KR20200034125A - Markers for predicting concentration of statin in blood - Google Patents

Abstract

The present invention relates to a genetic marker for predicting the statin drug concentration in the blood. The genetic marker for predicting the statin concentration in the blood according to the present invention is useful for determining the amount of statin to be injected since it is possible to predict a group with a high or low level of statin in the blood compared to a normal level even if the statin of the same concentration is injected.

Description

Markers for predicting concentration of statin in blood

The present invention relates to a gene marker for predicting the drug concentration of statins in the blood, and more particularly, to a gene mutation marker combination capable of determining that the statin concentration in the blood is high or low compared to a normal person.

As the obese population increases, dosing of hyperlipidemia treatments is increasing, and currently, statin preparations are used most frequently as lipid-lowering agents. Statins are included in almost all prescription drugs for hyperlipidemia, and as the dosage for statin drugs increases, the number of side effects associated with statin drugs also increases. In particular, when taking high doses of statins for a long time, side effects such as muscle pain and diabetes are continuously mentioned, and safety of taking statin drugs has become an issue.

According to a UK study of 12064 people in the general population, the experimental group taking a high dose of simvastatin (80 mg) had a higher incidence of myopathy, a known side effect of statin drugs, than the experimental group taking a low dose of simvastatin (20 mg). High (high dose: 53/6031 (0.9%), low dose: 2/6033 (0.03%)) (SEARCH collaborative group, Lancet. 2010; 376 (9753): 1658-69). Studies of adverse reaction cases have been reported (Mayo Clinic, https://www.mayoclinic.org/diseases-conditions/high-blood-cholesterol/in-depth/statin-side-effects/art-20046013 .; American College of Cardiology, https://www.acc.org/latest-in-cardiology/articles/2015/08/11/09/16/statin-intolerance-not-a-myth). In Korea, in May 2016, the Korea Institute of Health and Medical Sciences (NECA) said that taking a long-term, high-dose dose of statins, a treatment for hyperlipidemia, increased the risk of diabetes by 2.5 times or more. Comparative effect study on risk, 2015.). In the United States, there have been cases in which class action was filed for Pfizer's statin-based hyperlipidemia drug 'Lipitor (ingredient: atorvastatin)' that did not report side effects early in the sale. In 2012, the U.S. FDA warned of side effects such as diabetes, liver damage, loss of memory, and muscle damage when taking Lipitor for a long time.

Statin side effects include gastrointestinal symptoms and muscle pain, diabetes, and rare side effects, including myopathy, rash, peripheral neuropathy, insomnia, and sleep or concentration symptoms. According to the American college of cardiology, the symptoms of statin drug adverse reactions are called Statin intolerance, and are reported to occur in about 15% of all patients who are prescribed statin medications (American College of Cardiology) , https://www.acc.org/latest-in-cardiology/articles/2015/08/11/09/16/statin-intolerance-not-a-myth). Statins are available in a variety of medications and dose regimens and are experiencing high statin hypersensitivity to certain medications and doses. In order to prevent statin hypersensitivity and to administer effectively, it is important to maintain the statin concentration in the blood in a stable range by predicting the pharmacokinetics (PK), pharmacodynamics (PD), and dosage of the statin drug. To this end, studies of genetic factors that are thought to affect the pharmacokinetics / pharmacodynamics of statin drugs (Gryn SE and Hegele RA, Clin Pharmacol Ther. 2014; 96 (1): 36-47) are involved in drug metabolism. Studies have shown that the genotypes of various genes involved, such as MRP, HMG-CoA-R, and LDL-R, are associated with statin drug resistance (Reiner Z, Nutr Metab Cardiovasc Dis, 2014; 4 (10): 1057-66 .) Is being reported. Based on this, studies to predict the response and blood concentration of statin drugs due to individual genetic differences are continuing.

Accordingly, the inventors of the present application, as a result of diligent efforts to identify genetic markers of pharmacokinetic and pharmacodynamic predictions of statin drugs, are based on analysis of single-nucleotide polymorphisms (SNPs) of genes involved in statin drug metabolism. When a set of related SNPs capable of predicting concentration was determined, and the SNP was analyzed, it was confirmed that the statin concentration in blood could be predicted, and the present invention was completed.

An object of the present invention is to provide a gene marker combination for predicting statin concentration in blood.

Another object of the present invention is to provide a method for providing information for predicting blood statin concentration.

Another object of the present invention is to provide a primer composition for predicting blood statin concentration, a probe composition, an antibody or aptamer composition, and a kit for predicting blood statin concentration comprising the same.

In order to achieve the above object, the present invention is a single nucleotide polymorphism having a thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 1 (GenBank SNP database, rs72655363); A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 2 (GenBank SNP database, rs550110479); And a genetic marker or a combination thereof, comprising one or more mutations selected from the group consisting of a single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 3, wherein the genetic marker or a combination thereof is detected The isolated individual provides a gene marker or a combination thereof characterized in that the administered statin concentration in the blood is maintained higher than the control group.

The present invention also, a single base polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 31 (GenBank SNP database, rs15524); A mutation in which thymine (T), thymine (T), and cytosine (C) at positions 101 to 103 of the nucleotide sequence represented by SEQ ID NO: 32 are deleted (GenBank SNP database, rs781599319); And a single marker polymorphism having a guanine (G) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 33 (GenBank SNP database, rs28371759), or a genetic marker comprising one or more variations selected from the group consisting of The individual in which the genetic marker or a combination thereof is detected provides a genetic marker or a combination thereof characterized in that the administered statin concentration in the blood is kept low compared to the control group.

The present invention also provides a method for providing information for predicting the statin concentration in the blood of an individual administered a statin comprising the step of detecting a variation of the gene marker or a combination thereof in a biological sample isolated from the individual.

The present invention also provides a primer composition for predicting blood statin concentration in a subject administered with a statin that specifically hybridizes with the polynucleotide composed of 10 or more consecutive bases around the mutation site or the mutation site or a complementary polynucleotide thereof. do.

The present invention also provides a probe composition for predicting blood statin concentration in a subject administered with a statin that specifically hybridizes with the polynucleotide or a complementary polynucleotide composed of 10 or more consecutive bases containing the mutation position or the mutation. to provide.

The present invention also provides a composition for predicting the concentration of statin in the blood of an individual administered with a statin containing an antibody or an aptamer that specifically binds a polypeptide encoded by a polynucleotide containing the mutation.

The present invention also provides a kit for predicting the concentration of statin in the blood of an individual administered with a statin containing the composition.

The gene marker for predicting the concentration of statin in the blood according to the present invention is useful in determining the amount of statin to be injected, because it is possible to predict a group with a high or low level of statin in the blood compared to normal even if the statin of the same concentration is injected. Can be utilized.

BRIEF DESCRIPTION OF THE DRAWINGS It is a schematic diagram which shows the outline | summary of construction of the predicted variation set of statin blood drug concentration in this invention.
Figure 2 confirms the correlation (Pearson correlation coefficient r = 0.943, p <0.001) of the drug concentration value (X axis) and the actual drug concentration value (Y axis) predicted in the statin blood drug concentration prediction model developed in the present invention. It is a graph.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

In the present invention, a model capable of predicting the concentration of statins in blood was developed and the accuracy was determined.

In the present invention, targeted sequencing is performed on DNA samples of various statin drug treatment targets to identify mutation information of related genes, and clinical information of drug treatment targets is confirmed to establish a statin concentration prediction model in blood through statistical analysis and blood A combination of gene markers capable of predicting statin concentration was selected.

That is, in one embodiment of the present invention, targeted sequencing of a gene as shown in Table 1 is performed on a DNA sample of a subject receiving 66 atorvastatin treatments, the average drug dose of the subject, blood drug concentration, number of concurrent medications, After confirming the normality of the genotype and data distribution using age and weight as variables, a multi-linear regression analysis was performed to predict blood drug concentration using a stepwise variable input method, and the explanatory power of the predictive model was 80% or more and F- Genetic marker combinations that achieve p <0.05 were identified in the assay, and it was confirmed that the marker combination can predict the actual blood statin concentration with high accuracy (FIG. 2).

 List of genes to be tested No. Gene One ABCB1 2 ABCC2 3 ABCG2 4 CYP2D6 5 CYP3A4 6 CYP3A5 7 GATM 8 SLCO1B1

Thus, the present invention, in one aspect, a single base polymorphism having a thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 1 (GenBank SNP database, rs72655363); A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 2 (GenBank SNP database, rs550110479); And a genetic marker or a combination thereof, comprising one or more mutations selected from the group consisting of a single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 3, wherein the genetic marker or a combination thereof is detected The subject is related to a genetic marker or a combination thereof, characterized in that the administered statin concentration in the blood is maintained higher than the control group.

As used herein, the term “statin” refers to a set of drugs that reduce cholesterol synthesis in the blood and liver by inhibiting HMG-CoA reductase, for example simvastatin, atorvastatin, serivastatin (cerivastatin), lovastatin, pitavastatin, rosuvastatin, pravastatin, fluvastatin and mevastatin, but are not limited to This includes all drugs known to be statin-based drugs or to be found to belong to statins in the future.

In the present specification, the meaning of “statin concentration is maintained higher than that of the control group” means that the concentration of statin in the blood is significantly higher when the reference time elapses after administration of the statin compared to the individual without the genetic marker or a combination thereof of the present invention. In comparison, it means that the dose or frequency of administration should be kept low. Specifically, it means 50% or more higher than the control group, more specifically 150% or higher, and most specifically 500%. It means high case.

In the present specification, the term “reference time” refers to a reference time point for comparison with an initial value of statin concentration after administration of a therapeutically effective amount of statin, specifically, 2 hours after administration, and more specifically, 12 after administration. It means time, and most specifically, 24 hours after administration.

In the present invention, the genetic marker, the genetic marker or a combination thereof,

Single base polymorphism with cytosine (C) at the 101st position of the base sequence represented by SEQ ID NO: 4 (GenBank SNP database, rs58708491),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 5 (GenBank SNP database, rs776746),

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 6 (GenBank SNP database, rs551294038),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 7 (GenBank SNP database, rs28364274),

Single base polymorphism having adenine (A) at position 101 of the nucleotide sequence represented by SEQ ID NO: 8 (GenBank SNP database, rs72552713),

Single nucleotide polymorphism having guanine (G) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 9 (GenBank SNP database, rs72559747),

Single base polymorphism having adenine (A) at position 101 of the nucleotide sequence represented by SEQ ID NO: 10 (GenBank SNP database, rs182367277),

Single nucleotide polymorphism having thymine (T) at position 101 of the nucleotide sequence represented by SEQ ID NO: 11 (GenBank SNP database, rs2291075),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 12 (GenBank SNP database, rs148697674),

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 13 (GenBank SNP database, rs1481012),

Single base polymorphism with cytosine (C) at position 101 of the nucleotide sequence represented by SEQ ID NO: 14 (GenBank SNP database, rs186907101),

Single base polymorphism with cytosine (C) at the 101st position of the base sequence represented by SEQ ID NO: 15 (GenBank SNP database, rs4363657),

A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 16 (GenBank SNP database, rs72554040), and

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 17 (GenBank SNP database, rs4149086)

It may be characterized in that it further comprises one or more variations selected from the group consisting of.

The present invention also, a single base polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 31 (GenBank SNP database, rs15524); A mutation in which thymine (T), thymine (T), and cytosine (C) at positions 101 to 103 of the nucleotide sequence represented by SEQ ID NO: 32 are deleted (GenBank SNP database, rs781599319); And a single marker polymorphism having a guanine (G) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 33 (GenBank SNP database, rs28371759), or a genetic marker comprising one or more variations selected from the group consisting of The individual in which the genetic marker or a combination thereof has been detected relates to the genetic marker or a combination thereof, characterized in that the administered statin concentration in the blood is kept low compared to the control group.

In the present specification, the meaning of “maintaining a statin concentration lower than that of a control group” means that the concentration of statin in the blood is significantly lower when the reference time elapses after administration of the statin compared to an individual without the genetic marker or a combination thereof of the present invention. In comparison, it means that the dose or frequency of administration should be kept high, specifically, 40% or more lower than the control group, more specifically 30% or lower, and most specifically 25%. It means low case.

In the present invention, the gene marker or a combination thereof,

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 18 (GenBank SNP database, rs1448784),

Single base polymorphism having adenine (A) at position 101 of the nucleotide sequence represented by SEQ ID NO: 19 (GenBank SNP database, rs1049518),

Single base polymorphism with cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 20 (GenBank SNP database, rs761999329),

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 21 (GenBank SNP database, rs1049508),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 22 (GenBank SNP database, rs1135822),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 23 (GenBank SNP database, rs717620),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 24 (GenBank SNP database, rs28371725),

Single base polymorphism with cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 25 (GenBank SNP database, rs12721627),

A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 26 (GenBank SNP database, rs4149036),

Single base polymorphism with cytosine (C) at the 101st position of the base sequence represented by SEQ ID NO: 27 (GenBank SNP database, rs1135840),

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 28 (GenBank SNP database, rs2306282),

A single nucleotide polymorphism having cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 29 (GenBank SNP database, rs4149085), and

Single nucleotide polymorphism with guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 30

It may be characterized in that it further comprises one or more variations selected from the group consisting of.

In the present invention, the control group may be characterized in that it does not include the mutation.

The term “variation” in the present invention means a base sequence different from the reference chromosome sequence, and may be a single base variation, a single base polymorphism (SNP), insertion, deletion, indel, overlap, substitution, translocation, but is not limited thereto. .

In the present invention, the reference chromosome sequence is a base sequence of a reference group that can be compared, such as a standard base sequence database, and refers to a base sequence of a population of people who do not currently have a specific disease or condition. In the present invention, the standard base sequence in the standard chromosome sequence database of the reference group may be a reference chromosome registered in public health organizations such as NCBI.

In the present invention, the NCBI refSNP ID for the SNP indicates the sequence of the SNP and its position. Those skilled in the art can easily confirm the position and sequence of the SNP using the number. The specific sequence corresponding to the refSNP ID of the SNP registered in the NCBI may be slightly changed depending on the research results of the gene to be continued, and it will be apparent to those skilled in the art that such modified sequence is also included within the scope of the present invention.

The sequence information of the gene marker developed in the present invention is as disclosed in Table 2 below.

Gene marker sequence SeqID RS # Seq One rs72655363 TAGTGAAACACATTGTTAAGGGGAGAAAAAAAGCCACTTCTGCTTCTGTGTTTCCAAACAGCATTGCATTGATTCAGTAAGATGTTATTTTTGAGGAGTTCCTGGTCCTTTCACTAAGAATTTCCACATCTTTTATGGTGGAAGTATAAATAAGCCTATGAACTTATAATAAAACAAACTGTAGGGAAA 2 rs550110479 TGCATCAGGTCCACCAGGAGCAGGAAGATGGCCACTATCACGGCCAGGGGCACCAGTGCTTCTAGCCCCATACCTGCCTCACTACCAAATGGGCTCCTCTGGACACACCTGGCACCCCCACCCCACCAGGCACAGAGGACCAGGCAGGACACTCTCAGCACACCGAGCGCGTAGAGACTTC 3 - AGTCCACCATGCCTAGCTAATTTGTGTATTTTTAGTAGAGATGGGGTTTCAACCATGTAGGCCAGGCTTGTCTTGAACTCCTGACCTCAGGCGATCCACCCGGCTCAGCCTCCCAAACTGCTAGGATTACAGGCGTGAGCCACTGTGCCTGATCAAAAAAGGCATAATTAAACTTAGACATT 4 rs58708491 TGGTTACCTTTGTGGGACTCAGTTTCTTTCGAATTCTGGGAGTCAATCATCAGCTGAAGGAAATCTAGTCGGTGCTAGAAGCAAAAGGAGAGATTTCTTTGGCAGAAAGTGACTCGTGAAGTCAGAAGTAAATCAAAAGTGCAGTCCTCAACCTCCCTTCTTGACTTCCCTCCCTCACCTCTGACT 5 rs776746 TCTAGTTCATTAGGGTGTGACACACAGCAAGAGTCTCACACAGGAGCCACCCAAGGCTTCATATGATGAAGGGTAATGTGGTCCAAACAGGGAAGAGATACTGAAAGACAAAAGAGCTCTTTAAAGAGATTATGGTTAGAAATGACAGTAGAGCATTCGTTAAGCTGGGTGGTACATACGTGGGTATCCTATCTCTAT 6 rs551294038 TTCTAGTTCATTAGGGTGTGACACACAGCAAGAGTCTCACACAGGAGCCACCCAAGGCTTCATATGATGAAGGGTAATGTGGTCCAAACAGGGAAGAGATACTGAAAGACAAAAGAGCTCTTTAAAGAGATTATGGTTAGAAATGACAGTAGAGCATTCGTTAAGCTGGGTGGTACATACGTGGGTATCCTCT 7 rs28364274 GTCAGAGTTCACTGGCGCTTTGTTCCAGCCTGGACACTGACCATTGAAAAATAGATGCCTTTCTGTGCCAGCAGCTGCTGATGCGTGCCATGCTCCTTGACTCTGCCATTCTGAAACACCACTATTAAGTCTGCATTCTGGATGGTGGACAGGCGGTGAGCAATCACAATGCTT 8 rs72552713 TGTCACATAATCAACTGGAAGCACATTGAACTATCAGCCAAAGCACTTACCCATATAGAAACAGAGGAAACAGAAAATGCAAACCCACTAATACTTACTTGTACCACGTAACCTGAATTACATTTGAAATTGGCAGGTCGCGGTGCTCCATTTATCAGAACATCTCCAGATAATCCACTTGGATCTTTCAG 9 rs72559747 TTTTAGATATAAATGTATATTTAAGTTGCATTCAAATATTTTCTTTATTTTTACAATTTTACAGGTTTTTTCCAGTCTTTTAAAAGCATCCTTACTAATCCCCTGTATGTTATGTTTGTGCTTTTGACGTTGTTACAAGTAAGCAGCTATATTGGTGCTTTTACTTATGTCTTCAAATACGTAGCAACAG 10 rs182367277 TATCAGTCCAGGAACTTTCCTTCCTGCCTGCTCTTGGGGCAGGAGAAAGAATGAGAGAGGAAACTTGGCAGCCCCCAAAGTAGATCCTGCAGCTACCAGGGAACATTGAGGCTTTCCGAGTAAACTAGCCTCGAGGAAATGTCCCGAGTGAAATTAACAGCTCTCCTATCTCCTTGGGTTCCACTC 11 rs2291075 CTGGGTCATACATGTGGATATATGTGTTCATGGGTAATATGCTTCGTGGAATAGGGGAGACTCCCATAGTACCATTGGGGCTTTCTTACATTGATGATTTCGCTAAAGAAGGACATTCTTCTTTGTATTTAGGTAATGTACACAAAATATTAAATTGTATGATCACTTTCCCTTTGTCTACTTTTGAAATAGTAGTT 12 rs148697674 GCTTTATTGCTAAGACACTAGGTGCAATTATTATGAAAAGTTCCATCATTCATATAGAACGGAGATTTGAGATATCCTCTTCTCTTGTTGGTTTTATTGACGGAAGCTTTGAAATTGGTAACATTTATTTTCTATTTTAATAACCAAACTTGCAAAGTTAAAAAATATATATGCTTTACACCACTGGTTCAACT 13 rs1481012 TAAGAAATGGTCACTGTAACTAGGAAGCAGAATATAGGCCCAGTAGAAATACACACATGCATGCACATTGAAATAAGACAAGAAAGATACCTAAATAACAAGCTGGTGCTACAAAAATGAAGAAAAATACTAGCACCAAATGGAACAAACACATTTTGAAGTGATAGATTCTCATGGTATGTCTAACCAAAGA 14 rs186907101 GTCCAGGAACTTTCCTTCCTGCCTGCTCTTGGGGCAGGAGAAAGAATGAGAGAGGAAACTTGGCAGCCCCCAAAGTAGATCCTGCAGCTACCAGGGAACATTGAGGCTTTCCGAGTAAACTAGCCTCGAGGAAATGTCCCGAGTGAAATTAACAGCTCTCCTATCTCCTTGGGTTCCTTTTCTTTTTCTTTTTCTTTTT 15 rs4363657 TGCTATATTTTGGTACCAGGATGATTCTGGCTTCAAAAAAATCAGTTAAGAAAGAGTCCTTCTTTCTCAATTTTTCAGAATAATTTAGTACAGTGGGTACTCACTCTTTTTTGTATTTCCAGTAGAATTTGGCTATGAATGCATTTGGTCTAGGGCTTTTATTGATAGGCAGGTTTTTTCAGTACTGATTACA 16 rs72554040 CTACACTTAGGAGTTTTCCTAGACAGACTTCAACCAGGACCCACGCCTACTAAACAGACGAGTATCAGTCCAGGAACTTTCCTTCCTGCCTGCTCTTGGGGCAGGAGAAAGAATGAGAGAGGAAACTTGGCAGCCCCCAAAGTAGATCCTGCAGCTACCAGGGAACATTGAGGCTTTCCGAGAGA 17 rs4149086 TATATGATCCATACAAATTAAAGTGAGAGACATGGTTACTGTGTAATAAAAGAAAAAATACTTGTTCAGGTAATTCTAATTCTTAATAAAACAAATGAGTATCATACAGGTAGAGGTTAAAAAGGAGGAGCTAGATTCATATCCTAAGTAAAGAGAAATGCCTAGTGTCTATTTTATTAAACAAACAAACACAGTAG 18 rs1448784 GGAAATACATCAAGTGTCATTTCAAAAATAACCCAGGGGTAAGGAAGGAAGTAGTGACTGGGAGAATGGCTGAGTAGGCTTTTGTGTGCTACAATCTTCTATTTCTTGACCTGAATTGATGGTTGCACATGTGTGTTCATTTTAATTCACTGAACTATATTTTTTGGTACATTACCCTTCAACTAAAAAAAAAA 19 rs1049518 CAAGAGCCACATTCCTATAATTTACTTATACTAAAATGACTAGACCAATGCCAAATTCAATCTGGAACACAAAAGTTTATTAGAATAAAAATACACATACGGTATCAACACTAAAATTATTTCACATCGCATTTAGGTTTTACCTCCATTAGTTTTTTTTAATGCTTATAAAGTCTATGCTCTAAATAATTGCATT 20 rs761999329 TGACATTTTCACGGCCATAGCGAATGTTTTCAGCTATCGTGGTGGCAAACAATACAGGTTCCTGACTCACCACACCAATGATTTCCCGTAGAAACCTTACATTTATGGTCCTAATATCCTGTCCATCAACACTGACCTGGAATAAAAAGTAAGTGTGACTTTCATACATTTGTAATTGAAAGGGCAACATCA 21 rs1049508 ATGCAGTGTATCTATCAGATATTGAATATCAAAACTTAAGGATGGGAACTGATAGCGAAATCCAATTACACTAAACATTCCTAAATTTTTGGAAAGAGAGAAAAAGATTAAAATAATTCACTTGAAATGAGGTAAGATGTATATGAAAAGGTTTTTAGTAGCATATATCACAATGTTGAGATGAGATTAAAAATA 22 rs1135822 ACCCACTGCTCCAGCGACTTCTTGCCCAGGCCCAAGTTGCGCAAGGTGGAGACGGAGAAGCGCCTCTGCTCGCGCCACGCGGGCCCATAGCGCGCCAGGAACACCCCTGGGGGTGGGACGGGCACGTGCGCGTGGCCATGAAGGCATTAGCCCCACCCCCCCCCCCCCCCCC 23 rs717620 CTTTACGGAGAACATCAGAATGGTAGATAATTCCTGTTCCACTTTCTTTGATGAAACAAGTAAAGAAGAAACAACACAATCATATTAATAGAAGAGTCTTCGTTCCAGACGCAGTCCAGGAATCATGCTGGAGAAGTTCTGCAACTCTACTTTTTGGGTGAGAAATTACATTTATCTTCATATTGACTCTTCAGACT 24 rs28371725 TCCTATGTTGGAGGAGGTCAGGCTTACAGGATCCTGGTCAAGCCTGTGCTTGGAGCCCCGGGTGTCCCAGCAAAGTTCATGGGCCCCCGCCTGTACCCTTCCTCCCTCGGCCCCTGCACTGTTTCCCAGATGGGCTCACGCTGCACATCCGGATGTAGGATCATGAGCGGAGT 25 rs12721627 TGGATCCAAAAAATCAAATCTTAAAAGCTTCTTGGTGTTTTCCACAAAGGGGTCTTGTGGATTGTTGAGAGAGTCGATGTTCACTCCAAATGATGTGCTAGTGATCACATCCATGCTGTAGGCCCCAAAGACGCTGAGTGGAGAAAGATGTGGAAAATTAAAATCAGCACCTTTTTACCATCCCCTC 26 rs4149036 GATAGTAAGTGTTAAAAAAAAAAAAAACCTCTGTGCCACTATCAGTACCTTGTAAATTAGGAGTAGAATTTTATTATTATCCCTTTAAATAGGCAGTTACCTTTTGAGAAGATACCCACTAAGTGTGTACAGAAATGAAATAGTGTCTATTTGTCTACATAATCATTTTATTTATCGTAGCTTTCATATACTTTGAAATA 27 rs1135840 CATTGCTTTATTGTACATTAGAGCCTCTGGCTAGGGAGCAGGCTGGGGACTAGGTACCCCATTCTAGCGGGGCACAGCACAAAGCTCATAGGGGGATGGGGTCACCAGGAAAGCAAAGACACCATGGTGGCTGGGCCGGGGCTGTCCAGTGGGCACCGAGAAGCTGAAGTGCTGCAGCAGAGAGAGAGAGAGAGAG 28 rs2306282 TCTTACAGTTACAGGTATTCTAAAGAAACTAATATCAATTCATCAGAAAATTCAACATCGACCTTATCCACTTGTTTAATTAATCAAATTTTATCACTCAATAGAGCATCACCTGAGATAGTGGGAAAAGGTAAGAATTAATATTGACAGTAAAAAGTCTTCTAAAATGTATACATTTAATTACATCTCTAAAAATTGTT 29 rs4149085 TATTTTTGAGGAGTTCCTGGTCCTTTCACTAAGAATTTCCACATCTTTTATGGTGGAAGTATAAATAAGCCTATGAACTTATAATAAAACAAACTGTAGGTAGAAAAAATGAGAGTACTCATTGTTACATTATAGCTACATATTTGTGGTTAAGGTTAGACTATATGATCCATACAAATTAAAGTGAGAGACATGGTT 30 - CCACATTCCTATAATTTACTTATACTAAAATGACTAGACCAATGCCAAATTCAATCTGGAACACAAAAGTTTATTAGAATAAAAATACACATACGGTATCAACACTAAAATTATTTCACATCGCATTTAGGTTTTACCTCCATTAGTTTTTTTTAATGCTTATAAAGTCTATGCTCTAAATAATTTGCACATTTTA 31 rs15524 CAGTACATTAGATTAAGCCCATCTTTATTTCAAGGTTTTATTGACTAAGTTGAAATCTCTGGTGTTCTGGGGCACAGCTTTCTTGAAGACCAAAGTAGAAATCCTTAGAATAACTCATTCTCCACTTAGGGTTCCATCTCTTGAATCCACCTTTAGAACAATGGGTTTTTCTGGTTGAAGAAGTCCTTGGT 32 rs781599319 TCAGAGCTGGAGGCTAGAAATAAATTACTCAAATCTCGCAACTATGTAAACTATGAAAATGAAACAAGCTAGTTACCTTTTATTGTTCAGTTTAAAAAAGTTCTTCTTCTTTGCTCCTCCATTGCGGTCCCCTTCAAGATCCATTCCGACCTGAAGAGAAACCGCAGCTCATTAGCCAAATGCATGCC 33 rs28371759 ATCAGGGTGAGTGGCCAGTTCATACATAATGAAGGAGAGAACACTGCTCGTGGTTTCATAGCCAGCAAAAATAAAGATAATTGATTGGGCCACGAGCTCCAGATCGGACAGAGCTGAAAGGAGAGGAAAGACATTTTAGGTAAATCAGATCAATGTAGGGCATCACAGTTTAGATGAAGAGAAATCTAAGTGAAG

Identification of the genotype of the SNP of the present invention includes sequencing analysis, sequencing analysis using an automatic sequencing analyzer, pyrosequencing, hybridization by microarray, restriction fragment length polymorphism (PCR-RELP), PCR-SSCP method ( Single strand conformation polymorphism), PCR-SSO method (specific sequence oligonucleotide), PCR-SSO method and dot hybridization method (allele specific oligonucleotide) hybridization method, TaqMan-PCR method, MALDI-TOF / MS method, RCA method ( rolling circle amplification), HRM (high resolution melting) method, primer extension method, Southern blot hybridization method, dot hybridization method, and the like. Furthermore, the results of the SNP polymorphism can be statistically processed using a statistical analysis method commonly used in the art, for example, Student's t-test, Chi-square test (Chi- Continuous variables, categorical variables, odds ratio, and 95 obtained through square test, linear regression line analysis, multiple logistic regression analysis, etc. It can be analyzed using variables such as% confidence interval.

In another aspect, the present invention relates to a method for providing information for predicting a statin concentration in a blood of an individual administered statin, comprising detecting a variation of the gene marker or a combination thereof in a biological sample isolated from the individual. .

In the present invention, when a “biological sample” is a sample of mammalian or human origin, the sample may be derived from a specific tissue or organ. Representative examples of tissue include connective, skin, muscle or nerve tissue. Typical examples of organs are the eye, brain, lungs, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testicle, ovary, uterus, rectum, nervous system, Lines and internal blood vessels are included. The biosample to be analyzed includes any cell, tissue, fluid from a biological source, or any other medium that can be well analyzed by the present invention, which is the consumption of humans, animals, humans or animals. Samples from foods prepared for are included. In addition, the biological sample to be analyzed includes a body fluid sample, which includes blood, serum, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extract (eg, brain crushed matter), spinal fluid, appendix, and spleen And tonsil tissue extract, but is not limited thereto.

In another aspect, the present invention relates to a primer composition for predicting blood statin concentration in a subject administered with a statin that specifically hybridizes with a polynucleotide composed of 10 or more consecutive bases around the mutation site or a mutation or a complementary polynucleotide thereof. will be.

In the present invention, the appropriate length of the primer may vary depending on the purpose of use, but may generally consist of 15 to 30 bases. The primer sequence need not be completely complementary to the template, but must be sufficiently complementary to hybridize with the template. The primer can hybridize to the DNA sequence containing the mutation to amplify the DNA fragment containing the mutation. The primer of the present invention can be used in a diagnostic kit or a prediction method for predicting the statin concentration in the blood by detecting alleles.

In the present invention, the periphery of this position can be used without limitation as long as it is a nucleotide sequence of the same chromosome that does not directly include the mutation site, but specifically, 1 to 1000 bp upstream of the mutant position and 3 'downstream. It may be 1 to 1000 bp, and more specifically, may be 1 to 200 bp 5 'upstream of the mutation site, and 1 to 200 bp 3' downstream, but is not limited thereto.

In another aspect, the present invention is for predicting blood statin concentration in a subject administered with a statin that specifically hybridizes with the polynucleotide consisting of the mutation site or 10 or more consecutive bases containing the mutation or a complementary polynucleotide thereof. It relates to a probe composition.

In the present invention, the probe may be allele-specific, which means to hybridize specifically to each allele. That is, it refers to hybridization so that the bases of the mutations present in the polymorphic sequence can be specifically distinguished. Here, hybridization is usually carried out under strict conditions, for example, salt concentrations below 1M and temperatures above 25 ° C. For example, conditions of 5XSSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 ° C. may be suitable for allele specific probe hybridization.

In the present invention, the probe means a hybridization probe, and means an oligonucleotide capable of specifically binding to a complementary strand of a nucleic acid. The allele-specific probe of the present invention has a variation among nucleic acid fragments derived from two individuals of the same species, and may hybridize to DNA fragments derived from one individual, but not fragments derived from another individual. In this case, the hybridization conditions must be strict enough to hybridize to only one of the alleles, showing a significant difference in hybridization strength between alleles. In the probe of the present invention, it is preferable that the central region is aligned with a variation of the polymorphic sequence. Accordingly, it is possible to cause a good hybridization difference between different allelic forms. The probe of the present invention can be used in a diagnostic kit or a prediction method for predicting statin concentration in the blood by detecting alleles.

The present invention also relates to a composition for predicting the concentration of statins in the blood of an individual administered with a statin containing an antibody or an aptamer that specifically binds a polypeptide encoded by a polynucleotide containing the mutation.

In another aspect, the present invention relates to a kit for predicting the concentration of statin in the blood comprising any one of the above compositions.

In the present invention, the kit may include the polynucleotide, antibody, and aptamer of the present invention, as well as one or more other component compositions, solutions, or devices suitable for analytical methods. In one aspect, the kit of the present invention may be a kit containing essential elements necessary to perform PCR, test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water (DEPC-water) and sterile water may be further included. In another aspect, the kit of the present invention may be a kit for predicting the concentration of statins in the blood that includes an essential element necessary for performing a DNA chip, and the DNA chip kit is attached with a specific polynucleotide, primer or probe for the SNP. The substrate may include a nucleic acid corresponding to a quantitative control gene or a fragment thereof.

In another aspect, the present invention, (a) a single nucleotide polymorphism having a thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 1 (GenBank SNP database, rs72655363); A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 2 (GenBank SNP database, rs550110479); And a gene marker or a combination thereof comprising at least one mutation selected from the group consisting of a single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 3, and a combination of the nucleotide sequence represented by SEQ ID NO: 31 Single base polymorphism with guanine (G) at position 101 (GenBank SNP database, rs15524); A mutation in which thymine (T), thymine (T), and cytosine (C) at positions 101 to 103 of the nucleotide sequence represented by SEQ ID NO: 32 are deleted (GenBank SNP database, rs781599319); And a single marker polymorphism having a guanine (G) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 33 (GenBank SNP database, rs28371759), to detect a gene marker or a combination thereof comprising one or more mutations step; And (b) a single nucleotide polymorphism having thymine (T) at position 101 of the nucleotide sequence represented by SEQ ID NO: 1 (GenBank SNP database, rs72655363); A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 2 (GenBank SNP database, rs550110479); And if any one of the gene markers including at least one variation selected from the group consisting of a single base polymorphism having thymine (T) at the 101st position of the nucleotide sequence shown in SEQ ID NO: 3, statin concentration in the blood is normal A single nucleotide polymorphism having a guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 31 (GenBank SNP database, rs15524); A mutation in which thymine (T), thymine (T), and cytosine (C) at positions 101 to 103 of the nucleotide sequence represented by SEQ ID NO: 32 are deleted (GenBank SNP database, rs781599319); And when any one of the gene markers including one or more mutations selected from the group consisting of a single nucleotide polymorphism (GenBank SNP database, rs28371759) having guanine (G) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 33 , It relates to a method for predicting blood statin concentration in an individual administered statins, which determines that the blood statin concentration is lower than normal.

In the present invention, step (a) is a single nucleotide polymorphism having cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 4 (GenBank SNP database, rs58708491),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 5 (GenBank SNP database, rs776746),

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 6 (GenBank SNP database, rs551294038),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 7 (GenBank SNP database, rs28364274),

Single base polymorphism having adenine (A) at position 101 of the nucleotide sequence represented by SEQ ID NO: 8 (GenBank SNP database, rs72552713),

Single nucleotide polymorphism having guanine (G) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 9 (GenBank SNP database, rs72559747),

Single base polymorphism having adenine (A) at position 101 of the nucleotide sequence represented by SEQ ID NO: 10 (GenBank SNP database, rs182367277),

Single nucleotide polymorphism having thymine (T) at position 101 of the nucleotide sequence represented by SEQ ID NO: 11 (GenBank SNP database, rs2291075),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 12 (GenBank SNP database, rs148697674),

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 13 (GenBank SNP database, rs1481012),

Single base polymorphism with cytosine (C) at position 101 of the nucleotide sequence represented by SEQ ID NO: 14 (GenBank SNP database, rs186907101),

Single base polymorphism with cytosine (C) at the 101st position of the base sequence represented by SEQ ID NO: 15 (GenBank SNP database, rs4363657),

A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 16 (GenBank SNP database, rs72554040), and

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 17 (GenBank SNP database, rs4149086),

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 18 (GenBank SNP database, rs1448784),

Single base polymorphism having adenine (A) at position 101 of the nucleotide sequence represented by SEQ ID NO: 19 (GenBank SNP database, rs1049518),

Single base polymorphism with cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 20 (GenBank SNP database, rs761999329),

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 21 (GenBank SNP database, rs1049508),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 22 (GenBank SNP database, rs1135822),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 23 (GenBank SNP database, rs717620),

Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 24 (GenBank SNP database, rs28371725),

Single base polymorphism with cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 25 (GenBank SNP database, rs12721627),

A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 26 (GenBank SNP database, rs4149036),

Single base polymorphism with cytosine (C) at the 101st position of the base sequence represented by SEQ ID NO: 27 (GenBank SNP database, rs1135840),

Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 28 (GenBank SNP database, rs2306282),

A single nucleotide polymorphism having cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 29 (GenBank SNP database, rs4149085), and

Single nucleotide polymorphism with guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 30

It may be characterized in that it further comprises the step of detecting one or more mutations selected from the group consisting of.

In the present invention, the rs58708491, rs776708, rs551294038, rs28364274, rs72552713, rs72559747, rs182367277, rs2291075, rs148697674, rs1481012, rs186907101, rs4363657, rs72554040 and rs41454086 are selected from the group consisting of one or more stars, rs41454086 The statin concentration in the blood of an individual is determined to be higher than normal, and the nucleotide sequence represented by SEQ ID NO: 30 of SEQ ID NO: 30 of rs1448784, rs1049518, rs761999329, rs1049508, rs1135822, rs717620, rs28371725, rs12721627, rs4149036, rs1135840, rs2306282, rs4149085 and SEQ ID NO: 30 And when one or more mutations selected from the group consisting of monobasic polymorphism having guanine (G) at the position are detected, further comprising determining that the statin concentration in the blood of the individual administered statin is lower than normal. Can be done with

As used herein, the term "administration" refers to the introduction of statins into a patient in any suitable way. The route of administration of statins can be administered through various routes, oral or parenteral, as long as the target tissue can be reached, specifically, oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial, transdermal, non- It may be administered in a conventional manner via intralateral, inhalation, intraocular or intradermal routes.

Statins may be administered orally or parenterally, and when parenterally administered, it is preferable to select an external or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection injection method. It does not work.

 The preferred dosage of statin depends on the patient's condition and body weight, the degree of disease, the drug form, the route and duration of administration, but can be appropriately selected by those skilled in the art. However, for the desired effect, statins are preferably administered at 0.0001 to 100 mg / kg per day, preferably 0.001 to 10 mg / kg, but are not limited thereto. The administration may be administered once a day, or may be divided into several times. The above dosage does not limit the scope of the present invention in any way.

It is obvious to those skilled in the art that the appropriate total daily use amount of statins can be determined by the treating physician within the proper medical judgment. The specific therapeutically effective amount for a particular patient includes the specific composition, patient's age, weight, general health status, gender and diet, time of administration, including the type and extent of response desired to be achieved and, in some cases, whether other agents are used. It is desirable to apply differently depending on the route of administration, the rate of secretion of statins, the duration of treatment, and various factors including drugs used with or concurrently with the specific composition and similar factors well known in the pharmaceutical field.

Example

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example 1. Construction of a prediction model for statin concentration in blood

For a total of 66 subjects receiving atorvastatin treatment (10 mg / day 17, 20 mg / day 44, 40 mg / day 5), a library was prepared using IDT xGen Custom Panel and Ion Ampliseq Custom Panel. Targeted sequencing was performed on MiSeq Dx equipment. The list of test genes is shown in Table 1, all of which have been reported in existing literature to affect blood levels of statin drugs (Gryn SE and Hegele RA.Pharmacogenomics, lipid disorders, and treatment options.Clin Pharmacol Ther. 2014; 96 (1): 36-47.) The average drug dosage, blood drug concentration, number of concurrent medications, age, weight, etc. of 66 patients are listed in Table 3.

 66 average drug dosage, blood drug concentration, number of concurrent drugs, age, weight information Item Average Standard Deviation Medication dosage (atorvastatin), mg / day 19.39 7.82 Blood drug concentration (atorvastatin), ng / mL 20.14 31.73 Number of simultaneous medications, number 3.04 1.05 Age, years 66.50 8.70 Weight, kg 66.36 9.71

A total of three steps were performed to construct a set of predicted statin drug concentration variations. In step 1, it was confirmed that the significance level of P> 0.05 was satisfied when the Shapiro-Wilk test or the Kolmogorov-Smirnov test was performed on the normality of the data distribution. If not, data conversion (Log substitution, root substitution, etc.) was performed until normality was satisfied.

In step 2, the results of the genotypes generated for blood drug concentration, drug dosage, number of co-drugs, age, and weight information were set as variances and multi-linear regression analysis was performed. The method (Stepwise Method) was used. In the blood drug concentration prediction model optimization, the variable input criterion was P <0.05 and the variable elimination criterion was P> 0.1 as the initial value. Drug dosage, number of concurrent medications, age, weight, etc. were not removed because they correspond to confounding variables.

In step 3, the explanatory power (R-squared, Explanatory Power) of the blood drug concentration prediction model optimized by the stepwise variable input method satisfies 80% or more of explanatory power (R-squared 0.8 or higher), and at the same time F for the significance of the predictive model. -It was confirmed that P <0.05 was achieved in the test. If the criteria are not satisfied, the variable input criteria of the stepwise variable input method were adjusted. A series of processes are disclosed in FIG. 1, and 33 gene mutation sets for predicting statin blood drug concentration were identified (Table 4).

R-squared value of genetic variation set and regression model for predicting statin drug concentration Sequence number Variable name Reference value Confrontation rs number gene Regression coefficient Standard error t statistic p value Weight (kg) - - - - 0.02 0.15 1.05 0.305 Dose (mg / day) - - - - 0.12 0.02 6.02 <.001 Concurrent medications - - - - -0.43 0.12 -3.42 0.002 age - - - - -0.01 0.02 -0.64 0.528 gender - - - - 0.51 0.27 1.88 0.071 One chr12.21392205 C T rs72655363 SLCO1B1 6.58 0.86 7.65 <.001 2 chr22.42526823 G A rs550110479 CYP2D6 6.53 1.24 5.27 <.001 3 chr7.99355039 C T . CYP3A4 4.7 0.77 6.14 <.001 4 chr7.99260532 G C rs58708491 CYP3A5 4.24 0.59 7.17 <.001 5 chr7.99270539 C T rs776746 CYP3A5 2.71 0.89 3.03 0.005 6 chr7.99270538 A G rs551294038 CYP3A5 2.66 0.55 4.88 <.001 7 chr7.87133651 C T rs28364274 ABCB1 2.55 0.45 5.72 <.001 8 chr4.89052957 G A rs72552713 ABCG2 2.21 0.71 3.13 0.004 9 chr12.21353478 C G rs72559747 SLCO1B1 1.5 0.57 2.61 0.145 10 chr4.89152386 G A rs182367277 ABCG2 1.22 0.63 1.92 0.065 11 chr12.21331625 C T rs2291075 SLCO1B1 1.21 0.68 1.79 0.086 12 chr12.21325709 C T rs148697674 SLCO1B1 1.09 0.72 1.51 0.143 13 chr4.89039082 A G rs1481012 ABCG2 0.84 0.2 4.2 <.001 14 chr4.89152391 T C rs186907101 ABCG2 0.83 0.73 1.14 0.264 15 chr12.21368722 T C rs4363657 SLCO1B1 0.66 0.39 1.68 0.104 16 chr4.89152324 G A rs72554040 ABCG2 0.56 0.8 2.79 0.009 17 chr12.21392451 A G rs4149086 SLCO1B1 0.5 0.29 1.75 0.092 18 chr4.89012320 A G rs1448784 ABCG2 -0.19 0.2 -0.93 0.359 19 chr15.45653367 G A rs1049518 GATM -0.66 0.51 -1.28 0.211 20 chr7.87179335 A C rs761999329 ABCB1 -1.03 0.82 -1.26 0.22 21 chr15.45653592 A G rs1049508 GATM -1.18 0.28 -4.18 <.001 22 chr22.42525182 A T rs1135822 CYP2D6 -1.22 0.39 -3.1 0.004 23 chr10.101542578 C T rs717620 ABCC2 -1.28 0.19 -6.63 <.001 24 chr22.42523805 C T rs28371725 CYP2D6 -1.3 0.61 -2.13 0.042 25 chr7.99366093 G C rs12721627 CYP3A4 -1.33 0.78 -1.71 0.098 26 chr12.21327740 C A rs4149036 SLCO1B1 -1.33 0.57 -2.33 0.028 27 chr22.42522613 G C rs1135840 CYP2D6 -1.65 0.16 -10.26 <.001 28 chr12.21329802 A G rs2306282 SLCO1B1 -1.74 0.87 -2 0.056 29 chr12.21392290 T C rs4149085 SLCO1B1 -1.77 0.32 -5.54 <.001 30 chr15.45653373 A G . GATM -1.83 0.97 -1.88 0.071 31 chr7.99245914 A G rs15524 CYP3A5 -3.46 0.86 -4.04 <.001 32 chr7.87229456 TTC - rs781599319 ABCB1 -3.9 0.74 -5.3 <.001 33 chr7.99361626 A G rs28371759 CYP3A4 -4.67 0.67 -6.99 <.001 Adjusted R-squared value of regression model 0.8719 P-value for F-test <.001

Table 4 shows the R-squared values of genetic variation sets and regression models for predicting statin blood drug concentration. A regression model was established, including 5 perturbation variables such as weight, dosage, number of concurrent medications, age, and gender, and 33 genotypes. Among them, the variable with a negative regression coefficient can be judged as having a sequence corresponding to the allele affecting the decrease in the drug concentration of statins. For the variable with a positive regression coefficient, the sequence corresponding to the allele affects the increase in drug concentration. It was confirmed that it can be predicted by giving.

The adjusted R-squared value for the entire regression model was 0.8719, and the p-value of the F-test satisfies the significance level, confirming that there is 87.19% explanatory power for predicting statin blood drug concentration.

Example 2. Confirmation of the performance of the blood statin concentration prediction model

The correlation between the statin drug concentration value predicted by the regression model and the actual drug concentration value was analyzed. As a result, it was confirmed that the Pearson correlation coefficient was 0.976, and the statin drug concentration prediction model was very closely related to the result of the actual blood drug concentration (FIG. 2).

Since the specific parts of the present invention have been described in detail above, it will be apparent to those of ordinary skill in the art that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

                         SEQUENCE LISTING <110> Green Cross Genome Corporation   <120> Markers for predicting concentration of statin in blood <130> P18-B195 <160> 33 <170> PatentIn version 3.5 <210> 1 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 1 tagtgaaaca cattgttaag gggagaaaaa aagccacttc tgcttctgtg tttccaaaca 60 gcattgcatt gattcagtaa gatgttattt ttgaggagtt cctggtcctt tcactaagaa 120 tttccacatc ttttatggtg gaagtataaa taagcctatg aacttataat aaaacaaact 180 gtaggtagaa aaaatgagag t 201 <210> 2 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 2 tgcatcaggt ccaccaggag caggaagatg gccactatca cggccagggg caccagtgct 60 tctagcccca tacctgcctc actaccaaat gggctcctct ggacacacct ggcaccccca 120 ccccaccagg cacagaggac caggcaggac actctcagca caccgagcgc gtgacccttc 180 ccttataaag ggagctgatg a 201 <210> 3 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 3 agtccaccat gcctagctaa tttgtgtatt tttagtagag atggggtttc aaccatgtag 60 gccaggcttg tcttgaactc ctgacctcag gcgatccacc cggctcagcc tcccaaactg 120 ctaggattac aggcgtgagc cactgtgcct gatcaaaaaa ggcataatta aactatgaat 180 attctttcta aacaatgggc a 201 <210> 4 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 4 tggttacctt tgtgggactc agtttctttc gaattctggg agtcaatcat cagctgaagg 60 aaatctagtc ggtgctagaa gcaaaaggag agatttcttt ggcagaaagt gactcgtgaa 120 gtcagaagta aatcaaaagt gcagtcctca acctcccttc ttgacttccc tccctcaacc 180 tccctatggc ttcttgaaga c 201 <210> 5 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 5 tctagttcat tagggtgtga cacacagcaa gagtctcaca caggagccac ccaaggcttc 60 atatgatgaa gggtaatgtg gtccaaacag ggaagagata ctgaaagaca aaagagctct 120 ttaaagagat tatggttaga aatgacagta gagcattcgt taagctgggt ggtacatacg 180 tgggtatctc ctatgccact c 201 <210> 6 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 6 ttctagttca ttagggtgtg acacacagca agagtctcac acaggagcca cccaaggctt 60 catatgatga agggtaatgt ggtccaaaca gggaagagat actgaaagac aaaagagctc 120 tttaaagaga ttatggttag aaatgacagt agagcattcg ttaagctggg tggtacatac 180 gtgggtatct cctatgccac t 201 <210> 7 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 7 gtcagagttc actggcgctt tgttccagcc tggacactga ccattgaaaa atagatgcct 60 ttctgtgcca gcagctgctg atgcgtgcca tgctccttga ctctgccatt ctgaaacacc 120 actattaagt ctgcattctg gatggtggac aggcggtgag caatcacaat gcaggtgcgg 180 ccttctctgg ctttgtccag g 201 <210> 8 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 8 tgtcacataa tcaactggaa gcacattgaa ctatcagcca aagcacttac ccatatagaa 60 acagaggaaa cagaaaatgc aaacccacta atacttactt gtaccacgta acctgaatta 120 catttgaaat tggcaggtcg cggtgctcca tttatcagaa catctccaga taatccactt 180 ggatctttcc ttgcagctaa g 201 <210> 9 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 9 ttttagatat aaatgtatat ttaagttgca ttcaaatatt ttctttattt ttacaatttt 60 acaggttttt tccagtcttt taaaagcatc cttactaatc ccctgtatgt tatgtttgtg 120 cttttgacgt tgttacaagt aagcagctat attggtgctt ttacttatgt cttcaaatac 180 gtagagcaac agtatggtca g 201 <210> 10 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 10 tatcagtcca ggaactttcc ttcctgcctg ctcttggggc aggagaaaga atgagagagg 60 aaacttggca gcccccaaag tagatcctgc agctaccagg gaacattgag gctttccgag 120 taaactagcc tcgaggaaat gtcccgagtg aaattaacag ctctcctatc tccttgggtt 180 ccttttttct ccactactag c 201 <210> 11 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 11 ctgggtcata catgtggata tatgtgttca tgggtaatat gcttcgtgga ataggggaga 60 ctcccatagt accattgggg ctttcttaca ttgatgattt cgctaaagaa ggacattctt 120 ctttgtattt aggtaatgta cacaaaatat taaattgtat gatcactttc cctttgtcta 180 cttttgaaat agtagagtta c 201 <210> 12 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 12 gctttattgc taagacacta ggtgcaatta ttatgaaaag ttccatcatt catatagaac 60 ggagatttga gatatcctct tctcttgttg gttttattga cggaagcttt gaaattggta 120 acatttattt tctattttaa taaccaaact tgcaaagtta aaaaatatat atgctttaca 180 ccactggtta tcaactgggg t 201 <210> 13 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 13 taagaaatgg tcactgtaac taggaagcag aatataggcc cagtagaaat acacacatgc 60 atgcacattg aaataagaca agaaagatac ctaaataaca agctggtgct acaaaaatga 120 agaaaaatac tagcaccaaa tggaacaaac acattttgaa gtgatagatt ctcatggtat 180 gtctacccaa agaccaaaca g 201 <210> 14 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 14 gtccaggaac tttccttcct gcctgctctt ggggcaggag aaagaatgag agaggaaact 60 tggcagcccc caaagtagat cctgcagcta ccagggaaca ttgaggcttt ccgagtaaac 120 tagcctcgag gaaatgtccc gagtgaaatt aacagctctc ctatctcctt gggttccttt 180 tttctccact actagctgat t 201 <210> 15 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 15 tgctatattt tggtaccagg atgattctgg cttcaaaaaa atcagttaag aaagagtcct 60 tctttctcaa tttttcagaa taatttagta cagtgggtac tcactctttt ttgtatttcc 120 agtagaattt ggctatgaat gcatttggtc tagggctttt attgataggc aggttttttc 180 agtactgatt caaatttgga a 201 <210> 16 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 16 ctacacttag gagttttcct agacagactt caaccaggac ccacgcctac taaacagacg 60 agtatcagtc caggaacttt ccttcctgcc tgctcttggg gcaggagaaa gaatgagaga 120 ggaaacttgg cagcccccaa agtagatcct gcagctacca gggaacattg aggctttccg 180 agtaaactag cctcgaggaa a 201 <210> 17 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 17 tatatgatcc atacaaatta aagtgagaga catggttact gtgtaataaa agaaaaaata 60 cttgttcagg taattctaat tcttaataaa acaaatgagt atcatacagg tagaggttaa 120 aaaggaggag ctagattcat atcctaagta aagagaaatg cctagtgtct attttattaa 180 acaaacaaac acagagtttg a 201 <210> 18 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 18 ggaaatacat caagtgtcat ttcaaaaata acccaggggt aaggaaggaa gtagtgactg 60 ggagaatggc tgagtaggct tttgtgtgct acaatcttct atttcttgac ctgaattgat 120 ggttgcacat gtgtgttcat tttaattcac tgaactatat tttttggtac attacccttc 180 aactaaaaaa ataaaattaa a 201 <210> 19 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 19 caagagccac attcctataa tttacttata ctaaaatgac tagaccaatg ccaaattcaa 60 tctggaacac aaaagtttat tagaataaaa atacacatac ggtatcaaca ctaaaattat 120 ttcacatcgc atttaggttt tacctccatt agtttttttt aatgcttata aagtctatgc 180 tctaaataat ttgcacattt g 201 <210> 20 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 20 tgacattttc acggccatag cgaatgtttt cagctatcgt ggtggcaaac aatacaggtt 60 cctgactcac cacaccaatg atttcccgta gaaaccttac atttatggtc ctaatatcct 120 gtccatcaac actgacctgg aataaaaagt aagtgtgact ttcatacatt tgtaattgaa 180 agggcaacat cagaaagatg t 201 <210> 21 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 21 atgcagtgta tctatcagat attgaatatc aaaacttaag gatgggaact gatagcgaaa 60 tccaattaca ctaaacattc ctaaattttt ggaaagagag aaaaagatta aaataattca 120 cttgaaatga ggtaagatgt atatgaaaag gtttttagta gcatatatca caatgttgag 180 atgagaatat taaaaacatt c 201 <210> 22 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 22 acccactgct ccagcgactt cttgcccagg cccaagttgc gcaaggtgga gacggagaag 60 cgcctctgct cgcgccacgc gggcccatag cgcgccagga acacccctgg gggtgggacg 120 ggcacgtgcg cgtggccatg aaggcattag ccccaccatc caccacccac tccaacccta 180 tgctccccct ggtctcccgc a 201 <210> 23 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 23 ctttacggag aacatcagaa tggtagataa ttcctgttcc actttctttg atgaaacaag 60 taaagaagaa acaacacaat catattaata gaagagtctt cgttccagac gcagtccagg 120 aatcatgctg gagaagttct gcaactctac tttttgggtg agaaattaca tttatcttca 180 tattgactct tctcagactc a 201 <210> 24 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 24 tcctatgttg gaggaggtca ggcttacagg atcctggtca agcctgtgct tggagccccg 60 ggtgtcccag caaagttcat gggcccccgc ctgtaccctt cctccctcgg cccctgcact 120 gtttcccaga tgggctcacg ctgcacatcc ggatgtagga tcatgagcag gaggccccag 180 gccagcgtgg tcgaggtggt c 201 <210> 25 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 25 tggatccaaa aaatcaaatc ttaaaagctt cttggtgttt tccacaaagg ggtcttgtgg 60 attgttgaga gagtcgatgt tcactccaaa tgatgtgcta gtgatcacat ccatgctgta 120 ggccccaaag acgctgagtg gagaaagatg tggaaaatta aaatcagcac ctttttacca 180 tccttcctct atgcatgcaa c 201 <210> 26 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 26 gatagtaagt gttaaaaaaa aaaaaaacct ctgtgccact atcagtacct tgtaaattag 60 gagtagaatt ttattattat ccctttaaat aggcagttac cttttgagaa gatacccact 120 aagtgtgtac agaaatgaaa tagtgtctat ttgtctacat aatcatttta tttatcgtag 180 ctttcatata ctttgaaata a 201 <210> 27 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 27 cattgcttta ttgtacatta gagcctctgg ctagggagca ggctggggac taggtacccc 60 attctagcgg ggcacagcac aaagctcata gggggatggg gtcaccagga aagcaaagac 120 accatggtgg ctgggccggg gctgtccagt gggcaccgag aagctgaagt gctgcagcag 180 ggaggtgaag aagaggaaga g 201 <210> 28 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 28 tcttacagtt acaggtattc taaagaaact aatatcaatt catcagaaaa ttcaacatcg 60 accttatcca cttgtttaat taatcaaatt ttatcactca atagagcatc acctgagata 120 gtgggaaaag gtaagaatta atattgacag taaaaagtct tctaaaatgt atacatttaa 180 ttacatctct aaaaattgtt g 201 <210> 29 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 29 tatttttgag gagttcctgg tcctttcact aagaatttcc acatctttta tggtggaagt 60 ataaataagc ctatgaactt ataataaaac aaactgtagg tagaaaaaat gagagtactc 120 attgttacat tatagctaca tatttgtggt taaggttaga ctatatgatc catacaaatt 180 aaagtgagag acatggttac t 201 <210> 30 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 30 ccacattcct ataatttact tatactaaaa tgactagacc aatgccaaat tcaatctgga 60 acacaaaagt ttattagaat aaaaatacac atacggtatc aacactaaaa ttatttcaca 120 tcgcatttag gttttacctc cattagtttt ttttaatgct tataaagtct atgctctaaa 180 taatttgcac atttgtaaac a 201 <210> 31 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 31 cagtacatta gattaagccc atctttattt caaggtttta ttgactaagt tgaaatctct 60 ggtgttctgg ggcacagctt tcttgaagac caaagtagaa atccttagaa taactcattc 120 tccacttagg gttccatctc ttgaatcbca cctttagaac aatgggtttt tctggttgaa 180 gaagtccttg cgtgtctaat tt 202 <210> 32 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 32 tcagagctgg aggctagaaa taaattactc aaatctcgca actatgtaaa ctatgaaaat 60 gaaacaagct agttaccttt tattgttcag tttaaaaaag ttcttcttct ttgctcctcc 120 attgcggtcc ccttcaagat ccattccgac ctgaagagaa accgcagctc attagccaaa 180 tgcatgagcc tcaggcgcgc t 201 <210> 33 <211> 201 <212> DNA <213> Artificial Sequence <220> <223> Artifical Sequence <400> 33 atcagggtga gtggccagtt catacataat gaaggagaga acactgctcg tggtttcata 60 gccagcaaaa ataaagataa ttgattgggc cacgagctcc agatcggaca gagctgaaag 120 gagaggaaag acattttagg taaatcagat caatgtaggg catcacagtt tagatgaaga 180 gaaatctaag tgaagccctc a 201

Claims (10)

A single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 1 (GenBank SNP database, rs72655363); A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 2 (GenBank SNP database, rs550110479); And a genetic marker or a combination thereof, comprising one or more mutations selected from the group consisting of a single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 3, wherein the genetic marker or a combination thereof is detected In the individual, the administered statin concentration in the blood is maintained higher than the control group.
According to claim 1, wherein the genetic marker or a combination thereof,
Single base polymorphism with cytosine (C) at the 101st position of the base sequence represented by SEQ ID NO: 4 (GenBank SNP database, rs58708491),
Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 5 (GenBank SNP database, rs776746),
Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 6 (GenBank SNP database, rs551294038),
Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 7 (GenBank SNP database, rs28364274),
Single base polymorphism having adenine (A) at position 101 of the nucleotide sequence represented by SEQ ID NO: 8 (GenBank SNP database, rs72552713),
Single nucleotide polymorphism having guanine (G) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 9 (GenBank SNP database, rs72559747),
Single base polymorphism having adenine (A) at position 101 of the nucleotide sequence represented by SEQ ID NO: 10 (GenBank SNP database, rs182367277),
Single nucleotide polymorphism having thymine (T) at position 101 of the nucleotide sequence represented by SEQ ID NO: 11 (GenBank SNP database, rs2291075),
Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 12 (GenBank SNP database, rs148697674),
Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 13 (GenBank SNP database, rs1481012),
Single base polymorphism with cytosine (C) at position 101 of the nucleotide sequence represented by SEQ ID NO: 14 (GenBank SNP database, rs186907101),
Single base polymorphism with cytosine (C) at the 101st position of the base sequence represented by SEQ ID NO: 15 (GenBank SNP database, rs4363657),
A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 16 (GenBank SNP database, rs72554040), and
Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 17 (GenBank SNP database, rs4149086)
Gene marker, characterized in that it further comprises one or more mutations selected from the group consisting of or a combination thereof.
A single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 31 (GenBank SNP database, rs15524); A mutation in which thymine (T), thymine (T), and cytosine (C) at positions 101 to 103 of the nucleotide sequence represented by SEQ ID NO: 32 are deleted (GenBank SNP database, rs781599319); And a single marker polymorphism having a guanine (G) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 33 (GenBank SNP database, rs28371759), or a genetic marker comprising one or more variations selected from the group consisting of In the individual in which the genetic marker or a combination thereof is detected, the administered statin concentration in blood is kept low compared to the control group.
According to claim 3, The genetic marker or a combination thereof,
Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 18 (GenBank SNP database, rs1448784),
Single base polymorphism having adenine (A) at position 101 of the nucleotide sequence represented by SEQ ID NO: 19 (GenBank SNP database, rs1049518),
Single base polymorphism with cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 20 (GenBank SNP database, rs761999329),
Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 21 (GenBank SNP database, rs1049508),
Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 22 (GenBank SNP database, rs1135822),
Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 23 (GenBank SNP database, rs717620),
Single nucleotide polymorphism having thymine (T) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 24 (GenBank SNP database, rs28371725),
Single base polymorphism with cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 25 (GenBank SNP database, rs12721627),
A single nucleotide polymorphism having adenine (A) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 26 (GenBank SNP database, rs4149036),
Single base polymorphism with cytosine (C) at the 101st position of the base sequence represented by SEQ ID NO: 27 (GenBank SNP database, rs1135840),
Single nucleotide polymorphism having guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 28 (GenBank SNP database, rs2306282),
A single nucleotide polymorphism having cytosine (C) at the 101st position of the nucleotide sequence represented by SEQ ID NO: 29 (GenBank SNP database, rs4149085), and
Single nucleotide polymorphism with guanine (G) at position 101 of the nucleotide sequence represented by SEQ ID NO: 30
Gene marker, characterized in that it further comprises one or more mutations selected from the group consisting of or a combination thereof.
According to claim 1 or 3, wherein the control gene marker, or a combination thereof, characterized in that it does not include the mutation.
A method of providing information for predicting the statin concentration in a blood of an individual administered statin, comprising detecting a variation of the genetic marker of any one of claims 1 to 4 or a combination thereof in a biological sample isolated from the individual. .
Prediction of blood statin concentration in a subject administered with a statin that hybridizes specifically with a polynucleotide comprising at least 10 contiguous bases or a complementary polynucleotide thereof at the mutation site of any one of claims 1 to 4 or around the mutation site. Primer composition.
Statin concentration in a subject administered with a statin specifically hybridizing with a polynucleotide comprising 10 or more contiguous bases comprising the mutation position of any one of claims 1 to 4 or a complementary polynucleotide thereof, or a complementary polynucleotide thereof. Prediction probe composition.
A composition for predicting blood statin concentration in a subject administered with a statin containing an antibody or an aptamer that specifically binds a polypeptide encoded by a polynucleotide comprising the variation of any one of claims 1 to 4.
A kit for predicting blood statin concentration in a subject administered with a statin comprising the composition of any one of claims 7 to 9.

Images