KR20200145009A - Composition for improving acquired immunity including Codium fragile extraction and red ginseng extract - Google Patents

Abstract

The present invention relates to a composition for enhancing acquired immunity containing a Codium fragile extract and a red ginseng extract. The composition for enhancing immunity containing the Codium fragile extract and the red ginseng extract has an effect of enhancing immune capability by increasing a spleen index in an animal model in which immunity deterioration is induced by cyclophosphamide (CY) treatment, inducing the activity of B cells or T cells, which are responsible for the immune system, and increasing the activity of natural killer cells and the production of cytokines.

Description

Composition for improving acquired immunity including Codium fragile extraction and red ginseng extract}

The present invention relates to a composition for enhancing acquired immunity comprising a hearing extract and a red ginseng extract.

Immunity is the main defense mechanism of the human body, and it refers to the function of defending the human body by acting on various immune cells against the invasion or infection of foreign substances (Hancock and Diamond, 2000), and non-specific immune responses involving macrophages and T And specific immune responses involving B cells (Seo et al., 2009). In a non-specific immune response, i.e., in natural immunity, macrophages are widely distributed in all tissues in the body. Primaryly, interleukin (IL)-6 removes infectious pathogens such as bacteria or virus, cancer cells, and aging normal cells through phagocytosis. , IL-1β and tumor necrosis factor-α (TNF-α), and other cytokines are secreted, and play an antigen-presenting function to maximize the immune response (Yu et al., 2012a). Specific immunity is also called adaptive immunity, and is an immune response that occurs when T cells recognize antigen information presented after phagocytosis by antigen-presenting cells, and T and B cells are involved (Yoon, 2008). In particular, CD4+ T cells, also known as helper T (Th) lymphocytes, are the most important cells in protective immunity and induce immune responses through the secretion of cytokines along with macrophages. These Th cells are differentiated into Th1 and Th2 cells, respectively, and are involved in different immune functions (Mosmann and Coffman, 1989). Among them, Th1 cell-inducing cytokine includes IL-2, IL-12, interferon-γ (IFN-γ) and TNF-α, mainly activating cell-mediated immunity, and IL-4 and IL in Th2 cell-induced cytokine There are -5, IL-6, and IL-10, and they activate humoral immunity mainly mediated by antibody production. These Th1 and Th2 cells are balanced with each other to regulate the immune function (Liblau et al., 1995; Rengarajan et al., 2000).

Recently, as economic growth, industrialization, environmental pollution, and changes in diet have changed the homeostasis of the human body, immune system diseases such as cancer and acquired immunodeficiency syndrome are increasing (Park et al., 2006a). In order to treat these immune system diseases, many immunotherapy has been performed since ancient times (Fahey and Myers, 1975; Oettgen, 1990; Nikonenko et al., 1996), but there are several problems in clinical use. As a representative example, there is a method of controlling the body's immune system by directly administering cytokine, lymphokine, growth factor, etc. (Oldham, 1995). In the body, several types of cytokine interact to increase or suppress each other's actions to regulate immune function. Therefore, even if a large amount of one or two cytokines are injected, a great effect cannot be expected, and the toxicity is strong, and it is difficult to continuously maintain an appropriate concentration in blood. Therefore, efforts to search for safer bioactive substances that induce cytokine by stimulating several immune cells in the body are increasing (Bergelson, 1995; Han et al., 1998; Kim et al., 2013).

Accordingly, the present inventors treated the auditory extract and red ginseng extract using splenocytes, which are the main immune organs that process blood-derived antigens and perform major immune functions in the body, and as a result, increase the spleen index, and B cells responsible for the immune system, or The present invention was completed by confirming the effect of inducing the activity of T cells and increasing the activity of natural killer cells and the production of cytokines to enhance immunity.

Korean Patent Publication No. 10-2017-0053144

It is an object of the present invention to provide a composition for enhancing acquired immunity.

Another object of the present invention is to provide a health functional food composition for enhancing acquired immunity.

Another object of the present invention is to provide a health food composition for enhancing acquired immunity.

Another object of the present invention is to provide an animal feed additive for enhancing immunity.

To achieve the above object,

The present invention is a hearing extract ( Codium fragile ) and It provides a composition for enhancing acquired immunity comprising red ginseng extract.

In addition, the present invention auditory extract ( Codium fragile ) and It provides a health functional food composition for enhancing acquired immunity comprising red ginseng extract.

Furthermore, the present invention is a hearing extract ( Codium fragile ) and It provides a health food composition for enhancing acquired immunity comprising red ginseng extract.

In addition, the present invention auditory extract ( Codium fragile ) and It provides an animal feed additive for improving immunity, including red ginseng extract.

The composition for enhancing acquired immunity comprising the auditory extract and red ginseng extract of the present invention increases the spleen index in an animal model that induces immunity reduction by CY (cyclophosphamide) treatment, and induces the activity of B cells or T cells responsible for the immune system. And, it has the effect of enhancing the immunity by increasing the activity of natural killer cells and the production of cytokines.

Figure 1A shows the effect on body weight according to the mixed use of the auditory extract and red ginseng extract (data has a significant difference compared with the CY group (*, p<0.05) and the red ginseng group (#, p<0.05)) will be.
Figure 1B is the effect on the spleen index according to the mixed use of the auditory extract and red ginseng extract in mouse splenocytes (data is a significant difference compared to the CY group (*, p<0.05) and the red ginseng group (#, p<0.05) There is).
Figure 1C shows the effect on the size of the spleen according to the mixed use of the auditory extract and red ginseng extract in mouse splenocytes (data is a significant difference compared to the CY group (*, p<0.05) and the red ginseng group (#, p<0.05). There is).
Figure 2 shows the effect on the proliferation of splenic lymphocytes according to the mixed use of the auditory extract and red ginseng extract in mouse splenocytes (data is significant compared with the CY group (*, p<0.05) and the ginseng group (#, p<0.05). There is a difference).
Figure 3 is the effect on NK cell activity according to the mixed use of the auditory extract and red ginseng extract in mouse splenocytes (data is significant compared with the CY group (*, p<0.05) and the ginseng group (#, p<0.05) There is a difference).
Figure 4 shows the effect on the relative expression (fold-change) of immune genes in mitogen-stimulated splenic lymphocytes according to the mixed use of auditory extract and red ginseng extract (A = IL-1β; B = IL-4; C = IL. -6; D = IL-10; E = TNF-α; F = IFN-γ; and G = TLR-4) (data are CY group (*, p<0.05) and ginseng group (#, p<0.05) There is a significant difference compared to ).

Hereinafter, the present invention will be described in detail.

Composition for enhancing acquired immunity

The present invention is a hearing extract ( Codium fragile ) and It provides a composition for enhancing acquired immunity comprising red ginseng extract.

In an embodiment of the present invention, the composition comprises 25 to 100 parts by weight of the auditory extract based on 100 parts by weight of the red ginseng extract, and preferably 40 to 60 parts by weight of the auditory extract based on 100 parts by weight of the red ginseng extract. It characterized in that it includes.

In one embodiment of the present invention, the auditory extract is characterized in that the anionic macromolecule derived from the auditory extract.

In one embodiment of the present invention, the composition is characterized in that it enhances immunity by inducing the activity of B cells or T cells responsible for the immune system.

The spleen performs the main protective immunity against foreign antigens derived from the blood, and is a lymphoid organ where B and T lymphocytes mature and differentiate, and the proliferation of these lymphocytes has a very important meaning in the immune system. Looking at the distribution of immune cells present in the spleen, T cells account for more than 60%, and B cells and macrophages account for the rest. Therefore, splenocytes are mainly used to determine the activation of immune T cells in confirming the immune activity of the immune enhancing substance. In order to investigate the effect of synergistic immunity on T cells responsible for the acquired immune system, splenocytes were isolated from spleen tissue and treated with both auditory extract and red ginseng extract to investigate the effect of synergistic immunity. As a result, it was confirmed that when the red ginseng extract and the auditory extract were used in combination, the spleen index increased and the splenic lymphocyte proliferation response was increased (see FIGS. 1 and 2 ).

In one embodiment of the present invention, the composition is characterized in that for preventing or improving diseases caused by a decrease in immune function.

In one embodiment of the present invention, the disease caused by the lowering of the immune function is characterized in that at least one selected from the group consisting of infectious diseases, inflammatory diseases, allergic diseases and chronic fatigue.

Health food or health functional food composition for enhancing acquired immunity

The present invention is a hearing extract ( Codium fragile ) and It provides a health functional food or health food composition for promoting acquired immunity comprising red ginseng extract.

When using the hearing extract (Codium fragile) and red ginseng extract of the present invention as a health functional food and a health food composition, there is no particular limitation on the type of food. Examples of foods to which the hearing extract (Codium fragile) and red ginseng extract of the present invention can be added include drinks, meat, sausage, bread, biscuits, rice cakes, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, There are dairy products including ice creams, various soups, beverages, alcoholic beverages and vitamin complexes, dairy products and dairy products, and include all health functional foods and health food compositions in the usual sense.

The health functional food and health food composition containing the hearing extract (Codium fragile) and red ginseng extract according to the present invention may be added to food as it is or may be used with other foods or food ingredients, and may be appropriately used according to a conventional method. . The mixed amount of the auditory extract (Codium fragile) and the red ginseng extract may be appropriately determined according to the purpose of use (for prevention or improvement). In general, the amount of the composition in the health functional food and health food composition may be added in 0.1 to 90 parts by weight of the total food weight. However, in the case of long-term intake for the purpose of maintaining health or for the purpose of health control, the amount may be less than the above range, and there is no problem in terms of safety, so the amount of the auditory extract (Codium fragile) and red ginseng extract is above the above range. Can also be used as.

The health functional food and health food composition of the present invention is not particularly limited to other ingredients other than containing the present invention hearing extract (Codium fragile) and red ginseng extract as essential ingredients in the indicated ratio, and various flavoring agents or It may contain natural carbohydrates and the like as additional ingredients. Examples of the above-described natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, and the like; And polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 of the health functional food and health food composition of the present invention.

In addition to the above, the health functional food and health food composition containing the hearing extract (Codium fragile) and red ginseng extract of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents, coloring agents, such as synthetic flavoring agents and natural flavoring agents, and Contains heavy-duty agents (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, etc. I can. In addition, the health functional food and health food composition of the present invention may contain flesh for the manufacture of natural fruit juice and fruit juice beverage and vegetable beverage.

These components may be used independently or in combination. Although the proportion of these additives is not so important, it is generally selected from 0.1 to about 20 parts by weight per 100 parts by weight of the health functional food and health food composition containing the hearing extract (Codium fragile) and red ginseng extract of the present invention.

Animal feed additive for immunity enhancement

The present invention is a hearing extract ( Codium fragile ) and It provides an animal feed additive for improving immunity, including red ginseng extract.

In one embodiment of the present invention, the composition for animal feed additives is characterized in that it is in the form of a 20 to 90% highly concentrated liquid or powder or granules.

Hereinafter, the present invention will be described in more detail by the following examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

<Preparation Example 1> Material preparation

For red ginseng, commercial red ginseng syrup extracted from 6-year-old red ginseng purchased from South Korea was used. phonsphamide (CY), levamisole (LVS; an immunostimulant), and EZ-Cytox Cell Viability Assay Kit were purchased from Daeil Labservice (South Korea). Tri reagent® is manufactured by Molecular Research Center, Inc. (USA). A large capacity cDNA reverse transcription kit was purchased from Applied Biosystems (USA). SYBR®Premix Ex Taq™ II is a trademark of Takara Bio Inc. I bought it from (Japan).

<Preparation Example 2> Animal preparation

Six week old male BANB/c mice (weight 21-23 g) were used in the experiment. This mouse is a Central Lab. Animal Inc. (South Korea) obtained and used. All mice were fed a standard laboratory diet and water, and were kept free of specific pathogens for a week before the start of the experiment. The experimental procedure was carried out with the approval of the Animal Testing Committee of Gangneung Wonju University.

<Preparation Example 1> Anionic polymer derived from auditory extract (crude macromolecule)

Anionic macromolecule of C. fragile (CFAM) derived from auditory extract was suspended in 80% ethanol under constant mechanical agitation at room temperature overnight. After centrifugation, the precipitate was washed again with ethanol, rinsed with acetone, centrifuged, and dried at room temperature. The dried biomass was extracted with distilled water, and the supernatant was collected by centrifugation. The supernatant was concentrated and precipitated with 99% ethanol. The precipitate was obtained by filtering the solution with a nylon membrane (0.45-μm pore size; Whatman International, Maidstone, UK), washed with 99% ethanol and acetone, and dried at room temperature. The dried precipitate was redissolved in distilled water and deproteinized by the method reported by Sevag et al., and an anionic polymer derived from the auditory extract was obtained, which was abbreviated as CFAM.

<Preparation Example 2> Induction of immune suppression in mice

Mice were divided into 8 groups (n=5) and stored in a specific pathogen-free animal facility for a week before the start of the experiment. One group was orally administered saline and designated as a control group (normal group). The other group was administered red ginseng extract 100mg/kg BW (named Ginseng), red ginseng extract 100mg/kg BW and CFAM 25 mg/kg BW (named Tr.1), red ginseng extract 100mg/kg BW and CFAM 50 mg/kg BW (designated as Tr.2), red ginseng extract 100 mg/kg BW and CFAM 75 mg/kg BW (designated as Tr.3), red ginseng extract 100 mg/kg BW and CFAM 100 mg/ kg BW was administered (designated Tr.4).

Levamisole (LVS, immune stimulant, Sigma-Aldrich, USA) was used as a positive control and orally administered at a concentration of 40 mg/kg BW. Table 1 shows the treatment of each group. All groups were treated once a day for 10 consecutive days. 4-6 days after administration, CY (80mg/kg BW; Sigma-Aldrich, USA) was injected intraperitoneally once a day to mice excluding normal mice, and all mice were injected within 24 hours after completion of the treatment regimen. Sacrificed.

Group CFAM
(mg/kg BW) Red ginseng
(100 mg/kg BW) CY
(80 mg/kg BW) Levamisole
(40 mg/kg BW) Normal - - - - CY - - + - Ginseng - + + - Tr. One 25 + + - Tr. 2 50 + + - Tr. 3 75 + + - Tr. 4 100 + + - Levamisole - + + +

<Experimental Example 1> Preparation of spleen cells and confirmation of the effect on the spleen index

The spleen of each mouse was weighted, and the spleen cells were collected in ice-filled PBS to separate. Splenocytes were extracted using 1 × RBC Lysis Buffer (eBioscience, USA). Splenocytes were resuspended in RPMI-1640 medium supplemented with 10% fetal bovine serum, streptomycin (100 μg/mL) and penicillin (100 IU/mL). The spleen index was calculated using the following formula.

[Equation 1]

The spleen of each mouse was collected on the day of sacrifice. Figure 1b shows the spleen index, Figure 1c shows the spleen size of CY-induced mice treated with different concentrations of CFAM and red ginseng extract. CY-induced mice showed a decrease in spleen size and spleen index compared to normal mice. It was shown that the mixed treatment of CFAM (25, 50 and 75 mg/kg BW) and red ginseng extract at different concentrations significantly improved the spleen index compared to treatment with red ginseng alone. However, no significant difference in body weight was observed between the experimental groups (Fig. 1a).

Spleen index measurement Spleen index Normal 4.3 CY 2 Red ginseng extract alone (Ginseng) 2.4 Red ginseng extract (100mg/kg) + auditory extract (25mg/kg) (Th1) 2.8 Red ginseng extract (100mg/kg) + auditory extract (50mg/kg) (Th2) 3.2 Red ginseng extract (100mg/kg) + auditory extract (75mg/kg) (Th3) 2.5 Red ginseng extract (100mg/kg) + auditory extract (100mg/kg) (Th4) 2.4 levamisole(LVS) 2.7

<Experimental Example 2> Spleen lymphocyte proliferation analysis

For splenic lymphocytes, 5 μg/mL of ConA, a mitogen that selectively proliferates T cells associated with cellular immunity, is added, or 10 μg/mL of LPS, a mitogen that selectively proliferates B cells associated with humoral immunity. mL was added and incubated at 37°C in a humidified atmosphere of 5% CO ₂ . Cells cultured with RPMI-1640 alone were used as a normal control. After incubation for 48 hours, cell proliferation was measured using the EZ-Cytox Cell Viability Assay Kit (Daeillab service, Korea). The growth rate was evaluated using the following formula.

[Equation 2]

Compared with the normal group, splenic lymphocyte proliferation was significantly decreased in both T cell and B cell mitotic responses in the CY-treated group. However, treatment with red ginseng extract 100 mg/kg BW and CFAM 50 mg/kg BW (designated Tr.2) increased T and B cell proliferation than observed with red ginseng alone (designated Ginseng) treatment. Therefore, it was found that the mixed use of red ginseng extract and CFAM increased splenocyte proliferation ability by acting as a mitogen for splenocytes.

Spleen lymphocyte proliferation assay Con A LPS Normal 100 100 CY 34 38 Red ginseng extract alone (Ginseng) 57 63 Red ginseng extract (100mg/kg) + auditory extract (25mg/kg) (Th1) 60 67 Red ginseng extract (100mg/kg) + auditory extract (50mg/kg) (Th2) 81 94 Red ginseng extract (100mg/kg) + auditory extract (75mg/kg) (Th3) 48 57 Red ginseng extract (100mg/kg) + auditory extract (100mg/kg) (Th4) 41 52 Levamisole(LVS) 64 70

<Experimental Example 3> Spleen NK (Natural killer, NK) cell activity assay

YAC-1 cell (NK-sensitive cell line, target cell) fmf was used to evaluate splenic NK cell (effector cell) activity. Splenocytes and YAC-1 cells were cultured together to obtain an effector cell-target cell ratio of 50:1 and cultured for 4 hours. The cultured supernatant was centrifuged to remove contaminated cells, and then mixed with lactate dehydrogenase (LDH) solution (Promega Co., USA). The absorbance of each solution was measured at 490 nm, and the cytotoxicity of NK cells was calculated using the following equation.

[Equation 3]

Splenic NK cell activity was evaluated by splenocytes co-cultured with YAC-1 cells. The supernatant was used to measure cytotoxicity by LDH assay. As shown in Fig. 3, splenic NK cell activity was inhibited by CY treatment compared to normal mice. In addition, treatment with 100 mg/kg BW of red ginseng extract and 50 mg/kg BW of CFAM (designated as Tr.2) significantly increased the NK cell activity of splenocytes of splenocytes than that observed in treatment with red ginseng alone (indicated as Ginseng). Recovered.

Spleen NK cell activity measurement NK cell activity Normal 100 CY 59 Red ginseng extract alone (Ginseng) 95 Red ginseng extract (100mg/kg) + auditory extract (25mg/kg) (Th1) 106 Red ginseng extract (100mg/kg) + auditory extract (50mg/kg) (Th2) 124 Red ginseng extract (100mg/kg) + auditory extract (75mg/kg) (Th3) 99 Red ginseng extract (100mg/kg) + auditory extract (100mg/kg) (Th4) 94 levamisole(LVS) 108

<Experimental Example 4> Confirmation of the effect on immune-related gene expression

Total RNA was isolated from mitogen-stimulated (Con A or LPS) splenic lymphocytes using Tri reagent® (Molecular Research Center, Inc., USA). Total RNA was dissolved in nuclease-free wate and the concentration was measured using a nano photometer (Implen, Germany). The isolated RNA was used as a template to generate first-stranded cDNA according to the manufacturer's instructions using the High Capacity cDNA Reverse Transcription kit (Applied biosystems, USA).

First strand cDNA (0.1 ng) was used as a template for real-time PCR analysis to quantify immune-related gene expression in splenic lymphocytes. SYBR®Premix Ex Taq™II (Takara Bio Inc., Japan) detection chemistry was performed three times using a QuantStudio™3 FlexReal-Time PCR System (ThermoFisher scientific, USA). Table 2 shows specific primer pairs for each immune-related gene. Relative gene expression was calculated using the 2 ^-ΔΔC T method and β-actin as the reference gene.

Gene Accession No. Oligonucleotide Sequence IL-1β NM_008361.4 F: GGGCCTCAAAGGAAAGAATC
R: TACCAGTTGGGGAACTCTGC IL-4 NM_021283.2 F: ACAGGAGAAGGGACGCCATR: GAAGCCCTACAGACGAGCTCA IL-6 NM_031168.2 F: AGTTGCCTTCTTGGGACTGA
R: CAGAATTGCCATTGCACAAC IL-10 NM_010548.2 F: TACCTGGTAGAAGTGATGCC
R: CATCATGTATGCTTCTATGC IFN-γ NM_008337.3 F: CTCAAGTGGCATAGATGT
R: GAGATAATCTGGCTCTGCAGGATT TNF-α D84199.2 F: ATGAGCACAGAAAGCATGATCR: TACAGGCTTGTCACTCGAATT TLR-4 NM_021297.3 F: CGCTCTGGCATCATCTTCATR: GTTGCCGTTTCTTGTTCTTCC β-actin NM_007393.5 F: CCACAGCTGAGAGGAAATC
R: AAGGAAGGCTGGAAAAGAGC

Expression of immune-related genes in splenic lymphocytes induced by Mitogen was evaluated using qRT-PCR. Fig. 4 shows that the expression of immune-related genes is significantly reduced in the CT treatment group. Nevertheless, the mixed use of red ginseng extract and CFAM improved T and B cell responses by increasing the expression of immune-related genes in splenic lymphocytes. In splenic lymphocytes, genes such as IL-4, IL-10, TNF-α, IFN-γ, and TLR-4 are highly upregulated by B cell mitogens rather than T cell mitotic agents. However, the expression of IL-1β and IL-6 was higher in T cell mitogen-stimulated cells than in B cell mitogen-stimulated cells.

<Statistical Analysis>

Statistix 8.1 Statistics Software (Statistix, Florida, USA) was used to perform statistical analysis of all results. All data were also compared to control using one-way ANOVA. Thereafter, a significant difference was shown at p<0.05 using the Tukey post-hoc test.

So far, the present invention has been looked at around its preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

Claims (13)

Hearing extract ( Codium fragile ) and A composition for enhancing acquired immunity comprising red ginseng extract.
The method of claim 1,
The composition, characterized in that it comprises 25 to 100 parts by weight of the auditory extract based on 100 parts by weight of red ginseng extract.
The method of claim 2,
The composition is a composition comprising 40 to 60 parts by weight of a hearing extract based on 100 parts by weight of red ginseng extract.
The method of claim 1,
The composition is a composition, characterized in that to induce the activity of B cells or T cells responsible for the immune system to enhance the immunity.
The method of claim 1,
The composition, characterized in that the auditory extract is an anionic macromolecule derived from the auditory extract.
The method of claim 1,
The composition is a composition, characterized in that for the prevention or improvement of a disease caused by a decrease in immune function.
The method of claim 5,
The disease caused by the lowering of the immune function is a composition, characterized in that at least one selected from the group consisting of infectious diseases, inflammatory diseases, allergic diseases and chronic fatigue.
Hearing extract ( Codium fragile ) and A health functional food composition for promoting acquired immunity comprising red ginseng extract.
The method of claim 8,
The health functional food composition, characterized in that the food in the form of a tablet, capsule, pill or liquid.
Hearing extract ( Codium fragile ) and Health food composition for promoting acquired immunity comprising red ginseng extract.
The method of claim 10,
The health food is a health food composition, characterized in that selected from various drinks, meat, sausage, bread, candy, snacks, noodles, ice cream, dairy products, soups, ion drinks, beverages, alcoholic beverages, gum, tea and vitamin complexes.
Hearing extract ( Codium fragile ) and Animal feed additives for improving immunity, including red ginseng extract.
The method of claim 12,
The composition for animal feed additives is an animal feed additive in the form of a 20 to 90% highly concentrated liquid or powder or granule.

Images