CN102127554B - Japanese encephalitis particle vaccine and preparation method and application thereof - Google Patents
Japanese encephalitis particle vaccine and preparation method and application thereof Download PDFInfo
- Publication number
- CN102127554B CN102127554B CN2010105996877A CN201010599687A CN102127554B CN 102127554 B CN102127554 B CN 102127554B CN 2010105996877 A CN2010105996877 A CN 2010105996877A CN 201010599687 A CN201010599687 A CN 201010599687A CN 102127554 B CN102127554 B CN 102127554B
- Authority
- CN
- China
- Prior art keywords
- japanese encephalitis
- virus
- antigen
- vaccine
- particle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention belongs to the field of biotechnology, and relates to a vaccine embedded with virus-like particles expressing multi-epitope antigen for Japanese encephalitis, and a preparation method and application thereof. The antigen of the vaccine is virus-like particles formed through spontaneous assembly of hepatitis B virus core antigen embedded with neutralizing antigen epitope expressing Japanese encephalitis virus and cytotoxic lymphocyte (CTL) antigen epitope, and is prepared through soluble expression of escherichia coli and purification. The Japanese encephalitis virus-like particle antigen is properly diluted with physiological saline, or is compatible with immunologic adjuvants to be prepared into the Japanese encephalitis particle vaccine. Animal experiments show that: the vaccine is safe and high-efficiency; mice inoculate with the vaccine generate high-level neutralizing antigen for the Japanese encephalitis virus to protect the mice against the attack of strong Japanese encephalitis virus by 100 percent.
Description
Technical field
The present invention relates to a kind of virus sample particle vaccines of chimeric expression japanese encephalitis virus multi-epitope antigen, belong to biological technical field, be exclusively used in the immunoprophylaxis of the Japanese encephalitis of people and susceptible animal.
Background technology
Japanese encephalitis (Japanese Encephalitis; JE) be a kind of by japanese encephalitis virus (Japanese Encephalitis Virus; JEV) the infecting both domestic animals and human arthropod borne infection that causes; People and Ma present the encephalitis symptom, and pig mainly shows as breeding difficulty, the most inapparent infection of other animal.This disease mainly betides south east asia, and China is one of important epidemic-stricken area of Japanese encephalitis, and annual human morbidity number is only second to India.In recent years, the Japanese encephalitis distribution range enlarges, the popular time is elongated along with global warming and variation of ecology and environment cause, and hazard rating strengthens day by day.
Though there are 5 genotype in japanese encephalitis virus, this virus has only a serotype.A large amount of research shows humoral immunization, and especially cause of disease specificity neutralizing antibody level is consistent with the Japanese encephalitis infection level height of humans and animals, and cellular immune level has determined to infect the removing ability of body to this virus.
Vaccination is one of important measures of people and susceptible animal prevention Japanese encephalitis in the epidemic-stricken area.The Japanese encephalitis vaccine that commercialization is used has two kinds; A kind of is the Japanese encephalitis inactivated vaccine; Early stage is mouse brain purified virus inactivated vaccine; A few peoples have negative reaction after using, and use Chinese hamster kidney cell (BHK21) or African green monkey kidney cell (VERO) recently instead and are production matrix, generally need inoculation 2 to 3 times; Another kind is the Japanese encephalitis attenuated live vaccines; By China's biological products assay institute development; Strain is JEV SA14-14-2; This vaccine one shot immunity can produce immune protective effect preferably, but because there is the anti-high wind of potential virulence danger in the weak poison of Japanese encephalitis vaccine, the World Health Organization does not ratify this vaccine so far in global widespread use.
Genetic engineering subunit vaccine since security good, receive maternal antibody disturb little, can the matched reagent box distinguish advantages such as vaccine immunity and wild virus infection and have broad application prospects.Yet gene engineered subunit antigen immune originality is relatively weak, antibody response is slow; Immunity system for better excitating organism; Make it enough resistibilitys arranged, be necessary to seek the immune effect of the genetic engineering subunit vaccine of method raising safely and efficiently japanese encephalitis virus.
(Virus-like particle is the protein grain of the highly structural that formed by the virus structural protein being made by manufacturers or users VLP) to virus-like particle, lacks viral nucleic acid, does not have infectious.Some VLP surfaces can be repeated high-density and showed the exogenous antigen epi-position, thereby induce to the efficient immunne response of exogenous antigen epi-position.Recent research shows; Some VLP can effectively pass through MHC I class and MHC II classpath submission antigen; Induce the CTL cell response, excite Th1 and the immunoreation of Th2 type, some viral VLP can induce that BMDC and monokaryon are huge has a liking for cell mass maturation and cytokine expression in vivo and in vitro.Therefore, using chimeric virus-like particle antigen prepd vaccine has characteristics safely and efficiently.
The cAg of people's quasi-hepatitis B virus (HBc) can spontaneous assembling assembly virus-like particle in virus infection, the nucleic acid of parcel virus.The virus-like particle of the spontaneous formation of HBc has two kinds of sizes, is respectively the icosahedron of forming with core monomer antigen by 180 and 240.The HBc total length is 183 Aa, and wherein 75-82Aa is the antigen visualization area, shows the virus like particle surface, spike district in the middle of constituting.39 Aa of the C-terminal of HBc are rich in l-arginine, have the function that combines packaging virus nucleic acid, do not influence HBc after the removal and form virus-like particle.The HBc that blocks (1-149Aa) can efficiently express in intestinal bacteria; And independently be assembled into virus-like particle; The middle spike district of HBc (1-149Aa) HBc and the C latter end that blocks all are exposed to the surface of virus particle; But epitope [the Birkett A of these zone amalgamation and expression external sources; Lyons K; Schmidt A, et al. A modified hepatitis B virus core particle containing multiple epitopes of the Plasmodium falciparum circumsporozoite protein provides a highly immunogenic malaria vaccine in preclinical analyses in rodent and primate hosts. Infect Immun 2002; 70 (12): 6860 – 6870. [PubMed:12438363].Some HBc that merge external source B cell antigen epi-position or T cell antigen epitope still can be assembled into chimeric VLP, and the induction of immunity animal produces the intensive immunne response, and the exogenous antigen epi-position inductive immune effect that especially inserts in HBc molecule intermediary spike district is best.As a kind of novel epitope submission system, HBc-VLP successfully has been used for the development of AIDS, hepatitis C and malaria new generation vaccine, the clinical second phase research of the entering that has.
Summary of the invention
Technical problem
The purpose of this invention is to provide a kind of novel Japanese encephalitis particle vaccines.This vaccine safety is efficient, does not contain infectious viral nuclei acid, and antigen purity is high, can inoculate the protective immune response that body produces infection with Japanese ence phalitis Viruses by rapid induction.Be used for the immunoprophylaxis of people and susceptible animal, prevent the generation of Japanese encephalitis safely, efficiently Japanese encephalitis.
Technical scheme
The invention provides a kind of virus sample particle vaccines that is used to prevent Japanese encephalitis; The antigen composition of this vaccine is among the chimeric JEV and the virus-like particle of the autonomous assembling of the HBcAg of epitope and CTL epitope, through bacterium coli solubility expression, purifying preparation.Japanese encephalitis virus appearance particulate antigen with saline water suitably dilution or with the immunological adjuvant compatibility after process Japanese encephalitis particle vaccines of the present invention.
Beneficial effect
Rapid induction produces cause of disease specificity neutralizing antibody behind the Japanese encephalitis particle vaccines inoculation mouse; Two exempt from the resistibility that the back mouse acquisition of 2 weeks is attacked the lethal dose japanese encephalitis virus; And demonstrate stronger immunological memory; Cause of disease specificity neutralizing antibody level significantly raises, and 100% protection mouse is to the attack of the strong poison of Japanese encephalitis.
Description of drawings
Fig. 1. expression vector PET-28a-VLP-con makes up synoptic diagram
Fig. 2. expression vector PET-28a-VLP-JEV makes up synoptic diagram
Fig. 3. HBV cAg (A:VLP-con) electromicroscopic photograph (* 150,000 times)
Virus-like particle (B:VLP-JEV) electromicroscopic photograph (* 150,000 times) of Fig. 4 chimeric expression japanese encephalitis virus epitope antigen
Fig. 5. the Japanese ence phalitis Viruses EDIII protein antibodies level that Japanese encephalitis particle vaccines inoculation mouse produces
Fig. 6. the Japanese ence phalitis Viruses antibody horizontal that Japanese encephalitis particle vaccines inoculation mouse produces
Fig. 7. the neutralizing antibody level that Japanese encephalitis particle vaccines inoculation mouse produces
Fig. 8. the Japanese encephalitis particle vaccines is inoculated the malicious protection situation of attacking of mouse.
Embodiment
Experimental technique that this embodiment relates to or step are with reference to " molecular cloning experiment guide " (second edition) 1 ~ 60 page, 672 ~ 681 pages and 822 ~ 847 pages.
One, the structure of HBcAg skelemin (HBc-con) prokaryotic expression carrier PET28a-VLP-Con
With reference to synthetic HBcAg skelemin (HBc-con) encoding sox (its nucleotides sequence is classified Seq NO.3 as) of the artificial design of hepatitis B virus gene sequence (AY707087.1) in the GenBank DB.Compare with the encoding sox of HBcAg 1-149Aa, the HBc-con encoding sox has 2 artificial constructed restriction enzyme site BamH I and EcoR I at 231 and 238, and HBc-con inserts four amino acid PEFS at the 78th of HBc and 79 Aa; Add Nco I and Xho I site respectively at the two ends of HBcAg skelemin (HBc-con) encoding sox, so that HBcAg skelemin (HBc-con) encoding sox imports the PET-28a carrier; HBcAg skelemin (HBc-con) encoding sox is not with terminator codon, so that utilize the his label in PET-28a expression cassette downstream.HBcAg skelemin (HBc-con) encoding sox imports PET-28a through Nco I and Xho I site; Obtain HBcAg skelemin (HBc-con) prokaryotic expression carrier; Called after PET28a-VLP-Con, sequencing result show consistent with design.
Two, the structure of virus-like particle antigen (VLP-JEV) the prokaryotic expression carrier PET28a-VLP-JEV of chimeric japanese encephalitis virus epitope
Design three pairs of primers, through recombinant PCR method, enzyme cut with the method that is connected respectively with in two on the japanese encephalitis virus E albumen and epitope and a CTL epitope import the HBc skelemin.In two and epitope "
327 SYSGSDGPCKI 337 " [Wu S-C, Lin C-W. Neutralizing peptide ligands selected from phage-displayed libraries mimic the conformational epitope on domain III of the Japanese encephalitis virus envelope protein. Virus Res 2001; 76:59-69.] and "
384 VVGRGDKQI 392 " [Seif, S. A., Morita; K., Matsuo, S.; Hasebe; F. and Igarashi, A., Finer mapping of neutralizing epitope (s) on the C-terminal of Japanese encephalitis virus E-protein expressed in recombinant Escherichia coli system. Vaccine 1995. 13:1515-1521.] be illustrated in spike district in the middle of the antigen of HBc; be between the 78th of HBc and 79 Aa, the CTL epitope "
60 CYHASVTDI 68 " [Takada, K., Masaki; H., Konishi, E.; Takahashi; M. and Kurane, I., Definition of an epitope on Japanese encephalitis virus (JEV) envelope protein recognized by JEV-specific murine CD8+ cytotoxic T lymphocytes.
Arch Virol2000. 145:523-534.] insert the C latter end of HBc.
P1:5`-CGAT
CCATGGACATTGACCCTT-3` Nco I sees seq NO.4
P2:5`-TCT
GGATCCTCGATTTTGCACGGGCCATCGCTGCCGCTATAGCTCAAGTTATTACCCAC-3` BamH I sees seq NO.5
P3:5`-ATA
GAATTCGTGGTGGGCCGTGGCGATAAACAGATCTCCCCAGCATCTAGG-3` EcoR I sees seq NO6
P4:5`-CAA
CTCGAGAACCACAGTAGTTTCC-3` Xho I sees seq NO.7
P5:5`-CGAT
CCATGGACATTGACCCTT-3` Nco I sees seq NO.8
P6:5`-CAA
CTCGAGGATATCGGTCACGCTCGCATGATAGCAAACCACAGTAGTTTCC-3` Xho I sees seq NO.9
P1 and P2 introduce among the JEV and epitope "
327SYSGSDGPCKI
337"; See seq NO.10
P3 and P4 introduce among the JEV and epitope "
384VVGRGDKQI
392"; See seq NO11
P5 and P6 introducing JEV CTL epitope "
60CYHASVTDI
68".See seq NO.12.
The condition of described PCR is 94 ℃, 5min; 94 ℃, 30sec, 50 ℃, 30sec, 72 ℃, 30sec, 30 circulations; 72 ℃, 7 min.
Recombination imports PET-28a through Nco I and Xho I site, obtains virus-like particle antigen (VLP-JEV) prokaryotic expression carrier of chimeric japanese encephalitis virus epitope, and called after PET28a-VLP-JEV is correct through sequence verification.
Three, solubility expression and the purifying of Japanese encephalitis particulate antigen in intestinal bacteria
With PET28a-VLP-Con and PET28a-VLP-JEV transformed into escherichia coli (BL21 DE3); With positive strain in the LB substratum 37 ℃ to be cultured to bacterial concentration be OD600 ≈ 0.4, in 18 ~ 20 ℃ of environment, use final concentration to be 0.1mM isopropylthiogalactoside (IPTG) abduction delivering 12h ~ 15h then.Centrifugal collection thalline; Ultrasonic treatment; With intestinal bacteria lysate supernatant 12000rpm after centrifugal 30 minutes, using final concentration is that 0.22 μ m filters behind 20% ammonium sulphate precipitation particulate antigen, the physiological saline solution, uses Sepharose CL-4B sieve chromatography purifying; Obtain particulate antigen, its aminoacid sequence is that Seq NO.1, nucleotides sequence are classified Seq NO.2 as.HBc-con and VLP-JEV can express by highly-soluble in intestinal bacteria, and independently are assembled into virus-like particle (Fig. 1)
Four, Japanese encephalitis particle vaccines mouse immune protection test
Testing program
6 age in week BALB/C mice, be divided into 5 groups, 5 every group, respectively VLP-Con, VLP-JEV and the ISA206 adjuvant emulsion VLP-JEV of the dilution of immunization saline water, the particulate antigen content of every mouse immune is 50 μ g; The commercially available vaccine control group is a pig with Japanese encephalitis less toxic vaccine (veterinary biological product ltd before the section of Wuhan), and every mouse inoculation 1/10 pig is used dosage; Every mouse inoculation of blank 100 μ L saline water.Head exempts from back 2 all booster immunizations once, and each is organized vaccine kind and dosage and just exempts from identical.Two exempt from back 2 all immune mouses counts lethal dose (LD with 10 sesquialters
50) (the JEV NJ08 strain) intracranial inoculation of the strong poison of Japanese encephalitis attack poison, observed for 3 weeks.Before the immunization, head exempts from the back and exempts from 1 week of back 1 week, two and attack 1 week of poison back eye socket venous blood collection respectively, separation of serum detects antibody.It is envelope antigen that the ELISA detection of antibodies adopts purified recombinant ED3 albumen.The detection of neutralizing antibody adopts virus (JEV SA14-14-2) plaque to reduce test, virus plaque is reduced 50% maximum serum dilution factor and is defined as NAT, gets 3 sample determinations for every group.
Test-results
ELISA antibody
The Japanese encephalitis particle vaccines immune mouse of the Japanese encephalitis particle vaccines of no adjuvant and compatibility ISA206 adjuvant has all produced the antibody response (Fig. 2 and Fig. 3) to recombination Japanese encephalitis ED3 antigen and japanese encephalitis virus.1 week behind the initial immunization, the antibody against Japanese encephalitis level that the Japanese encephalitis particle vaccines group mouse of the no adjuvant of immunity produces a little more than with the Japanese encephalitis particle vaccines of ISA206 adjuvant, but two exempt from afterwards that 1 all adjuvant group antibody against Japanese encephalitis levels are higher than no adjuvant group.It is close with the Japanese encephalitis commercialized vaccine to the antigenic antibody horizontal of ED3 that Japanese encephalitis particle vaccines immune mouse produces; But the antibody horizontal particle vaccines to totivirus is lower than commercialized vaccine, infers that there is other dominance epitope in japanese encephalitis virus.
Neutralizing antibody
Inoculation Japanese encephalitis particle vaccines and commercialization less toxic vaccine mouse have all produced japanese encephalitis virus neutralizing antibody (Fig. 4); Two exempt from afterwards, and the NAT of the Japanese encephalitis particle vaccines immune mouse of 1 all Application of I SA206 adjuvants is 1:40; Close with commercialized vaccine; The neutralizing antibody of no adjuvant Japanese encephalitis particle vaccines group mouse is low slightly, is 1:20.Japanese encephalitis particle vaccines inoculation mouse all is significantly increased attacking poison back viral special neutralizing antibody level of one week, shows that the Japanese encephalitis particle vaccines can induce stronger immunological memory reaction.
Attack the poison protection
Mouse is attacked malicious protection test result (Fig. 5) and shows that inoculation ISA206 adjuvant Japanese encephalitis particle vaccines and commercialization less toxic vaccine mouse are with 10 times of LD
50The strong poison of japanese encephalitis virus (JEV NJ08 strain) all do not have death, 100% immunoprotection after attacking poison; The survival rate of no adjuvant Japanese encephalitis particle vaccines immune group mouse is 70%; The particulate antigen group mouse that inoculates no Japanese encephalitis epitope is all dead.The Japanese encephalitis particle vaccines can produce good immune protection by inducing mouse; The immune protective effect that adds ISA206 adjuvant Japanese encephalitis particle vaccines is superior to not having adjuvant Japanese encephalitis particle vaccines; Similar with the commercialization less toxic vaccine, inductive Japanese encephalitis specificity neutralizing antibody level is more consistent after this and the vaccine inoculation.
SEQUENCE LISTING
< 110>Agricultural University Of Nanjing
< 120>a kind of Japanese encephalitis particle vaccines
<130>
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 190
<212> PRT
< 213>artificial sequence
<400> 1
Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu
1 5 10 15
Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp
20 25 30
Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys
35 40 45
Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu
50 55 60
Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Ser Tyr Ser Gly
65 70 75 80
Ser Asp Gly Pro Cys Lys Ile Glu Asp Pro Glu Phe Val Val Gly Arg
85 90 95
Gly Asp Lys Gln Ile Ser Pro Ala Ser Arg Asp Leu Val Val Asn Tyr
100 105 110
Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln Leu Leu Trp Phe His
115 120 125
Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val
130 135 140
Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn
145 150 155 160
Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr Val Val Cys Tyr His
165 170 175
Ala Ser Val Thr Asp Ile Leu Glu His His His His His His
180 185 190
<210> 2
<211> 573
<212> DNA
< 213>artificial sequence
<400> 2
atggacattg acccttataa agaatttgga gctactgtgg agttactctc gtttttgcct 60
tctgactttt ttccttccgt cagagatctc ctagacaccg cctcagctct gtatcgggaa 120
gccttagagt ctcctgagca ttgctcacct caccatactg cactcaggca agcaattctc 180
tgctgggggg aattgatgac tctagctacc tgggtgggta ataacttgag ctatagcggc 240
agcgatggcc cgtgcaaaat cgaggatcca gaattcgtgg tgggccgtgg cgataaacag 300
atctccccag catctaggga tctagtagtc aattatgtta atactaacat gggtttaaag 360
atcaggcaac tattgtggtt tcatatatct tgccttactt ttggaagaga gactgtactt 420
gaatatttgg tctctttcgg agtgtggatt cgcactcctc cagcctatag accaccgaat 480
gcccctatct tatcaacact tccggaaact actgtggttt gctatcatgc gagcgtgacc 540
gatatcctcg agcaccacca ccaccaccac tga 573
<210> 3
<211> 471
<212> DNA
< 213>artificial sequence
<400> 3
taccatggac attgaccctt ataaagaatt tggagctact gtggagttac tctcgttttt 60
gccttctgac ttttttcctt ccgtcagaga tctcctagac accgcctcag ctctgtatcg 120
ggaagcctta gagtctcctg agcattgctc acctcaccat actgcactca ggcaagcaat 180
tctctgctgg ggggaattga tgactctagc tacctgggtg ggtaataact tggaggatcc 240
agaattctcc ccagcatcta gggatctagt agtcaattat gttaatacta acatgggttt 300
aaagatcagg caactattgt ggtttcatat atcttgcctt acttttggaa gagagactgt 360
acttgaatat ttggtctctt tcggagtgtg gattcgcact cctccagcct atagaccacc 420
aaatgcccct atcttatcaa cacttccgga aactactgtg gttctcgagc a 471
<210> 4
<211> 22
<212> DNA
< 213>artificial sequence
<400> 4
cgatccatgg acattgaccc tt 22
<210> 5
<211> 59
<212> DNA
< 213>artificial sequence
<400> 5
tctggatcct cgattttgca cgggccatcg ctgccgctat agctcaagtt attacccac 59
<210> 6
<211> 51
<212> DNA
< 213>artificial sequence
<400> 6
atagaattcg tggtgggccg tggcgataaa cagatctccc cagcatctag g 51
<210> 7
<211> 25
<212> DNA
< 213>artificial sequence
<400> 7
caactcgaga accacagtag tttcc 25
<210> 8
<211> 22
<212> DNA
< 213>artificial sequence
<400> 8
cgatccatgg acattgaccc tt 22
<210> 9
<211> 52
<212> DNA
< 213>artificial sequence
<400> 9
caactcgagg atatcggtca cgctcgcatg atagcaaacc acagtagttt cc 52
<210> 10
<211> 11
<212> PRT
< 213>artificial sequence
<400> 10
Ser Tyr Ser Gly Ser Asp Gly Pro Cys Lys Ile
1 5 10
<210> 11
<211> 9
<212> PRT
< 213>artificial sequence
<400> 11
Val Val Gly Arg Gly Asp Lys Gln Ile
1 5
<210> 12
<211> 9
<212> PRT
< 213>artificial sequence
<400> 12
Cys Tyr His Ala Ser Val Thr Asp Ile
1 5
Claims (3)
1. a Japanese encephalitis particle vaccines is characterized in that its propylhomoserin acid sequence is Seq NO.1.
2. Japanese encephalitis particle vaccines is characterized in that its nucleotides sequence classifies SeqNO.2 as.
3.
According to claim 1 and 2A kind of Japanese encephalitis particle vaccines is in the application of preparation in the medicine, it is characterized in that with the Japanese encephalitis particle vaccines with the saline water dilution or with the immunological adjuvant compatibility, be used for the immunoprophylaxis of people or susceptible animal Japanese encephalitis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105996877A CN102127554B (en) | 2010-12-22 | 2010-12-22 | Japanese encephalitis particle vaccine and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105996877A CN102127554B (en) | 2010-12-22 | 2010-12-22 | Japanese encephalitis particle vaccine and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102127554A CN102127554A (en) | 2011-07-20 |
| CN102127554B true CN102127554B (en) | 2012-07-25 |
Family
ID=44265828
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105996877A Expired - Fee Related CN102127554B (en) | 2010-12-22 | 2010-12-22 | Japanese encephalitis particle vaccine and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102127554B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102357246B (en) * | 2011-11-02 | 2013-04-03 | 江苏省中医药研究院 | EGFR and HER2 combined polypeptide epitope vaccine |
| CN116987154A (en) * | 2013-08-28 | 2023-11-03 | 阿菲博迪公司 | Binding polypeptides with mutated scaffolds |
| BR112018003580A2 (en) * | 2015-08-25 | 2018-09-25 | Xiamen University | nucleic acid molecule, method for presenting a target polypeptide, recombinant protein, viral type particle, pharmaceutical composition, polypeptide, vector, host cell and method for preparing the recombinant protein |
| CN105688202B (en) * | 2016-03-03 | 2019-07-19 | 四川农业大学 | A kind of Vaccinum Encephalitis B composition and preparation method thereof |
| JP6955020B2 (en) | 2017-02-17 | 2021-10-27 | シャアメン ユニバーシティ | Polypeptide Carriers and Their Use to Present Target Polypeptides |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1609204A (en) * | 2003-03-20 | 2005-04-27 | 上海天甲生物医药有限公司 | Bivalent hepatitis B-encephalitis B vaccine |
| CN101899466A (en) * | 2010-06-29 | 2010-12-01 | 中国人民解放军第三军医大学 | Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof |
-
2010
- 2010-12-22 CN CN2010105996877A patent/CN102127554B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1609204A (en) * | 2003-03-20 | 2005-04-27 | 上海天甲生物医药有限公司 | Bivalent hepatitis B-encephalitis B vaccine |
| CN101899466A (en) * | 2010-06-29 | 2010-12-01 | 中国人民解放军第三军医大学 | Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 吴玉水.日本脑炎病毒DNA疫苗和基因工程亚单位颗粒疫苗的动物保护实验研究.《中国人兽共患病杂志》.2002,第18卷(第6期),p3-6. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102127554A (en) | 2011-07-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Denis et al. | Immunogenicity of papaya mosaic virus-like particles fused to a hepatitis C virus epitope: evidence for the critical function of multimerization | |
| Li et al. | Virus-like particles for enterovirus 71 produced from Saccharomyces cerevisiae potently elicits protective immune responses in mice | |
| KR101818934B1 (en) | Construct for production of empty picornaviral capsids | |
| Wang et al. | Recombinant VP1 protein expressed in Pichia pastoris induces protective immune responses against EV71 in mice | |
| CN102127554B (en) | Japanese encephalitis particle vaccine and preparation method and application thereof | |
| CN108624601B (en) | Yeast-expressed coxsackievirus A10 virus-like particle and application thereof | |
| KR101608121B1 (en) | Method for Preparing Virus Like Particle of Nodavirus, Yeast Strain producing the Same and Vaccine Composition Comprising the Same | |
| CN113164586A (en) | Immune composition and preparation method and application thereof | |
| CA2434000A1 (en) | Adjuvant viral particle | |
| CN112048004B (en) | Coxsackie virus B5 type virus-like particle, and preparation method and application thereof | |
| CN104873967A (en) | O type foot and mouth disease virus-like particle vaccine as well as preparation method and application thereof | |
| JP2019195328A (en) | Methods and compositions for dengue virus vaccines | |
| CN106318955B (en) | Recombinant adenovirus expressing human enterovirus 71-type capsid protein, vaccine prepared from recombinant adenovirus and application of recombinant adenovirus | |
| Crisci et al. | Chimeric calicivirus-like particles elicit protective anti-viral cytotoxic responses without adjuvant | |
| CN113862284A (en) | Gene for coding recombinant avian influenza virus HA protein, virus-like particle, vaccine, preparation and application | |
| CN104628871B (en) | A kind of preparation for recombinating bursal disease protein engineering vaccine | |
| US20220096620A1 (en) | Foot-and-mouth disease virus-like particle antigen, and vaccine composition, preparation method, and application thereof | |
| CN109776657A (en) | Recombinate norovirus VLP particle and preparation method and its usage | |
| Viljoen et al. | Novel Developments and Next‐Generation Vaccines | |
| KR102365464B1 (en) | Development of recombinant subunit Zika virus vaccine and preparing method thereof | |
| CN107974458A (en) | Express gene gapdh and its recombination bacillus coli and the application of bacillus rhusiopathiae suis recombinant protein GAPDH | |
| KR102451412B1 (en) | Novel immunopotent recombinant protein with simultaneous induction of cellular and humoral immune responses and broad spectrum of protective efficacy, and foot-and-mouth disease (FMD) vaccine composition comprising the same | |
| CN102212120A (en) | Salmonella paratyphi A PagC subunit vaccine and preparation method thereof | |
| CN109880839B (en) | Preparation method of swine mycoplasma pneumonia and porcine circovirus bivalent genetic engineering vaccine | |
| CN113827714A (en) | H7N9 subtype avian influenza virus-like particle vaccine preparation and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120725 Termination date: 20131222 |