KR20200113476A - New compound and medicinal composition for preventing or treating cancer including the same - Google Patents

Abstract

The present invention relates to a compound of chemical formula 1 or a pharmaceutically acceptable salt thereof, and to a medical composition for preventing or treating cancer including the same. The compound exhibits an apoptosis effect against various cancer cell lines, shows excellent anticancer activity, and has little toxicity to normal cells, and thus can be utilized as an anticancer agent with little side effects.

Description

A novel compound and a pharmaceutical composition for preventing or treating cancer containing the same {NEW COMPOUND AND MEDICINAL COMPOSITION FOR PREVENTING OR TREATING CANCER INCLUDING THE SAME}

The present invention relates to a novel compound and a pharmaceutical composition for preventing or treating cancer comprising the same.

Cancer has a high mortality rate worldwide, and is the most common cause of death after cardiovascular disease in Western society. In particular, lung cancer is increasing due to an increase in the smoking population and air pollution along with the aging of the population, and the consumption of high-fat diet is generalized due to the westernization of diet, and colon cancer and breast cancer due to a rapid increase in environmental pollutants and an increase in alcohol consumption. , Prostate cancer, etc. are on a continuous increase. In this situation, the creation of anticancer substances that can contribute to the promotion of human health, improvement of healthy quality of life, and improvement of human health by enabling early prevention and treatment of cancer is urgently required.

On the other hand, the treatment method for cancer is to remove the cancer tissue from the body at the cellular level. Current cancer treatment methods are divided into surgical therapy, radiation therapy, and chemotherapy. Surgical therapy is to remove cancer from the body at the tissue level, and it is most reasonable, but at the cell level, it is difficult to completely remove microscopic lesions that infiltrate the surrounding tissues or metastasize to the lymph glands. Therefore, surgical treatment is very effective for early cancer or cancer (cancer with stage 1 or stage 2) in which the lesion is limited, but in case of advanced stage 3 cancer, radiation therapy or chemotherapy is used as well as surgery. It is necessary to use it together.

Radiotherapy and chemotherapy are mainly used for advanced or terminal cancer after stage 3, but in laryngeal cancer and cervical cancer, even stage 1 cancer is cured only by radiation therapy, so radiation therapy is the first priority. In particular, in laryngeal cancer, in order to preserve the function of the vocal cords, only radiation therapy is performed in stage 1, and partial surgery or chemotherapy can be used in combination with radiation therapy in stage 2. In addition, among lung cancer, small cell cancer has a poor prognosis even if it has been surgically treated. Now, chemotherapy is given priority and radiation is often used in combination. In recent years, this therapy has been able to slightly increase the 5-year survival rate. As described above, it is difficult to say that any cancer treatment is safe except for early cancer, and all of the above-described surgical therapy, radiation therapy, and chemotherapy also affect normal cells, causing serious side effects.

Therefore, there is a need for an alternative cancer treatment method that is safer and has a high therapeutic effect.

Korean Patent Registration No. 1538264

An object of the present invention is to provide a novel compound.

An object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer that can induce specific death of cancer cells.

1. A compound of formula 1 or a pharmaceutically acceptable salt thereof:

[Formula 1]

.

.

2. A pharmaceutical composition for preventing or treating cancer containing the compound of 1 or a salt thereof.

3. The composition of the above 2, wherein the cancer is at least one selected from the group consisting of glioma, neuroblastoma, pancreatic cancer, prostate cancer, breast cancer, thyroid cancer, kidney cancer, colon cancer, liver cancer and ovarian cancer.

4. In the above 2, the composition is a composition for human administration.

The composition of the present invention exhibits anti-cancer activity against various cancer cell lines.

The composition of the present invention has very little toxicity to normal cells.

1 to 3 show the anticancer activity of the compound of Formula 1 against various cancer cell lines.
4 shows the toxicity of the compound of Formula 1 to normal cells.
5 is an HPLC peak of the compound of Formula 1.
6 is an LC-MS analysis result of the compound of Formula 1.
7 is a ¹ H NMR analysis result of the compound of Formula 1.
8 is a ¹³ C NMR analysis result of the compound of Formula 1.
9 is a summary of the results of NMR analysis of the compound of Formula 1.

The present invention relates to a novel compound or a pharmaceutically acceptable salt thereof.

The novel compound of the present invention may be represented by the following formula (1).

[Formula 1]

.

.

The compound of Formula 1 may exhibit excellent anti-cancer activity against various cancer cell lines, and particularly has low toxicity to normal cells, and thus may be preferably used as a cancer cell-specific anti-cancer agent.

The compound of Formula 1 may be prepared, for example, by acetylating the compound of Formula 2 below.

[Formula 2]

.

.

Acetylation may be performed using acetyl transferase as a catalyst, and as a specific example, a protein consisting of the amino acid sequence of SEQ ID NO: 1 may be used, but is not limited thereto.

The gene encoding the amino acid sequence of SEQ ID NO: 1 may be composed of, for example, the nucleotide sequence of SEQ ID NO: 2.

When using acetyl transferase, for example, a C16 hydroxy group may be substituted with an acetyl group to prepare the compound of Formula 1.

The compound of Formula 2 may be obtained from, for example, watermelon ( Citrullus lanatus ), but is not limited thereto.

"Pharmaceutically acceptable salts" in the present invention include salts of the active compounds prepared with relatively non-toxic acids and bases depending on the specific substituents found in the compounds mentioned herein. When the compounds of the present invention contain relatively acidic functionality, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, pure or suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino or magnesium salts or similar salts. When the compounds of the present invention contain relatively basic functionality, acidic addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, pure or suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include acetic acid, propionic acid, isobutyl acid, oxalic acid, maleic, malonic, benzoic acid, succinic acid, suberic, fumaric acid. ), mandelic, phthalic, benzenesulfonic, p-tolylsulfonic, citric acid, tartaric acid, methanesulfonic, and their analogues. Hydrogen chloride, hydrogen bromide, nitric acid, carbonic acid, monohydrogencarbonic, phosphoric, monohydrogen phosphoric acid, dihydrogenphosphate, sulfuric acid, monohydrosulfuric acid, hydrogen iodide or phosphorous acid, as well as salts derived from toxic organic acids. acid) and analogues thereof. It also includes salts of amino acids such as alginate and their analogs, and analogs of organic acids such as glucuronic or galactunoric acids and their analogs (e.g., Berge et al. (1977). ) J. Pharm. Sci. 66: 1-19). Some specific compounds of the present invention have both basic and acidic functionality that allows the compounds to be converted into basic or acidic addition salts. Other examples of salts are in the literature known in the field to which the present invention pertains, for example Remington's Pharmaceutical Sciences, 8theds. Mack Publishing, Easton PA (1990) or Remington: The Science and Practice of Pharmacy, 19th eds., Mack Publishing, Easton PA (1995).

The present invention relates to a pharmaceutical composition for preventing or treating cancer.

The pharmaceutical composition of the present invention includes the compound of Formula 1 or a pharmaceutically acceptable salt thereof.

Cancer to be prevented or treated by the composition of the present invention may be any cancer known in the art, for example, lung cancer (including small cell lung cancer and non-small cell lung cancer), colon cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, Hematologic cancer, leukemia, myeloid leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma, pancreatic cancer, gastric cancer, liver cancer, kidney cancer, gallbladder cancer, biliary tract cancer, esophageal cancer, Ovarian cancer, neuroblastoma, glioma, thyroid cancer, including cancer (cancer), tumorigenesis (neoplasia), or tumor (tumor), specifically glioma, neuroblastoma, pancreatic cancer, prostate cancer , Breast cancer, thyroid cancer, kidney cancer, colon cancer, liver cancer, ovarian cancer, and the like.

Suitable individuals to be treated according to the compositions of the present invention include mammalian individuals. Mammals according to the present invention are, but are not limited to, humans, canines, felines, bovines, goats, horses, sheep, and pigs. Includes (porcine), rodents, lagomorphs, primates, etc., includes mammals in utero, and may be specifically human. An individual can be of both sexes and can be any stage of development.

The compounds according to the present invention can be administered in the form of a pharmaceutical composition suitable for this route by any suitable route, and in an effective dosage for the intended treatment. Effective dosages are generally about 0.001 to about 100 mg/kg body weight/day, preferably about 0.01 to about 30 mg/kg/day, in single or divided doses. Depending on the age, species, and disease or condition to be treated, dosage levels below the lower limit of this range may be suitable. In other cases, still larger dosages can be used without harmful side effects. Larger dosages can be divided into several smaller dosages, for administration throughout the day. Methods for determining an appropriate dosage are well known in the art to which the present invention pertains, for example, Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20th ed., 2000 can be used.

The compound according to the present invention or a pharmaceutically acceptable salt thereof may be administered as follows.

The compound according to the present invention can be administered orally, and the oral cavity is a concept including swallowing. By oral administration, the compounds of the present invention can enter the gastrointestinal tract or be absorbed directly from the mouth into the bloodstream, for example, buccal or sublingual administration.

Suitable compositions for oral administration may be in the form of solid, liquid, gel, or powder, and may have formulations such as tablets, lozenges, capsules, granules, powders, etc. .

Compositions for oral administration may optionally be enteric coated, and exhibit delayed or sustained release through enteric coating. That is, the composition for oral administration according to the present invention may be a formulation having an immediate or modified release pattern.

Liquid formulations may include solutions, syrups and suspensions, and such liquid compositions may be contained within soft or hard capsules. Such formulations may contain a pharmaceutically acceptable carrier, such as water, ethanol, polyethylene glycol, cellulose, or oil. The formulation may also contain one or more emulsifying and/or suspending agents.

In a tablet formulation, the amount of the active ingredient drug may be present in about 0.05% to about 95% by weight, more generally from about 2% to about 50% by weight of the formulation, based on the total weight of the tablet. In addition, the tablet may contain a disintegrant comprising from about 0.5% to about 35% by weight, more generally from about 2% to about 25% by weight of the formulation. Examples of the disintegrant may include lactose, starch, sodium starch glycolate, crospovidone, croscarmellose sodium, maltodextrin, or a mixture thereof, but is not limited thereto.

Suitable lubricants included to prepare tablets may be present in an amount of about 0.1% to about 5% by weight, such as talc, silicon dioxide, stearic acid, calcium, zinc or magnesium stearate, sodium stearyl fumarate, etc. Although it can be used as a lubricant, the present invention is not limited to the types of these additives.

Gelatin, polyethylene glycol, sugar, gum, starch, polyvinylpyrrolidone, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, etc. can be used as a binder for manufacturing tablets. And, as suitable diluents for preparing tablets, mannitol, xylitol, lactose, dextrose, sucrose, sorbitol, starch, microcrystalline cellulose, etc. may be used, but the present invention is not limited to the types of these additives. .

Optionally, the solubilizing agent that may be included in the tablet may be used in an amount of about 0.1% to about 3% by weight based on the total weight of the tablet, for example, polysorbate, sodium lauryl sulfate, sodium dodecyl sulfate, propylene carbonate, Diethylene glycol monoethyl ether, dimethylisosorbide, polyoxyethylene glycolated natural or hydrogenated castor oil, HCORTM (Nikkol), oleyl ester, GelucireTM, caprylic/caprylic acid mono/diglyceride , Sorbitan fatty acid ester, Solutol HSTM, etc. may be used in the pharmaceutical composition according to the present invention, but the present invention is not limited to the specific types of such solubilizing agents.

The compounds according to the present invention can be administered directly into the bloodstream, muscle, or intestines. Suitable methods for parenteral administration include intravenous, intra-muscular, subcutaneous intraarterial, intraperitoneal, intrathecal, intracranial injection, etc. Include. Suitable devices for parenteral administration include injectors (including needles and needleless syringes) and infusion methods.

Compositions for parenteral administration may be formulations having an immediate or modified release pattern, and the modified release pattern may be a delayed or sustained release pattern.

Most parenteral formulations are liquid compositions, and such liquid compositions are aqueous solutions containing the pharmaceutical ingredients, salts, buffers, isotonic agents, and the like according to the present invention.

Parenteral formulations can also be prepared in dried form (eg, lyophilized) or as sterile non-aqueous solutions. These formulations can be used with a suitable vehicle such as sterile water. Solubility-enhancing agents can also be used in the preparation of parenteral solutions.

The compounds according to the present invention can be administered topically, dermal or transdermally. Formulations for this topical administration include lotions, solutions, creams, gels, hydrogels, ointments, foams, implants, patches and the like. Pharmaceutically acceptable carriers for topical administration formulations may include water, alcohol, mineral oil, glycerin, polyethylene glycol, and the like. Local administration can also be performed by electroporation, iontophoresis, phonophoresis, and the like.

Compositions for topical administration may be formulations with an immediate or modified release pattern, and the modified release pattern may be a delayed or sustained release pattern.

A method of preparing a pharmaceutical composition for the appropriate treatment or prevention of a disease or condition is well known to those of ordinary skill in the field to which the present invention belongs. See, for example, Handbook of Pharmaceutical Excipients (7th ed.), Remington: The Science and Practice of Pharmacy (20th ed.), Encyclopedia of Pharmaceutical Technology (3rd ed.), Sustained and Controlled Release Drug Delivery Systems (1978), etc. Accordingly, a pharmaceutical composition for the purposes of the present invention can be prepared by appropriately mixing a pharmaceutically acceptable carrier, carrier, additives, and the like with the compound according to the present invention.

The compounds according to the invention may be used alone or in combination with other pharmaceutically active compounds for the prevention or treatment of cancer. The compound according to the invention and other pharmaceutically active compound(s) may be administered simultaneously (in the same formulation or in separate formulations) or sequentially.

The pharmaceutical composition of the present invention may further comprise one or more additional pharmaceutically active compounds other than the compound according to the present invention.

The one or more additional pharmaceutically active compounds are anticancer agents. For example, anticancer agents are EGFR kinase inhibitors, MEK inhibitors, VEGFR inhibitors, anti-VEGFR2 antibodies, KDR antibodies, AKT inhibitors, PDK-1 inhibitors, PI3K inhibitors, c-kit/Kdr tyrosine kinase inhibitors, Bcr-Abl tyrosine kinase inhibitors. , VEGFR2 inhibitor, PDGFR-beta inhibitor, KIT inhibitor, Flt3 tyrosine kinase inhibitor, PDGF receptor family inhibitor, Flt3 tyrosine kinase inhibitor, RET tyrosine kinase receptor family inhibitor (RET tyrosine kinase receptor family inhibitor), VEGF- 3 Receptor antagonists, Raf protein kinase family inhibitors, angiogenesis inhibitors, Erb2 inhibitors, mTOR inhibitors, IGF-1R antibodies, NFkB inhibitors, proteosome inhibitors, chemotherapy agents ), or a glucose reduction agent.

More specific examples include nitrogen mustard, chlorambucil, cyclophosphoamide (cytoxan), isopamide, melphalan, tiptepa, and busulfan. ) Alkylating agent; Methodrexate, 5-fluorouracil, cytoxin arabinoside (ara-C), 5-azacididine, 6-methcaptopurine, 6-thioguanine, and fludarabine phosphate ) Anti-metabolites; Todoxorubicin (adriamycin), daunorubicin, dactinomycin, bleomycin, mitomycin C, plicamycin, iidarubicin (idarubicin), and anticancer antibiotics including mitoxantrone; Vinca alkaloids and epidophiloxin agents including vincristine, vinblastine, vindesine, etoposide, and teniposide; Nitrosoureas including carmustine, lomustine, semustine and streptozocin; Synthetic drugs including dacrabazine, hexamethylmelamine, hydroxyurea, mitotan procabazine, cisplatin, cisplatinum, and carboplatin; Corticosteroids (cortisone acetate, hydrocortisone, prednisone, prednisolone, methyl prednisolone and dexamethasone), estrogens (diethylstibesterol, estradiol, esterified estrogens) Classes, conjugated estrogens, chlorotiasnene), progestins (medroxyprogesterone acetate, hydroxy progesterone caproate, megestrol acetate), antiestrogens (tamoxifen) ), aromastase inhibitors (aminoglutethimide), androgens (testosterone propionate, methyltestosterone, fluoxymesterone, testolactone), Liquid therapeutics including anti-androgens (flutamide), LHRH analogs (leuprolide acetide), and prostate cancer endocrines (ketoconazole) may be exemplified, but are limited thereto. It is not.

Hereinafter, examples will be described in detail to illustrate the present invention in detail.

Example

Preparation of compound

Cucurbitacin D (Chemical Formula 2) was obtained from watermelon ( Citullus lanatus ).

Specifically, watermelon leaves, stems, and root tissues were ground, followed by ultrasonic extraction and water bath extraction for 1 hour with 100% methanol extraction solvent. As for the extract, the solution layer was recovered and concentrated using centrifugation and a vacuum concentrator. The concentrated solution was fractionated from the eluted portion of cucurbitacin D using a C18 reverse phase column and an LC instrument. The fractionated eluate was dried using a seed vacuum concentrator and used in the present invention.

Total RNA was extracted from the watermelon (citrullus spp.) plant, and complementary DNA (cDNA) was prepared using oligo-dT prime and reverse transcription enzyme. Forward primer (base sequence: CAAATGGGTCGCGGATCCATGGGGACGATGAATTAC, SEQ ID NO: 4) containing the start codon of the ACT3 protein gene (SEQ ID NO: 2) and the BamH1 restriction enzyme nucleotide sequence (GGATCC, SEQ ID NO: 3) for cloning into a recombinant protein expression vector by infusion method The reverse primer (base sequence: GTGGTGGTGGTGCTCGAGATTGGCACTTGGGTTCAA, SEQ ID NO: 6) excluding the stop codon and the Xho1 restriction enzyme nucleotide sequence (base sequence: GTGGTGGTGGTGCTCGAGATTGGCACTTGGGTTCAA, SEQ ID NO: 6) was prepared by the polymerase chain reaction (PCR) method using pfu DNA polymerase. The ACT3 protein gene was amplified using the resulting cDNA as a template, and separated and purified by gel electrophoresis. The purified ACT3 protein gene fragment was cloned into a pET28a(+) recombinant protein expression vector by infusion cloning.

The ACT3 recombinant protein expression vector cloned to express the ACT3 recombinant protein was transformed into BL21a1, which is a protein expression E. coli, and then transformed into 1 mM IPTG (isopropyl β-D-1-thiogalactopyranoside) in LB (lysogeny broth) culture at 16°C at 180 rpm. By mixing to induce the expression of ACT3 protein.

BL21a1 cells were precipitated using a culture solution (2 liters) derived from ACT3 protein, and then suspended in a binding buffer (20mM sodium phosphate, 0.5M NaCl, pH7.4) and disrupted using a sonicator. After collecting the supernatant by centrifuging the crushed cell, combine the His-tagged ACT3 protein using Ni sepharoes and wash it with a binding buffer.Elution buffer (350~500mM imidazole, 20mM sodium phosphate, 0.5M NaCl, pH 7.4) ). The recovered ACT3 protein solution was concentrated using a 30KDa cut off centricon and exchanged with a storage buffer (10% glycerol, 50mM sodium phosphate, 0.1M sodium citrate, pH 7.4) and stored at -80°C.

ACT3 enzyme activity was confirmed using cucurbitacin D (CuD) standard. 200 μM of CuD, 400 μM of acetyl-CoA (aceryl coenzyme A), and 40 μg of ACT enzyme were added to the enzyme reaction buffer (50 mM sodium phosphate buffer, pH 7.4), followed by enzyme reaction at 30° C. for 1 hour, and the reaction solution was 100 Fractionated with% etyl acetate. The fractionated ethylacetate fraction solution was dried with a centrifugal vacuum concentrator, dissolved in 120 μl of 100% mehtanol, and used as a sample for analysis.

The results of the ACT3 enzyme reaction were analyzed for reactants using high performance liquid chromatography (HPLC). The retention time of the cucurbisatin D standard was checked. The reaction material was analyzed, and the material with the same retention time as the standard was set as the standard material (CuD), and the peak material of the other retention time was set as the enzyme reaction product (see FIG. 5). The conditions of HPLC used for the analysis of the enzyme reactant are shown in Table 1 below.

Condition equipment Pump, autosampler, UV detector (Shimadzu, Japan) column Syncronis C18, 250×4.6mn (Thermo Scientific, USA) Solvent condition A solvent: 100% acetonitrile, 0.1% formic acid
B solvent: water, 0.1% formic acid
Linear gradient:
30% A solvent, 70% B solvent (5min)
70% A solvent, 30% B solvent (20~30min)
30% A solvent, 70% B solvent (40~45min)
Flow rate: 1ml/min Detection wavelength 230nm

As a result of the analysis, it was found that peaks of retention times other than those of the same retention time as standard CuD were detected. LC-MS (liquid chromatography-mass spectrometry) analysis was performed to determine the molecular weight of the newly detected material (see FIG. 6). The conditions of LC-MS used for molecular weight analysis of the enzyme reactant are shown in Table 2 below.

Condition equipment ACQUITY UPLC system, SYNAPT G2-Si HDMS (Waters) Column Waters Acquity BEH C18 1.7 μm (2.1 x 100mm)
column temp.:40℃ Solvent condition A solvent: water, 0.1% formic acid
B solvent: 100% acetonitrile, 0.1% formic acid
Linear gradient:
95% A solvent, 5% B solvent (initial)
95% A solvent, 5% B solvent (2.5min)
30% A solvent, 70% B solvent (5.0min)
30% A solvent, 70% B solvent (9.0min)
0% A solvent, 100% B solvent (9.5min)
0% A solvent, 100% B solvent (10.5min)
95% A solvent, 5% B solvent (11min)
95% A solvent, 5% B solvent (12min)
Flow rate: 0.3ml/min Detection wavelength 230nm Mass spectrometry conditions Mode: ESI(-)
Capillary voltage: 2 kV
Source temp: 400 ^o C
Sampling cone: 10
Desolvation Gas Flow (L/hr): 900.0

As a result of LC-MS analysis, a mass [M-H+FA] value of 557.3110 of CuD, which is a substrate, was detected in the reaction product with the ACT3 protein using the standard CuD as a substrate, and an acetylated ranatusin mass value of 603.3157 was detected. In order to further find out the structure of lanatucin, through 1H-NMR (600 MHz, CD3OD, δH) and 13C-NMR (150 MHz, CD3OD, δC) structural analysis, the ACT3 enzyme in the present invention is C16 of CuD, which is a triterpenoids system. It was confirmed that ranatusin of Formula 1 was synthesized by acetylation at carbon position (FIGS. 7 to 9).

Anticancer activity evaluation

Cancer cell lines were obtained from ATCC (American Type Culture Collection). The types of cancer cell lines are shown in Table 3 below.

Cell line Origin Cell line Origin AsPC1 Pancreatic cancer BHT101 Thyroid cancer PANC-1 Pancreatic cancer CAK1 Kidney cancer BxPC3 Pancreatic cancer HT29 Colon cancer BE2C Neuroblastoma Huh-7 Liver cancer PC3 Prostate cancer MDA-MB231 Breast cancer T47D Breast cancer SKOV3 Ovary cancer BCPAP Thyroid cancer U87MG Glioma CAL62 Thyroid cancer BJ6 Human fibroblast cell

Each anticancer cell line was dispensed into a 96 well plate at a concentration of 5000 cells/well, pre-cultured in an incubator for 24 hours, and then treated with ranatusin at each concentration, and cultured in an incubator for 48 hours. After applying the CCK-8 assay method to the culture medium, the anticancer activity was evaluated by measuring the absorbance at 450 nm using a microplate reader.

1 to 3, it can be seen that the compound of Formula 1 exhibits anti-cancer activity against various cell lines of various carcinomas.

Normal cytotoxicity assessment

BJ6 (human fibroblasts) cells were used as normal cells, which were obtained from ATCC (American Type Culture Collection).

After dispensing a normal cell line at a concentration of 5000 cells/well in a 96 well plate, pre-culture in an incubator for 24 hours, and then treated with ranatusin and CuD (which is structurally most similar because carbon 16 is deacetylated and used as a control). Incubated in the incubator for hours. After applying the CCK-8 assay method to the culture medium, the anticancer activity was evaluated by measuring the absorbance at 450 nm using a microplate reader.

Referring to Figure 4, it can be seen that the compound of Formula 1 exhibits very low toxicity to BJ6 cells.

<110> SEJONG UNIVERSITY INDUSTRY ACADEMY COOPERATION FOUNDATION <120> NEW COMPOUND AND MEDICINAL COMPOSITION FOR PREVENTING OR TREATING CANCER INCLUDING THE SAME <130> 015 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 437 <212> PRT <213> Artificial Sequence <220> <223> acetyl transferase <400> 1 Met Gly Thr Met Asn Tyr Met Gln His Leu Gln Ile Val Ser Thr Glu 1 5 10 15 Thr Ile Lys Pro Ser Ser Pro Thr Pro Pro Asn Leu Asn Thr His Thr 20 25 30 Leu Ser Leu Phe Asp Gln Leu Ala Pro His Ile Phe Val Pro Leu Val 35 40 45 Phe Phe Phe Ser His His Gly His Gly Ser Gly Thr Cys Val Gln Leu 50 55 60 Leu Arg Arg Ser Leu Ser Met Thr Leu Ser Arg Tyr Tyr Pro Phe Ala 65 70 75 80 Gly Arg Ile Lys Asp Asn Val Ser Val Asp Cys Asn Asp Glu Gly Val 85 90 95 Thr Phe Val Glu Ala Arg Leu Glu Gly Val Thr Val Ser Glu Ile Leu 100 105 110 Glu Asn Pro Arg Ser Glu Ile Val Glu Val Leu Phe Val Asp Gly Leu 115 120 125 Gln Trp Lys Asp Ser Lys Ile Gly Ala Leu Leu Lys Val Gln Ile Thr 130 135 140 Phe Phe Glu Cys Gly Gly Leu Ser Ile Gly Val Met Leu Ser His Arg 145 150 155 160 Leu Gly Asp Leu Ala Thr Leu Val Lys Phe Val Lys Asp Trp Ala Val 165 170 175 Val Thr Arg Asn Ser Gly Phe Gly Glu Glu Ile Val Asn Pro Leu Phe 180 185 190 Asn Ser Ala Asp Leu Phe Pro His Gly Asp Leu Pro Ala Met Ser Gly 195 200 205 Ala Val Val Glu Glu Gly Asn Phe Thr Cys Lys Arg Phe Val Phe Glu 210 215 220 Gly Ser Lys Ile Val Ser Leu Lys Asn Arg Ile Ser Glu Lys Val Glu 225 230 235 240 Asn Pro Ser Arg Val Glu Val Val Ser Ala Leu Ile Tyr Lys Ala Ile 245 250 255 Ile Ser Ala Ser Arg Asn Ser Gln Asn His Pro Thr Leu Leu Leu Gln 260 265 270 Thr Leu Asn Leu Arg Lys Arg Val Ala Pro Pro Leu Pro Glu Ser Leu 275 280 285 Val Gly Ser Leu Val Ser Phe Phe Pro Val Gly Val Gly Gly Glu Arg 290 295 300 Glu Val Ile Glu Leu His Glu Leu Val Gly Thr Met Arg Lys Glu Met 305 310 315 320 Gly Glu Phe Cys Asn Lys Tyr Ala Lys Lys Tyr Arg Thr Lys Glu Trp 325 330 335 Pro Glu Leu Ile Lys Arg Arg Leu Asn Glu Ser Arg Glu Ile Leu Ser 340 345 350 Lys Asn Gly Asn Asn Gln Leu Val Tyr Arg Phe Ser Ser Gly Cys Asn 355 360 365 Phe Pro Ile Tyr Glu Val Asp Phe Gly Trp Gly Ala Ala Asp Trp Val 370 375 380 Thr Val Ala Ala Phe Lys Met Lys Asn Thr Val Met Met Leu Asp Ala 385 390 395 400 Lys Asn Gly Gly Gly Ile Glu Ala Leu Val Ser Leu Gln Asp His Glu 405 410 415 Met Ala Ala Phe Gln His Asn Gln Glu Leu Leu Ala Phe Ala Ser Leu 420 425 430 Asn Pro Ser Ala Asn 435 <210> 2 <211> 1314 <212> DNA <213> Artificial Sequence <220> <223> acetyl transferase <400> 2 atggggacga tgaattacat gcaacacctt caaattgttt caacagaaac cattaaacct 60 tcttctccaa ctcctccaaa tctcaacact cataccctct ccctcttcga tcagctagcc 120 ccccacattt tcgtgcctct cgtgttcttc ttctcccacc acggtcacgg ttcgggtact 180 tgcgtccaat tgcttcgacg atctctttct atgactctat ctcggtacta cccatttgcg 240 ggtaggatta aagacaacgt ctcggttgac tgtaacgatg agggggtgac ttttgtggag 300 gctcggctcg agggcgtgac ggtgtcggag attttggaaa accctagaag tgagattgtg 360 gaagtgttat ttgttgatgg gttgcaatgg aaagattcaa aaattggagc tttgttgaag 420 gttcaaataa cgttttttga atgtggagga ttgagcattg gagtgatgct gtctcacagg 480 cttggggatt tggcaacgtt agtgaagttc gtaaaagatt gggcagtcgt gactcgaaac 540 agcggttttg gggaagaaat tgtaaacccg ctttttaact ctgcggattt gttcccccac 600 ggcgacttac ccgccatgtc cggcgccgtg gttgaagaag gaaatttcac gtgcaagagg 660 ttcgtattcg aaggttcaaa gattgtatcc ctaaaaaata ggatttcaga gaaggtggag 720 aatccatctc gagtggaagt tgtgtcagca ttaatttaca aagccatcat ttcagcttcg 780 cgaaattccc aaaaccaccc cacactgttg ttacaaacac taaatttacg taaaagggtg 840 gcgccgccgc tgccggaaag tttagtggga agtttagtgt cattcttccc ggtgggtgtg 900 ggcggagaaa gagaagtaat agagctgcat gagttggtgg gtacaatgag aaaagaaatg 960 ggagagtttt gtaacaaata cgccaaaaag tacagaacaa aagagtggcc tgaattgata 1020 aaaagacgat taaatgaatc gagagaaatt ttgagcaaaa atgggaataa tcaattggtt 1080 tatagattta gcagtggatg caattttcca atttatgaag tggattttgg gtggggagcg 1140 gcggattggg ttactgtggc ggcgtttaag atgaaaaaca ccgtaatgat gttggacgcc 1200 aaaaatggcg gcggaattga agctttggtc agtttacaag accacgaaat ggctgccttc 1260 caacacaatc aggagcttct tgcttttgct tctttgaacc caagtgccaa ttaa 1314 <210> 3 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> BamH1 restriction site <400> 3 ggatcc 6 <210> 4 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 4 caaatgggtc gcggatccat ggggacgatg aattac 36 <210> 5 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> Xho1 restriction site <400> 5 ctcgag 6 <210> 6 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 6 gtggtggtgg tgctcgagat tggcacttgg gttcaa 36

Claims (4)

A compound of formula 1 or a pharmaceutically acceptable salt thereof:
[Formula 1]

.
A pharmaceutical composition for preventing or treating cancer comprising the compound of claim 1 or a salt thereof.
The composition of claim 2, wherein the cancer is at least one selected from the group consisting of glioma, neuroblastoma, pancreatic cancer, prostate cancer, breast cancer, thyroid cancer, kidney cancer, colon cancer, liver cancer, and ovarian cancer.
The composition of claim 2, wherein the composition is for human administration.

Images