KR20200032802A - Composition for improving eye fatigue by blue light - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating eye diseases and a food composition for preventing or alleviating eye diseases, wherein compositions contains an eggplant extract as an active component. The eggplant extract inhibits cell death by oxidized A2E in retinal pigment epithelial cells, thereby having an effect of treating related eye diseases. Therefore, compositions according to the present invention can be usefully used for preventing or treating various eye diseases.

Description

Composition for improving eye fatigue by blue light {Composition for improving eye fatigue by blue light}

The present invention relates to a pharmaceutical composition for preventing or treating ophthalmic diseases and a food composition for preventing or improving ophthalmic diseases comprising eggplant extract as an active ingredient.

Modern people spend most of their time in front of various digital screens such as computers and smartphones, and these environmental effects keep the rate of visual acuity constantly rising. As the LED is frequently used on the screen of a smart device, blue light is deteriorating eye health. Blue light is blue light in the range of 400 ~ 500nm among visible light, and means light from a digital device or smartphone. When you turn on your digital device at night, the reason you feel the bluish light as a whole is due to the blue light.

When exposed to blue light for a long time, it stimulates the optic nerve of the eye, causing eye fatigue and causing various eye diseases. Because blue light has high energy and high transmittance, when it comes into the eye, it focuses on the retina opaquely and deteriorates its sharpness, and when chronically exposed, it causes aging and degeneration of the retina. It is known that the effects of blue light on the human body include dry eyes and eye fatigue, decreased vision and various eye diseases, accelerated retinal aging, insomnia due to macular degeneration and inhibition of melatonin production (Ganka Gakkai Zasshi. 2001 Oct; 105 (10 ): 687-95; Archives of Ophthalmology 1992; 110: 99-104; Review of Ophthalmology Oct 15 2003; 10 (10)).

Due to the action of blue light, metabolic waste byproducts accumulate in retinal cells throughout life, starting in infancy. In particular, it is known that accumulation occurs most actively in the retinal pigment epithelial cells below the center of the retina where the rod photoreceptors are concentrated. These metabolic waste products are characterized by specific fluorophores, one of the most important being the lipofuscin component N-retinylidene-N-retinyl-ethanolamine (N-retinylidene-N-retinyl- As ethanolamine: A2E), A2E causes photooxidation when exposed to blue light, causing the formation of reactive oxygen species.

When a human reaches a certain age limit, the physiological ability of the human body to process these metabolic waste by-products through metabolism in the retina decreases, and due to blue light stimulation at a predetermined wavelength, drusen (yellow between the retina and choroid) in the retinal pigment epithelial layer Precipitates) are formed. The drusen thus formed is believed to contribute to age-related macular degeneration (AMD) by further hindering the normal physiological / metabolical activity that allows proper nutrients to reach the photoreceptors.

Retinal disease is not a fatal disease leading to death, but has increased rapidly in recent years due to the industrialization and dietary changes along with the increase in the elderly population. Therefore, in addition to the surgical method, there is an urgent situation to develop a therapeutic composition that can be supplied in the form of herbal medicines, which are conventionally ingested, rather than therapeutic agents synthesized by artificial methods.

Under the above background, the present inventors conducted a study on substances having excellent eye disease prevention and treatment effect among natural resources, and the effect of inhibiting cell death by A2E where eggplant extract was oxidized by blue light. The present invention was completed by confirming the appearance.

An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of eye diseases comprising eggplant extract as an active ingredient.

Another object of the present invention is to provide a food composition for preventing or improving eye diseases, including eggplant extract as an active ingredient.

One aspect of the present invention provides a pharmaceutical composition for preventing or treating ophthalmic diseases comprising eggplant extract as an active ingredient.

In the present invention, "Branch ( Solanum 　 melongena ) "is a plant belonging to the family Gajidae that grows from the tropics to the temperate zone. It is a perennial plant in the temperate zone and a perennial plant in the tropical zone. The height of the plant is 60-100 cm. Stem is dark purple with black color, leaves are alternate, egg-shaped, 15 ~ 35cm long, with petiole, pointed end.Flowers bloom in June ~ September, with flower stalk between stem and branch of branch Several flowers of light purple flowers are running and the calyx is purple, which can be used by purchasing and using commercially available ones, or from nature.

In the present invention, the "extract" is an extract obtained by extracting the eggplant, a dilution or concentrate of the extract, a dried product obtained by drying the extract, a crude product or a purified product of the extract, or a mixture thereof, and Contains extracts of all formulations that can be formed using the extract. The extract can be extracted from natural, hybrid or varietal plants of eggplant, and can also be extracted from plant tissue cultures.

The method for extracting eggplant extract in the present invention is not particularly limited, and may be extracted according to a method commonly used in the art. Hot water extraction method, ultrasonic extraction method, filtration method, reflux extraction method, and the like, these may be performed alone or in combination of two or more methods, but are not limited thereto.

The type of the extraction solvent used for extraction in the present invention is not particularly limited, and any solvent known in the art may be used. The extraction solvent includes water (or distilled water); Lower alcohols having 1 to 4 carbon atoms such as methanol, ethanol, propyl alcohol, and butyl alcohol; Polyhydric alcohols such as glycerin, butylene glycol, and propylene glycol; And hydrocarbon-based solvents such as methyl acetate, ethyl acetate, acetone, benzene, hexane, diethyl ether, and dichloromethane; Or a mixture of these may be used, but is not limited thereto. In addition, a solvent extract may be prepared by extracting the eggplant one or more times using the solvent, and a dry extract obtained by distilling the solvent extract under reduced pressure followed by freeze drying or spray drying may be prepared.

In one embodiment of the present invention, after preparing eggplant extract using ethanol, the efficacy of treating eye diseases was confirmed.

Eggplant extract in the present invention may be included in the form of a fraction thereof, a processed product thereof, animals and plants containing the same, an extract thereof.

In the present invention, "fraction" means a result obtained by performing fractionation to separate a specific component or a specific component group from a mixture comprising various various constituents.

The fractionation method for obtaining a fraction in the present invention is not particularly limited, and may be performed according to a method commonly used in the art. A non-limiting example of the fractionation method is a method of obtaining a fraction from the extract by treating a predetermined solvent with the extract obtained by extracting the eggplant, but is not limited thereto.

The type of solvent used in the fraction is not particularly limited, and any solvent known in the art may be used. The fractional solvent includes polar solvents such as water and alcohol; Non-polar solvents such as hexane, ethyl acetate, chloroform, and dichloromethane may be used, and these may be used alone or in combination of two or more, but are not limited thereto.

In the present invention, "prophylaxis" means any action that suppresses or delays the onset of eye diseases by administration of the composition according to the invention.

In the present invention, "treatment" refers to all actions in which symptoms of eye diseases are improved or advantageously changed by administration of the composition according to the present invention.

In the present invention, the "eye disease" may be an eye disease caused by blue light, specifically, may refer to a retinal disease related to photooxidation and accumulation of A2E by blue light. Specifically, macular degeneration, glaucoma, retinitis pigmentosa, Stargardt disease, choroideremia, choroider atrophy, dry eye syndrome And it may mean one or more selected from the group consisting of eye strain (eye strain), but is not limited thereto.

The macular degeneration (MD) refers to a phenomenon in which central vision is destroyed by damage to the macula, and the macular degeneration disease is dry macular degeneration, wet macular degeneration, age-related macular degeneration, myopic macular degeneration and idiopathic macular degeneration. It may include sex, and more specifically, may be age related macular degeneration (AMD).

The exact etiology of senile macular degeneration is still unknown, but it is generally known that the accumulation of excessive pigment in retinal pigment epithelial cells following aging appears to occur in the early stages of senile macular degeneration, all-trans retinal (all-trans A2E, which is produced by the synthesis of -retinal) and ethanolamine, is a substance that accumulates in retinal epithelial cells, generates singlet oxygen by blue light, and the double bond between carbons is oxidized, causing retina It can cause damage to pigment epithelial cells.

Prevention or treatment of the eye disease may be achieved by inhibiting cell death by A2E oxidized by blue light. In one embodiment of the present invention, after A2E accumulation in human retinal pigment epithelial cells, cell death occurs upon irradiation with blue light, and it is confirmed that cell death is suppressed when treating eggplant extract (FIG. 1). That is, the eggplant extract of the present invention can be usefully used for the prevention or treatment of eye diseases by inhibiting apoptosis caused by exposure to blue light.

The pharmaceutical composition of the present invention can also be used as a single agent, and it can be prepared and used as a combination preparation by further including a pharmaceutical composition known to have a recognized ocular disease prevention or treatment effect. Pharmaceutically acceptable carriers, excipients, or diluents can be added to formulate into pharmaceutical unit dosage forms.

In the present invention, "pharmaceutically acceptable" means not significantly stimulating the organism and not inhibiting the biological activity and properties of the active substance administered.

In the present invention, the pharmaceutical composition containing a pharmaceutically acceptable carrier is a tablet, a pill, a powder, a granule, a capsule, a suspension, an intravenous solution, an emulsion, a syrup, a sterilized aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a freeze It may have any one formulation selected from the group consisting of desiccants and suppositories.

The pharmaceutical composition may be various oral or parenteral formulations. In the case of formulation, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc., which are usually used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations include at least one excipient in one or more compounds, such as starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, and the like. In addition, lubricants such as magnesium stearate and talc may be used in addition to simple excipients. Liquid preparations for oral administration include suspending agents, intravenous solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are common diluents, various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, can be included. have.

Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. As non-aqueous solvents and suspension solvents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin, etc. may be used, but is not limited thereto. Specifically, eye drops for intraocular administration, eye drops, and the like may be included.

Eggplant extract in the composition of the present invention may be included in a pharmaceutically effective amount. “Pharmaceutically effective amount” means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and does not cause side effects, and an effective dose level is a patient's health condition, type of disease, The severity, activity of the drug, sensitivity to the drug, method of administration, time of administration, route of administration and rate of excretion, duration of treatment, factors including the drug used in combination or co- and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect in a minimal amount without side effects, which can be easily determined by those skilled in the art.

Another aspect of the present invention provides a food composition for preventing or improving eye diseases, which includes eggplant extract as an active ingredient.

"Branch", "extract", "eye disease" and "prevention" are as described above.

Eggplant is a natural substance that has been used for a long time and has been proven to be a safe substance for the human body, so it can be ingested in the form of food that can be common sense and prevent or improve eye diseases.

In the present invention, "improvement" means any action that reduces the parameters related to the condition to be treated by ingestion of the food composition, for example, the severity of symptoms.

Eggplant extract contained in the food composition of the present invention may be included in the form of animals and plants, extracts thereof, fractions thereof or processed products thereof containing the extracts of eggplants of the present invention. In addition, the composition may include a food additive that is food-pharmaceutically acceptable in addition to the active ingredient.

In the present invention, "food supplement additive" means a component that can be supplementally added to food, and is added to prepare a health functional food of each formulation, and can be appropriately selected and used by a person skilled in the art. Examples of food additives include flavors such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants and fillers, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners , pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonic acid used in carbonated beverages, and the like.

The food composition of the present invention may include a health functional food. The healthy food refers to food prepared and processed in the form of tablets, capsules, powders, granules, liquids and pills using ingredients or ingredients having useful functionality for the human body. Here, the term "functionality" means obtaining a useful effect for health use, such as adjusting nutrients or physiological effects on the structure and function of the human body. The health functional food of the present invention can be manufactured by a method conventionally used in the art, and may be prepared by adding raw materials and ingredients commonly added in the art. In addition, the formulation of the health functional food can also be prepared without limitation as long as the formulation is recognized as a health functional food. The food composition of the present invention can be manufactured in various types of formulations, and has the advantage of not having side effects that may occur when taking the drug for a long time by using food as a raw material, unlike general medicines, and is excellent in portability. Health functional foods can be consumed as supplements to enhance the effect of improving eye diseases.

There is no limitation in the form that the health functional food of the present invention can take, it may include all foods in a common sense, and it is interchangeable with terms known in the art, such as functional food. In addition, the health functional food of the present invention can be prepared by mixing appropriate other auxiliary ingredients and known additives that may be included in the food according to the choice of those skilled in the art. Examples of foods that can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, dairy products including gums, ice cream, various soups, beverages, teas, drinks, alcoholic beverages, and There are vitamin complexes and the like, and can be prepared by adding the extract according to the present invention as a main component, and adding it to juice, tea, jelly, and juice. It also includes foods used as feed for animals.

The pharmaceutical composition and food composition of the present invention may further contain one or more active ingredients exhibiting the same or similar functions. For example, it may include ingredients for preventing and / or treating eye diseases known in the art. Due to the additional components, the effect of preventing and / or treating eye diseases of the composition of the present invention may be further enhanced. The content range of additional ingredients may be appropriately adjusted by a person skilled in the art in consideration of safety according to the combined use, ease of formulation, and stability of active ingredients.

Another aspect of the present invention provides a method for preventing or treating eye diseases, comprising administering the pharmaceutical composition to a suspected eye disease subject.

"Branch", "extract", "eye disease", "prevention" and "treatment" are as described above.

In the present invention, "individual" refers to monkeys, cows, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits, or guinea pigs, including humans who may or may develop the eye disease. Means all animals, including, by administering the pharmaceutical composition of the present invention to the individual can effectively prevent or treat the eye disease. In addition, the pharmaceutical composition of the present invention may exhibit a synergistic effect by administering in parallel with an existing therapeutic agent.

In the present invention, "administration" means providing a predetermined substance to a patient in any suitable way, and the route of administration of the composition of the present invention can be administered through any general route as long as it can reach the target tissue. have. Intraocular administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, intrarectal administration, but are not limited thereto. In addition, the pharmaceutical composition of the present invention may be administered by any device capable of transporting the active substance to target cells. Preferred modes of administration and formulations are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, and the like. Injectables include aqueous solvents such as physiological saline solutions and ring gel solutions, vegetable oils, higher fatty acid esters (e.g., oleic acid ethyl), and non-aqueous solvents such as alcohols (e.g. ethanol, benzyl alcohol, propylene glycol, glycerin, etc.). Stabilizers (e.g., ascorbic acid, sodium hydrogen sulfite, sodium pyrosulfite, BHA, tocopherol, EDTA, etc.), emulsifiers, buffers for pH control, and for preventing microbial growth And a pharmaceutical carrier such as a preservative (eg, phenyl mercuric nitrate, chimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, etc.).

Eggplant extract has the effect of inhibiting apoptosis caused by oxidized A2E in retinal pigment epithelial cells and treating eye diseases caused by blue light. Therefore, the composition according to the present invention can be usefully used for the prevention or treatment of various eye diseases.

1 is a view confirming whether the retinal pigment epithelial cell death in the control and eggplant extract treatment group under a microscope.
2 is a graph quantifying the survival rate of retinal pigment epithelial cells in the control and eggplant extract treatment groups.
3 is a graph showing the expression of the INHBA gene in the control and eggplant extract treatment groups.

Hereinafter, the present invention will be described in more detail through examples. These examples are intended to illustrate the present invention more specifically, but the scope of the present invention is not limited to these examples.

< Example  1> Preparation of eggplant extract

After adding 3 L of 50% ethanol to 300 g of dried eggplant, extraction was performed at 4 ° C. for 24 hours. After filtering the extract with filter paper (Pore size, 8um), it was concentrated using a vacuum concentrator. The concentrate was lyophilized to complete a powdered eggplant extract.

< Example  2> Eggplant Extract Blue light  Judo Retinal pigment epithelial cells  Death inhibition effect

2-1. Blue light  By investigation Retinal pigment epithelial cells  Method of killing and measuring cell viability

A2E accumulated in human retinal pigment epithelial cells is known to induce cytotoxicity when irradiated with blue light. Using the human retinal pigment epithelial cell line, the effect of the eggplant extract on suppressing cell death by blue light irradiation was measured.

The human retinal pigment epithelial cell line (ARPE-19) used in the experiment was pre-sale from the American Type Culture Collection (ATCC). The ARPE-19 cell line was cultured in DMEM medium containing 10% FBS. After incubation, the cells were dispensed into 6-well plates at a concentration of 4 x 10 ³ cells / well and cultured for 24 hours.

In order to induce A2E accumulation in the ARPE-19 cell line, A2E was treated three times at a concentration of 20 μM at 48 hour intervals. After 24 hours after the last A2E treatment, eggplant extracts were treated twice in total at 24 hour intervals. Thereafter, after further incubation for 24 hours, blue light (BL, 430 nm, 6000 lux) was irradiated for 20 minutes, and cultured for 24 hours.

Cell death was observed under a microscope, and the number of living cells was measured using Image J (National Institutes of Health, USA) for quantitative cell viability calculation.

2-2. Blue light  By investigation Retinal pigment epithelial cells  Death and cell viability measurements

Cell death did not occur when only A2E accumulation was induced or blue light was irradiated without A2E accumulation, and blue light was irradiated after A2E accumulation. The death of ARPE-19 cells was induced. On the other hand, in the eggplant extract (20 ug / ml) treatment group, it was confirmed that cell death was significantly inhibited compared to the control group DMSO treatment group (FIG. 1).

As a result of quantifying the cell viability with Image J, it was confirmed that the eggplant extract had a statistically significant inhibitory effect on retinal pigment epithelial cell death (FIG. 2).

< Example  3> Eggplant Extract Blue light  Judo Retinal pigment epithelial cells  Effect of suppressing gene expression in apoptosis model

3-1. human In retinal pigment epithelial cells  Gene expression measurement method

The ARPE-19 cell line was cultured in DMEM medium containing 10% FBS. After incubation, the cells were dispensed into 6-well plates at a concentration of 4 x 10 ³ cells / well and cultured for 24 hours.

 The process of accumulating A2E in the ARPE-19 cell line, irradiating blue light, and treating the eggplant extract was performed in the same manner as in Example 2. After 24 hours of irradiation with blue light, total RNA was isolated from ARPE-19 cells using Trizol reagent (Invitrogen), and total RNA was quantified using Nanodrop, Thermo Scientific, CDNA was synthesized using 0.5 μg of total RNA, and amplified using a primer and a real-time gene amplifier LC480 (Roche) shown in Table 1 below as a template (PCR condition: denaturation-95 ° C., 10 sec. ; Primer binding-60 ° C, 10 seconds; elongation-72 ° C, 10 seconds).

gene Primer (forward) Primer 18S GAGGATGAGGTGGAACGTGT (SEQ ID NO: 1) TCTTCAGTCGCTCCAGGTCT (SEQ ID NO: 2) INHBA TGTGATGGCAAGGTCAACAT (SEQ ID NO: 3) ATGATAGCCAGAGGGAGCAA (SEQ ID NO: 4)

At this time, using the PCR result for 18S as a control, the relative amount of the gene measured in the ARPE-19 cell line was corrected.

3-2. human In retinal pigment epithelial cells  Gene expression measurement result

By A2E accumulation and blue light irradiation, the expression of the INHBA gene mRNA was significantly increased in the ARPE-19 cell line. In addition, when the eggplant extract (20ug / ml) was treated, it was confirmed that the expression of these genes was statistically significantly reduced (P <0.05) (FIG. 3).

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without changing its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as including all changes or modifications derived from the meaning and scope of the following claims rather than the above detailed description and equivalent concepts thereof.

Claims (7)

Pharmaceutical composition for preventing or treating ophthalmic disease comprising eggplant extract as an active ingredient.
The pharmaceutical composition for preventing or treating eye diseases according to claim 1, wherein the eye diseases are caused by blue light.
The method of claim 1, wherein the eye diseases include macular degeneration, glaucoma, retinitis pigmentosa, Stargardt disease, choroideremia, choroider atrophy, One or more selected from the group consisting of dry eye syndrome and eye strain, pharmaceutical composition for preventing or treating eye diseases.
According to claim 1, The composition is to inhibit cell death by N-retinidene-N-retinyl-ethanolamine (N-retinylidene-N-retinyl-ethanolamine: A2E) oxidized by blue light, Pharmaceutical composition for preventing or treating eye diseases.
Food composition for preventing or improving ophthalmic diseases comprising eggplant extract as an active ingredient.
The method of claim 5, wherein the eye diseases are macular degeneration, glaucoma, retinitis pigmentosa, Stargardt disease, choroideremia, choroider atrophy, Food composition for preventing or improving eye disease, at least one selected from the group consisting of dry eye syndrome and eye strain.
The food composition for preventing or improving eye diseases according to claim 5, wherein the composition inhibits cell death caused by A2E oxidized by blue light.

Images