KR101985865B1 - New Alkoxide Derivatives of Alizarin and Use Thereof - Google Patents

Abstract

The present invention relates to a novel alizarin alkoxide derivative, a process for producing the same, and a pharmaceutical composition for treating cancer comprising the same. According to the present invention, it is possible to produce various anthraquinone derivatives using a recombinant microorganism into which a gene coding for a glycosyltransferase and a methyltransferase is introduced, and a novel alizarin alkoxide derivative of the present invention or a pharmaceutically acceptable salt thereof Salts have anticancer activity and thus can be useful in medicine.

Description

TECHNICAL FIELD The present invention relates to a novel alizarin alkoxide derivative and a use thereof.

The present invention relates to a novel alizarin alkoxide derivative, a process for producing the same, and a pharmaceutical composition for treating cancer comprising the same.

Anthraquinone (also referred to as anthraquinonoid, anthracenedione, or dioxoanthracene) is one of quinones derived from anthracene, and is an aromatic organic compound generally having a 9,10-anthraquinone structure. Anthraquinone is known to be present in a variety of plants, microorganisms, fungi and mosses (Dave and Ledwani, Indian J. Not. Prod. Res ., 3, 291-319, 2012) and has a variety of biological activities (Derksen et al. , Phytochem. Anal ., 14, 137-144, 2003; Kosalec et al., Food Chem ., 136, 335-341, 2013). In particular, anthraquinones from the Rubiaceae family have been shown to have antimicrobial activity (Sittie et al., Planta Med ., 65, 259-261, 1999), antifungal (Rath G et al., Int. J. Pharmacog . -114, 1995), low blood pressure analgesic (Younos et al., Planta Med., 56, 430-434, 1990), anti-malarial (Koumaglo et al., Planta Med., 58, 533-534, 1991), antioxidants ( Akhtar et al., Molecules., 18, 10042-10055, 2013), anti-leukemia and mutagenic function (Ismail et al., Nat. prod. Sci., the in vivo biological activity of the 8, 48-51, 2002) . Several isomers of anthraquinone can be regarded as quinone derivatives, and they are widely used as cancer treatments. Anthraquinone acts cytotoxic to guanine / cytosine-rich DNA as an anticancer agent (Al-Otaibi and EL Gogary, J. MoI. Struct ., 1130, 799-809, 2017).

Emodin, which has been studied with type 2 diabetes, can inhibit human cytomegalovirus development (Feng et al., Br. J. Pharmacol ., 161, 113-126, 2010). Aloe emodin has a strong irritant emollient action (Srinivas et al., Med. Res. Rev. , 27, 591-608, 2007), aloe gel, sap or leaf and Rhubarb (Rheum rhaponticum) Found in the roots of. Chrysazin is mainly used for relieving constipation and quinizarin is a cheap dye used to color gasoline and some heating oils (Hunger., Wiley-VCH. Doi: 10.1021 / ja0335418, 2003).

Alizarin was mainly used as a prominent red dye to dye textile fabrics. The anthraquinone glycoside produces di-, tri- or tetra-hydroxy anthraquinone or its derivative aglycone upon hydrolysis. Although the liberated anthraquinone aglycone is therapeutically active, the glycoside form is superior in solubility and is considered to be a diverse pharmacologically active ingredient such as anti-inflammatory, antiseptic, anti-tuberculosis and anti-tumor (Jackson and Attalla, Rapid Commun. Mass Spectrom , 24, 3567-3577, 2010). Anthraquinone has been reported to be used as an emollient in improving digestion, reducing inflammation in patients with arthritis, inhibiting the growth of cancer cells, and treating fungal skin diseases (Kunze et al., Zeitschrift fur Naturforsch.-Sect. 0-3, 1996, Huang et al., Med. Res. Rev. , 27, 609-630., 2007).

The main prior art of synthesis of anthraquinone derivatives is molecular condensation of aryl and O - aroylbenzoic acid with fuming sulfuric acid, benzoyl chloride and concentrated sulfuric acid, benzoyl chloride and zinc chloride and POCl3 / P2O3C14, hurdle) and high cost (Seidel et al., New J. Chem., 37, 601-610, 2013).

The present inventors have made intensive efforts to produce anthraquinone derivatives, especially alizarin derivatives, by using an environmentally friendly and inexpensive biosynthesis method. As a result, they have found that O -methyltransfer from Streptomyces avermitilis MA4680 (SaOMT2) It has been confirmed that a recombinant microorganism into which a gene coding for O- methyltransferase has been introduced can produce a novel alizarin derivative having anticancer activity, thus completing the present invention.

It is an object of the present invention to provide an alizarin-alkoxide derivative having anticancer activity, more particularly, an alizarin-methoxide derivative or a pharmaceutically acceptable salt thereof.

It is another object of the present invention to provide a process for the production of alizarin-methoxide derivatives or biologically acceptable salts thereof using biotransformation.

It is still another object of the present invention to provide a pharmaceutical composition for treating cancer comprising the alizarin-methoxide derivative or a pharmaceutically acceptable salt thereof as an active ingredient.

It is still another object of the present invention to provide a health functional food for preventing or ameliorating cancer, which contains the above-mentioned alizarin-methoxide derivative or a pharmaceutically acceptable salt thereof as an active ingredient.

In order to achieve the above object, the present invention provides an Alizarin alkoxide derivative represented by the general formula (1) or a pharmaceutically acceptable salt thereof.

[Chemical Formula 1]

In formula (1), R is an alkoxide group.

The invention also, (a) O - methyl transferase (O -methyltransferase: SaOMT2) alizarin (Alizarin) from alizarin (Alizarin) under the presence of a recombinant microorganism or a methyl transferase (methyltransferase) Gene encoding alkoxide derivative ≪ / RTI > And (b) recovering the resulting alizarin alkoxide derivative or a pharmaceutically acceptable salt thereof, wherein the alizarin alkoxide derivative represented by the above formula (1) or a pharmaceutically acceptable salt thereof And a manufacturing method thereof.

The present invention also provides a pharmaceutical composition for treating cancer, comprising an alizarin alkoxide derivative represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a health functional food for preventing or ameliorating cancer comprising an alizarin alkoxide derivative represented by the above formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

According to the present invention, it is possible to produce various anthraquinone derivatives by using a recombinant microorganism into which a gene encoding a methyltransferase is introduced, and the novel alizarin alkoxide derivative of the present invention or a pharmaceutically acceptable salt thereof has anticancer activity And thus can be usefully used in the medical field.

1 is a schematic diagram of a method for producing an anthraquinone methoxide derivative in a recombinant microorganism.
Figure 2 shows the chemical structure of anthraquinone used for biotransformation.
FIG. 3 shows HPLC-PDA chromatogram and HQ-QTOF ESI / MS analysis of anthraquinone (substrate) and anthraquinone glycoside derivative (product). a) emodin, b) aloe emodin, c) 2-amino-3-hydroxyanthraquinone, d) alizarin, e ) Anthraflavic acid. S is the substrate peak, and P is the product peak.
Figure 4 shows HPLC-PDA chromatogram and HQ-QTOF ESI / MS analysis of alizarin and alizarin methoxide derivatives. S is the substrate peak, and P is the product peak.
FIG. 5 shows the inhibitory effect of anthraquinone and its derivatives on cancer cell AGS (gastric cancer cell), HeLa (cervical cancer cell) and HepG2 (liver cancer cell) growth. 1. Anthraflavic acid, 2. alizarin, 2. 2-amino-3-hydroxyanthraquinone, 4. anthraflavic acid glyco An alizarin glycoside derivative, an alizarin methoxide derivative, and a 2-amino-3-hydroxyanthraquinone glycoside derivative.
Figure 6 shows the cancer cell proliferation IC ₅₀ (M) values of anthraquinone and its derivatives; AGS (gastric cancer cell), HeLa (cervical cancer cell), HepG2 (liver cancer cell) and B16F10 (skin cancer cell). 1. Anthraflavic acid, 2. alizarin, 2. 2-amino-3-hydroxyanthraquinone, 4. anthraflavic acid glyco An alizarin glycoside derivative, an alizarin methoxide derivative, and a 2-amino-3-hydroxyanthraquinone glycoside derivative. NT: not tested.
7 shows the ¹³ C-NMR spectrum of the alizarin methoxide derivative.
Figure 8 shows the HSQC and HMBC spectra of the alizarin methoxide derivative.

In the present invention, a novel alizarin derivative was prepared through the bioconversion reaction of various anthraquinones (FIG. 2) (Formula 1), and the alizarin derivative had anticancer activity (FIGS. 5 and 6) 6).

In one embodiment of the invention, Streptomyces cis Abbe reumi subtilis (Streptomyces avermitili s) MA4680 (SaOMT2 ) origin O - methyl transferase dehydratase (O -methyltransferase) alizarin (Alizarin) a recombinant microorganism coding for the gene is introduced To produce an alizarin methoxide derivative, and its structure through anticancer activity and NMR analysis was confirmed.

Accordingly, in one aspect, the present invention relates to an alizarin methoxide derivative represented by the general formula (I) or a pharmaceutically acceptable salt thereof.

[Chemical Formula 1]

In formula (1), R is an alkoxide group.

In the present invention, the alkoxide derivative is selected from the group consisting of methoxide (CH ₃ O-), ethoxide (C ₂ H ₅ O-), propoxide (C ₃ H ₇ O-), butoxide (C ₄ H ₉ O -), pentyloxides (C ₅ H ₁₁ O-) and hexyloxides (C ₆ H ₁₃ O-) derivatives, most preferably methoxide derivatives.

The anthraquinones of the present invention may be selected from emodin, alloemodine, furfurin, 2-amino-3-hydroxy anthraquinone, leucocounizarin, chrysophyes, anthraflavic acid, quinizarin, anthrafulin and alizarin And most preferably Alizarin, but is not limited thereto.

The alizarin alkoxide derivatives of the present invention were synthesized by recombinant microorganisms including enzymes or enzyme reactions using an enzyme and a donor, rather than a chemical synthesis method.

In the present invention, biotransformation, also referred to as biotransformation or biotransformation, refers to a biotransformation reaction that converts a substance introduced into a living body into another substance or binds with a metabolite in the body.

In another embodiment of the present invention, Streptomyces cis Abbe reumi subtilis (Streptomyces avermitili s) MA4680 (SaOMT2 ) origin O - methyl transferase dehydratase (O -methyltransferase) for making a gene encoding the introduction of a recombinant microorganism, and alizarin this (Alizarin) to produce an alizarin methoxide derivative.

Therefore, the invention in another aspect, (a) O - methyl transferase (O -methyltransferase: SaOMT2) in the presence of a recombinant microorganism or a methyl transferase (methyltransferase) Gene encoding alizarin from alizarin (Alizarin) (Alizarin ) Alkoxide derivative; And (b) recovering the resulting alizarin alkoxide derivative or a pharmaceutically acceptable salt thereof. The method for producing an alizarin methoxide derivative represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof, .

The O - methyl transferase (O -methyltransferase: SaOMT2) is characterized in that it is a Streptomyces cis Abbe reumi subtilis (Streptomyces avermitilis) MA4680 derived.

May be added at a concentration of 20 to 2,000 [mu] M to Alizarin, which is a substrate of the enzyme reaction.

The recombinant microorganism according to the present invention can be prepared by inserting the gene on a chromosome of a microorganism according to a conventional method, or introducing the recombinant vector onto a plasmid of a microorganism.

A vector in the present invention means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host. The vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Since the plasmid is the most commonly used form of the current vector, plasmids and vectors are sometimes used interchangeably in the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or known in the art.

A host cell transformed or transfected with the vector constitutes another aspect of the present invention. The term transformation used in the present invention means that DNA is introduced into the host and the DNA becomes replicable as an extrachromosomal factor or by chromosome integration completion. This includes any method of introducing the nucleic acid into an organism, cell, tissue or organ, and can be carried out by selecting a suitable standard technique depending on the host cell as is known in the art. Such methods include electroporation, protoplast fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, agitation with silicon carbide fibers, Agrobacterium mediated transformation, PEG, dextran sulfate, Pectamine, and dry / depressant-mediated transformation methods. The host cell of the invention may be a prokaryotic or eukaryotic cell. In addition, a host having high efficiency of introduction of DNA and high efficiency of expression of the introduced DNA is usually used. Known eukaryotic and prokaryotic hosts such as Escherichia coli, Pseudomonas, Bacillus, Streptomyces, fungi and yeast, insect cells such as Spodoptera prolipida (SF9), animal cells such as CHO and mouse cells, COS 1, COS 7, BSC 1, BSC 40 and BMT 10, and tissue cultured human cells are examples of host cells that can be used.

Of course, it should be understood that not all vectors function equally well in expressing the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections among a variety of vectors, expression control sequences, and hosts without undue experimentation and without departing from the scope of the present invention. For example, in selecting a vector, the host should be considered because the vector must be replicated within it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered. In selecting the expression control sequence, a number of factors must be considered. For example, the relative strength of the sequence, controllability and compatibility with the DNA sequences of the present invention should be considered in relation to particularly possible secondary structures. The single cell host may be selected from a selected vector, the toxicity of the product encoded by the DNA sequence of the present invention, the secretion characteristics, the ability to fold the protein correctly, the culture and fermentation requirements, the product encoded by the DNA sequence of the invention And ease of purification. Within the scope of these variables, one skilled in the art can select various vector / expression control sequences / host combinations that can express the DNA sequences of the invention in fermentation or in large animal cultures. A binding method, a panning method, a film emulsion method, or the like can be applied as a screening method for cloning cDNA of NSP protein by expression cloning.

In the present invention, the microorganism is selected from the group consisting of Agrobacterium genus, Aspergillus genus, Acetobacter genus, Aminobacter genus, Agromonas genus, Acidphilium genus, Bulleromyces genus, Buller genus, Brevundimonas genus, Cryptococcus genus, Chionosphaera genus, Candida genus, Cerinosterus genus, Escherichia genus, Exisophial a genus, Exobasidium in, Fellomyces in, Filobasidium genus, Geotrichum genus, Graphiola genus, Gluconobacter genus, Kockovaella in, Curtzmanomyces in, Lalaria in, Leucospoidium genus, Legionella genus, Psedozyma in, Paracoccus genus, Petromyc genus, Rhodotorula genus, Rhodosporidium genus, Rhizomonas in, Rhodobium in, Rhodoplanes genus Rhodopseudomonas genus Rhodobacter genus Sporobolomyces, A Spridobolus genus Saitoella genus Schizosaccharomyces genus Sphingomonas genus Sporotrichum genus, Sympodiomycopsis in, Sterigmatosporidium in, Tapharina genus Tremella genus, Trichosporon genus, Tilletiaria in, Tilletia genus, Tolyposporium in, Tilletiposis in, Ustilago genus, Udenlomyce in, Xanthophilomyces in, Xanthobacter in, Paecilomyces sp., Acremonium sp., Hyhomon sp., Rhizobium sp., And Escherichia coli .

Methyltransferase is a generic term for enzymes that catalyze methyltransferases. It is a methyltransferase and is classified as EC 2.1.1. The amino group, the hydroxy group, and the thiol group, which are substrates, may be methylated to be referred to as a methylation enzyme.

In the present invention, the methyltransferase may be exemplified by glycine methyl transferase, tRNA methyltransferase, thymidylase-producing enzyme, etc. Streptomyces avermitilis MA4680 (SEQ ID NO: 2) Derived O- methyltransferase.

In the present invention, the methyl group donor of the methyltransferase reaction is not limited as long as it is a compound capable of releasing the methyl group, but is preferably selected from S-adenosylmethionine, dimethyltetine, betaine, 5- Methyl tetrahydro folate, 5,10-methylene tetrahydro folate, 5-methyl tetrahydrophthaloyl-L-glutamic acid.

In another embodiment of the present invention, AGS gastric carcinoma cells of anthraquinone derivatives (glycoside 2-amino-3-hydroxy anthraquinone, anthraflavic acid, alizarin and O -methoxide alizarin) And analyzed for anticancer activity against B16F10 melanoma, HeLa cervical carcinoma and HepG2 hepatocarcinoma cells. As a result, it was confirmed that the alizarin methoxide derivative was effective in various cancer cell lines and had a low IC ₅₀ value.

Accordingly, the present invention relates, in another aspect, to a pharmaceutical composition for treating cancer comprising an alizarin methoxide derivative represented by the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

In the present invention, the cancer is characterized by being gastric cancer, skin cancer, cervical cancer or liver cancer.

In the present invention, a " composition " is considered to include not only products containing the specified ingredients, but also any products made directly or indirectly by the combination of the specified ingredients.

The composition of the present invention may be prepared in the form of a unit dose by formulating it using a carrier or an excipient according to a method which can be easily carried out by those skilled in the art, . The carrier used in the pharmaceutical composition of the present invention includes a pharmacologically acceptable carrier, adjuvant and vehicle, and is collectively referred to as a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers that can be used in the pharmaceutical compositions of the present invention include, but are not limited to, ion exchange, alumina, aluminum stearate, lecithin, serum proteins (e.g., human serum albumin), buffer substances Water, salt or electrolyte (e.g., protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride and zinc salts), colloidal silicon dioxide, But are not limited to, silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substrates, polyethylene glycol, sodium carboxymethylcellulose, polyarylate, wax, polyethylene-polyoxypropylene-barrier polymer, polyethylene glycol, wool, lactose, dextrose, Sucrose, sorbitol, acacia gum, gelatin, water, syrup, methylhydroxybenz Benzoate, may include talc, mineral oil and the like, but is not limited to this. The composition can be used as a preservative such as methyl parahydroxybenzoate or potassium sorbate, a stabilizer, a natural flavor such as a plum flavor or a lemon flavor, a natural coloring matter such as chlorophyllin, a sweetener such as fructose, honey or sugar, May be further contained.

The route of administration of the pharmaceutical composition according to the present invention may be, but is not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, Sublingual or rectal.

The administration route of the pharmaceutical composition of the present invention is preferably oral or parenteral administration. The term "parenteral" as used herein includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.

In a preferred embodiment, for parenteral administration, the pharmaceutical composition of the present invention can be prepared as a water-soluble solution. Preferably, physically suitable buffer solutions such as Hank's solution, Ringer's solution or physically buffered saline can be used. Water-soluble injection suspensions may contain a substrate capable of increasing the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran. In addition, suspensions of the active ingredient may be prepared in suitable oily injection suspensions. Suitable lipophilic solvents or carriers include fatty acids such as sesame oil or synthetic fatty acid esters such as ethyl oleate, triglycerides or liposomes. Polycationic amino polymers can also be used as carriers. Optionally, the suspension may employ a suitable stabilizing agent or agent to increase the solubility of the compound and to produce a high concentration of solution.

The pharmaceutical composition may be in the form of a sterile injectable preparation, either as a sterile injectable aqueous or oleagenous suspension. The suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (e. G., Tween 80) and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent (e.g., a solution in 1,3-butanediol). Vehicles and solvents that may be used tolerably include mannitol, water, a Ringgel solution and an isotonic sodium chloride solution. In addition, sterile, nonvolatile oils are conventionally employed as a solvent or suspending medium. For this purpose, any non-volatile oil with low irritation, including synthetic mono- or diglycerides, may be used. Fatty acids such as oleic acid and glyceride derivatives thereof are useful in injection formulations as well as pharmaceutically acceptable natural oils (e.g., olive oil or castor oil), especially those polyoxyethylated.

The pharmaceutical compositions of the present invention may be orally administered in any dosage form orally acceptable, including, but not limited to, capsules, tablets, and aqueous suspensions and solutions. In the case of oral tablets, commonly used carriers include lactose and corn starch. Lubricants such as magnesium stearate are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When the aqueous suspension is orally administered, the active ingredient is combined with an emulsifying agent and a suspending agent. If desired, sweetening and / or flavoring agents and / or coloring agents may be added.

The pharmaceutical compositions of the present invention may also be administered in the form of suppositories for rectal administration. These compositions may be prepared by mixing the compounds of the invention with suitable non-polar excipients which are solid at room temperature but liquid at rectal temperature. Such materials include, but are not limited to, cocoa butter, beeswax, and polyethylene glycols.

Oral administration of a pharmaceutical composition according to the present invention is particularly useful when the desired treatment is associated with a site or organ that is accessible by topical application. When topically applied to the skin, the pharmaceutical composition should be formulated with a suitable ointment containing the active ingredient suspended or dissolved in the carrier. Carriers for topical administration of the compounds of the present invention include, but are not limited to, mineral oil, liquid paraffin, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsifying wax and water. Alternatively, the pharmaceutical composition may be formulated with a suitable lotion or cream containing the active compound suspended or dissolved in a carrier. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl ester wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water. The pharmaceutical compositions of the present invention may also be topically applied by rectal suppositories to the lower intestinal tract with a suitable enema. Topically applied transdermal patches are also included in the present invention.

The pharmaceutical composition of the present invention can be administered by inhalation aerosol or by inhalation. Such compositions may be prepared according to techniques well known in the art of pharmacy and may be prepared using benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, fluorocarbons, and / or other solubilizing or dispersing agents known in the art, Solution.

The compounds of the present invention can be used in combination with conventional anti-inflammatory agents or in combination with inhibitors of matrix metalloproteinase inhibitors, lipoxygenase inhibitors and cytokines other than IL-1beta. The compounds of the present invention may also be used in combination with immunomodulators (e.g., bropyrimines, anti-human alpha interferon antibodies, IL-2, GM-CSF, methionine enkephalin, interferon Alpha, diethyldithiocarbamate, tumor necrosis factor, naltrexone and rEPO) or prostaglandins. When the compounds of the present invention are administered in combination with other therapeutic agents, they may be administered to a patient sequentially or simultaneously. Alternatively, the pharmaceutical composition according to the present invention may be prepared by mixing the compound of formula (I) with another therapeutic or prophylactic agent as described above.

Suitable dosages of the compositions of the present invention will vary depending on factors such as the severity of the symptoms, the body weight, age, sex, mode of administration, and time of administration of the patient, and the ordinarily skilled physician will know the dose Can be easily determined.

The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents.

In another aspect, the present invention relates to a health functional food for preventing or ameliorating cancer, which comprises an alizarin methoxide derivative represented by the general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

In the present invention, the cancer is characterized by being gastric cancer, skin cancer, cervical cancer or liver cancer.

In the present invention, the term "health functional food" refers to a food prepared and processed by using raw materials or ingredients having useful functions in accordance with Law No. 6727 on Health Functional Foods, and the nutritional control on the structure and function of the human body Or for the purpose of obtaining a beneficial effect for health use such as physiological action.

The health functional foods of the present invention may contain conventional food additives and, unless otherwise specified, whether or not they are suitable as food additives are classified according to the General Rules for Food Additives approved by the Food and Drug Administration, Standards and standards.

Examples of the food items included in the above food additives include chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; Natural additives such as persimmon extract, licorice extract, crystalline cellulose, high color pigment and guar gum; L-glutamic acid sodium preparations, noodle-added alkalis, preservative preparations, tar coloring preparations and the like.

For example, the health functional food in tablets may be prepared by granulating a mixture of the alizarin methoxide derivative of the present invention or a salt thereof with an excipient, a binder, a disintegrant and other additives in a usual manner, Compression molding, or direct compression molding of the mixture.

The hard capsule may be prepared by filling a normal hard capsule with a mixture of an alizarin methoxide derivative of the present invention or a salt thereof with an additive such as an excipient. The soft capsule may be prepared by mixing the alizarin methoxide A seed derivative or a salt thereof and an additive such as an excipient into a capsule base such as gelatin. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a coloring agent, a preservative and the like, if necessary.

The ring-shaped health functional food can be prepared by molding a mixture of the alizarin methoxide derivative or salt thereof of the present invention with an excipient, a binder, a disintegrant, etc. by a conventionally known method and, if necessary, The surface can be coated with a material such as starch, talc or the like.

The granular form of the health functional food may be prepared by granulating a mixture of the alizarin methoxide derivative or salt thereof of the present invention with an excipient, a binder, a disintegrant and the like in a granular form by a conventionally known method, And the like.

The health functional food may be a beverage, a meat, a chocolate, a food, a confectionery, a pizza, a ramen, a noodle, a gum, a candy, an ice cream, an alcoholic beverage, a vitamin complex and a health supplement food.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example 1 Preparation of Chemicals and Recombinant Strain

Anthraquinone, quinizarin, anthrafine, and alizarin) were synthesized from Sigma-Aldrich (Sigma-Aldrich) (Sigma-Aldrich) -Aldrich; St. Louis, Mo., USA).

E. coli BL21 (DE3) (Stratgene, La Jolla, CA, USA) was used as a host for expression and biotransformation. The restriction enzyme was Takara Bio. Inc. (Japan) or Promega (USA). Luria-Bertani (LB) broth medium supplemented with antibiotic (kanamycin 50 L / mL) was used for E. coli growth, colony selection, culture preparation and biotransformation.

PET28a and pRSF-Duet were used as vectors. The genes inserted into the vector were YjiC and SaOMT2, respectively, and glycosyltransferase (SEQ ID NO: 1) derived from Bacillus licheniformis DSM 13, methyl transferase (O -methyltrasferase, SEQ ID NO: 2) a gene fragment by performing PCR using the PCR primers (primer) in Table 1 as a gene encoding - Streptomyces cis Abbe reumi subtilis (Streptomyces avermitilis) MA4680 origin O . The PCR conditions were 10 min at 94, 1 min at 95, 1 min at 60, 1 min at 72 for 30 min and reaction at 72 for 10 min. The amplified gene was identified and obtained with a DNA band of the expected size in 1% agarose gel. The obtained fragment and the vector were treated with restriction enzymes Bam HI / Xho I and Bam HI / Eco RI and ligated to prepare recombinant plasmids pET28a-YjiC and pRSF-Duet-SaOMT2.

E. coli strains including the recombinant plasmids pET28a-YjiC and pRSF-Duet-SaOMT2 were cultured overnight in 5 mL of LB medium supplemented with 50 L / mL kanamycin at 37 ^° C, seed E. coli 500 L of the strain medium was transferred to 50 mL of the medium and cultured at a cell optical density of 600 nm (OD _{600 nm} ) until 05 to 07. IPTG (isopropyl-D-1-thiogalactopyranoside) at a final concentration of 0.5 mM was added to induce protein expression, and then cultured at 20 ^° C for 20 hours.

name order SEQ ID NO: YjiC-F GGATCC ATGGGACATAAACATATCGCG 3 YjiC-R CTCGAG TTATTTTACTCCTGCGGGTGCTAA 4 SaOMT2-F GGATCC GATGAGCTGCCGCACCGGCA 5 SaOMT2-R GAATTC TCAGCCAACCGCGCGCAG 6

Example 2: Biotransformation < RTI ID = 0.0 >

Using recombinant strains expressing the pET28a (+) - YjiC and pRSF-Duet-SaOMT2 plasmids prepared in Example 1, the immunomodin, alloemedin, furfurin, 2-amino-3-hydroxy anthra Bioconversion of anthraquinones selected from quinones, leucoquinizarins, cryocapses, anthraflavic acid, quinizarin, anthrulphine and alizarin was performed.

The substrate (anthraquinone) was dissolved in DMSO to make a stock at a concentration of 50 mM, and then treated with the strain at a concentration of 0.2 mM. After culturing for 48 hours, the biotransformed cultures were harvested, added with 2 volumes of ethyl acetate and shaken with vertical shaking, and transferred to a separating funnel. The organic ethyl acetate layer was collected and evaporated using a rotary evaporator. The last sample was dissolved in 1 mL of methanol.

The samples were analyzed using HPLC-PDA and HQ-QTOF ESI / MS. More specifically, 20 l of the sample was analyzed by injecting it into an HPLC-PDA (Shimadzu, Japan; SPD-M20A Detector) containing a reversed phase C18 column (Mightysil-RP-18GP, 150 * 4.6 mm, kanto Chemical Japan). The mobile phase consisted of solvent A (HPLC grade water + 0.05% TFA) and solvent B (100% acetonitrile). The total flow rate was maintained at 1 mL / min in a 25 min program and the ACN concentration was 20% (0-5 min), 70% (5-10 min), 90% (10-15 min), 50% 20 min) and 10% (20-25 min). 20-30 minutes, 50% (30-34 minutes), 20% (20-30 minutes), 20% (10-10 minutes) The product was purified using prep-HPLC with a C18 column (YMC-Pack ADS-AQ 150 * 20 mm ID, 10 m) coupled with ACN at a concentration of 34-35 min and a UV detector at 437 nm and 430 nm. The purified product was lyophilized and used for structural and biophysical analysis. HQ-QTOF ESI / MS spectra were obtained from ACQUITY (UPLC; Waters, MA, USA) -SYNAPT G2-S (Water, MA, USA).

Glycosylation bioconversion

For glycosylation, pET28a-YjiC-expressing E. coli strain BL21 (DE3) was cultured in a flask for 20 hours, and then treated with anthraquinone to a final concentration of 0.2 mM. Forty-eight hours after the anthraquinone treatment, the cultures were harvested and the glycosylated anthraquinone samples were analyzed using HPLC-PDA / LC-MS by adding 2 volumes of ethyl acetate. The peak and retention time of each substrate (anthraquinone; emodine, alloemodine, 2-amino-3-hydroxy anthraquinone, anthraflavic acid and alizarin) Respectively. In addition, glycosylated anthraquinone was quantitatively analyzed using YjiC gene using HQ-QTOF ESI / MS (FIG. 3).

Methoxidated bioconversion

1 is a schematic diagram showing a method for producing alizarin as an alizarin methoxide derivative using a recombinant microorganism.

For the methoxidation reaction, pRSF-Duet-SaOMT2-expressing E. coli strain BL21 (DE3) was cultured in a flask for 20 hours and anthraquinone was treated at a final concentration of 0.2 mM. Forty-eight hours after the anthraquinone treatment, the cultures were harvested and the methoxidated anthraquinone samples were analyzed using HPLC-PDA by adding twice the volume of ethyl acetate. The peak and retention time of each substrate (anthraquinone; emodin, alloemodine, 2-amino-3-hydroxyanthraquinone, anthraplavic acid and alizarin) 4 and Table 2), SaOMT2 gene only alizarin O-methylation was found that for (O -methylate). The samples were quantitatively analyzed using HQ-QTOF ESI / MS (Table 2).

Glycosylation of anthraquinones Methylation of anthraquinones Name of Antraquinones Retention time (min) Measured mass [M + H] ⁺ Calculated mass [M + H] < ⁺ > Retention time (min) Measured mass [M + H] ⁺ Calculated mass [M + H] < ⁺ > Substrate Product Substrate Product Emodin 22.011 16.057 433.1135 433.113 13.360 ND ND ND Aloe emodin 18.996 15.297 433.1138 433.113 12.01 ND ND ND 2-amino 3-hydroxyanthraquinone 15.11 13.312 402.1182 402.1182 14.5 ND ND ND Anthraflavic acid 14.603 12.856 403.1020 403.103 10.729 ND ND ND Alizarin 16.142 13.545 425.0826 425.085 11.906 13.427 255.0556 255.06

Example 3: Mass production using a cell-growth catalytic fermenter

For the mass production of anthraquinone derivatives, 3 L of LB medium was fermented using a 5 L autoclavable self-controlled fermenter system (Biotron, Korea). Each recombinant strain expressing glycosyltransferase and methyltransferase was inoculated into three shake flasks (100 mL medium) and fermented. The cultures were incubated overnight in a shaking incubator at 37 ^° C. During fermentation, the pH meter and dissolved oxygen probe were calibrated according to the instrument's protocol. The pH was maintained at 7.0 using ammonium hydroxide and the dissolved oxygen level was maintained above 95%. When the 600 nm optical density of the culture reached 10, the culture was induced with 0.5 mM lactose and the temperature was lowered to 20 ^o C or lower. After incubation for 6 hours, 300 mg of each anthraquinone was dissolved in DMSO and added for bioconversion. The fermentor maintained the above pH and dissolved oxygen conditions for 72 hours. 100 mL of 50% glucose was supplied as a carbon source every 12 hours. To take each glycoside or methoxide sample, each substrate was fermented 6 times with the strain and fermenter and the sample was harvested. The final product was purified using prep-HPLC and the purified fractions were stripped of water using a rotary evaporator and freeze-drying. The final product was quantitatively analyzed and then used for the anticancer activity test.

Example 4: Anticancer activity of anthraquinone derivatives

AGS gastric carcinoma cells were cultured in RPMI 1640 medium containing 10% FBS. B16F10 melanoma, HeLa cervical carcinoma and HepG2 hepatocarcinoma cells were cultured in DMEM (Dulbecco's modified Eagle's ) Culture medium. All cell lines were cultured under 37 ^° C and 5% CO2 wet conditions. For the measurement of cell growth, various cancer cell lines were dispensed into a 96-well plate at a density of 210 ³ cells / well per well. Various concentrations of anthraquinone derivatives (glycoside 2-amino-3-hydroxyanthraquinone, , Alizarin, and O - methoxide alizarin) and cultured for 72 hours. Cell growth was measured by MTT assay. After adding 50 μl of MTT (2 mg / ml stock solution) for 4 hours, the medium was removed and 100 μl of DMSO was added. Absorbance was measured at 540 nm using a microplate spectrophotometer (Thermo Scientific Multiskan Spectrum).

As a result, it was found that O -glycoside anthraflavic acid and O -glycoside 2-amino-3-hydroxyanthraquinone had a cancer cell growth inhibitory effect compared with anthraplicane and 2-amino-3-hydroxy anthraquinone- Respectively. In addition, O - glycoside alizarin and O - methoxide alizarin were more effective than alizarin - treated group. In particular, O -methoxide alizarin was superior to other drugs (derivatives) in all cancer cell lines tested (FIG. 5). In addition, O -methoxide alizarin showed a low effect on AGS, HeLa and HepG2 cell lines including B16F10 skin cancer cell line, and the IC50 (M) value thereof is shown in Fig.

Example 5: Structural analysis

For the structural analysis, standard reagents and samples were dissolved in DMSO (Sigma-Aldrich, MO, USA) and subjected to one-dimensional ¹ H-NMR (proton NMR), ¹³ C- And HMBC). In addition, the standard molecule was 300 MHz Brucker (Germany) BioSin NMR. Structures were analyzed using the MestReNova 11.0 program (Mestrelab Research SL Feliciano Barrera 9B - Bajo 15706 Santiago de Compostela, Spain).

As a result, -OCH ₃ signal was observed at 3.97 ppm (s, 3H) in proton ( ¹ H) NMR and -CH ₃ was observed at 56.78 ppm in 13 C NMR (Fig. 7). The correlation between OCH _{3 at} 3.97 ppm and CH _{3 at} 56.78 ppm was analyzed by HSQC (FIG. 8). A direct link of 3.96 ppm of OCH ₃ was observed at carbon number 2 (2C) of alizarin, which showed a signal of 154.1 ppm. Thus, the methylation position was identified as the second hydroxy group of alizarin and 2- O -methoxide alizarin was produced (Table 3).

Position ^One H
Alizarin ^One H (Alizarin 2- O -methoxide) ¹³ C Alizarin ¹³ C (Alizarin 2- O -methoxide) One 151.17 152.38 2 153.15 154.17 3 7.20 (d, J = 8.3 Hz 1H) 7.48 (d, J = 8.4 Hz 1H) 126.8 127 4 7.62 (d, J = 8.3 Hz 1H) 7.78 (d, J = 8.3 Hz 1H) 121.2 121 5 8.15 (m, 2 H) 8.21 (d, 1 H) 127.1 127 6 7.89 (m, 2 H) 7.95 (m, 2 H) 135.5 135.7 7 7.89 (m, 2 H) 7.95 (m, 2 H) 133.94 134.7 8 8.15 (m, 2 H) 8.26 (d, 1 H) 133.2 134 9 189.16 189 10 180.93 181 11 124.17 125.15 12 121.55 121.16 13 121.23 117.43 14 116.64 116.57 -OCH ₃ 3.97 (s) 56.78

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Industry-University Cooperation Foundation Sunmoon University <120> New Alkoxide Derivatives of Alizarin and Use Thereof <130> P17-B242 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 396 <212> PRT <213> Bacillus licheniformis DSM 13 <400> 1 Met Gly His Lys His Ile Ala Ile Phe Asn Ile Pro Ala His Gly His   1 5 10 15 Ile Asn Pro Thr Leu Ala Leu Thr Ala Ser Leu Val Lys Arg Gly Tyr              20 25 30 Arg Val Thr Tyr Pro Val Thr Asp Glu Phe Val Lys Ala Val Glu Glu          35 40 45 Thr Gly Ala Glu Pro Leu Asn Tyr Arg Ser Thr Leu Asn Ile Asp Pro      50 55 60 Gln Gln Ile Arg Glu Leu Met Lys Asn Lys Lys Asp Met Ser Gln Ala  65 70 75 80 Pro Leu Met Phe Ile Lys Glu Met Glu Glu Val Leu Pro Gln Leu Glu                  85 90 95 Ala Leu Tyr Glu Asn Asp Lys Pro Asp Leu Ile Leu Phe Asp Phe Met             100 105 110 Ala Met Ala Gly Lys Leu Ala Glu Lys Phe Gly Ile Glu Ala Val         115 120 125 Arg Leu Cys Ser Thr Tyr Ala Gln Asn Glu His Phe Thr Phe Arg Ser     130 135 140 Ile Ser Glu Glu Phe Lys Ile Glu Leu Thr Pro Glu Glu Glu Asp Ala 145 150 155 160 Leu Lys Asn Ser Asn Leu Pro Ser Phe Asn Phe Glu Asp Met Phe Glu                 165 170 175 Pro Ala Lys Leu Asn Ile Val Phe Met Pro Arg Ala Phe Gln Pro Tyr             180 185 190 Gly Glu Thr Phe Asp Glu Arg Phe Ser Phe Val Gly Pro Ser Leu Ala         195 200 205 Lys Arg Lys Phe Gln Glu Lys Glu Thr Pro Ile Ile Ser Asp Ser Gly     210 215 220 Arg Pro Val Met Leu Ile Ser Leu Gly Thr Ala Phe Asn Ala Trp Pro 225 230 235 240 Glu Phe Tyr His Met Cys Ile Glu Ala Phe Arg Asp Thr Lys Trp Gln                 245 250 255 Val Ile Met Ala Val Gly Thr Thr Ile Asp Pro Glu Ser Phe Asp Asp             260 265 270 Ile Pro Glu Asn Phe Ser Ile His Gln Arg Val Pro Gln Leu Glu Ile         275 280 285 Leu Lys Lys Ala Glu Leu Phe Ile Thr His Gly Gly Met Asn Ser Thr     290 295 300 Met Glu Gly Leu Asn Ala Gly Val Pro Leu Val Ala Val Pro Gln Met 305 310 315 320 Pro Glu Gln Glu Ile Thr Ala Arg Arg Val Glu Glu Leu Gly Leu Gly                 325 330 335 Lys His Leu Gln Pro Glu Asp Thr Thr Ala Ala Ser Leu Arg Glu Ala             340 345 350 Val Ser Gln Thr Asp Gly Asp Pro His Val Leu Lys Arg Ile Gln Asp         355 360 365 Met Gln Lys His Ile Lys Gln Ala Gly Gly Ala Glu Lys Ala Ala Asp     370 375 380 Glu Ile Glu Ala Phe Leu Ala Pro Ala Gly Val Lys 385 390 395 <210> 2 <211> 359 <212> PRT <213> Streptomyces avermitilis MA-4680 <400> 2 Met Ser Cys Arg Thr Gly Thr Asp Thr Val Pro Ala Gly Ser His Glu   1 5 10 15 Gln Arg Thr Val Glu Ser Gly Glu Val Met Ala Lys Glu Thr Thr Pro              20 25 30 Arg Gly Gly Gly Val Trp Ala Ala Asp Leu Leu Thr Pro Met Ala          35 40 45 Val Arg Val Ala Ala Thr Leu Arg Leu Ala Asp His Ile Ala Ala Gly      50 55 60 Ala Arg Thr Thr Glu Ala Leu Ala Glu Ala Val Gly Ala Asp Arg Asp  65 70 75 80 Ala Leu Gly Arg Leu Leu Asp His Leu Val Thr Ala Gly Val Leu Ser                  85 90 95 Gly Thr Gly Pro Gly Ala Tyr Asp Leu Thr Ala Met Gly Arg His Leu             100 105 110 Cys Glu Gly Ala Pro Glu Asp Met Arg Ala Leu Asp Ile Glu Gly         115 120 125 Ala Leu Gly His Ala Glu Leu Ser Leu Val His Leu Leu His Thr Val     130 135 140 Arg Thr Gly Glu Ala Ala Phe Pro Gln Gln Tyr Gly Val Thr Phe Trp 145 150 155 160 Asp Asp Leu Ser Ser Asp Asp Gly Arg Ala Glu Ser Phe Asp Thr Leu                 165 170 175 Met Gly Ala Arg Leu Thr Ala His Ser Pro Ala Val Ala Gly Ala Tyr             180 185 190 Pro Trp Gly Thr Leu Arg His Val Val Asp Val Gly Gly Gly Asp Gly         195 200 205 Thr Met Leu Ile Ala Ile Leu Gln Ser His Pro Asp Leu Arg Gly Thr     210 215 220 Val Val Asp Leu Pro Gly Pro Val Arg Arg Ala Glu Lys Ala Ile Ala 225 230 235 240 Ala Ala Gly Leu Asp His Arg Ala Asp Ile Ala Ala Gly Ser Phe Phe                 245 250 255 Asp Ala Leu Pro Ala Gly Ala Asp Gly Tyr Leu Leu Ser Ser Ile Leu             260 265 270 His Asn Trp Asp Asp Ala Ser Ala Ala Arg Ile Leu Arg Arg Cys Ala         275 280 285 Asp Ala Gln Thr Thr Gly Arg Val Leu Val Val Asp Tyr Phe Gly     290 295 300 Asp Arg Thr Val Gln Thr Glu Gly Asp Leu Arg Met Leu Gly Tyr Phe 305 310 315 320 Gly Gly Arg Gln His Thr Leu Glu Gln Leu Ala Glu Leu Ala Gly Thr                 325 330 335 Val Gly Leu His Thr Thr Ser Val Thr Pro Ala Gly Arg Tyr Ser Val             340 345 350 Val Glu Leu Arg Ala Val Gly         355 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> YjiC-F <400> 3 ggatccatgg gacataaaca tatcgcg 27 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> YjiC-R <400> 4 ctcgagttat tttactcctg cgggtgctaa 30 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SaOMT2-F <400> 5 ggatccgatg agctgccgca ccggca 26 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SaOMT2-R <400> 6 gaattctcag ccaaccgcgc gcag 24

Claims (14)

delete delete delete A process for preparing an alizarin alkoxide derivative represented by the formula (1) or a pharmaceutically acceptable salt thereof, comprising the steps of:
(a) O - methyl transferase enzyme, comprising the steps of: generating a alizarin (Alizarin) alkoxide derivative from (O -methyltransferase SaOMT2) alizarin (Alizarin) in the presence of recombinant microorganisms or a methyl transferase (methyltransferase) the gene is introduced encoding; And
(b) recovering the resulting Alizarin alkoxide derivative or a pharmaceutically acceptable salt thereof,

In formula (1), R is an alkoxide group.
The method of claim 4, wherein the O - methyl transferase (O -methyltransferase: SaOMT2) is Streptomyces cis Abbe reumi subtilis (Streptomyces avermitilis) alizarin (Alizarin) alkoxide derivative or a pharmaceutically acceptable, characterized in that MA4680 derived Lt; / RTI &gt;
5. The method according to claim 4, wherein, when methyltransferase is used in step (a), an alizarin alkoxide derivative or a pharmaceutically acceptable salt thereof is further characterized by adding a methyl group donor Lt; / RTI &gt;
5. The composition of claim 4, wherein the alkoxide is selected from methoxide, ethoxide, propoxide, butoxide, pentyloxide, and hexyloxide, or an alizarin alkoxide derivative or a pharmaceutically acceptable salt thereof, &Lt; / RTI &gt;
5. The method according to claim 4, wherein the alkoxide is a methoxide, or a pharmaceutically acceptable salt thereof.
5. The method according to claim 4, wherein the microorganism in step (a) is E. coli . 2. The method according to claim 1, wherein the microorganism is E. coli .
5. The method according to claim 4, wherein the alizarin of step (a) is added at a concentration of 20 to 2000 μM, or a pharmaceutically acceptable salt thereof.
delete delete delete delete

Images