CN100549173C - TH gene and detection method and purposes with special single nucleotide polymorphism - Google Patents

Abstract

The present invention relates to have in a kind of intron the TH gene and the detection method thereof of special single nucleotide polymorphism.The invention still further relates to the method that detects primary hypertension relative gene.The invention still further relates to the method for the susceptibility loci that whether has primary hypertension relative gene of the present invention in the vitro detection testing sample and the method for external prediction individual essential hypertension relative risk to be measured.The present invention relates to the test kit that has the TH gene of single nucleotide polymorphism in the detection intron at last.

Description

TH gene and detection method and purposes with special single nucleotide polymorphism

Technical field

The present invention relates to a kind of gene and detection method and purposes, particularly a kind of tyrosine hydroxylase (TH) gene and detection method and purposes with special single nucleotide polymorphism with special single nucleotide polymorphism.

Background technology

Essential hypertension is a kind of common frdquently encountered disease of harm humans health, and coronary heart disease that it causes and brain soldier have now become the due to illness lethal primary cause of disease of the mankind.Press for the effective ways and the medicine that can prevent, diagnose or treat essential hypertension at present.Though the mankind have dropped into great amount of manpower and material resources for hypertensive research, do not illustrate fully as yet about hypertensive pathogeny up to now, also do not have effective prevention, diagnosis and methods of treatment.Epidemiology previously and clinical study show that essential hypertension has tangible family and assembles tendency, illustrate that essential hypertension and inherited genetic factors are closely related.From the molecular biology viewpoint, the unusual and/or abnormal expression of some gene structures is the basic reason of essential hypertension, and wherein transgenation, gene displacement and gene regulating play sizable effect unusually.It is believed that now that epinephrine gene is unusual, Angiotensin, angiotensin I converting enzyme gene may form relevant with hypertension with proto-oncogene.

Tyrosine hydroxylase, English: tyrosine hydroxlase, abbreviation: TH, another name abbreviation: TYH, protein product: see Table 1.

4 kinds of isomer of table 1, Tyrosine Hydroxylase Gene protein product

Chinese	English
		Tyrosine hydroxylase 1 type isomer tyrosine hydroxylase 2 type isomer tyrosine hydroxylases 3 type isomer tyrosine hydroxylases 4 type isomer	tyrosine hydroxylase isoform 1 tyrosine hydroxylase isoform 2 tyrosine hydroxylase isoform 3 tyrosine hydroxylase isoform 4

Known Tyrosine Hydroxylase Gene is positioned at human chromosomal 11p15.5, has only 1 copy on human genome, comprises 14 main exons, and length is approximately 8K base pair (seeing also shown in Figure 1).The RNA alternative splicing that takes place in its first intron in genetic expression has produced at least 3 kinds of different mRNA, and the difference of the mRNA that these are different is the insertion or the disappearance of 12 base pairs and 18 base pairs.Genetic expression at neural different piece tyrosine hydroxylase there are differences.

Tyrosine hydroxylase catalysis phenylalanine (phenylalanine) changes Dopamine HCL (dopamine) into, be the rate-limiting enzyme in catecholamine (catecholamines) the biosynthesizing step, in the physiological process of adrenergic nerve, play keying action.Tyrosine hydroxylase and nervous system disorders, for example the relation of schizophrenia, affective disorders and nicotine dependence disease has had extensive studies.Also few at the research of hypertension and tyrosine hydroxylase incidence relation at present, limited several experiments have all only related to the interior TCAT tumor-necrosis factor glycoproteins of first intron of Tyrosine Hydroxylase Gene and have been positioned at the 2nd the Va181Met pleomorphism site in the exon, but the relation between all the other pleomorphism sites of Tyrosine Hydroxylase Gene and essential hypertension, and the detection method of these pleomorphism sites, test kit all do not have patent or report at home and abroad.

Summary of the invention

At the problems referred to above, an object of the present invention is to provide the TH gene that has special single nucleotide polymorphism in a kind of intron.

An object of the present invention is to provide a kind of method that detects the TH gene that has special single nucleotide polymorphism in the intron of the present invention.

An object of the present invention is to provide a kind of method of external examination primary hypertension relative gene.

An object of the present invention is to provide the method that whether has the susceptibility loci of primary hypertension relative gene in a kind of vitro detection testing sample.

Another object of the present invention provides the method for a kind of external prediction individual essential hypertension danger to be measured.

Another object of the present invention provides the test kit that has the TH gene of single nucleotide polymorphism in a kind of vitro detection intron.

Description of drawings

Fig. 1 is the structural representation of human TH gene.Digital 1-13 among the figure represents introne 1-13 respectively.

Fig. 2 is TH gene rs2070762 pleomorphism site and flanking sequence thereof.Adding black C/T among the figure is TH gene rs2070762 pleomorphism site, and the front and back sequence is respectively its flanking sequence.

After Fig. 3 is amplification, the restriction enzyme mapping of TH gene rs2070762 pleomorphism site.Wherein, swimming lane 1 expression T/T genotype; Swimming lane 2 expression T/C genotype; Swimming lane 3 expression C/C genotype; M represents Marker, i.e. the standard electrophoretogram.

Embodiment

The present invention is by a large amount of experimental studies, the TH gene that has special single nucleotide polymorphism in a kind of intron (NCBI Gene database registration number is 7054) is provided, gene of the present invention and registration number in NCBI are that 7054 TH gene is compared, for having the gene of special single nucleotide polymorphism in the intron, particularly, the allelotrope of rs2070762 pleomorphism site is C.This pleomorphism site is by the world authority's (NCBI of biomedical data storehouse-NIH, http://www.ncbi.nlm.nih.gov) includes, be positioned at the 13rd intron of Tyrosine Hydroxylase Gene, be the polymorphism of C/T, promptly be positioned at 6701 Nucleotide places of sequence shown in the SEQ ID NO:1; In addition, as shown in Figure 2, adding black C/T among the figure is TH gene rs2070762 pleomorphism site, and front and back are respectively its flanking sequence, and flanking sequence (flanking sequence) is respectively referring to SEQ IDNO:2 and SEQ ID NO:3.This pleomorphism site can be determined by unique on human genome.Because this sequence is positioned at the intron zone, do not change amino acid whose coding in addition, so it there is not amino acid whose change coding.

Those of ordinary skills are known, and so-called " gene pleiomorphism " refers in the crowd, the difference that the nucleotide sequence of each genes of individuals exists.Those of ordinary skills are known, and pleomorphism site of the present invention is single nucleotide polymorphism (SNP) site, and promptly single Nucleotide changes in the genome sequence; The difference of nucleotide sequence can be embodied on the dna level or on the rna level, so TH gene of the present invention can be embodied in dna level, and on the rna level, preferred dna level, more preferably genomic dna.

Here said " tumor susceptibility gene " is meant that decision is easy to suffer from the gene of certain (certain class) disease.The carrier of essential hypertension tumor susceptibility gene shows as the Hazard Factor increase that the individuality that carries tumor susceptibility gene is suffered from essential hypertension.

The present invention adopts the association study that has bigger power of a test in genetics research, and it is by detecting the frequency distribution difference that genetic marker exists, the position of identification tumor susceptibility gene between normal control crowd and disease crowd.Particularly, in an embodiment of the invention, single factor analysis is found (referring to embodiment 2), the frequency of rs2070762 pleomorphism site C allelotrope in the case group is significantly higher than control group (P=0.005), pleomorphism site rs2070762 is positioned at and includes the subarea, may participate in Tyrosine Hydroxylase Gene has potential related in the adjusting of cell inner expression or with variable shearing, thereby has very big application in high blood pressure disease prediction and the new drug development at tyrosine hydroxylase.

The present invention also provides a kind of method that detects the TH gene that has special single nucleotide polymorphism in the intron of the present invention.It is known to those skilled in the art that the pleomorphism site that to use multiple technologies external detection TH gene order on dna level.Can through with the dna sequence dna after radiolabeled sense-rna or dna probe and amplification hybridization, with the differential point polymorphism.Also can be based on the change of known nucleotide sequence, synthetic normal and have a PCR primer of special single nucleotide polymorphism, in the substrate of polymerase chain reaction (PCR reaction), add fluorescently-labeled Nucleotide, according to having or not fluorescence to occur in the reaction product, determine in the used primer of amplification, to have or not base to change, thereby detect special single nucleotide polymorphism.Can directly disclose crt gene and carry the sequence difference that has between the special single nucleotide polymorphism gene by the dna direct order-checking.When being used in combination with PCR, the susceptibility of this method improves greatly.Also available ordinary method of the mensuration of the nucleotide sequence of various DNA and dna fragmentation such as dideoxy chain termination (people such as Sanger, PNAS, 1977,74:5463-5467).In addition, also available commercial sequencing kit of nucleotide sequencing or automatic sequencer etc.Conventional automatic sequencing method is come the definite kernel acid sequence with radio-labeling or fluorescent mark.Also can adopt pvuii restriction fragment analysis (RFLP) to come the pleomorphism site of vitro detection TH gene order.

The principle of restriction fragment length polymorphism analytical procedure is: because gene has special single nucleotide polymorphism; cause the restriction enzyme digestion sites change, disappear or produce new site; if with certain digestion with restriction enzyme genomic dna; then enzyme is cut the dna fragmentation of back generation and normal gene group different lengths; detect the size and the quantity of this dna fragmentation, judge whether to have special single nucleotide polymorphism.Preferred this method combines (PCR-RFLP) with round pcr, method is: when the experiment of design pcr amplification, primer is positioned at the both sides at gene pleiomorphism position, earlier goal gene is increased, make it be easy to detect, change because special single nucleotide polymorphism causes existing restriction endonuclease sites, then can be earlier with corresponding digestion with restriction enzyme amplified production, carry out agarose gel electrophoresis again and observe, judge according to product clip size or quantity and normal control.The method of the polymorphism of the described TH gene of preferred detection rs2070762 pleomorphism site is that the polymerase chain reaction combines with the restriction fragment length polymorphism analysis among the present invention.

The present invention also provides a new thinking for obtaining primary hypertension relative gene simultaneously.The method of seeking the disease-related disease at present mostly is the variation of seeking structure gene.And the present invention not only has specific polymorphism and can cause protein level to have specific polymorphism in the coding region of gene from a side illustration, and then the Hazard Factor that cause suffering from essential hypertension increase, and at the special single nucleotide polymorphism of non-coding region, the Hazard Factor that also can cause suffering from essential hypertension increase.Be exactly to have special single nucleotide polymorphism in the intron of TH gene in the present invention.

The present invention also provides a kind of method of external examination primary hypertension relative gene, and this method comprises:

(1) at the functional mononucleotide polymorphism site of potential, carries out the association study between primary hypertension patient and the control group;

(2) determine to have on the statistics mononucleotide polymorphism site of significant difference.

For further inquiring into relation between TH gene and the essential hypertension morbidity from genetic angle, and provide the evidence of genetic epidemiology for existing similar research both at home and abroad, the methods of genotyping of the current international practice of present embodiment utilization PCR-RFLP, in large sample essential hypertension example (n=503) contrast (n=490) research of collecting, vitro detection is from the polymorphism in rs2070762 site in the sample of individuality to be measured, thereby analysis rs2070762 site is at primary hypertension patient and normal control crowd's distributional difference.Through lot of experiments of the present invention, the TH gene that the present invention determines to have the rs2070762 polymorphism is a primary hypertension relative gene; And the rs2070762 pleomorphism site of TH gene intron district rs2070762 pleomorphism site when being C allelotrope is the susceptibility loci of essential hypertension; The rs2070762 polymorphic site is that the allelic TH gene of C is a Susceptible Genes of Essential Hypertension.

On the other hand, the present invention also provides the method that whether has the susceptibility loci of primary hypertension relative gene in a kind of vitro detection testing sample, and this method comprises:

1) DNA of extraction testing sample carries out pcr amplification at TH gene rs2070762 pleomorphism site design primer;

2) described PCR product is analyzed;

3) identify whether TH gene rs2070762 pleomorphism site is C.

Described testing sample can obtain Tathagata autoblood, urine, saliva, gastric juice, hair, the cell of examination of living tissue and necrotomy material from the cell from the trier.Preferably come autoblood.

The method that described PCR product is analyzed can adopt aforementioned any method about mentioning in the method that detects the TH gene that has special single nucleotide polymorphism in the intron of the present invention, for example, include but not limited to, utilize radio-labeling to detect, utilize fluorescent mark to detect, directly order-checking detects, and adopts pvuii restriction fragment analysis (RFLP) to detect.Preferably the method that described PCR product is analyzed is that the polymerase chain reaction combines with the restriction fragment length polymorphism analysis.

In one embodiment, the method that described PCR product is analyzed is polymerase chain reaction combine with the restriction fragment length polymorphism analysis (PCR-RFLP).The PCR product that will comprise purpose SNP site is cut as enzyme with specific restriction enzyme, and a cognition that then includes this SNP site produces and is cut into two or three or cuts motionless three kinds of situations.In the present invention for the rs2070762 pleomorphism site, after adopting pcr amplification, 196 PCR products that base is long have been obtained, selecting for use the PstI restriction enzyme to carry out enzyme to the long PCR product of these 196 bases cuts, because on the product sequence, there is a PstI restriction enzyme site when allelotrope in rs2070762 site is C, after cutting, can produce the fragment of 122bp and two kinds of length of 74bp, and when the allelotrope in rs2070762 site is T, no PstI restriction enzyme site on the product sequence, it is constant that enzyme is cut the after product sequence length, still is 196 bases.So when having 196,122 and during the fragment of three kinds of length of 74bp simultaneously, the allelotype that the rs2070762 site is described is the C/T heterozygote; When only having the 196bp fragment, rs2070762 site allelotrope T is described; When only having 122bp and 74bp fragment, rs2070762 site allele C is described.(specifically referring to embodiment 1).

On the other hand, the invention provides the method for a kind of external prediction individual essential hypertension danger to be measured, this method comprises the polymorphism of vitro detection from rs2070762 pleomorphism site in the sample of individuality to be measured, and wherein the dangerous of rs2070762 site C allelotrope carrier essential hypertension significantly increases.Preferred described individuality to be measured is a China Han.The present invention is by the statistical study of large sample, on the basis of getting rid of experimental error, proved that with conclusive experimental evidence the distribution of rs2070762 pleomorphism site C allelotrope in case is significantly higher than control group (P=0.005), rs2070762 pleomorphism site and hypertensive being closely related property (referring to embodiment 2); In addition, rs2070762 pleomorphism site C allelotrope carrier suffers from 2.66 times of the non-carrier of risk average out to of essential hypertension, that is to say, has increased more than one times.(referring to embodiment 3).

Those of ordinary skills are known, the method that described PCR product is analyzed can adopt aforementioned any method about mentioning in the method that detects the TH gene that has special single nucleotide polymorphism in the intron of the present invention, for example, include but not limited to, utilize radio-labeling to detect, utilize fluorescent mark to detect, directly order-checking detects, and adopts pvuii restriction fragment analysis (RFLP) to detect.Preferably the method that described PCR product is analyzed is that the polymerase chain reaction combines with the restriction fragment length polymorphism analysis.

On the basis of the statistical study of large sample of the present invention, can use method of the present invention separately, promptly detect polymorphism, with the external prediction individual essential hypertension danger of suffering to be measured from rs2070762 pleomorphism site in the sample of individuality to be measured.

On the other hand, the invention provides the test kit that has the TH gene of single nucleotide polymorphism in a kind of vitro detection intron.In the described test kit one or more containers can be housed, one or more components that contain the TH gene of rs2070762 pleomorphism site in order to detection are housed in the container.According to the difference of concrete detection method and detection pleomorphism site, test kit can contain different components.What provide simultaneously with it can be through medication management mechanism of government audit, relevant medicine or biological products manufacturing, the information using and sell.In an embodiment of the invention, provide the test kit that has the TH gene of single nucleotide polymorphism in a kind of vitro detection intron, this test kit comprises:

(1) primer of amplification rs2070762 pleomorphism site;

(2) pcr amplification enzyme and corresponding damping fluid;

(3) reagent of detection rs2070762 pleomorphism site.

Those of ordinary skills are known, the primer in described amplification polymorphism site, can be according to the known nucleotide sequence design of the present invention, be generally 15-30 base, GC content is about 45%-50%, combine with template specificity under suitable temperature, it can utilize special computer programming, for example (Oligo 6.53 softwares).Shown in the embodiment of the invention 1, provide a kind of primer of the rs2070762 of amplification pleomorphism site:

The primer sequence sequence number

Forward 5 ' CCTTCCTTCTGGCCTTGAGCAG 3 ' SEQ ID NO:4

Reverse 5 ' TGTCAGCACCTCCAAGACTGG, 3 ' SEQ ID NO:5

Those of ordinary skills are known, and the enzyme of pcr amplification can be used in the enzyme of pcr amplification for Tag archaeal dna polymerase, Klenow fragment, Tth archaeal dna polymerase, VENT archaeal dna polymerase etc.The reagent that detects the rs2070762 pleomorphism site in the test kit is according to the difference of detection method and difference.For example, when adopting the polymerase chain reaction to detect the rs2070762 pleomorphism site with the restriction fragment length polymorphism analysis method of combining, can contain restriction enzyme and corresponding restriction enzyme mapping in the test kit, for example PstI restriction enzyme and corresponding restriction enzyme mapping.

The test kit that has the TH gene of single nucleotide polymorphism in the detection intron of the present invention can be used for the polymorphism of vitro detection primary hypertension relative gene.

In order more to be expressly understood the present invention, further describe the present invention referring now to the following example and accompanying drawing.Embodiment only is used for explaining and does not limit the present invention in any way.The experimental technique of unreceipted actual conditions is ordinary method well known in the art and normal condition among the embodiment, for example referring to people such as Sambrook, " molecular cloning: laboratory manual " (New York:Cold Spring Harbor LaboratoryPress, 1989) condition described in, or the condition of advising according to manufacturers.

The detection method of embodiment 1, rs2070762 pleomorphism site

R s2070762 pleomorphism site can combine with the restriction fragment length polymorphism method by PCR and detect.

1.rs2070762 the acquisition of polymorphic amplified fragments

Use polymerase chain reaction (PCR) to obtain the polymorphic amplified fragments of rs2070762 (196bp), PCR is reflected on the 9700 type PCR instrument of ABI company and finishes; Each 2 example of blank reaction that every plate PCR adds testing sample dna profiling (take from detected object, intraleukocytic DNA is extracted with the benzene phenol-chloroform method or with salting-out process according to ordinary method get final product) control reaction and do not add dna sample.Amplification the primer and amplification condition see Table 2 and table 3, and wherein used Taq enzyme is the HotStart Taq enzyme that precious biotech firm produces, and is suitable for the Touch-down method.

Table 2, rs2070762 pleomorphism site detect primer

Primer	Sequence	Sequence number
			Direct/Reverse	5’CCTTCCTTCTGGCCTTGAGCAG 3’ 5’TGTCAGCACCTCCAAGACTGG 3’	SEQ ID NO：4 SEQ ID NO：5

Table 3, rs2070762 pleomorphism site pcr amplification system and amplification condition

2. the restriction fragment length polymorphism method is identified the polymorphic genotype of rs2070762

After success was increased and contained the dna fragmentation of rs2070762 pleomorphism site, at first commodity in use PCR product purification plate (for example: Millipore MultiScreen ^TMPCR, Millipore company) carry out product purification according to the manufacturer's recommended step.Product behind the purifying carries out enzyme with PstI restriction enzyme (MBI company) to be cut, and can tell the genotype in this site from gel electrophoresis spectrum.The polymorphic endonuclease reaction of rs2070762 carries out in 37 degree constant incubators, and enzyme cuts system and the enzyme tangent condition sees Table 4.

Table 4, the polymorphic enzyme of rs2070762 are cut system and enzyme tangent condition

3. agarose gel electrophoresis inspection enzyme is cut product

In concentration is 2.5% sepharose (weighing plain agar Icing Sugar 7.5 grams, be dissolved in the TB liquid of 300 milliliters of 0.5X, be heated to clear, room temperature was placed about 2 minutes, add 25 microlitre EB, the vibration mixing, room temperature is placed and to be dried) in electrophoresis enzyme cut product, 180 volts of voltages, electrophoresis time are 1 hour.

The result: as shown in Figure 3, when T allelotrope appearred in the rs2070762 pleomorphism site, electrophoresis was the band (swimming lane 1) of 196bp; When C/T allelotrope occurring, electrophoresis is 196,122,74bp three bands (swimming lane 2); When C allelotrope occurring, electrophoresis is two bands (swimming lane 3) of 122bp and 74bp.

The dependency of embodiment 2, rs2070762 pleomorphism site and human essential hypertension

1. case-control sample Clinical symptoms is described, referring to table 5.

Table 5, case-control sample Clinical symptoms are described

Numerical value is means standard deviation.NS, not statistically significant; BMI, weight index.

2.rs2070762 the frequency distribution of pleomorphism site in the case-control sample

Adopt method among the embodiment 1, respectively the rs2070762 pleomorphism site of above-mentioned case (n=503) and contrast (n=490) is analyzed, and the result is carried out statistical study, the results are shown in Table 6.

Table 6, the polymorphic frequency distribution in the case-control sample of rs2070762

Genotype	Case (n=503) adds up to	Contrast (n=490) adds up to	P
				T/T T/C C/C C gene frequency	58 403 42 487	127 313 50 413	＜0.0001 0.005

Result: as shown in table 6, the distribution of rs2070762 pleomorphism site C allelotrope in case is significantly higher than control group (P=0.005), because this research is selected sample according to the standard of strictness, territorial environment in life, age, mate aspects such as sex, has got rid of the influence of non-genetic factor to statistic analysis result as far as possible, so that statistical study has illustrated rs2070762 and human essential hypertension is closely related.

Embodiment 3, rs2070762 pleomorphism site are for the relative risk of essential hypertension

In the research object rs2070762 pleomorphism site for the relative risk of essential hypertension

Adopt the method among the embodiment 1 that the rs2070762 pleomorphism site is analyzed, the step of going forward side by side is carried out statistical study (using the SAS software package, polynary logistic regression analysis), the results are shown in Table 7.

Table 7, the polymorphic relative risk of rs2070762 for essential hypertension

Variable	OR(％95CI)	P
			BMI，kg/m 2Triglyceride level, mmol/L blood sugar, mmol/L C/C vs.T/T C/T vs.T/T	(1.15 1.11 to 1.19) 1.18 (1.02 to 1.37) 1.12 (1.02 to 1.21) 1.61 (0.94 to 2.76) 2.66 (1.86 to 3.80)	＜0.001 0.01 ＜0.001 0.001 0.001

Conclusion: as shown in table 7, adjusting the traditional Hazard Factor BMI of essential hypertension, behind triglyceride level and the blood sugar, the relative risk that essential hypertension takes place rs2070762 pleomorphism site C allelotrope carrier significantly raises, promptly under the same situation of other condition, 2.66 times of the non-carrier of risk average out to that C allelotrope is suffered from essential hypertension are carried in this site, that is to say, have increased more than one times.

The test kit of embodiment 4 vitro detection TH gene rs2070762 pleomorphism sites

The test kit of vitro detection TH gene, this test kit comprises:

1. the primer of amplification rs2070762 pleomorphism site:

The primer sequence sequence number

Forward 5 ' CCTTCCTTCTGGCCTTGAGCAG 3 ' SEQ ID NO:4

Reverse 5 ' TGTCAGCACCTCCAAGACTGG, 3 ' SEQ ID NO:5

2.PCR amplification enzyme and corresponding damping fluid: Tag archaeal dna polymerase, 10X damping fluid, dNTP;

3. detect the reagent of rs2070762 pleomorphism site: PstI restriction endonuclease and damping fluid thereof.

And in the operation instruction of test kit, point out and to detect according to embodiment 1 described method.

Should be understood that those skilled in the art can make various changes or modifications the present invention after having read foregoing description content of the present invention, but the equivalent form of value of changing or revising drops on equally in the application's claims institute restricted portion.

Sequence table

＜110〉Sinogenomax Co., Ltd.

China Medical Sciences Academy Fu Wai Hospital

Institute of Biophysics, Academia Sinica

＜120〉have TH gene and the detection method and the purposes of special single nucleotide polymorphism

<130>GBI05CN0323

<160>5

<170>PatentIn version 3.3

<210>1

<211>7876

<212>DNA

＜213〉homo sapiens

<220>

<221>misc_feature

<222>(6701)..(6701)

＜223〉n=c or t

<400>1

cggacctcca cactgagcca tgcccacccc cgacgccacc acgccacagg ccaagggctt 60

ccgcagggcc gtgtctgagc tggacgccaa gcaggcagag gccatcatgg taagagggca 120

ggtaggtgcc cggcggccgc agtggaccgg agcccagggc tggtgccagc tgcctctgct 180

actccccagc ctggctggca gccccaggct cagggtccat gcaaacccct gggacgcggc 240

gtggatgtgg aggcctgggc acagcggcat cccctgtgcc tggtgtttga gtccctgttg 300

ggggagggtg aggtgatgcc tgtccctgtg tgtgcccctc ttaggccgac ctctctcggg 360

ggtcgtgtgg gtctctgtgt cttgtttcat cttgaatctt aacgatcgga atgtggaaac 420

aaatccatcc aaaaaatcca agatggccag aggtccccgg ctgctgcacc cagcccccac 480

cctactccca cctgcccctg cctccctctg ccccagctgc cctagtcagc accccaacca 540

gcctgcctgc ttggggaggc agccccaagg cccttcccag gctctagcag cagctcatgg 600

tggggggtcc tgggcaaata gggggcaaaa ttcaaagggt atctgggctc tggggtgatt 660

cccattggcc tgttcctccc ttatttccct cattcattca ttcattcatt cattcattca 720

ccatggagtc tgtgttccct gtgacctgca ctcggaagcc ctgtgtacag gggactgtgt 780

gggccaggct ggataatcgg gagcttttca gcccacagga ggggtcttcg gtgcctcctt 840

gggcactcag aaccttgggc tccctggcac atttaaaatg ggtttttatt tatggacctt 900

gattgaaatg tggtgtgagt tgtagcagtg tcatttccag gtaccttctc agggacacag 960

ggcgccctcc cccgtcctcc cccgccctcc cctaccctcc cccaccaggc tccccatcag 1020

gcatcccctc cccagggcgc cccggggccc agcctcacag gctctccgtg gcctggaact 1080

gcagccccag ctgcatccta cacccccacc ccaagggtaa gtaagagggg actctgggag 1140

gggcttctgc tgctcccctt catgttccac aaccctggaa gctcaggatg aagctgattc 1200

ttctcttaca aggggcccag agccttcttg ggagttcagc tccaagggat gagccccagg 1260

tgtctgccaa gtccccctct gtccaggcct gggacggctc tgggatcgag gggtcagagg 1320

cgctgagccc agggagagac acctgcgccc agagctatga caaagggtgg agggatgaca 1380

aggcagccag gagcgggcgc ctgcggggtg gcacagaggg gcagggcccg aggacaggtg 1440

tcctgatggg agtgtgagaa agggtcccct gtgcggcagc caggagggta ggggggttgt 1500

tcactggggc cctgtggggg cagctccttc ctgagctgcc gttccctccc cggcagccga 1560

tgccactgtc catcaagaca tcgccctctt cccatcacta atccagttag cgcctggcct 1620

ggggatgagt gacacagcgt ctctgtctgt ctgctcgcca cagagtgggg agcaggcgag 1680

caccttccca gcccccactc ctcccccacc accactgctt ctgactgggc tgcccccatc 1740

gggaagggcg tgcaatgccc gcaggcacct cggctagcat ctgccccagc aggcacacag 1800

taggcgctca aaaacgtgct ctcatcccct gcctctgtgt gccatcagcg ctgcccgact 1860

gtgggaccag ctgtgggtgg aggtccccgg gtctcagcag gtggaggagg catgggtgcc 1920

ccttgtcccc acagtccccg cggttcattg ggcgcaggca gagcctcatc gaggacgccc 1980

gcaaggagcg ggaggcggcg gtggcagcag cggccgctgc agtcccctcg gagcccgggg 2040

accccctgga ggctgtggcc tttgaggaga aggaggggaa ggccgtgcta aacctgctct 2100

tctccccgag ggccaccaag ccctcggcgc tgtcccgagc tgtgaaggtg tttgaggtga 2160

gctggtggcc ttcgtgtccc tggggcaagt tcacctgtgg gtggggctgt gtgggctgag 2220

ttcctgaccc ctctatagca gaggtgcagc tgcccaggcc cccgaggccg gcacaggatg 2280

cagcagggga gtctcaggcc tcagctcagc ccccatggca tctagccaca cccccgtgtt 2340

tttgagggat cctgagccca cccctagggc tgaggctacc aagccccact gtgcctcttg 2400

ccttgcccat cccctggatc cccctcaccc accatttccc acgtgggggg ctcccagcag 2460

ggcagcacaa gaggcagggg cagggcagtg tgccctctcc cacccaccca gcacagtggc 2520

tcaggtgacc actgattgca ttagtcactc cggccccact gtgccccggg aggcaggtga 2580

cccagctccc ggaagaagct cccaaatgac attaaagcca gactccccgc cccccagctc 2640

ccagagccag ttttgtggcc cgagggccac tgcgacccac cgcccttgtt gctaggcaac 2700

aggaggtggg ggtggagcgg acccttctgg ccagtgtcct ggacgctcag gggccagtga 2760

gactcagggc ccatcctaca aacctggatg aggccaccag ggttgggggc accttctgac 2820

cagtggctga ggagccggac tgtgtggcat ggccttggga cacacacacc gagccgccca 2880

gaaccaggtt aagcctcaag cggtgacaac tcctggttag gcacgtaaca caaaatccaa 2940

cttgccagtg gcaaaccctg gcctggtggc cgacagctga cctgagcctg gaagaacggg 3000

atctgtgtgc tgctagcaca aaagtcaagg gcagggcctg gccagccagc cagatgtgcc 3060

tcctccccgc ccaccccacc ctctctctcc atctctgtct ctttctcctt ctctctctct 3120

tcctgctttt gctccctaag acgtttgaag ccaaaatcca ccatctagag acccggcccg 3180

cccagaggcc gcgagctggg ggcccccacc tggagtactt cgtgcgcctc gaggtgcgcc 3240

gaggggacct ggccgccctg ctcagtggtg tgcgccaggt gtcagaggac gtgcgcagcc 3300

ccgcggggcc caagggtgag gcggttttct gtccttgagg gccaccaaat gaccttgaga 3360

ggctggggtg caggggctcc tgcaggggga ccctacagtg accacgtggt ggtggcctgg 3420

ttccctctct gcgggctcca ctccgcaccc cgttttgcta cacatccgtg tccgggcctg 3480

gggccactcc aggatccccc cgcagctctc acagccccgg ctgcctctgc cccccggaag 3540

tcttgtaggg gaggctgctt caaggtgggt gacacagccc cacggctccg agctcaccaa 3600

gatctcttcc tccatcaccc ataaagtccc ctggttccca agaaaagtgt cagagctgga 3660

caagtgtcat cacctggtca ccaagttcga ccctgacctg gacttggacc acccggtgag 3720

tggtgcgccc ctcactcagg cctcctgccc ctgatcacat cccctaccct tagcccaacc 3780

ctggacagga gtctgtcggc tccaggagcc tccgtggcct gtgcccccac cccagcacag 3840

cctcctgacc cgtgcatccc ctctgccctc agggcttctc ggaccaggtg taccgccagc 3900

gcaggaagct gattgctgag atcgccttcc agtacaggca gtgaggggcc cctgcgctcg 3960

ggacccagac tccgtcctgc aggctgacgc tggacctggg gggtgggagg gaaggacaaa 4020

ggggaggacc catcttgtca ccagcatcag tgcctcctgc caggcagctc tgctccaggg 4080

ctttccatgt ccccaaatcc cagtggggaa actgaggccc aggggggcta gagcaacctg 4140

ccgaggccac atagccggct cacggcacag tcagctgggg tgcaccctcc tgtccatcct 4200

ccaacccaaa ggcctcgctg cactaggcgg gtgtggacct gtgcccagtg aagctccctc 4260

cctccctcct gcccttctca ctccccgagg ggacctgctg accactggcc ccctccccag 4320

cggcgacccg attccccgtg tggagtacac cgccgaggag attgccacct ggtgagacct 4380

ccgtgcagct aggggctggg gaggagcccg ggggatgcct cctggaatcc tggcgtgtga 4440

gggccgcctc cagggacctt ggcacaacag gagagactaa ggccgggaag aagagggact 4500

tgcagggctc agaatgttgg gttgggagga agaggctacc catcctgtcg ggccatcccc 4560

agtgtgctga gggaccgccc ctcatggccc cctatcccct gggattccct aaagccacca 4620

gcaaaagccc ctcccggggg cctgggtctt caggggtccc caagaggcct gcgttggtag 4680

gggctcaggc aggcagaggc acccacagtt caggaggggg gtttcgggca ctggggtggg 4740

gcattagagg gccctgagcc tggctgcccg caggaaggag gtctacacca cgctgaaggg 4800

cctctacgcc acgcacgcct gcggggagca cctggaggcc tttgctttgc tggagcgctt 4860

cagcggctac cgggaagaca atatccccca gctggaggac gtctcccgct tcctgaaggg 4920

tgtgcccaga cgggaggggc gcagagccgg ggggccgggg atggtcagcc aagcgcccca 4980

ccccagcgcg gctccagccc gtcccggctc ggcagtgacc cgcgtggccc cttgcagagc 5040

gcacgggctt ccagctgcgg cctgtggccg gcctgctgtc cgcccgggac ttcctggcca 5100

gcctggcctt ccgcgtgttc cagtgcaccc agtatatccg ccacgcgtcc tcgcccatgc 5160

actcccctga gccgtgagtg cgcgccctgg ccgccagccc gagggtgggg ggtgcgacgg 5220

gcggcccctc agcccccttc tccctcctac gcgcagggac tgctgccacg agctgctggg 5280

gcacgtgccc atgctggccg accgcacctt cgcgcagttc tcgcaggtac gccgcggcct 5340

cggagggagc cggggtcacc caggggctgg cttggcgccg ggggcgggcg gggatcgatg 5400

tgcgggtggg tgaagtgtgc tgcctgctcc cgggccccgc caaggaggct cggcgccccg 5460

agggtcgcgc ggcatagggc ggggctggag cggagcctcc cacggcctgt gctgccacct 5520

gccggctacc tgggaacggc gcccacgggc ttaggaatgt ggtcaaggag ggctgcctgg 5580

aggaggaggc ccggtggagg tgcggatcct gggcggccag ggaaggtctc tgccgccagg 5640

gaagtgtccc agagacccct ggaggggctg ctgacacccc cggtgccccc acctcgagca 5700

tgacccaggg ctgcctctcc ccatccttca tcctccctgc tccacaggac attggcctgg 5760

cgtccctggg ggcctcggat gaggaaattg agaagctgtc cacggtgggt tgacccctcc 5820

ctgcagggcc tggggtgtgg gtttgggggt ctgaatccag gcctcaccct cttgccgtcc 5880

aggctgaggc ctctccttcc acccacgaat tgtgaccctc accctggcct gcctgcatcc 5940

tggcctggcc tccctggggg tggtatcctg gtcacgggtg accaggggct gcccggtggg 6000

cggcagctgt ctctgggctg atgctgcccg gcttccccgc agctgtactg gttcacggtg 6060

gagttcgggc tgtgtaagca gaacggggag gtgaaggcct atggtgccgg gctgctgtcc 6120

tcctacgggg agctcctggt gagagtctct ccttgctgca gcccccagca gaggggcagg 6180

gctgggggac ggtgcaggga ggggacaggc tcccagtggg aggaaactga ggcctggacc 6240

tccaggactc aggctctgtt tgggagaagg cttgtctctg cccagtcctc accccacatt 6300

atcccaggcc tccgaaggcc cggcggggga gatgggggtg actctaccca aggaacccac 6360

ccagcgtcag gccacggtgc cccagttccc tcggggacct gggtgcagtg gagtcagtga 6420

tgccattggc ctcctgccag cactgcctgt ctgaggagcc tgagattcgg gccttcgacc 6480

ctgaggctgc ggccgtgcag ccctaccaag accagacgta ccagtcagtc tacttcgtgt 6540

ctgagagctt cagtgacgcc aaggacaagc tcaggtgggc taggctgcta gggcaagccc 6600

cccatggtgc ccccaaactg ggccagccag gccttccttc tggccttgag cagggctgga 6660

cctgtgagcc caggtcacag atgagaaaac cgacccctgg ttgcagcagc ccccacacag 6720

cagggacacc atccgtgaga aggaccccag cgtctgggga ggggcagacc tacaggactg 6780

ggggctgctg ggtggccggg tcaaggccag tcttggaggt gctgacagag cctgagcttt 6840

gtgaggacgt cctgtggaac ctgtcccggc cccctgccct gggatgggga gaagtcaggg 6900

ggatagacag agtcaaggtg ggggacaggg cgggagtggg gtccccaggg ctgggggcct 6960

ttggtgcagt gaccagagtg tcaggagagg ggagcaaagc cctctagcct catcctcata 7020

aaaggtctca tcattttccc tccagcctct tatgcactgg ggaaactgag gccaggggct 7080

atgtgtccag cggacagggg tgctgaattc cacccacagg cttagggata tggtcaagga 7140

aagcttcctg gaggaggccc agtggaggtt cagggaggga tggggtgccc ggcagtctct 7200

agtggaaaag gcgcctagcc tatctccccc atgaaccccc tcacccagcc ctggaagagg 7260

cctcagtgtc ccgcctgtga ccagttggct cagaaaagcc ctgggagctc tgagccactg 7320

tgaaggtgga aacgcggccc ctggcctccc ctctcctgga ggctgcagac tctgcccgcc 7380

agttgacgag ggctctgccg ctctcctccc caggagctat gcctcacgca tccagcgccc 7440

cttctccgtg aagttcgacc cgtacacgct ggccatcgac gtgctggaca gcccccaggc 7500

cgtgcggcgc tccctggagg gtgtccagga tgagctggac acccttgccc atgcgctgag 7560

tgccattggc taggtgcacg gcgtccctga gggcccttcc caacctcccc tggtcctgca 7620

ctgtcccgga gctcaggccc tggtgagggg ctgggtcccg ggtgcccccc atgccctccc 7680

tgctgccagg ctcccactgc ccctgcacct gcttctcagc gcaacagctg tgtgtgcccg 7740

tggtgaggtt gtgctgcctg tggtgaggtc ctgtcctggc tcccagggtc ctgggggctg 7800

ctgcactgcc ctccgccctt ccctgacact gtctgctgcc ccaatcaccg tcacaataaa 7860

agaaactgtg gtctct 7876

<210>2

<211>200

<212>DNA

＜213〉homo sapiens

<400>2

ccctaccaag accagacgta ccagtcagtc tacttcgtgt ctgagagctt cagtgacgcc 60

aaggacaagc tcaggtgggc taggctgcta gggcaagccc cccatggtgc ccccaaactg 120

ggccagccag gccttccttc tggccttgag cagggctgga cctgtgagcc caggtcacag 180

atgagaaaac cgacccctgg 200

<210>3

<211>200

<212>DNA

＜213〉homo sapiens

<400>3

tgcagcagcc cccacacagc agggacacca tccgtgagaa ggaccccagc gtctggggag 60

gggcagacct acaggactgg gggctgctgg gtggccgggt caaggccagt cttggaggtg 120

ctgacagagc ctgagctttg tgaggacgtc ctgtggaacc tgtcccggcc ccctgccctg 180

ggatggggag aagtcagggg 200

<210>4

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>4

ccttccttct ggccttgagc ag 22

<210>5

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>5

tgtcagcacc tccaagactg g 21

Claims (6)

1, detect from the reagent of the polymorphism in TH gene rs2070762 site in the sample of individuality to be measured and be used for predicting the application of the test kit of individual essential hypertension danger to be measured in preparation, wherein rs2070762 site C allelotrope carrier suffers from essential hypertension danger significantly increases than non-carrier.

2, application as claimed in claim 1 wherein detects reagent from the polymorphism in TH gene rs2070762 site in the sample of individuality to be measured and is the reagent of the detection method that is applicable to that the polymerase chain reaction combines with the restriction fragment length polymorphism analysis.

3, application as claimed in claim 2, the employed primer in wherein said polymerase chain reaction is:

Forward: 5 ' CCTTCCTTCTGGCCTTGAGCAG 3 '

Oppositely: 5 ' TGTCAGCACCTCCAAGACTGG 3 '.

4, application as claimed in claim 1, wherein said sample comes autoblood, urine, saliva, gastric juice, hair, examination of living tissue or necrotomy material.

5, the 1) primer of amplification rs2070762 pleomorphism site;

2) pcr amplification enzyme and corresponding damping fluid; With

3) reagent of detection rs2070762 loci polymorphism;

Be used for the application of the test kit of vitro detection primary hypertension relative gene polymorphism in preparation.

6, application as claimed in claim 5, the primer of wherein said amplification rs2070762 pleomorphism site is:

Forward: 5 ' CCTTCCTTCTGGCCTTGAGCAG 3 '

Oppositely: 5 ' TGTCAGCACCTCCAAGACTGG 3 '.

Images