KR20200144470A - Novel immunopotent recombinant protein with simultaneous induction of cellular and humoral immune responses and broad spectrum of protective efficacy, and foot-and-mouth disease (FMD) vaccine composition comprising the same - Google Patents

Abstract

The present invention relates to HSP70 and T cell epitopes, B cell epitopes of foot-and-mouth disease virus serotype O and A, a carrier or a carrier molecule, a VP1 site of foot-and-mouth disease virus, an active site gene of immune-enhancing peptide, and foot-and-mouth disease recombinant virus having an invasion gene, which is a universal T cell epitope, inserted thereinto. More specifically, the present invention relates to a novel recombinant protein which simultaneously induces cellular and humoral immune responses to enhance initial, intermediate, and long-term immune responses and exhibit a strong protective effect against foot-and-mouth disease virus infection, and a vaccine composition for preventing foot-and-mouth disease including the same. According to the present invention, the recombinant protein can act as an antigen exhibiting broad-spectrum protection.

Description

Novel immunopotent recombinant protein with simultaneous induction of cellular and humoral immune responses and broad spectrum of protective efficacy, and novel immunopotent recombinant protein with simultaneous induction of cellular and humoral immune responses and broad spectrum of protective efficacy, and foot-and-mouth disease (FMD) vaccine composition comprising the same}

The present invention relates to a foot-and-mouth disease recombinant virus, specifically, HSP70 and universal T cell epitope (3A) of foot-and-mouth disease virus, B-cell epitope of foot-and-mouth disease type O and A virus, delivery material or carrier molecule, VP1 site of foot-and-mouth disease virus, It relates to a recombinant protein into which an active site gene of an immune enhancing peptide and an Invasin gene, a universal T cell epitope, are inserted, and a vaccine composition for preventing foot-and-mouth disease including the same.

Foot-and-mouth disease (FMD) is classified as an acute infectious disease in cattle, especially pigs and cattle, and causes fever, lameness and blisters in the legs, tongue, nose, and nipples when infected, and has rapid spread. In addition, high mortality rates and reduced productivity lead to significant economic losses for the livestock industry. This disease is classified and designated as a disease subject to management by the World Animal Health Organization (OIE) as a type 1 livestock infectious disease under the Livestock Infectious Disease Prevention Act, and it is a disease that must be reported to the OIE when it occurs.

Foot-and-mouth disease virus (Foot-and-mouth disease virus) is a single-stranded bipolar RNA virus that belongs to the genus Picornaviridae and Aphthovirus, and to this day it is a foot-and-mouth disease virus. , FMDV) has been identified 7 types of serotypes including O, A, Asia 1, C, South African Territories (SAT) 1, SAT 2, and SAT 3, and Serotype O is persistent worldwide. Serotype O, Serotype Asia1 and A are intermittently occurring in East Asia regions such as China and North Korea. Foot-and-mouth disease virus is not serologically neutralized between viruses of different serotypes, and shows a large genetic or antigenic difference that is not cross-protected by a vaccine.

Vaccination is used as a means to control disease in countries with foot-and-mouth disease, and plays an important role in establishing contingency plans in countries with foot-and-mouth disease. Foot-and-mouth disease vaccines worldwide use dead poison (inactivated) vaccines, and most of them were improved in terms of effectiveness by vaccination with an oil adjuvant (Double Oil Emulsion, DOE or Single Oil Emulsion, SOE). Late antibody induction period, low antibody titer, short persistence of antibodies and low immunogenicity in pigs are pointed out as disadvantages. Foot-and-mouth disease vaccines to date have focused on inducing humoral immune responses rather than cellular immune responses, but their protective capabilities are not perfect. In addition, the current foot-and-mouth disease vaccine requires regular vaccination every 4 to 6 months as the antibody retention period is short after vaccination.In particular, when inoculating a pig muscle, lesions are formed in the inoculated muscles such as fibrosis and granulomas There are disadvantages such as low local side effects and safety. Therefore, the ideal vaccine design to overcome the limitations of these current commercial vaccines is to simultaneously induce cellular and humoral immune responses, maintain high titer antibodies by inducing memory responses, secure safety to reduce local side effects, and a new strategy optimized for pigs. There is a problem in that the requirements such as the development of adjuvants must be satisfied.

On the other hand, related prior art is Unexamined Patent Publication No. 10-2001-0053042 (synthetic peptide vaccine for foot-and-mouth disease), Korean Patent Publication No. 10-2016-0044764 (Foot-and-mouth disease vaccine composition comprising an adjuvant to enhance immunity And a manufacturing method thereof), but the technical characteristics are different from the present invention.

Unexamined Patent Publication No. 10-2001-0053042 Unexamined Patent Publication No. 10-2016-0044764

In order to solve the above problems, the present invention relates to the long-term immune enhancing protein HSP70, a universal T cell epitope of foot and mouth disease virus 3A, foot and mouth disease O serotype and A serotype B cell epitope, VP1 site of foot and mouth disease virus, delivery material or carrier. Molecular, immune-enhancing peptide PADRE and a universal T cell epitope, Invasin, a powerful recombinant protein that has a wide range of defense against foot-and-mouth disease O serotype and A serotype viruses, and a vaccine composition for foot-and-mouth disease prevention comprising the same as an active ingredient In providing.

In order to achieve the above object, the present invention provides a recombinant protein for enhancing immunity.

In addition, it provides an adjuvant composition comprising the recombinant protein for enhancing immunity and a foot-and-mouth disease vaccine composition comprising the recombinant protein for enhancing immunity.

The recombinant protein for enhancing immunity is a universal T cell epitope of foot-and-mouth disease virus 3A, foot-and-mouth disease O serotype and B-cell epitope of A serotype virus, VP1 site of foot-and-mouth disease virus, delivery material or It includes Astrotactin 1-derived peptide (AP), a kind of delivery molecule, and PADRE, an immune enhancing peptide.

In addition, the recombinant protein may further include an Invasin gene, which is a universal T cell epitope.

More specifically, the recombinant protein, HSP70, which induces the long-term immune and memory response, consists of the amino acid sequence of SEQ ID NO: 1.

The T cell epitope of the foot-and-mouth disease virus is not limited, but may preferably be a universal T cell epitope, preferably a T cell epitope having the sequence of SEQ ID NO: 2. The T cell epitope of SEQ ID NO: 2 may be a T cell epitope corresponding to residues 21-35 of 3A, which is a foot-and-mouth disease virus NSP (non structural protein peptide).

The B cell epitope of the foot and mouth disease virus is not limited, but preferably may be a B cell epitope of the foot and mouth disease virus O serotype or A serotype.

The epitope of the O serum may preferably be an O serotype of SEQ ID NO: 3 (O/JC/SKR/2014-R) and an O serotype of SEQ ID NO: 4 (O/TWN/97-R).

The epitope of the serum A is preferably foot-and-mouth disease virus A serotype (A/GP/2018) having the sequence of SEQ ID NO: 5, foot-and-mouth disease virus A serotype of SEQ ID NO: 6 (A/GVII:BAN-GA) B cells It can be an epitope. The epitope may be one or a combination of two or more epitopes.

The foot-and-mouth disease virus VP1 site may be amino acid residues 200 to 213 of foot-and-mouth disease virus VP1 having the sequence of SEQ ID NO: 7.

A delivery molecule may be inserted between the VP1 site and the immuno-enhancing peptide PADRE, preferably an astrotactin 1-derived peptide (AP), which is a carrier molecule having the sequence of SEQ ID NO: 8.

The immune enhancing peptide, PADRE, has the sequence of SEQ ID NO: 9.

The Invasin gene has the sequence of SEQ ID NO: 10 as a universal T cell epitope.

The above HSP70, universal T cell epitope of foot and mouth disease virus, B cell epitope of foot and mouth disease virus O serotype and A serotype, VP1 site of foot and mouth disease virus, transporter molecule AP, immune enhancing peptide PADRE, and universal T cell epitope, Invasin gene Each may be linked through a linker, and preferably may be the GGSGG sequence of SEQ ID NO: 11, but is not limited thereto.

The protein recombined through the above process has SEQ ID NO: 12.

Strains or vectors commonly used in the art may be used to express the recombinant protein of the present invention, and protein expression may be expressed by methods commonly used in the art.

The recombinant protein can enhance early, mid-term, and long-term immune responses by simultaneously inducing cellular and humoral immune responses, and can exhibit a strong protective effect against a wide range of viral infections such as foot-and-mouth disease O serotype and A serotype.

When used as an adjuvant, the recombinant protein's immune response induction, immunity strengthening, and defense effects are applied to foot-and-mouth disease virus O serotype, A serotype, Asia serotype, C serotype, SAT1 serotype, SAT2 serotype, SAT3 serotype, etc. It may appear against foot-and-mouth disease virus O serotype, A serotype more strongly.

The adjuvant composition or foot-and-mouth disease vaccine composition according to the present invention may contain the recombinant protein for enhancing immunity as an active ingredient, and in this case, 0.1 to 50 parts by weight, preferably 0.1 to 40 parts by weight, based on 100 parts by weight of the total adjuvant composition. Parts, more preferably 1 to 30 parts by weight may be included, but is not limited thereto.

In addition, the active ingredient may be included differently depending on the type and weight of the administered animal. In addition, the amount of the active ingredient may be described in terms of mass/volume, volume/volume/, mass/mass, and the like, and in this case, it may be converted and described according to the specific gravity of the volume and mass.

The adjuvant composition may be formulated as an adjuvant composition, further including a pharmaceutically acceptable emulsifier, stabilizer, additive, etc. that are generally provided in a carrier or adjuvant composition, and prepared in an appropriate formulation according to an administration method. Can be.

The adjuvant composition is not limited, but may preferably be an oil formulation or a non-oil formulation (oil-based emulsion-free).

The foot-and-mouth disease vaccine composition of the present invention is sublingual administration, transdermal administration, rectal administration, transmucosal administration, topical administration, oral administration, intrapleural administration, intravenous administration, intraarterial administration, intraperitoneal administration, subcutaneous administration, intramuscular administration, It can be administered by intranasal administration, intrathecal administration, intraarticular administration, or the like.

In addition, the vaccine composition may be formulated as a vaccine composition, further including additives, stabilizers, etc. that are generally provided in a pharmaceutically acceptable carrier or vaccine composition, and may be prepared in an appropriate formulation according to an administration method. .

The vaccine composition is not limited, but may preferably be an oil formulation or a non-oil formulation (oil-based emulsion-free).

The present invention relates to a recombinant protein in which HSP70 and T cell epitopes, foot and mouth disease virus O serotype and B cell epitope of A serotype, foot and mouth disease virus VP1 gene, carrier molecule, active site gene of immune enhancing peptide, and universal T cell epitope are inserted. In this regard, by inducing cellular and humoral immune responses at the same time, it strengthens the initial, mid-term, and long-term immune responses, thereby acting as an adjuvant for enhancing immunity that exhibits a strong protective effect in the host when infected with foot-and-mouth disease virus. It can act as an antigen that exhibits broad-spectrum protection when infected with foot-and-mouth disease virus O serotype and A serotype within (host).

1 shows a schematic diagram of an immune enhancing recombinant protein gene.
Figure 2 shows a schematic diagram of a plasmid into which the recombinant protein of Example is inserted.
Figure 3 shows the expression results of the Example through Sun Gel staining.
4(A) shows the experimental process of Experimental Example 1, (B) shows the survival rate of the mouse, and (C) shows the result of changing the weight of the mouse.
5 shows the experimental process of Experimental Example 2.
6 shows the results of the experiment (SP O and SP A ELISA, and VN titers) of Experimental Example 2.
7 shows the results of the experiment (mouse survival rate, weight change) of Experimental Example 2; (A) The survival rate of mice when challenged with 84 dpv, (B) The amount of change in weight of mice when challenged with 84 dpv, (C) Survival rate of mice when challenged with 168 dpv, (D) 168 dpv attack At the time of inoculation, the amount of change in the weight of the mouse
8 shows the experimental process of Experimental Example 3.
9 shows the results of the experiment (SP A ELSIA, VN titers) of Experimental Example 3.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following examples and experimental examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples and experimental examples.

<Example>

1. Immunity-enhancing recombinant protein gene synthesis

(1) Long-term immune enhancing protein HSP70 (SEQ ID NO: 1), (2) foot-and-mouth disease virus universal T cell epitope (3A, SEQ ID NO: 2), (3) O serotype B cell epitope consisting of SEQ ID NOs: 3 and 4, ( 4) A serotype B cell epitope consisting of SEQ ID NOs: 5 and 6, (5) VP1 peptide of SEQ ID NO: 7, (6) carrier molecule (AP) of SEQ ID NO: 8, (7) immuno-enhancing peptide of SEQ ID NO: 9 PADRE and (8) universal T cell epitope (Invasin) of SEQ ID NO: 10 were combined using a linker of SEQ ID NO: 11 to synthesize an immune-enhancing recombinant gene (2396 bp) of SEQ ID NO: 12 (FIG. 1). This was cloned into the pBT7-C-His vector, and a cleavage map of the vector into which the nucleotide sequence encoding the recombinant protein was inserted is shown in FIG. 2.

2. Expression of immune enhancing recombinant protein

For the smooth expression of the above recombinant protein, PCR amplification was performed using the following primer as a pET28a(+) vector, and then cloned into the Nde I and Xho I restriction enzyme sites of the PET28a(+) vector, and the primer sequence is as follows. ;

HSP70-F: TGCCGCGCGGCAGCCATATGGCACGTGCAGTTGGTATCGA (SEQ ID NO: 13)

HSP70-R: TGGTGGTGGTGGTGctcgagAAACTGATATGTTGCGGTAT (SEQ ID NO: 14)

After transforming pET28a(+)-HSP70 into E. coli BL21(DE3) strain for protein expression, the single colony transformed with pET28a(+)-HSP70 was transformed into Luria-Bertani(LB) broth containing kanamycin antibiotic (50 μg/ml). Incubated in 3 ml at 37C for 3 hours.

After inoculation of the culture solution cultured for 3 hours in 250 ml LB broth, incubation at OD600 to a concentration of 0.7, the final concentration of 1 mM IPTG (Isopropyl β-D-1-thiogalactopyranoside, Sigma-Aldrich, OD600, 0.7 concentration, St. Louis, MO, USA) was added and then cultured for 12 hours to induce expression of the recombinant protein. After incubation for 12 hours, E. coli was recovered through centrifugation at 8000 rpm, and then 50 ml of 1X PBS and 1X of proteolysis inhibitor (protease inhibitor cocktail, Roche Diagnostics, Mannheim, Germany) were added to the recovered E. coli, E. coli was disrupted through sonication (Amp 20%, 5 sec; ON, 2 sec; OFF, 5 min).

The crushed E. coli was centrifuged at 8000 rpm for 30 minutes in a 4C high-speed centrifuge, and then only the supernatant was recovered, and the recombinant protein was separated and purified using HisPur ^TM Ni-NTA resin (Thermo Fisher Scientific, Rockford, IL, USA).

The recombinant protein was confirmed by SDS-PAGE followed by Sun Gel staining (Fig. 3).

<Experimental Example 1> Recombinant protein induction according to the present invention-Immunogenicity and broad-spectrum protection in mice

In order to confirm the immunogenicity of the present invention, an experiment for evaluating immunogenicity and extensive defense ability in mice was conducted according to the following method.

1. Experimental animal (mouse)

Wild-type C57BL/6 mice (7-week-old female) with matching age and sex were purchased (KOSA BIO Inc., Gyeonggi-do, Korea). All mice were housed in micro-quarantine cages in a specific sterile pathogen (SPF) animal facility with Biosafety Level 3 (ABSL3) of the Agriculture, Forestry and Livestock Quarantine Division.

2. Vaccination and foot-and-mouth disease virus attack vaccination

Using the recombinant protein of the above example, short-term immunogenicity and early defense induction effects were confirmed in mice. As shown in Fig. 4A, after preparation of the test vaccine containing the recombinant protein of the Example, mice were vaccinated with IM (intramuscular, intramuscular inoculation), and on the 7th day (7 days post vaccination, dpv), FMDV (100LD _{50_} O/VET/2013, ME-SA topotype or 100LD ₅₀ A/Malay/97, Asia topotype) was administered intraperitoneally to mice, and the survival rate until 7 days (7 days post challenge, 7 dpc) (Fig. 4B) Overweight change (FIG. 4C) was monitored. The composition of the test vaccine is as follows; Recombinant protein of the example (10 μg/dose/mouse), ISA 206 (50%, w/w), 10% Al(OH) ₃ , and Quil-A 15 μg/does/mouse were prepared in a total amount of 100 μL. .

As a result of confirming the immunogenicity and defense-inducing effect against infection with foot-and-mouth disease virus (type O and A) in mice inoculated with the recombinant protein of Example, 100 for each of A/Malay/97 and O/VET/2013 virus challenge inoculation %, 80% protective effect was shown, especially when the A/Malay/97 challenge vaccination, almost no body weight change was observed.

In addition, only about 10% change in body weight was observed even when O/VET/2013 challenge vaccination (FIG. 4), and the recombinant protein of the example showed a strong protective effect against a broad spectrum foot-and-mouth disease virus serotype regardless of the presence or absence of an antigen. It is expected to be used as an adjuvant.

<Experimental Example 2> Evaluation of the efficacy of the recombinant protein according to the present invention as an adjuvant and confirmation of induction of early, mid-term, and long-term immunity

In order to evaluate the efficacy of the recombinant protein prepared in the Examples as an adjuvant, particularly as an adjuvant, a non-oil (emulsion-free) test vaccine containing the recombinant protein of the Example as an adjuvant was prepared, and in mice in the early, mid-term, Long-term immunity and memory response induction effects were observed.

As an antigen, an inactivated antigen isolated and purified from O/TWN/97-R (O/TWN, FMDV O) or A/22/Iraq/24/64-R (A/22, FMDV A) was used. The composition of the test vaccine is as follows; Antigen (FMDV O or FMDV A antigen 15 μg/dose/mL per pig or cow, 1/10 dose/100 μL per mouse), protein of the example (10 μg/dose/mouse), w/o (without ) emulsion, 10% Al(OH) ₃ , Quil-A 15 μg/dose/mouse was prepared in a total amount of 100 μL.

In the case of the positive control group, the rest of the vaccine composition except the protein of the example was administered, and the negative control group received the same volume of PBS.

Mice were first inoculated with the test vaccine with IM at 0 dpv, followed by the second inoculation with 35 dpv, and after the first vaccination, blood was collected at 0, 7, 14, 28, 56, 84, 168 dpv, SP O, A It was used for serological analysis such as ELISA and VN titers (Fig. 5). Mice were administered FMDV (100LD ₅₀ of O/VET/2013, ME-SA topotype or A/Malay/97, Asia topotype) at 84 dpv and 168 dpv, respectively, intraperitoneally to monitor survival rate and weight change up to 7 dpc. I did.

As a result of the experiment, antibody titers and VN titers by SP O ELISA and SP A ELISA in the group administered rpHSP70-AD as an adjuvant compared to the positive control O/TWN or A/22 up to 28 dpv after the first vaccination. Was high, effectively inducing an initial immune response. In the absence of oil emulsion, significantly higher antibody titers and neutralizing antibody titers were maintained compared to the positive control group until 168 dpv after the second vaccination in the absence of oil emulsion (FIG. 6 ).

FMDV (100LD ₅₀ O/VET/2013, ME-SA topotype, 100LD ₅₀ A/Malay/97, SEA topotype) In the attack vaccination experiment, when the attack vaccination at 84 dpv, both the FMDV O and FMDV A attacks in the example administration group It showed 100% survival rate, no weight change or loss was observed, 100% survival rate was shown even when challenged to 168 dpv, and there was little change in weight. On the other hand, in the case of the O/TWN group used as the PC group, 84 dpv and 168 dpv were treated with FMDV O type (O/VET/2013), 60% defense rate, and 84 dpv and 168 dpv in the A/22 group. When inoculated with FMDV type A (A/Malay/97), 40% defense rate was shown (FIG. 7).

<Experimental Example 3> Evaluation of the induction of immune response in pigs of a non-oil (oil emulsion-free) vaccine containing the recombinant protein according to the present invention as an adjuvant

Experiments were conducted to evaluate the initial, mid-term, and long-term immunity enhancing effects and memory response in an oil emulsion-free (non-oil) state using the above example.

Pigs were divided into 2 groups, 5 pigs per group, and 10-week-old pigs were used, and the vaccine composition used in the experiment was FMDV A (A/22/Iraq/24/64-R) antigen (PC, 15 μg/dose/pig). /mL), 10% Al(OH) ₃ , 150 μg/dose/pig Quil-A and the recombinant protein of the Example were prepared in a total amount of 1 ml without 100 μg/dose/pig emulsion (emulsion-free). Pigs were used for foot-and-mouth disease type A antibody negative animals. After the first inoculation (0 dpv) with IM, boosting was performed at 28 dpv, blood was collected at 0, 7, 14, 28, 42, 56, 70, 84 dpv, and antibody titer by SP A ELISA and The VN titer was observed. In addition, PBMCs were isolated from whole blood to confirm factors related to cellular immune responses and humoral immune responses at 0, 14, 28, 56 dpv of vaccination (FIG. 8).

As a result of the experiment, antibody titers by SP A ELISA showed significantly higher values ( p<0.05, p<0.01 ) in the example administration group compared to the A22 alone administration group at 7 dpv and 14 dpv at the beginning of vaccination, and at 28 dpv. Even after boosting, antibody levels were significantly higher in the Example administration group than in the A22 administration group up to 84dpv ( p<0.01, p<0.001 ). As a result of measuring the VN titer using A22, which is a homologous virus to the A22 antigen, it showed a similar tendency to that of the SP A ELISA, but in the example administration group, 14 dpv began to show significance ( p<0.05 ), and 28 dpv was After boosting, a significantly higher level was maintained in the Example administration group from 42 dpv to 84 dpv ( p<0.001 ) (Fig. 9).

<110> Animal and Plant Quarantine Agency <120> Recombinant protein for immune enhancement and foot-and-mouth disease vaccine composition comprising the same <130> 19-11347 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 624 <212> PRT <213> Artificial Sequence <220> <223> HSP70 <400> 1 Ala Arg Ala Val Gly Ile Asp Leu Gly Thr Thr Asn Ser Val Val Ser 1 5 10 15 Val Leu Glu Gly Gly Asp Pro Val Val Val Ala Asn Ser Glu Gly Ser 20 25 30 Arg Thr Thr Pro Ser Ile Val Ala Phe Ala Arg Asn Gly Glu Val Leu 35 40 45 Val Gly Gln Pro Ala Lys Asn Gln Ala Val Thr Asn Val Asp Arg Thr 50 55 60 Val Arg Ser Val Lys Arg His Met Gly Ser Asp Trp Ser Ile Glu Ile 65 70 75 80 Asp Gly Lys Lys Tyr Thr Ala Pro Glu Ile Ser Ala Arg Ile Leu Met 85 90 95 Lys Leu Lys Arg Asp Ala Glu Ala Tyr Leu Gly Glu Asp Ile Thr Asp 100 105 110 Ala Val Ile Thr Thr Pro Ala Tyr Phe Asn Asp Ala Gln Arg Gln Ala 115 120 125 Thr Lys Asp Ala Gly Gln Ile Ala Gly Leu Asn Val Leu Arg Ile Val 130 135 140 Asn Glu Pro Thr Ala Ala Ala Leu Ala Tyr Gly Leu Asp Lys Gly Glu 145 150 155 160 Lys Glu Gln Arg Ile Leu Val Phe Asp Leu Gly Gly Gly Thr Phe Asp 165 170 175 Val Ser Leu Leu Glu Ile Gly Glu Gly Val Val Glu Val Arg Ala Thr 180 185 190 Ser Gly Asp Asn His Leu Gly Gly Asp Asp Trp Asp Gln Arg Val Val 195 200 205 Asp Trp Leu Val Asp Lys Phe Lys Gly Thr Ser Gly Ile Asp Leu Thr 210 215 220 Lys Asp Lys Met Ala Met Gln Arg Leu Arg Glu Ala Ala Glu Lys Ala 225 230 235 240 Lys Ile Glu Leu Ser Ser Ser Gln Ser Thr Ser Ile Asn Leu Pro Tyr 245 250 255 Ile Thr Val Asp Ala Asp Lys Asn Pro Leu Phe Leu Asp Glu Gln Leu 260 265 270 Thr Arg Ala Glu Phe Gln Arg Ile Thr Gln Asp Leu Leu Asp Arg Thr 275 280 285 Arg Lys Pro Phe Gln Ser Val Ile Ala Asp Thr Gly Ile Ser Val Ser 290 295 300 Glu Ile Asp His Val Val Leu Val Gly Gly Ser Thr Arg Met Pro Ala 305 310 315 320 Val Thr Asp Leu Val Lys Glu Leu Thr Gly Gly Lys Glu Pro Asn Lys 325 330 335 Gly Val Asn Pro Asp Glu Val Val Ala Val Gly Ala Ala Leu Gln Ala 340 345 350 Gly Val Leu Lys Gly Glu Val Lys Asp Val Leu Leu Leu Asp Val Thr 355 360 365 Pro Leu Ser Leu Gly Ile Glu Thr Lys Gly Gly Val Met Thr Arg Leu 370 375 380 Ile Glu Arg Asn Thr Thr Ile Pro Thr Lys Arg Ser Glu Thr Phe Thr 385 390 395 400 Thr Ala Asp Asp Asn Gln Pro Ser Val Gln Ile Gln Val Tyr Gln Gly 405 410 415 Glu Arg Glu Ile Ala Ala His Asn Lys Leu Leu Gly Ser Phe Glu Leu 420 425 430 Thr Gly Ile Pro Pro Ala Pro Arg Gly Ile Pro Gln Ile Glu Val Thr 435 440 445 Phe Asp Ile Asp Ala Asn Gly Ile Val His Val Thr Ala Lys Asp Lys 450 455 460 Gly Thr Gly Lys Glu Asn Thr Ile Arg Ile Gln Glu Gly Ser Gly Leu 465 470 475 480 Ser Lys Glu Asp Ile Asp Arg Met Ile Lys Asp Ala Glu Ala His Ala 485 490 495 Glu Glu Asp Arg Lys Arg Arg Glu Glu Ala Asp Val Arg Asn Gln Ala 500 505 510 Glu Thr Leu Val Tyr Gln Thr Glu Lys Phe Val Lys Glu Gln Arg Glu 515 520 525 Ala Glu Gly Gly Ser Lys Val Pro Glu Asp Thr Leu Asn Lys Val Asp 530 535 540 Ala Ala Val Ala Glu Ala Lys Ala Ala Leu Gly Gly Ser Asp Ile Ser 545 550 555 560 Ala Ile Lys Ser Ala Met Glu Lys Leu Gly Gln Glu Ser Gln Ala Leu 565 570 575 Gly Gln Ala Ile Tyr Glu Ala Ala Gln Ala Ala Ser Gln Ala Thr Gly 580 585 590 Ala Ala His Pro Gly Gly Glu Pro Gly Gly Ala His Pro Gly Ser Ala 595 600 605 Asp Asp Val Val Asp Ala Glu Val Val Asp Asp Gly Arg Glu Ala Lys 610 615 620 <210> 2 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> T cell epitope <400> 2 Ala Ala Ile Glu Phe Phe Glu Gly Met Val His Asp Ser Ile Lys 1 5 10 15 <210> 3 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> B cell epitope for O(JC) <400> 3 Leu Pro Asn Ala Arg Gly Asp Leu Gln Val Leu Ala Pro Lys Ala Ala 1 5 10 15 Arg Pro Leu <210> 4 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> B cell epitope for O(TWN) <400> 4 Pro Asn Asn Val Arg Gly Asp Leu Gln Val Leu Ala Gln Lys Thr Glu 1 5 10 15 Lys Thr Leu Pro 20 <210> 5 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> B cell epitope for A(GP, 2018) <400> 5 Pro Gln Asn Arg Arg Gly Asp Ser Gly Pro Leu Val Val Lys Pro Thr 1 5 10 15 Gln Leu Pro <210> 6 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> B cell epitope for A(GVII:BAN-GA) <400> 6 Ser Gly Arg Val Arg Gly Asp Leu Gly Gly Leu Ala Ala Arg Val Ala 1 5 10 15 Ala Gln Leu Pro 20 <210> 7 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> VP1 200-213 <400> 7 His Lys Gln Lys Ile Val Ala Pro Val Lys Gln Ser Leu 1 5 10 <210> 8 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> delivery molecule (AP) <400> 8 Arg Arg Arg Trp Cys Lys Arg Arg Arg 1 5 <210> 9 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> PADRE <400> 9 Ala Lys Phe Val Ala Ala Trp Thr Leu Lys Ala Ala Ala 1 5 10 <210> 10 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Invasin <400> 10 Thr Ala Lys Ser Lys Lys Phe Pro Ser Tyr Thr Ala Thr Tyr Gln Phe 1 5 10 15 <210> 11 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Linker <400> 11 Gly Gly Ser Gly Gly 1 5 <210> 12 <211> 798 <212> PRT <213> Artificial Sequence <220> <223> Recombinant protein for immune enhancement <400> 12 Ala Arg Ala Val Gly Ile Asp Leu Gly Thr Thr Asn Ser Val Val Ser 1 5 10 15 Val Leu Glu Gly Gly Asp Pro Val Val Val Ala Asn Ser Glu Gly Ser 20 25 30 Arg Thr Thr Pro Ser Ile Val Ala Phe Ala Arg Asn Gly Glu Val Leu 35 40 45 Val Gly Gln Pro Ala Lys Asn Gln Ala Val Thr Asn Val Asp Arg Thr 50 55 60 Val Arg Ser Val Lys Arg His Met Gly Ser Asp Trp Ser Ile Glu Ile 65 70 75 80 Asp Gly Lys Lys Tyr Thr Ala Pro Glu Ile Ser Ala Arg Ile Leu Met 85 90 95 Lys Leu Lys Arg Asp Ala Glu Ala Tyr Leu Gly Glu Asp Ile Thr Asp 100 105 110 Ala Val Ile Thr Thr Pro Ala Tyr Phe Asn Asp Ala Gln Arg Gln Ala 115 120 125 Thr Lys Asp Ala Gly Gln Ile Ala Gly Leu Asn Val Leu Arg Ile Val 130 135 140 Asn Glu Pro Thr Ala Ala Ala Leu Ala Tyr Gly Leu Asp Lys Gly Glu 145 150 155 160 Lys Glu Gln Arg Ile Leu Val Phe Asp Leu Gly Gly Gly Thr Phe Asp 165 170 175 Val Ser Leu Leu Glu Ile Gly Glu Gly Val Val Glu Val Arg Ala Thr 180 185 190 Ser Gly Asp Asn His Leu Gly Gly Asp Asp Trp Asp Gln Arg Val Val 195 200 205 Asp Trp Leu Val Asp Lys Phe Lys Gly Thr Ser Gly Ile Asp Leu Thr 210 215 220 Lys Asp Lys Met Ala Met Gln Arg Leu Arg Glu Ala Ala Glu Lys Ala 225 230 235 240 Lys Ile Glu Leu Ser Ser Ser Gln Ser Thr Ser Ile Asn Leu Pro Tyr 245 250 255 Ile Thr Val Asp Ala Asp Lys Asn Pro Leu Phe Leu Asp Glu Gln Leu 260 265 270 Thr Arg Ala Glu Phe Gln Arg Ile Thr Gln Asp Leu Leu Asp Arg Thr 275 280 285 Arg Lys Pro Phe Gln Ser Val Ile Ala Asp Thr Gly Ile Ser Val Ser 290 295 300 Glu Ile Asp His Val Val Leu Val Gly Gly Ser Thr Arg Met Pro Ala 305 310 315 320 Val Thr Asp Leu Val Lys Glu Leu Thr Gly Gly Lys Glu Pro Asn Lys 325 330 335 Gly Val Asn Pro Asp Glu Val Val Ala Val Gly Ala Ala Leu Gln Ala 340 345 350 Gly Val Leu Lys Gly Glu Val Lys Asp Val Leu Leu Leu Asp Val Thr 355 360 365 Pro Leu Ser Leu Gly Ile Glu Thr Lys Gly Gly Val Met Thr Arg Leu 370 375 380 Ile Glu Arg Asn Thr Thr Ile Pro Thr Lys Arg Ser Glu Thr Phe Thr 385 390 395 400 Thr Ala Asp Asp Asn Gln Pro Ser Val Gln Ile Gln Val Tyr Gln Gly 405 410 415 Glu Arg Glu Ile Ala Ala His Asn Lys Leu Leu Gly Ser Phe Glu Leu 420 425 430 Thr Gly Ile Pro Pro Ala Pro Arg Gly Ile Pro Gln Ile Glu Val Thr 435 440 445 Phe Asp Ile Asp Ala Asn Gly Ile Val His Val Thr Ala Lys Asp Lys 450 455 460 Gly Thr Gly Lys Glu Asn Thr Ile Arg Ile Gln Glu Gly Ser Gly Leu 465 470 475 480 Ser Lys Glu Asp Ile Asp Arg Met Ile Lys Asp Ala Glu Ala His Ala 485 490 495 Glu Glu Asp Arg Lys Arg Arg Glu Glu Ala Asp Val Arg Asn Gln Ala 500 505 510 Glu Thr Leu Val Tyr Gln Thr Glu Lys Phe Val Lys Glu Gln Arg Glu 515 520 525 Ala Glu Gly Gly Ser Lys Val Pro Glu Asp Thr Leu Asn Lys Val Asp 530 535 540 Ala Ala Val Ala Glu Ala Lys Ala Ala Leu Gly Gly Ser Asp Ile Ser 545 550 555 560 Ala Ile Lys Ser Ala Met Glu Lys Leu Gly Gln Glu Ser Gln Ala Leu 565 570 575 Gly Gln Ala Ile Tyr Glu Ala Ala Gln Ala Ala Ser Gln Ala Thr Gly 580 585 590 Ala Ala His Pro Gly Gly Glu Pro Gly Gly Ala His Pro Gly Ser Ala 595 600 605 Asp Asp Val Val Asp Ala Glu Val Val Asp Asp Gly Arg Glu Ala Lys 610 615 620 Gly Gly Ser Gly Gly Ala Ala Ile Glu Phe Phe Glu Gly Met Val His 625 630 635 640 Asp Ser Ile Lys Gly Gly Ser Gly Gly Leu Pro Asn Ala Arg Gly Asp 645 650 655 Leu Gln Val Leu Ala Pro Lys Ala Ala Arg Pro Leu Pro Asn Asn Val 660 665 670 Arg Gly Asp Leu Gln Val Leu Ala Gln Lys Thr Glu Lys Thr Leu Pro 675 680 685 Gly Gly Ser Gly Gly Pro Gln Asn Arg Arg Gly Asp Ser Gly Pro Leu 690 695 700 Val Val Lys Pro Thr Gln Leu Pro Ser Gly Arg Val Arg Gly Asp Leu 705 710 715 720 Gly Gly Leu Ala Ala Arg Val Ala Ala Gln Leu Pro Gly Gly Ser Gly 725 730 735 Gly His Lys Gln Lys Ile Val Ala Pro Val Lys Gln Ser Leu Arg Arg 740 745 750 Arg Trp Cys Lys Arg Arg Arg Gly Gly Ser Gly Gly Ala Lys Phe Val 755 760 765 Ala Ala Trp Thr Leu Lys Ala Ala Ala Gly Gly Ser Gly Gly Thr Ala 770 775 780 Lys Ser Lys Lys Phe Pro Ser Tyr Thr Ala Thr Tyr Gln Phe 785 790 795 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for HSP70 <400> 13 tgccgcgcgg cagccatatg gcacgtgcag ttggtatcga 40 <210> 14 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for HSP70 <400> 14 tggtggtggt ggtgctcgag aaactgatat gttgcggtat 40

Claims (8)

Recombinant protein having the sequence of SEQ ID NO: 12. The recombinant protein according to claim 1, wherein the recombinant protein simultaneously induces cellular and humoral immune responses against any one or more foot-and-mouth disease virus of O serotype and A serotype foot-and-mouth disease virus. An adjuvant composition comprising the recombinant protein of claim 1 as an active ingredient. The adjuvant composition of claim 3, wherein the recombinant protein is contained in an amount of 0.1 to 50 parts by weight based on 100 parts by weight of the total adjuvant composition. The adjuvant composition of claim 3, wherein the adjuvant composition is an oil formulation or a non-oil formulation. Foot-and-mouth disease vaccine composition comprising the recombinant protein of claim 1. The foot-and-mouth disease vaccine composition of claim 6, wherein the recombinant protein is contained in an amount of 0.1 to 50 parts by weight based on 100 parts by weight of the total foot-and-mouth disease vaccine composition. The foot-and-mouth disease vaccine composition of claim 6, wherein the adjuvant composition is an oil formulation or a non-oil formulation.

Images