CN102127554A - Japanese encephalitis particle vaccine and preparation method and application thereof - Google Patents
Japanese encephalitis particle vaccine and preparation method and application thereof Download PDFInfo
- Publication number
- CN102127554A CN102127554A CN2010105996877A CN201010599687A CN102127554A CN 102127554 A CN102127554 A CN 102127554A CN 2010105996877 A CN2010105996877 A CN 2010105996877A CN 201010599687 A CN201010599687 A CN 201010599687A CN 102127554 A CN102127554 A CN 102127554A
- Authority
- CN
- China
- Prior art keywords
- japanese encephalitis
- virus
- antigen
- epitope
- particle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the field of biotechnology, and relates to a vaccine embedded with virus-like particles expressing multi-epitope antigen for Japanese encephalitis, and a preparation method and application thereof. The antigen of the vaccine is virus-like particles formed through spontaneous assembly of hepatitis B virus core antigen embedded with neutralizing antigen epitope expressing Japanese encephalitis virus and cytotoxic lymphocyte (CTL) antigen epitope, and is prepared through soluble expression of escherichia coli and purification. The Japanese encephalitis virus-like particle antigen is properly diluted with physiological saline, or is compatible with immunologic adjuvants to be prepared into the Japanese encephalitis particle vaccine. Animal experiments show that: the vaccine is safe and high-efficiency; mice inoculate with the vaccine generate high-level neutralizing antigen for the Japanese encephalitis virus to protect the mice against the attack of strong Japanese encephalitis virus by 100 percent.
Description
Technical field
The present invention relates to virus sample particle vaccines of a kind of chimeric expression japanese encephalitis virus multi-epitope antigen and its production and application, belong to biological technical field, be exclusively used in the immunoprophylaxis of the Japanese encephalitis of people and susceptible animal.
Background technology
Japanese encephalitis (Japanese Encephalitis, JE) be a kind of by japanese encephalitis virus (Japanese Encephalitis Virus, JEV) the infecting both domestic animals and human arthropod borne infection that causes, people and Ma present the encephalitis symptom, pig mainly shows as breeding difficulty, the most inapparent infection of other animal.This disease mainly betides south east asia, and China is one of important epidemic-stricken area of Japanese encephalitis, and annual human morbidity number is only second to India.In recent years, the Japanese encephalitis distribution range enlarges, the popular time is elongated along with global warming and variation of ecology and environment cause, and hazard rating strengthens day by day.
Though there are 5 genotype in japanese encephalitis virus, this virus has only a serotype.Especially cause of disease specificity neutralizing antibody level is consistent with the Japanese encephalitis infection level height of humans and animals for a large amount of humoral immunizatioies that studies show that, cellular immune level has determined to infect the removing ability of body to this virus.
Vaccination is one of important measures of people and susceptible animal prevention Japanese encephalitis in the epidemic-stricken area.The Japanese encephalitis vaccine that commercialization is used has two kinds, a kind of is the Japanese encephalitis inactivated vaccine, early stage is mouse brain purified virus inactivated vaccine, a few peoples have negative reaction after using, recently use Chinese hamster nephrocyte (BHK21) or African green monkey kidney cell (VERO) instead and be production matrix, generally need inoculation 2 to 3 times; Another kind is the Japanese encephalitis attenuated live vaccines; by China's biological products assay institute development; strain is JEV SA14-14-2; this vaccine one shot immunity can produce immune protective effect preferably; but because there is the anti-high wind of potential virulence danger in the weak poison of Japanese encephalitis vaccine, the World Health Organization does not ratify this vaccine so far in global widespread use.
Genetic engineering subunit vaccine since security good, be subjected to maternal antibody disturb little, can the matched reagent box distinguish advantages such as vaccine immunity and wild virus infection and have broad application prospects.Yet gene engineered subunit antigen immune originality is relatively weak, antibody response is slow, immunity system for better excitating organism, make it enough resistibilitys be arranged, be necessary to seek the immune effect of the genetic engineering subunit vaccine of method raising safely and efficiently japanese encephalitis virus.
(Virus-like particle is the protein grain of the highly structural that formed by the virus structural protein being made by manufacturers or users VLP) to virus-like particle, lacks viral nucleic acid, does not have infectious.Some VLP surfaces can be repeated high-density and be showed the exogenous antigen epi-position, thereby induce at the efficient immunne response of exogenous antigen epi-position.Recent studies show that, some VLP can effectively pass through MHC I class and MHC II classpath submission antigen, induce the CTL cell response, excite Th1 and the immune response of Th2 type, some viral VLP can induce that dendritic cell and monokaryon are huge has a liking for cell mass maturation and cytokine expression in vivo and in vitro.Therefore, using chimeric virus-like particle antigen prepd vaccine has characteristics safely and efficiently.
The cAg of people's quasi-hepatitis B virus (HBc) can spontaneous assembling assembly virus-like particle in virus infection, the nucleic acid of parcel virus.The virus-like particle of the spontaneous formation of HBc has two kinds of sizes, is respectively by 180 and 240 and the icosahedron formed of core monomer antigen.The HBc total length is 183 Aa, and wherein 75-82Aa is the antigen visualization area, shows the virus like particle surface, spike district in the middle of constituting.39 Aa of the C-terminal of HBc are rich in arginine, have the function in conjunction with packaging virus nucleic acid, do not influence HBc after the removal and form virus-like particle.The HBc(1-149Aa that blocks) can in intestinal bacteria, efficiently express, and independently be assembled into virus-like particle, HBc(1-149Aa) the middle spike district of HBc and the C latter end that blocks all are exposed to the surface of virus particle, but epitope [the Birkett A of these zone amalgamation and expression external sources, Lyons K, Schmidt A, et al. A modified hepatitis B virus core particle containing multiple epitopes of the Plasmodium falciparum circumsporozoite protein provides a highly immunogenic malaria vaccine in preclinical analyses in rodent and primate hosts. Infect Immun 2002; 70 (12): 6860 – 6870. [PubMed:12438363].Some HBc that merge external source B cell antigen epi-position or T cell antigen epitope still can be assembled into chimeric VLP, and the induction of immunity animal produces the intensive immunne response, especially exogenous antigen epi-position inductive immune effect the best of inserting in HBc molecule intermediary spike district.As a kind of novel epitope submission system, HBc-VLP successfully has been used for the development of acquired immune deficiency syndrome (AIDS), hepatitis C and malaria new generation vaccine, and the clinical second phase that enters that has is studied.
Summary of the invention
Technical problem
The purpose of this invention is to provide a kind of novel Japanese encephalitis particle vaccines.This vaccine safety is efficient, does not contain infectious viral nuclei acid, and the antigen purity height can be inoculated the protective immune response that body produces infection with Japanese ence phalitis Viruses by rapid induction.Be used for the immunoprophylaxis of people and susceptible animal, prevent the generation of Japanese encephalitis safely, efficiently Japanese encephalitis.
Technical scheme
The invention provides a kind of virus sample particle vaccines that is used to prevent Japanese encephalitis, the antigen composition of this vaccine is among the chimeric JEV and the virus-like particle of the autonomous assembling of the hepatitis B virus core antigen of epitope and CTL epitope, by bacterium coli solubility expression, purifying preparation.Japanese encephalitis virus sample particulate antigen with physiological saline suitably dilution or with the immunological adjuvant compatibility after make Japanese encephalitis particle vaccines of the present invention.
Beneficial effect
Rapid induction produces cause of disease specificity neutralizing antibody behind the Japanese encephalitis particle vaccines inoculation mouse; two exempt from the resistibility that the back mouse acquisition of 2 weeks is attacked the lethal dose japanese encephalitis virus; and demonstrate stronger immunological memory; cause of disease specificity neutralizing antibody level significantly raises, and 100% protection mouse is to the attack of the strong poison of Japanese encephalitis.
Description of drawings
Fig. 1. expression vector PET-28a-VLP-con makes up synoptic diagram
Fig. 2. expression vector PET-28a-VLP-JEV makes up synoptic diagram
Fig. 3. HBV cAg (A:VLP-con) electromicroscopic photograph (* 150,000 times)
Virus-like particle (B:VLP-JEV) electromicroscopic photograph (* 150,000 times) of Fig. 4 chimeric expression japanese encephalitis virus epitope antigen
Fig. 5. the Japanese ence phalitis Viruses EDIII protein antibodies level that Japanese encephalitis particle vaccines inoculation mouse produces
Fig. 6. the Japanese ence phalitis Viruses antibody horizontal that Japanese encephalitis particle vaccines inoculation mouse produces
Fig. 7. the neutralizing antibody level that Japanese encephalitis particle vaccines inoculation mouse produces
Fig. 8. the Japanese encephalitis particle vaccines is inoculated the malicious protection situation of attacking of mouse.
Embodiment
Experimental technique that this embodiment relates to or step are with reference to " molecular cloning experiment guide " (second edition) 1 ~ 60 page, 672 ~ 681 pages and 822 ~ 847 pages.
One, the structure of hepatitis B virus core antigen skelemin (HBc-con) prokaryotic expression carrier PET28a-VLP-Con
With reference to synthetic hepatitis B virus core antigen skelemin (HBc-con) encoding gene (its nucleotides sequence is classified Seq NO.3 as) of the artificial design of hepatitis B virus gene sequence (AY707087.1) in the GenBank database.Compare with the encoding gene of hepatitis B virus core antigen 1-149Aa, the HBc-con encoding gene has 2 artificial constructed restriction enzyme site BamH I and EcoR I at 231 and 238, and HBc-con inserts four amino acid PEFS at the 78th of HBc and 79 Aa; Add Nco I and Xho I site respectively at the two ends of hepatitis B virus core antigen skelemin (HBc-con) encoding gene, so that hepatitis B virus core antigen skelemin (HBc-con) encoding gene imports the PET-28a carrier; Hepatitis B virus core antigen skelemin (HBc-con) encoding gene is not with terminator codon, so that utilize the his label in PET-28a expression cassette downstream.Hepatitis B virus core antigen skelemin (HBc-con) encoding gene imports PET-28a through Nco I and Xho I site, obtain hepatitis B virus core antigen skelemin (HBc-con) prokaryotic expression carrier, called after PET28a-VLP-Con, sequencing result show consistent with design.
Two, the structure of virus-like particle antigen (VLP-JEV) the prokaryotic expression carrier PET28a-VLP-JEV of chimeric japanese encephalitis virus epitope
Design three pairs of primers, by recombinant PCR method, enzyme cut with the method that is connected respectively with in two on the japanese encephalitis virus E albumen and epitope and a CTL epitope import the HBc skelemin.In two and epitope "
327 SYSGSDGPCKI 337 " [Wu S-C, Lin C-W. Neutralizing peptide ligands selected from phage-displayed libraries mimic the conformational epitope on domain III of the Japanese encephalitis virus envelope protein. Virus Res 2001; 76:59-69.] and "
384 VVGRGDKQI 392 " [Seif; S. A.; Morita; K.; Matsuo; S., Hasebe, F. and Igarashi, A., Finer mapping of neutralizing epitope (s) on the C-terminal of Japanese encephalitis virus E-protein expressed in recombinant Escherichia coli system. Vaccine 1995. 13:1515-1521.] be illustrated in spike district in the middle of the antigen of HBc, promptly between the 78th and 79 Aa of HBc, the CTL epitope "
60 CYHASVTDI 68 " [Takada; K.; Masaki; H., Konishi, E.; Takahashi; M. and Kurane, I., Definition of an epitope on Japanese encephalitis virus (JEV) envelope protein recognized by JEV-specific murine CD8+ cytotoxic T lymphocytes.
Arch Virol2000. 145:523-534.] insert the C latter end of HBc.
P1:5`-CGAT
CCATGGACATTGACCCTT-3` Nco I sees seq NO.4
P2:5`-TCT
GGATCCTCGATTTTGCACGGGCCATCGCTGCCGCTATAGCTCAAGTTATTACCCAC-3` BamH I sees seq NO.5
P3:5`-ATA
GAATTCGTGGTGGGCCGTGGCGATAAACAGATCTCCCCAGCATCTAGG-3` EcoR I sees seq NO6
P4:5`-CAA
CTCGAGAACCACAGTAGTTTCC-3` Xho I sees seq NO.7
P5:5`-CGAT
CCATGGACATTGACCCTT-3` Nco I sees seq NO.8
P6:5`-CAA
CTCGAGGATATCGGTCACGCTCGCATGATAGCAAACCACAGTAGTTTCC-3` Xho I sees seq NO.9
P1 and P2 introduce among the JEV and epitope "
327SYSGSDGPCKI
337"; See seq NO.10
P3 and P4 introduce among the JEV and epitope "
384VVGRGDKQI
392"; See seq NO11
P5 and P6 introducing JEV CTL epitope "
60CYHASVTDI
68".See seq NO.12.
The condition of described PCR is 94 ℃, 5min; 94 ℃, 30sec, 50 ℃, 30sec, 72 ℃, 30sec, 30 circulations; 72 ℃, 7 min.
Recombination imports PET-28a through Nco I and Xho I site, obtains virus-like particle antigen (VLP-JEV) prokaryotic expression carrier of chimeric japanese encephalitis virus epitope, and called after PET28a-VLP-JEV is correct through sequence verification.
Three, solubility expression and the purifying of Japanese encephalitis particulate antigen in intestinal bacteria
With PET28a-VLP-Con and PET28a-VLP-JEV transformed into escherichia coli (BL21 DE3), with positive strain in the LB substratum 37 ℃ to be cultured to bacterial concentration be OD600 ≈ 0.4, in 18 ~ 20 ℃ of environment, be 0.1mM isopropylthiogalactoside (IPTG) abduction delivering 12h ~ 15h then with final concentration.Centrifugal collection thalline, ultrasonic treatment, with intestinal bacteria lysate supernatant 12000rpm after centrifugal 30 minutes, with final concentration is that 0.22 μ m filters behind 20% ammonium sulphate precipitation particulate antigen, the physiological saline solution, use Sepharose CL-4B sieve chromatography purifying, obtain particulate antigen, its aminoacid sequence is that Seq NO.1, nucleotides sequence are classified Seq NO.2 as.HBc-con and VLP-JEV can express by highly-soluble in intestinal bacteria, and independently are assembled into virus-like particle (Fig. 1)
Four, Japanese encephalitis particle vaccines mouse immune protection test
Testing program
6 age in week BALB/C mice, be divided into 5 groups, 5 every group, respectively VLP-Con, VLP-JEV and the ISA206 adjuvant emulsion VLP-JEV of the dilution of immunization physiological saline, the particulate antigen content of every mouse immune is 50 μ g; The commercially available vaccine control group is that pig is used Japanese encephalitis attenuated vaccine (veterinary biological product company limited before the section of Wuhan), and every mouse inoculation 1/10 pig is used dosage; Every mouse inoculation of blank 100 μ L physiological saline.Head exempts from back 2 all booster immunizations once, and each is organized vaccine kind and dosage and just exempts from identical.Two exempt from back 2 all immune mouses counts lethal dose (LD with 10 sesquialters
50) (the JEV NJ08 strain) intracranial inoculation of the strong poison of Japanese encephalitis attack poison, observed for 3 weeks.Before the immunization, head exempts from the back and exempts from 1 week of back 1 week, two and attack 1 week of poison back eye socket venous blood collection respectively, separation of serum detects antibody.It is envelope antigen that the ELISA detection of antibodies adopts the reorganization ED3 albumen of purifying.The detection of neutralizing antibody adopts virus (JEV SA14-14-2) plaque to reduce test, virus plaque is reduced 50% maximum serum dilution factor and is defined as NAT, gets 3 sample determinations for every group.
Test-results
ELISA antibody
The Japanese encephalitis particle vaccines immune mouse of the Japanese encephalitis particle vaccines of no adjuvant and compatibility ISA206 adjuvant has all produced the antibody response (Fig. 2 and Fig. 3) at recombination Japanese encephalitis ED3 antigen and japanese encephalitis virus.1 week behind the initial immunization, the antibody against Japanese encephalitis level that the Japanese encephalitis particle vaccines group mouse of the no adjuvant of immunity produces a little more than with the Japanese encephalitis particle vaccines of ISA206 adjuvant, but two exempt from afterwards that 1 all adjuvant group antibody against Japanese encephalitis levels are higher than no adjuvant group.It is close with the Japanese encephalitis commercialized vaccine at the antigenic antibody horizontal of ED3 that Japanese encephalitis particle vaccines immune mouse produces, but the antibody horizontal particle vaccines at totivirus is lower than commercialized vaccine, infers that there is other dominance epitope in japanese encephalitis virus.
Neutralizing antibody
Inoculation Japanese encephalitis particle vaccines and commercialization attenuated vaccine mouse have all produced japanese encephalitis virus neutralizing antibody (Fig. 4), two NATs of exempting from the Japanese encephalitis particle vaccines immune mouse of back 1 week application ISA206 adjuvant are 1:40, close with commercialized vaccine, the neutralizing antibody of no adjuvant Japanese encephalitis particle vaccines group mouse is low slightly, is 1:20.Japanese encephalitis particle vaccines inoculation mouse all is significantly increased attacking poison back viral special neutralizing antibody level of one week, shows that the Japanese encephalitis particle vaccines can induce stronger immunological memory reaction.
Attack the poison protection
Mouse is attacked malicious protection test result (Fig. 5) and shows that inoculation ISA206 adjuvant Japanese encephalitis particle vaccines and commercialization attenuated vaccine mouse are with 10 times of LD
50The strong poison of japanese encephalitis virus (JEV NJ08 strain) all do not have death, 100% immunoprotection after attacking poison; The survival rate of no adjuvant Japanese encephalitis particle vaccines immune group mouse is 70%; The particulate antigen group mouse that inoculates no Japanese encephalitis epitope is all dead.The Japanese encephalitis particle vaccines can produce good immune protection by inducing mouse; the immune protective effect that adds ISA206 adjuvant Japanese encephalitis particle vaccines is better than not having adjuvant Japanese encephalitis particle vaccines; similar to the commercialization attenuated vaccine, inductive Japanese encephalitis specificity neutralizing antibody level is more consistent after this and the vaccine inoculation.
SEQUENCE?LISTING
＜110〉Agricultural University Of Nanjing
＜120〉a kind of Japanese encephalitis particle vaccines and its production and application
<130>
<160> 12
<170> PatentIn?version?3.3
<210> 1
<211> 190
<212> PRT
＜213〉artificial sequence
<400> 1
Met?Asp?Ile?Asp?Pro?Tyr?Lys?Glu?Phe?Gly?Ala?Thr?Val?Glu?Leu?Leu
1 5 10 15
Ser?Phe?Leu?Pro?Ser?Asp?Phe?Phe?Pro?Ser?Val?Arg?Asp?Leu?Leu?Asp
20 25 30
Thr?Ala?Ser?Ala?Leu?Tyr?Arg?Glu?Ala?Leu?Glu?Ser?Pro?Glu?His?Cys
35 40 45
Ser?Pro?His?His?Thr?Ala?Leu?Arg?Gln?Ala?Ile?Leu?Cys?Trp?Gly?Glu
50 55 60
Leu?Met?Thr?Leu?Ala?Thr?Trp?Val?Gly?Asn?Asn?Leu?Ser?Tyr?Ser?Gly
65 70 75 80
Ser?Asp?Gly?Pro?Cys?Lys?Ile?Glu?Asp?Pro?Glu?Phe?Val?Val?Gly?Arg
85 90 95
Gly?Asp?Lys?Gln?Ile?Ser?Pro?Ala?Ser?Arg?Asp?Leu?Val?Val?Asn?Tyr
100 105 110
Val?Asn?Thr?Asn?Met?Gly?Leu?Lys?Ile?Arg?Gln?Leu?Leu?Trp?Phe?His
115 120 125
Ile?Ser?Cys?Leu?Thr?Phe?Gly?Arg?Glu?Thr?Val?Leu?Glu?Tyr?Leu?Val
130 135 140
Ser?Phe?Gly?Val?Trp?Ile?Arg?Thr?Pro?Pro?Ala?Tyr?Arg?Pro?Pro?Asn
145 150 155 160
Ala?Pro?Ile?Leu?Ser?Thr?Leu?Pro?Glu?Thr?Thr?Val?Val?Cys?Tyr?His
165 170 175
Ala?Ser?Val?Thr?Asp?Ile?Leu?Glu?His?His?His?His?His?His
180 185 190
<210> 2
<211> 573
<212> DNA
＜213〉artificial sequence
<400> 2
atggacattg?acccttataa?agaatttgga?gctactgtgg?agttactctc?gtttttgcct 60
tctgactttt?ttccttccgt?cagagatctc?ctagacaccg?cctcagctct?gtatcgggaa 120
gccttagagt?ctcctgagca?ttgctcacct?caccatactg?cactcaggca?agcaattctc 180
tgctgggggg?aattgatgac?tctagctacc?tgggtgggta?ataacttgag?ctatagcggc 240
agcgatggcc?cgtgcaaaat?cgaggatcca?gaattcgtgg?tgggccgtgg?cgataaacag 300
atctccccag?catctaggga?tctagtagtc?aattatgtta?atactaacat?gggtttaaag 360
atcaggcaac?tattgtggtt?tcatatatct?tgccttactt?ttggaagaga?gactgtactt 420
gaatatttgg?tctctttcgg?agtgtggatt?cgcactcctc?cagcctatag?accaccgaat 480
gcccctatct?tatcaacact?tccggaaact?actgtggttt?gctatcatgc?gagcgtgacc 540
gatatcctcg?agcaccacca?ccaccaccac?tga 573
<210> 3
<211> 471
<212> DNA
＜213〉artificial sequence
<400> 3
taccatggac?attgaccctt?ataaagaatt?tggagctact?gtggagttac?tctcgttttt 60
gccttctgac?ttttttcctt?ccgtcagaga?tctcctagac?accgcctcag?ctctgtatcg 120
ggaagcctta?gagtctcctg?agcattgctc?acctcaccat?actgcactca?ggcaagcaat 180
tctctgctgg?ggggaattga?tgactctagc?tacctgggtg?ggtaataact?tggaggatcc 240
agaattctcc?ccagcatcta?gggatctagt?agtcaattat?gttaatacta?acatgggttt 300
aaagatcagg?caactattgt?ggtttcatat?atcttgcctt?acttttggaa?gagagactgt 360
acttgaatat?ttggtctctt?tcggagtgtg?gattcgcact?cctccagcct?atagaccacc 420
aaatgcccct?atcttatcaa?cacttccgga?aactactgtg?gttctcgagc?a 471
<210> 4
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 4
cgatccatgg?acattgaccc?tt 22
<210> 5
<211> 59
<212> DNA
＜213〉artificial sequence
<400> 5
tctggatcct?cgattttgca?cgggccatcg?ctgccgctat?agctcaagtt?attacccac 59
<210> 6
<211> 51
<212> DNA
＜213〉artificial sequence
<400> 6
atagaattcg?tggtgggccg?tggcgataaa?cagatctccc?cagcatctag?g 51
<210> 7
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 7
caactcgaga?accacagtag?tttcc 25
<210> 8
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 8
cgatccatgg?acattgaccc?tt 22
<210> 9
<211> 52
<212> DNA
＜213〉artificial sequence
<400> 9
caactcgagg?atatcggtca?cgctcgcatg?atagcaaacc?acagtagttt?cc 52
<210> 10
<211> 11
<212> PRT
＜213〉artificial sequence
<400> 10
Ser?Tyr?Ser?Gly?Ser?Asp?Gly?Pro?Cys?Lys?Ile
1 5 10
<210> 11
<211> 9
<212> PRT
＜213〉artificial sequence
<400> 11
Val?Val?Gly?Arg?Gly?Asp?Lys?Gln?Ile
1 5
<210> 12
<211> 9
<212> PRT
＜213〉artificial sequence
<400> 12
Cys?Tyr?His?Ala?Ser?Val?Thr?Asp?Ile
1 5
Claims (5)
1. a Japanese encephalitis particle vaccines is characterized in that its propylhomoserin acid sequence is Seq NO.1.
2. Japanese encephalitis particle vaccines is characterized in that its nucleotides sequence classifies SeqNO.2 as.
3. the preparation method of a Japanese encephalitis particle vaccines, it is characterized in that by in two of the japanese encephalitis viruses and epitope and CTL epitope prepare by middle spike district and the C latter end that gene recombination technology is illustrated in hepatitis B virus core antigen 1-149Aa respectively;
Its concrete steps are as follows:
(1) method by recombinant PCR or full method for synthesizing gene with in the japanese encephalitis virus envelope protein and epitope "
327SYSGSDGPCKI
337" and "
384VVGRGDKQI
392" encoding gene insert between the 78th and 79 Aa in middle spike district of hepatitis B virus core antigen 1-149Aa, with the CTL epitope of japanese encephalitis virus envelope protein "
60CYHASVTDI
68" encoding gene insert hepatitis B virus core antigen 1-149Aa encoding gene C latter end;
(2) said gene is inserted prokaryotic expression carrier, and transformed into escherichia coli, abduction delivering is identified the recombinant protein that obtains the japanese encephalitis virus epitope by westen-Blot, identifies that by the electron microscopic observation of intestinal bacteria cracking supernatant antigen expressed forms virus-like particle;
(3) 20 ℃ of inducing culture of positive strain are 16 ~ 18 hours, and centrifugal collection thalline is 10g/L with the physiological saline dilution; The broken thalline of ultrasonic treatment, 12000rpm collected supernatant liquor in centrifugal 10 minutes; With concentration is 20% ammonium sulphate precipitation albumen, with the PBS dissolution precipitation of 0.01M pH7.2, uses Sepharose CL-4B chromatography column purified virus sample particulate antigen behind the 0.22 μ m membrane filtration, and its aminoacid sequence is Seq NO.1.
4. the preparation method of a kind of Japanese encephalitis particle vaccines according to claim 3, the hepatitis B virus core antigen that it is characterized in that described chimeric Japanese encephalitis epitope can spontaneous formation virus-like particles during the low temperature solubility expression in intestinal bacteria.
5. the application of a Japanese encephalitis particle vaccines, it is characterized in that with the Japanese encephalitis particle vaccines with the dilution of an amount of physiological saline or with the immunological adjuvant compatibility, be used for the immunoprophylaxis of people or susceptible animal Japanese encephalitis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105996877A CN102127554B (en) | 2010-12-22 | 2010-12-22 | Japanese encephalitis particle vaccine and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105996877A CN102127554B (en) | 2010-12-22 | 2010-12-22 | Japanese encephalitis particle vaccine and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102127554A true CN102127554A (en) | 2011-07-20 |
| CN102127554B CN102127554B (en) | 2012-07-25 |
Family
ID=44265828
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105996877A Expired - Fee Related CN102127554B (en) | 2010-12-22 | 2010-12-22 | Japanese encephalitis particle vaccine and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102127554B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102357246A (en) * | 2011-11-02 | 2012-02-22 | 江苏省中医药研究院 | EGFR and HER2 combined polypeptide epitope vaccine |
| CN105688202A (en) * | 2016-03-03 | 2016-06-22 | 四川农业大学 | Japanese encephalitis (JE) vaccine composition and preparing method thereof |
| WO2017032303A1 (en) * | 2015-08-25 | 2017-03-02 | 厦门大学 | Polypeptide carrier for presenting target polypeptide and uses thereof |
| US10987418B2 (en) | 2017-02-17 | 2021-04-27 | Xiamen University | Polypeptide carrier for presenting target polypeptide and uses thereof |
| KR20220021007A (en) * | 2013-08-28 | 2022-02-21 | 애피바디 에이비 | Binding polypeptides having a mutated scaffold |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1609204A (en) * | 2003-03-20 | 2005-04-27 | 上海天甲生物医药有限公司 | Bivalent hepatitis B-encephalitis B vaccine |
| CN101899466A (en) * | 2010-06-29 | 2010-12-01 | 中国人民解放军第三军医大学 | Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof |
-
2010
- 2010-12-22 CN CN2010105996877A patent/CN102127554B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1609204A (en) * | 2003-03-20 | 2005-04-27 | 上海天甲生物医药有限公司 | Bivalent hepatitis B-encephalitis B vaccine |
| CN101899466A (en) * | 2010-06-29 | 2010-12-01 | 中国人民解放军第三军医大学 | Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 《中国人兽共患病杂志》 20020630 吴玉水 日本脑炎病毒DNA疫苗和基因工程亚单位颗粒疫苗的动物保护实验研究 p3-6 1-5 第18卷, 第6期 2 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102357246A (en) * | 2011-11-02 | 2012-02-22 | 江苏省中医药研究院 | EGFR and HER2 combined polypeptide epitope vaccine |
| KR20220021007A (en) * | 2013-08-28 | 2022-02-21 | 애피바디 에이비 | Binding polypeptides having a mutated scaffold |
| KR102497083B1 (en) | 2013-08-28 | 2023-02-07 | 애피바디 에이비 | Binding polypeptides having a mutated scaffold |
| WO2017032303A1 (en) * | 2015-08-25 | 2017-03-02 | 厦门大学 | Polypeptide carrier for presenting target polypeptide and uses thereof |
| KR20180038557A (en) * | 2015-08-25 | 2018-04-16 | 시아먼 유니버시티 | Polypeptide carriers and their uses for presenting target polypeptides |
| EP3342866A4 (en) * | 2015-08-25 | 2019-02-27 | Xiamen University | Polypeptide carrier for presenting target polypeptide and uses thereof |
| AU2016313660B2 (en) * | 2015-08-25 | 2019-11-07 | Xiamen University | Polypeptide carrier for presenting target polypeptide and uses thereof |
| US10548973B2 (en) | 2015-08-25 | 2020-02-04 | Xiamen University | Polypeptide carrier for presenting target polypeptide and uses thereof |
| KR102116320B1 (en) * | 2015-08-25 | 2020-05-29 | 시아먼 유니버시티 | Polypeptide carriers and uses thereof for presenting target polypeptides |
| CN105688202A (en) * | 2016-03-03 | 2016-06-22 | 四川农业大学 | Japanese encephalitis (JE) vaccine composition and preparing method thereof |
| CN105688202B (en) * | 2016-03-03 | 2019-07-19 | 四川农业大学 | A kind of Vaccinum Encephalitis B composition and preparation method thereof |
| US10987418B2 (en) | 2017-02-17 | 2021-04-27 | Xiamen University | Polypeptide carrier for presenting target polypeptide and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102127554B (en) | 2012-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Denis et al. | Immunogenicity of papaya mosaic virus-like particles fused to a hepatitis C virus epitope: evidence for the critical function of multimerization | |
| CN108624601B (en) | Yeast-expressed coxsackievirus A10 virus-like particle and application thereof | |
| KR101608121B1 (en) | Method for Preparing Virus Like Particle of Nodavirus, Yeast Strain producing the Same and Vaccine Composition Comprising the Same | |
| CN102127554B (en) | Japanese encephalitis particle vaccine and preparation method and application thereof | |
| CN101646772A (en) | Papaya mosaic virus-based vaccines against salmonella typhi and other enterobacterial pathogens | |
| CN112679584B (en) | Swine fever epitope peptide and application thereof | |
| CA2434000A1 (en) | Adjuvant viral particle | |
| CN104873967A (en) | O type foot and mouth disease virus-like particle vaccine as well as preparation method and application thereof | |
| CN108823218A (en) | Chicken infectivity bursa of Fabricius virus VP 2 gene, its expression product, its subunit vaccine and application | |
| WO2005105834A1 (en) | Method for the production of empty viral capsids in yeasts, said capsids comprising proteins derived from pvp2 of the virus that causes infectious bursal disease (ibdv) | |
| Lei et al. | Artificially designed hepatitis B virus core particles composed of multiple epitopes of type A and O foot‐and‐mouth disease virus as a bivalent vaccine candidate | |
| CN109136198A (en) | A kind of expression Chicken Infectious Anemia Virus VP1, VP2 genetic recombination bird pox virus live vector vaccine | |
| Crisci et al. | Chimeric calicivirus-like particles elicit protective anti-viral cytotoxic responses without adjuvant | |
| JP7303306B2 (en) | Foot-and-mouth disease virus-like particle antigen, vaccine composition thereof, preparation method and application | |
| CN113862284A (en) | Gene for coding recombinant avian influenza virus HA protein, virus-like particle, vaccine, preparation and application | |
| WO2023207717A1 (en) | Development and use of broad-spectrum vaccine for h5n8 avian influenza | |
| CN109776657A (en) | Recombinate norovirus VLP particle and preparation method and its usage | |
| JP2023520803A (en) | Foot-and-mouth disease virus-like particle antigen, its vaccine composition, preparation method and use | |
| Li et al. | Development and characterization of Rift Valley fever virus-like particles | |
| KR102365464B1 (en) | Development of recombinant subunit Zika virus vaccine and preparing method thereof | |
| KR102451412B1 (en) | Novel immunopotent recombinant protein with simultaneous induction of cellular and humoral immune responses and broad spectrum of protective efficacy, and foot-and-mouth disease (FMD) vaccine composition comprising the same | |
| WO2023023591A1 (en) | Development of mosaic vaccines against foot and mouth disease virus serotype o | |
| CN115044562A (en) | Recombinant rabies virus with chimeric expression molecular adjuvant and preparation method and application thereof | |
| CN108624611A (en) | The preparation and its application of infectious bursa of Fabricius virus virus-like particle | |
| CN107974458A (en) | Express gene gapdh and its recombination bacillus coli and the application of bacillus rhusiopathiae suis recombinant protein GAPDH |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120725 Termination date: 20131222 |