KR20200018919A - a herb fermentation extraction composite for improving cholesterol lowering and blood glucose regulation - Google Patents

Abstract

The present invention relates to a natural fermented composition having effects of alleviating cholesterol and regulating blood glucose, which has effects of alleviating cholesterol and regulating blood glucose by using a fermented composition obtained by fermenting a natural composite of artemisiae capillaris herba, turmeric, hawthorn, and salvia miltiorrhiza, and to a pharmaceutical composition including the same. The natural fermented composition having effects of alleviating cholesterol and regulating blood glucose is obtained by re-fermenting an extract extracted by mixing artemisiae capillaris herba, turmeric, hawthorn, and salvia miltiorrhiza. Also, the natural fermented composition having effects of alleviating cholesterol and regulating blood glucose is obtained by re-fermenting an extract extracted by mixing 80 to 120 parts by weight of turmeric, 80 to 120 parts by weight of hawthorn, and 80 to 120 parts by weight of salvia miltiorrhiza with respect to 100 parts by weight of artemisiae capillaris herba.

Description

A fermentation extraction composite for improving cholesterol lowering and blood glucose regulation

The present invention relates to a natural fermentation composition having a cholesterol regulating function and a glycemic control effect, in particular, a fermentation composition fermented with natural complexes of Injinho, Ulgeum, Sansa, and Salvia Miltiorrhiza. .

Recently, developed countries have been increasing the number of patients with metabolic syndrome (metabolic syndrome), such as obesity, heart disease, diabetes, hypertension due to changes in eating habits. Metabolic syndrome refers to the occurrence of various disorders in one individual, such as impaired glucose tolerance, hypertension, hyperlipidemia, obesity, and cardiovascular atherosclerosis due to chronic metabolic disorders.

In other words, insulin, which breaks down glucose and sends it to the liver and muscles, is not made properly, or if it does not function properly, various adult diseases such as diabetes, hypertension, stroke, and heart disease are found. Among these, diabetes is one of the rapidly increasing diseases, which is a chronic disease in which glucose is excreted in the urine due to abnormally high glucose concentration in the blood due to the relative lack of insulin. That is, carbohydrates in the digestive tract are degraded by the digestive enzymes α-amylase and α-glucosidase and finally digested and absorbed by glucose and fructose in the small intestine.

Cholesterol is also absorbed through food, but it is also synthesized by our bodies. Cholesterol is found in high concentrations in organs with many membranes, such as the liver, spinal cord, and brain, and is also a major component of blood clots. Cholesterol plays an important role in many physiological and biochemical reactions and is closely related to cardiovascular disease.

Cholesterol is produced primarily by the liver and is present in the blood in the form of small round particles called lipoproteins, which are transported throughout the body. There are two types of lipid protein, low density lipoprotein (LDL) and high density lipoprotein (HDL), and because HDL carries cholesterol from other tissue to liver, if HDL is high, cholesterol in blood vessel Removed. Since LDL is mainly produced in the liver and transported to other tissues of the human body, it is known that a large amount of LDL promotes arteriosclerosis by accumulating cholesterol in blood vessels.

Specifically, the cholesterol is an essential ingredient necessary for maintaining the normal functioning of the human body, a nutrient necessary for making biological membranes and cells, an ingredient of various hormones such as corticosteroids and sex hormones, and making bile. It becomes material. However, too much cholesterol is known to accumulate in blood vessels and cause heart disease.

So far, there have been few reports on the prevention or treatment of diseases caused by excess cholesterol, but there are practically no ways to prevent it, except low cholesterol diet, and cholesterol synthase activity compared to the effects of taking drugs such as cholesterol lowering agents. Problems causing side effects such as liver dysfunction due to inhibition have been proposed.

Therefore, in recent years, a lot of research is being conducted for the development of a substance which is more stable to the human body and which can effectively prevent, improve or treat excess cholesterol.

In this regard, as an example of studies conducted to date, Korean Patent No. 0561532 (prior art 1) containing a yucca extract or quillaya extract, a functional composition having a blood cholesterol lowering ability is known, and Korean Patent No. 1451588 Although arteriosclerosis prevention or therapeutic pharmaceutical compositions including cinnamon, pine needles, turmeric and licorice are known, there is still insufficient development of effective substances that effectively lower cholesterol and have little side effects or cytotoxicity.

In addition, Patent No. 10-1540004 (health functional food composition for improving blood sugar, blood pressure, blood flow and cholesterol) is "Glucose, blood pressure, blood pressure composed of four components of coenzyme Q10, ginkgo biloba extract and banaba leaf extract. , Health functional food composition for improving blood flow and cholesterol ".

The prior art and the prior art still lacks the lowering of cholesterol, the effect on blood sugar control is weak, the development of an effective substance with little side effects or cytotoxicity is insufficient.

The present invention is very effective in lowering cholesterol, compared to the prior art and the prior art, very effective in blood sugar control and has little side effects or cytotoxicity, and improves cholesterol and glycemic control effect using natural materials having the effect of producing GABA substance after fermentation. To provide a natural fermentation composition with this.

The present invention to solve the above object and demands,

The fermented extract extracted by mixing Injinho, Ulgeum, Sansa, and Salvia Milsaeng provides fermentation composition with improved cholesterol extraction and glycemic control effect.

In addition, the present invention is a natural fermentation composition having improved cholesterol and glycemic control effect by extracting fermented extract extracted by mixing 80 ~ 120 parts by weight of turmeric, 80 ~ 120 parts by weight, 80 ~ 120 parts by weight of Salvia soybeans to provide.

In another aspect, the present invention provides a pharmaceutical composition comprising a natural fermentation composition having the above cholesterol improving and glycemic control efficacy.

The natural fermentation composition according to the present invention lowers cholesterol more effectively than the prior art and the prior art, is very effective in regulating blood sugar, has little side effects or cytotoxicity, and has an effect of producing GABA substance after fermentation, thereby improving cholesterol and controlling blood sugar. More pronounced efficacy.

1 is a method for producing a natural fermentation composition according to the present invention.
Figure 2 is a diagram confirming the production of GABA natural fermentation composition according to the present invention.
3 to 6 are diagrams for the data of experiments in cells and animals of the natural fermentation composition (FMH) effective in improving cholesterol and glycemic control prepared by the embodiment according to the present invention.

Hereinafter, the present invention will be described in detail with reference to the drawings.

The present invention provides a natural fermentation composition having improved cholesterol and glycemic control effect by re-fermenting the extract extracted by mixing Injinho, turmeric, Sansa, Salvia.

The present invention is preferably natural fermentation with improved cholesterol and glycemic control effect by extracting by fermenting the extract extracted by mixing 80 ~ 120 parts by weight of turmeric, 80 ~ 120 parts by weight, 80 ~ 120 parts by weight of Salvia soybeans To provide a composition.

In another aspect, the present invention provides a pharmaceutical composition for improving cholesterol and glycemic control, including a natural fermentation composition having the above cholesterol improving and glycemic control efficacy.

Injinho of the present invention means dried dried outposts of the Asteraceae plant Injinho Artemisia capillaris Thunb. It grows on the sandy ground near the foothills and along the creeks. Between late spring and early summer, young shoots that grow about 10-15 cm are dried in the shade of a bear. The taste is very bitter and the nature is cool. It acts on the liver, the parenteral, and the bladder. Lower the heat, get rid of moist (濕 邪) and let the urine well. In pharmacological experiments, dipharymia, antipyretic, lowering blood pressure, lowering blood sugar, promoting hepatic parenchymal repair, antimicrobial, antiviral, and roundworm paralysis were found. Write for hepatitis, urine, itching, spear, scabies, etc. When using external medication, wash with decoction. In other countries, Injinho is used as Saninjin.

Turmeric of the present invention generally refers to the use of tubers of several plants belonging to Curcuma as a medicinal herb, edible, colorant, and the like.

Includes the ginger family Curcuma longa Radix, C. aromatica, C. kwangsiensis, and C. zedoaria. Compared with normal turmeric, turmeric is root stem, while turmeric is dried using tubers. It is grown or grown in Southeast Asia including South China, India and Okinawa. Originally, the name of the turmeric was named because it turns yellow when it is mixed with alcohol, and it is called magic because it is similar in shape to Azul and treats diseases of horses. Other names include magic (馬 울), Hwangwool (黄 鬱), Eulgeum (乙 金), Gulgeum (옥 金), jade gold (玉 金), Wanggeum (王金), turmeric (深 黃).

The hawthorn of the present invention means a medicinal herb (Korea) dried dried fruit of the Rosaceae (Crataegus pinnatifida Bunge var. Typica Schneider) and the same plant. In Japan, Yasansa (Crataegus cuneata Sieb. Et Zucc .: 野山 査) and Santae-hong (Crataegus pinnatifida Bge. (Crataegus pinnatifida Bge.var.major NE Br .: 山里紅).

The name Sansa is named after a fruit with an apple flavor and red color, which is like a small apple. Sansa fruit grows in the grass of the mountain, so monkeys and rats eat well, so it is also known as epic, hussa, after monkeys or rats. It is also called the red tide because it is similar to the red jujube.

Salviae of the present invention means perennial herbaceous plants belonging to the family Lamiaceae.

It is called red ginseng because it resembles the form of ginseng and its red color. The scientific name is Salvia miltiorrhiza BUNGE.

The height is 40-80㎝ and there are many hairs. Leaves face ovate or lanceolate. The back has dense and dull teeth.

The flower is purple and blooms in May-June and runs in layers. The root is used as a herbal medicine. It contains tannins and vitamin E, and animal experiments have been shown to dilate peripheral blood vessels and lower blood pressure.

The weakness (藥性) is slightly cold and bitter, and acts antibacterial to staphylococcus, E. coli, typhoid bacteria, tuberculosis bacteria. Myocardial infarction is a combination of unilateral, barn, etc., in the case of insomnia and anxiety caused by nervous breakdown, using a keel, a bone, etc. to treat.

Women's dysmenorrhea, dysmenorrhea and postpartum lower abdominal pain are also effective in the early symptoms of chronic hepatitis, liver dysfunction, cirrhosis. In addition, thrombophlebitis and high blood pressure is also used for hemorrhagic disease.

In particular, the technical feature of the present invention is that the composition extracted from the fermentation composition produced after the fermentation process again by extracting the mixture of the above-mentioned raw materials are produced GABA material and has a significant effect on improving cholesterol and glycemic control.

The present invention prepares a raw material in which 80 to 120 parts by weight of turmeric, 80 to 120 parts by weight of Sansa, 80 to 120 parts by weight of Salvia soybean is mixed.

In the present invention, 100 parts by weight of the raw material prepared above is put into 1000-2000 parts by weight of purified water (distilled water), and subjected to reflux extraction for 2 to 4 hours to obtain an extract.

The present invention mixes 5-7 parts by weight of MSG (L-Glutamate) to 100 parts by weight of the extract and sterilizes at 115-130 ° C. for 4-5 minutes.

After the sterilization process, the present invention mixes 2 to 4 parts by weight of glucose based on 100 parts by weight of the extract and inoculates 4 to 7 parts by weight of Bacillus subtilis to carry out the primary fermentation process. (4 courses)

The primary fermentation process is carried out by shaking 40 to 45 ℃ preferably 41 ℃, 40 to 56 hours preferably 48 hours.

The present invention is mixed with 1 ~ 3 parts by weight of glucos, 4 ~ 7 parts by weight of skim milk, based on 100 parts by weight of the extract, the fermented product, which has undergone the first fermentation process, and lactobacillus plantarum (lactobacillus plantarum)) Inoculate 0.5-5 parts by weight to carry out the second fermentation process.

The secondary fermentation process is carried out by shaking at 28 ~ 33 ℃ preferably 30 ℃, shaking for 60 to 80 hours preferably 72 hours.

The present invention performs a process of obtaining a natural fermentation composition having the effect of improving cholesterol and controlling blood sugar by extracting the secondary fermentation product after the secondary fermentation process.

The method of extracting the secondary fermentation may be a conventional extraction method or a method of concentrating under reduced pressure with a rotary vacuum evaporator.

The natural fermentation composition of the present invention thus obtained has a remarkable effect on improving cholesterol and controlling blood sugar.

The present invention can be seen that the natural fermentation composition obtained in the following examples has a significant effect on improving cholesterol and glycemic control.

<Example>

1. Sampling and Experiment Method

1) Sampling and Fermentation

2000 g of distilled water was added to 120 g of a raw material mixed with 30 g of Injinho, 30 g of turmeric, 30 g of mountain sand, and 30 g of Salvia bean, and reflux extraction was performed for 3 hours to obtain a filtrate.

The reflux extracted filtrate (1900ml) was mixed with MSG 4-5% (90-95g) and sterilized at 121 ℃ for 5 minutes.

2 ~ 3% (55 ~ 65g) of glucose to the sterile filtrate was mixed and inoculated about 4 ~ 5% (95 ~ 100g) Bacillus subtilis 1 while mixing at 42 ℃ for 48 hours 1 Proceed with tea fermentation.

Glucose 1 ~ 1.5% (25 ~ 38g), skim milk 4 ~ 5% (100 ~ 115g) is mixed with the primary fermentation and inoculated 0.5 ~ 1% (15 ~ 25g) Lactobacillus plantarum Secondary fermentation while mixing at 30 ℃ for 72 hours. (Figure 1)

The secondary fermented secondary fermentation product was concentrated under reduced pressure with a rotary vacuum evaporator, and 24.31 g of a fermentation mixed herbs extract ( FMH ) powder obtained by freeze drying the concentrated solution with a freeze dryer (yield 20.26%). Was stored in an cryogenic freezer (-80 ℃) and diluted with distilled water to the concentration required for the experiment.

2) cell culture

HUVEC cells were cultured in a cell incubator maintained at 37 ° C. and 5% CO ₂ using medium mixed with EGM ^™ -2 Medium and EGM ^™ -2 SingleQuots ^™ Kit. Proceeded.

3) TLC analysis

For the qualitative analysis of MSG and GABA, a silica gel TLC plate was cut to a size of 10 × 20 cm and TLC development was performed in a square chamber (30 × 25 × 10 cm). MSG 0.5% and GABA 0.5% were used as a standard for comparing MSG residue and GABA content. The developing solvent was mixed with acetic acid glacial: n-butylalcohol: distilled water at a ratio of 1: 3: 1 (v / v) and saturated at room temperature for at least 3 hours. The fermented product was diluted twice with distilled water, and 2 μl of the sample and the standard solution were placed at a position of 15 mm below the TLC plate, and the interval was maintained at 10 to 15 mm. After dropping, the sample of TLC plate was dried and then developed. The developed TLC plate was dried in a 50 ° C vacuum dryer. Sprinkle 0.2% ninhydrin solution as a color reagent on the dried TLC plate, color it for 5 to 10 minutes in a 100 ℃ vacuum dryer, and check the glutamic acid and GABA spot of the fermented product.

4) Cell viability measurement

HUVEC cells were inoculated into 1.5 × 10 ⁵ cells / well in a 96 well plate and incubated for 24 hours. Before the experiment, they were replaced with fresh culture medium, and FMH was treated at concentrations of 1, 10 and 100 (㎍ / ml), respectively. Again incubated for 24 hours. After incubation, 10 μl of EZ-Cytox solution was added and reacted in a cell incubator for 30 minutes. After the reaction, the change in absorbance at 450 nm was measured to express the cell viability of the control group as a percentage.

5) Measurement of gene expression in cells

  (1) RNA extraction

HUVEC cells were aliquoted into 6 well plates at 10 ⁶ cells / well and incubated for 24 hours. After incubation, the cells were replaced with fresh culture medium, and treated with FMH 1, 10, 100 (µg / ml) and 1 µg / ml TNF-α. After washing HUVEC cells twice with PBS, 1 ml of easy blue and 200 µl of chloroform were added and vortexed, followed by centrifugation at 13,000 rpm and 4 ° C. for 10 minutes. After 400 μl of the supernatant and 400 μl of binding buffer were reacted at room temperature for 1 minute, 700 μl of the reaction solution was injected into the column and centrifuged at 13,000 rpm for 30 seconds. 700 μl of washing buffer A was added to the column and centrifuged at 13,000 rpm for 30 seconds. Then, 700 μl of washing buffer B was added and centrifuged in the same manner. After replacing the bottom column with Ep tube, add 50 μl of elution buffer to the column, react for 1 minute, and centrifuge for 1 minute at 13,000 rpm to collect the extracted total RNA.

  (2) cDNA synthesis

  Reverse transcription reaction was carried out in diethyl pyrocarbonate (DEPC) -treated distilled water with a final volume of 20 μg using a mixture of RT premix kit (reaction buffer, dNTPs mixture, RNase inhibitor, stabilizer, oligo dT15 primer). Add to μl. After mixing 20 μl of the reaction mixture well and reacting at 45 ° C. for 60 minutes to synthesize first-strand cDNA, it was left at 95 ° C. for 5 minutes to inactivate M-MLV RT, and then the synthesized cDNA was polymerase chain reaction. (PCR).

(3) Gene expression level measurement

  Real-time PCR was performed to amplify the synthesized cDNA, and 1 μl of cDNA, 2 μl of each primer, 10 μl of SYBR Green, and 5 μl of DEPC-DW were added to the real-time dedicated tube. After reacting for 5 minutes at 94 ° C, it repeated for 15 seconds at 94 ° C, 30 seconds at 60 ° C, and 30 seconds at 72 ° C for 40 times, after which the gene expression was calculated compared to the control group. Is shown in [Table 1].

Table 1.The Sequences of Primers in This Study Primer F / R ^* Sequences KLF2 F CCTCCTTGACGAGTTTTGTTTTTC R AAGGCATCACAAGCCTCGAT eNOS F CTCATGGGCACGGTGATG R ACCACGTCATACTCATCCATACAC VCAM-1 F CCCTACCATTGAAGATACTGG R ATCTCTGGGGGCAACATTGAC GAPDH F GGCAAATTCCATGGCACCG R TCGCCCCACTTGATTTTGGA

^* F: forward, R: reverse

6) Statistical Processing

The experimental results were statistically analyzed using the unpaired student's T-test and ANOVA of SPSS 24.0 and tested for significance at p <0.05, p <0.01 and p <0.001.

2. Experimental Results

1) TLC analysis

As a result of confirming the production of GABA through TLC analysis, 72 hours of lactic acid fermentation through L. plantarum was exhausted MSG was used to produce about 0.4% of GABA (Fig. 2).

2) Cell viability measurement

As a result of measuring the cell viability in HUVEC cells, when the control group showed 100.00 ± 2.19%, FM. ± 1.91% (Figure 3).

3) Measurement of gene expression in cells

(One) KLF2

As a result of measuring the expression level of KLF2 gene in cells, it was 1.69 ± 0.14% in the normal group and 1.00 ± 0.07% in the control group, respectively 0.74 ± 0.03% and 1.74 ± 0.09% in FMH 1, 10 and 100 ㎍ / ml, respectively. , 2.35 ± 0.01%, showing a significant (***: p <0.001) increase at 10 and 100 μg / ml concentrations (FIG. 4).

(2) eNOS

As a result of measuring the expression level of eNOS gene in cells, it was 0.60 ± 0.16% and 2.01 ± 0.04% in FMH 1, 10, 100 ㎍ / ml, respectively, when it was 1.81 ± 0.14% in normal group and 1.00 ± 0.07% in control group. , 2.42 ± 0.01%, which showed a significant (***: p <0.001) increase at 10, 100 μg / ml concentration (FIG. 5).

 3) VCAM -One

As a result of measuring the expression level of VCAM-1 gene in cells, it was 0.13 ± 0.04% in the normal group and 1.00 ± 0.09% in the control group, respectively, 0.67 ± 0.10% and 0.73 ± in FMH 1, 10 and 100 ㎍ / ml, respectively. 0.06% and 0.42 ± 0.14%, which showed a significant (*: p <0.05, **: p <0.01) decrease at all concentrations (FIG. 6).

Natural fermentation composition having cholesterol improvement and glycemic control efficacy according to the present invention can be seen that there is a significant effect on cholesterol improvement and glycemic control as shown in the above experimental results.

As such, the present invention provides a natural fermentation composition having cholesterol improving and glycemic control efficacy.

The present invention is very useful in the industry of producing, manufacturing, selling, distributing, and researching drugs, compositions, and the like, which are effective in improving cholesterol and controlling blood sugar.

In particular, the present invention is very useful in the industry of producing, manufacturing, selling, distributing, and researching natural compositions or fermentation compositions that are effective in improving cholesterol and controlling blood sugar.

Claims (3)

Natural fermentation composition with improved cholesterol and glycemic control effect by re-fermenting the extract extracted by mixing Injinho, Ulgeum, Sansa, and Salvia Miltiorrhiza.
The method of claim 1,
Natural fermentation composition with cholesterol improvement and glycemic control effect, extracted by fermenting the extract extracted by mixing 80-120 parts of turmeric, 80-120 parts by weight, and 80-120 parts by weight of salvia.
A pharmaceutical composition comprising a natural fermentation composition having the effect of improving cholesterol and glycemic control according to claim 1.

Images