KR20200005776A - Recombinant yeasts of simultaneously producing ethanol and C4-organic acids - Google Patents

Abstract

The present invention provides a recombinant yeast strain which selectively increases production of ethanol or organic acid without inhibiting growth of yeast by lowering a gene expression degree of an acetaldehyde dehydrogenase synthesizing ethanol and a glycerol dehydrogenase and overexpressing an organic acid synthesizing gene. The recombinant yeast strain limits an output of a fermentation byproduct such as glycerol, thereby being realistically used for industrial processes such as production of bio compounds and bio synthetic resins using the glycose.

Description

Recombinant yeasts of simultaneously producing ethanol and C4-organic acids

The present invention relates to a recombinant yeast for producing ethanol and C4 organic acid and a method for producing ethanol and C4 organic acid through it.

Organic acids having four carbon atoms are widely used in food and cosmetic fields. Recently, the usefulness as a precursor of bio-synthetic resin has also been proved, and the use range is gradually being widened. Most of C4-organic acid is produced through chemical decomposition / synthesis method, and various studies have been made to produce it in an environmentally friendly manner.

At present, it has been confirmed to produce high concentrations of organic acids from bacteria and fungi, but it is known that there are many problems in industrial applications because of low safety and acid resistance.

Microorganisms such as yeast have been proven to be excellent in acid resistance, but there is a problem that the production concentration of organic acids is significantly low. To solve this problem, ethanol production was blocked by inactivation of pyruvate decarboxylase in S. cerevisiae, and yeast-specific genes and foreign genes derived from Schizosaccharmyces pombe, Aspergillus flavus, Aspergillus niger were introduced into yeast. Although studies have been reported to produce organic acids, it is known that there is a problem that the microbial culture time is long, the alcohol production pathway is completely blocked, the growth is significantly slowed, and the concentration of the organic acid is not sufficiently increased.

Accordingly, while the production of ethanol and glycerol, which are fermentation by-products of yeast, is reduced, the development of new industrially useful microorganisms that can increase the productivity of organic acids, which are wood yeast products, is required.

Patent Document 1. Republic of Korea Patent No. 10-0315161

The present invention provides an industrial yeast strain that can selectively improve the production of ethanol and C4 organic acids without inhibiting the growth of yeast, and to provide a method for producing ethanol and C4 organic acids in high yield using the same. It is done.

In order to achieve the above object, the present invention is a pyc2 gene and mdh3 gene is introduced, any one or more genes selected from adh1, adh2, adh3, adh4, adh5, adh6 and adh7 is inactivated, the production of C4 organic acid is increased Provides recombinant yeast.

The recombinant yeast may be an additional inactivation of the gpd1 gene and gpd2 gene.

The recombinant yeast may be one that mlml1 gene and icl1 gene is additionally introduced.

The recombinant yeast may be that the spmae1 gene encoding the C4 organic acid transporter protein is further introduced.

The pyc2 gene may be represented by SEQ ID NO: 44, and the mdh3 gene may be represented by SEQ ID NO: 45.

The sequence present at the position 247 ~ 249 bp from 5 ′ of the adh1 gene to the downstream may be replaced with TAA stop codon, thereby failing to function.

The gpd1 gene may be one in which the gpd1 and gpd2 genes are inactivated by the introduction of a genomic expression cassette consisting of SEQ ID NO: 43.

The mls1 gene may be represented by SEQ ID NO: 47, and the icl1 gene may be represented by SEQ ID NO: 48.

The spmae1 gene may be represented by SEQ ID NO: 45.

The yeast may be a Saccharomyces cerevisiae strain as a host cell.

The strain may be a D452-2 strain.

In addition, the present invention 1) preparing the recombinant yeast; And

2) provides a method for producing a C4 organic acid comprising culturing the recombinant yeast in a medium.

Recombinant yeast to lower the gene expression of acetaldehyde dehydrogenase and glycerol dehydrogenase for synthesizing ethanol of the present invention and to overexpress the organic acid synthesis gene to selectively increase the production of ethanol or organic acid without inhibiting the growth of yeast Strains were provided.

Since the recombinant yeast strain is limited in the amount of production of fermentation by-products such as glycerol, it can be practically used in industrial processes such as the production of bio compounds and bio-synthetic resin using glucose.

1 is a diagram showing the metabolic pathway of organic acid production of the recombinant yeast strain (DMG-A1G12) of Example 7. Marked in blue is the name of the introduced gene, and marked in red is the name of the inactivated gene.
2 shows a cloning vector, and FIG. 2A is a cleavage map of the pRS423GPD_pyc2 vector. At this time, pRS423GPD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.
2B is a cleavage map of the pRS423GPD mdh3ΔSKL vector. At this time, pRS423GPD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.
2C is a cleavage map of the pRS423GPD_pyc2_mdh3ΔSKL vector. At this time, pRS423GPD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.
2D is a cleavage map of the pRS425PD_spmae1 vector. At this time, pRS425PD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.
2E is a cleavage map of the pRS426GPD_icl1 vector. At this time, pRS426GPD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.
2F is a cleavage map of the pRS426GPD_mls1ΔSKL vector. At this time, pRS426GPD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.
2G is a cleavage map of the pRS426GPD_mls1ΔSKL_icl1 vector. At this time, pRS426GPD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.
3 is a batch culture of the wild type yeast D strain (S. cerevisiae D452-2) and the recombinant strain of Comparative Example 1 and the recombinant strain of Example 1, glucose consumption, glycerol, ethanol, acetate, malate, A graph showing the amount of succinate produced. 3A shows the result of culturing the wild type D strain in YPD20 medium, and FIGS. 3B and 3C show the result of culturing the recombinant DC2 strain of Comparative Example 1 and the recombinant DM strain of Example 1 in YPD50 + 5% CaCO3 medium, respectively.
4 is a batch culture of the D-A1 strain of Example 2, DM-A1 strain of Example 3 and DC2-A1 strain of Comparative Example 3, glucose consumption, glycerol, ethanol, acetate, malate, It is a graph which measured and produced | generated the succinate production amount. 4A shows the results of culturing the D-A1 strain of Example 2 in YPD20 medium, and FIGS. 4B and 4C show YPD50 + 5% CaCO3 of the DM-A1 strain of Example 3 and the DC2-A1 strain of Comparative Example 3, respectively. It is the result of culture in the medium.
5 is a graph showing the production of glucose consumption, glycerol, ethanol, acetate, malate, and succinate over time by culturing the D-A1G12 strain of Example 5 and the DM-A1G12 strain of Example 6 in a batch manner; to be. 5A shows the result of culturing D-A1G12 strain in YPD20 medium, and FIG. 5B shows the result of culturing DM-A1G12 strain in YPD50 + 5% CaCO ₃ medium.
FIG. 6 is a graph showing the growth of glucose consumption, glycerol, ethanol, acetate, malate, and succinate over time by culturing the DMG-A1G12 strain of Example 7 in a batch manner. The medium used was YPD50 + 5% CaCO ₃ .
7 is a graph showing the maleate concentration measured from the DM strain of Example 1, DM-A1G12 strain of Example 6, and DMG-A1G12 strain of Example 7 for 30 hours and measured therefrom.
8 is a graph showing the production of glucose consumption, glycerol, ethanol, acetate, malate, and succinate over time by culturing the D-A13G12 strain of Example 8 and the DM-A13G12 strain of Example 9 in a batch manner. to be.

It will be described below in more detail.

In one aspect of the present invention, a pyc2 gene and an mdh3 gene are introduced, and at least one gene selected from adh1, adh2, adh3, adh4, adh5, adh6, and adh7 is inactivated. It is about.

In the present invention, "inactive or lost activity" refers to a state in which a part or all of a gene is deleted, inserted, substituted, inverted, or duplicated, resulting in a loss or reduced activity of a microorganism in its natural state. do. For the purposes of the present invention, inactivation of the adh gene refers to a state in which a mutation occurs in part or all of the adh1, adh2, adh3, adh4, adh5, adh6 and adh7 genes.

The pyc2 gene and mdh3 gene may have a nucleotide sequence consisting of SEQ ID NO: 44, SEQ ID NO: 45, respectively.

Conventionally, bacteria and fungi were used as strains for producing organic acids, but there is a problem that it is difficult to utilize industrially due to low stability and acid resistance. Meanwhile, yeast strains that block ethanol production through inactivation of pyruvate decarboxylase in S. cerevisiae have been reported, but due to the genes in the yeast, the incubation time is long, alcohol production There is a problem that growth is slow because the pathway is completely blocked, the organic acid is not produced sufficiently.

In the present invention, in order to produce a yeast capable of overproducing C4-organic acid from glucose by culturing ethanol and glycerol-producing microorganisms, pyc2 gene and mdh3 gene are introduced into wild-type yeast, and adh1, adh2, adh3, An attempt was made to provide a recombinant yeast having increased production of C4 organic acids in which at least one gene selected from adh4, adh5, adh6 and adh7 is inactivated.

The pyc2 gene expresses pyruvate carboxylase derived from S. cerevisiae, and the mdh3 gene is known to express malate dehydrogenase.

In addition, the adh1, adh2, adh3, adh4, adh5, adh6 and adh7 are the genes encoding alcohol dehydrogenase I, II, III, IV, V, VI, VII in order, using the CRISPR / Cas9 system of the yeast By inserting a stop codon into the gene in the genome, one or more gene activities selected from adh1, adh2, adh3, adh4, adh5, adh6 and adh7 encoding alcohol dehydrogenase may be lost or inactivated.

For example, the adh1 gene may be one in which a sequence existing at a position of 247-249 bp from 5 ′ to downstream of the adh1 gene is replaced with a TAA stop codon, and the function is defective, but is not particularly limited thereto.

The recombinant yeast may be one in which the gpd1 gene and the gpd2 gene are additionally deleted or replaced to lose activity. The gpd1 gene and gpd2 gene are known as genes encoding glycerol-3-phosphate dehydrogenase.

Specifically, in order to inactivate gpd1, the TGG sequence coding for tryptophan located at the 71st downstream from the start codon was designated as the PAM sequence, and the GPD1p_mdh3ΔSKL_CYC1t expression cassette (SEQ ID NO: 1) was disrupted from 5 'to 620 bp of the gene including ATG. 43) may be introduced into the dielectric. In order to inactivate the gpd2, TGG sequence coding tryptophan located at the 309th downstream from the start codon was designated as the PAM sequence, and 980 bp of the gene including ATG may be removed.

In addition, the recombinant yeast may be that the mls1 gene and icl1 gene is additionally introduced. The mls1 and icl1 genes are isocitrate lyases and mathematic enzymes that convert isocitric acid into glyoxylate and succinate, among the enzymes that form the glyoxylate cycle. malate The mls1 gene may be represented by SEQ ID NO: 47, and the icl1 gene may be represented by SEQ ID NO: 48.

In addition, the recombinant yeast may be that the spmae1 gene encoding the C4 organic acid transporter protein is additionally introduced. The spmae1 gene is a gene encoding a malate derived from S. pombe, a succinate specific transporter (malate / succinate exporter). Introducing the gene allows for the extracellular secretion of malate and succinate, which have increased production. The spmae1 gene may be represented by SEQ ID NO: 46.

As described above, the recombinant yeast refers to a host cell metabolized and manipulated by transformation, and the host cell refers to a cell that is easily transformed by an expression vector. The type is not particularly limited as long as it can efficiently express. The suitable host cell may be a naturally occurring or wild type host cell or may be a modified host cell. The wild type host cell may be a host cell that is not genetically changed by a recombinant method.

As used herein, the term "metabolically engineered" refers to the involvement of rational pathway design and assembly of biosynthetic genes, control elements of these nucleic acid sequences, for the production of desired metabolites in microorganisms.

The host cell of the recombinant yeast may be a yeast, specifically, Saccharomyces cerevisiae strain. More preferably, the host cell may be Saccharomyces cerevisiae D452-2 (MATa, his3, leu2, ura3, can1) strain. The S. cerevisiae D452-2 strain is known as a strain that mainly produces ethanol and glycerol acetic acid under anaerobic culture conditions, such as general yeast. The strain can be grown under the conditions of 25 ~ 38 ℃, the optimum culture temperature is 30 ℃. It grows from pH 3.0 to 7.0 and the optimum growth pH is 5.50.

The present invention may provide a method for producing a recombinant yeast in which the pyc2 gene and the mdh3 gene are introduced and one or more genes selected from adh1, adh2, adh3, adh4, adh5, adh6 and adh7 are inactivated.

The gene referred to in the present invention is a gene derived from a host strain or an alien species other than the species to which the host strain belongs, or a strain other than the host strain, or a gene substantially modified from the original form, and for the purposes of the present invention, , Preferably may be useful genes related to malate production from glucose to further improve the production capacity of ethanol or C4 organic acid of Saccharomyces cerevisiae strain, for example from S. cerevisiae Genes encoding pyruvate carboxylase, malate dehydrogenase genes and genes encoding alcohol dehydrogenase. In a specific embodiment of the present invention isocitric acid glyoxylate and succinate among enzymes that inactivate the gene encoding glycerol-3-phosphate dehydrogenase or form a glyoxylate cycle. Genes encoding isocitrate lyase and malate synthase, respectively, were introduced. However, various foreign genes can be introduced or deleted.

In the present invention, the pyc2 gene and the mdh3 gene are introduced, and any one or more genes selected from adh1, adh2, adh3, adh4, adh5, adh6 and adh7 are inactivated to increase organic acid production of the D452-2 strain. Preferably, until the pyc2 gene, the mdh3 gene and the foreign gene are introduced, and the activity of the adh gene is lost, the organic acid is hardly produced even if the D452-2 strain is cultured in a glucose addition medium. After the pyc2 gene and mdh3 gene were introduced and the activity of the adh gene was lost, it was confirmed that when the strain was cultured in the medium, organic acids were produced at a significantly high concentration.

First, any one or more adh genes selected from adh1, adh2, adh3, adh4, adh5, adh6 and adh7 may be prepared by inserting a stop codon into a corresponding gene in the genome using a CRISPR / Cas9 system. For example, a strain in which the adh1 gene was inactivated was prepared by substituting the TAA stop codon for a sequence existing at a position of 247-249 bp from 5 ′ to downstream of adh1.

The pyc2 gene and the mdh3 gene may be introduced into a D452-2 strain or a strain in which the adh1 gene is inactivated while being inserted into a vector. As the vector, various types of vectors such as plasmid, virus, and cosmid may be used. Recombinant vectors include cloning vectors and expression vectors. Recombinant vectors contain essential regulatory elements operably linked to express the pyc2 and mdh3 genes in host cells, including, for example, promoters, initiation codons, genes encoding desired proteins, termination codons and terminators. It is preferable. In addition, the DNA encoding the signal peptide, enhancer sequences, non-translated regions, selectable marker regions, or replicable units at the 5 'and 3' ends of the gene of interest may be appropriately included.

Introduction of pyc2 gene and mdh3 gene include calcium phosphate method or calcium chloride / rubidium chloride method, lithium acetate method, electroporation method, electroinjection method, chemical treatment method such as PEG, gene gun guns) and other methods widely used in the art can be applied.

In a preferred embodiment, the present invention may be an introduction of the spmae1 gene encoding the C4 organic acid transporter protein together with the pyc2 gene and mdh3 gene in the host strain as described above.

The spmae1 gene may be inserted into a vector while the pyc2 gene and the mdh3 gene are introduced, and any one or more genes selected from adh1, adh2, adh3, adh4, adh5, adh6 and adh7 may be introduced into an inactivated strain. Various types of vectors, such as plasmid, virus, and cosmid, can be used. Recombinant vectors include cloning vectors and expression vectors. Recombinant vectors contain the necessary regulatory elements operably linked to express the spmae1 gene in the host cell, preferably including a promoter, an initiation codon, a gene encoding a protein of interest, a termination codon and a terminator. . In addition, the DNA encoding the signal peptide, enhancer sequences, non-translated regions, selectable marker regions, or replicable units at the 5 'and 3' ends of the gene of interest may be appropriately included.

In a preferred embodiment, the pyc2 gene and the mdh3 gene are introduced, and together with any one or more genes selected from adh1, adh2, adh3, adh4, adh5, adh6 and adh7, the production of C4 organic acids in which the gpd1 gene and gpd2 gene are inactivated May provide increased recombinant yeast.

In order to inactivate the gpd1 gene, the TGG sequence coding for the tryptophan located at the 71st downstream from the start codon is designated as the PAM sequence, and the GPD1p_mdh3ΔSKL_CYC1t expression cassette is broken into the genome while disrupting 5 to 620 bp of the gene including ATG. While introducing, it may be to introduce a pRS42H_gRNA_gpd1 vector expressing the guide RNA at the same time.

In order to inactivate gpd2, TGG sequence coding tryptophan located at 309th downstream from start codon was designated as PAM sequence, and pRS42H_gRNA_gpd2 vector expressing guide RNA while simultaneously removing 980bp of gene including ATG was removed. It may be to introduce.

Cas protein or gene information in the present invention can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). Specifically, the Cas protein may be a Cas9 protein. In addition, the Cas protein may be a genus Campylobacter, more specifically, a Cas protein derived from Campylobacter jejuni, and more specifically, a Cas9 protein.

In addition, the Cas protein is used in the present invention as a concept including all the variants that can act as an endonuclease or nickase activated in cooperation with the guide RNA in addition to the native protein. In the case of activated endonucleases or nickases, target DNA cleavage can be achieved, which can be used to bring genome correction. In addition, in the case of inactivated variants, it can be used to bring about transcriptional regulation or isolation of the desired DNA.

The variant of Cas9 protein may be a mutant form of Cas9 in which a catalytic aspartate residue or histidine residue is changed to any other amino acid. Specifically, the other amino acid may be alanine, but is not limited thereto.

The Cas protein or nucleic acid encoding the Cas protein may further include a nuclear localization signal (NLS) for locating the Cas protein in the nucleus. In addition, the nucleic acid encoding the Cas protein may additionally include a nuclear localization signal (NLS) sequence. Therefore, the expression cassette including the nucleic acid encoding the Cas protein may include an NLS sequence in addition to a regulatory sequence such as a promoter sequence for expressing the Cas protein. However, this is not limitative.

The Cas protein may be named RGEN (RNA-Guided Engineered Nuclease) along with target DNA specific guide RNA. As used herein, the term "RGEN" refers to a nuclease comprising a target DNA specific guide RNA and Cas protein as a component. In the present invention, the RGEN is a target DNA specific guide RNA or DNA encoding the guide RNA; And it can be applied to the cell in the form of an isolated Cas protein or a nucleic acid encoding the Cas protein, but is not limited thereto. In this case, the guide RNA or DNA encoding the same and the Cas protein or nucleic acid encoding the same may be applied to the cells simultaneously or sequentially.

In addition, the DNA encoding the guide RNA and the nucleic acid encoding the Cas protein may be used as the separated nucleic acid itself, but may be present in the form of a vector containing the expression cassette for expressing the guide RNA, and / or Cas protein. However, the present invention is not limited thereto.

The vector may be a viral vector, a plasmid vector, or an Agrobacterium vector. Examples of the viral vector may include Adeno-associated virus (AAV), but are not limited thereto.

The DNA encoding the guide RNA and the nucleic acid encoding the Cas protein may be present in individual vectors or in one vector, but are not limited thereto.

As used herein, the term "guide RNA" means a target DNA specific RNA, and may bind to a Cas protein to guide the Cas protein to the target DNA. Also. In the present invention, guide RNAs can be made to be specific to any target to be cleaved.

Specifically, the introduction into the cell may use a variety of methods known in the art, such as electroporation, liposomes, viral vectors, nanoparticles, as well as PTD (Protein translocation domain) fusion protein method, It is not limited to the example.

In addition, the present invention can provide a recombinant yeast having increased production of C4 organic acid in which the pyc2 gene, the mdh3 gene, the spmae1 gene, the mls1 gene, and the icl1 gene are introduced and the adh gene, the gpd1 gene, and the gpd2 gene are inactivated. .

The adh gene may be any one or more genes selected from adh1, adh2, adh3, adh4, adh5, adh6 and adh7.

 As described above, the mls1 gene and the icl1 gene may be additionally introduced into the recombinant strain. The recombinant strain may be added to the ability to promote ethanol production and growth of cells.

The mls1 gene and icl1 gene may be introduced into a strain while being inserted into a vector, and various types of vectors such as plasmid, virus, and cosmid may be used as the vector. Recombinant vectors include cloning vectors and expression vectors. Recombinant vectors contain essential regulatory elements operably linked to express the mls1 gene and icl1 gene in the host cell, including, for example, promoters, initiation codons, genes encoding desired proteins, termination codons and terminators. It is preferable. In addition, the DNA encoding the signal peptide, enhancer sequences, non-translated regions, selectable marker regions, or replicable units at the 5 'and 3' ends of the gene of interest may be appropriately included.

In addition, another aspect of the invention 1) preparing the recombinant yeast; And

2) to a method for producing a C4 organic acid comprising culturing the recombinant yeast in a medium.

The medium may be any medium that is conventionally used for cell culture without limitation. The medium may include a nitrogen source, inorganic salts, and the like, and may further include a bioactive material as necessary. As the nitrogen source, organic nitrogen sources such as proteins, amino acids, urea, and the like, and inorganic nitrogen sources such as nitrates and ammonium salts may be used. The inorganic salts may be Na +, K +, Ca2 +, Mg2 +, Cl-, and the like. Vitamin and the like may be used for the bioactive material, but is not limited thereto. In addition, the medium may include yeast extract, malt extract, etc., culture such as Rosewell Park Memorial Institute (RPMI), Dulbecco's Modified Eagle's Medium (DMEM), Minimum Essential Medium (MEM), etc., which are commercially available for cell culture. Badges may also be used, but are not limited thereto. According to one embodiment of the invention, acetic acid, starch, glucose, sugar and the like may be used as the carbon source, but preferably glucose may be used.

The culturing can be performed under predetermined temperature and pH conditions. The temperature may be 20 to 50 ° C, preferably 25 to 40 ° C, more preferably 28 to 35 ° C, but is not limited thereto.

In addition, according to another embodiment of the present invention, the pH may be in the range of 4 to 9, preferably in the range of 5 to 8, but is not limited thereto.

The present invention provides a microorganism, preferably a yeast strain, capable of efficient use of glucose when glucose is provided as a carbon source. To this end, in one embodiment of the present invention by performing genetic engineering experiments for promoting glucose metabolism, yeasts with improved ability to metabolize ethanol or C4 organic acid from glucose to confirm the transformation and properties, microorganisms with improved glucose metabolism, preferably Preferably, the useful compound productivity using yeast was confirmed.

In one embodiment of the present invention, as a result of constructing the yeast strain (DM strain) in which the pyc2 gene and the mdh3 gene were additionally introduced from the yeast strain, malate, which was rarely produced before, is produced at a concentration of about 2.7 g / L It was confirmed (see FIG. 3).

The recombinant D-A1 strain in which the gene adh1 gene encoding alcohol dehydrogenase I was inactivated was prepared by inserting a stop codon into the corresponding gene in the genome using the CRISPR / Cas9 system, and the pyc2 gene and mdh3 Gene was further introduced, and as a result of constructing the yeast strain, it was confirmed that the maleate was significantly increased more than three times compared to the DM strain at a concentration of 7.6 g / L (see FIG. 4).

By removing the gpd1 and gpd2 genes encoding glycerol-3-phosphate dehydrogenase from the yeast genome, and simultaneously introducing the pyc2 and mdh3 genes to limit the production of glycerol, a byproduct of fermentation, and inserting malate production-related genes into the genome. As a result of constructing DM-A1G12 strain to maintain the persistence of enzymatic activity even in long-term culture, the production of glycerol was not achieved, the final malate concentration was 7.58 g / L, and the ethanol concentration was 14.7 g / L. It was confirmed to be significantly higher (see FIG. 5).

Additionally, among the enzymes that form the glyoxylate cycle, isocitrate lyase and malate synthase, which convert isocitric acid into glyoxylate and succinate, respectively By introducing the icl1 gene and the mls1 gene encoding the DM-A1G12 strain, the DMG-A1G12 strain was constructed, which produced about 1.5 times higher malate than the DM-A1G12 strain. , 1.6 times better (see FIGS. 6 and 7).

Hereinafter, the present invention will be described in detail by Examples, Experimental Examples and Preparation Examples. However, the following Examples, Experimental Examples and Preparation Examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following Examples, Experimental Examples, and Preparation Examples.

Preparation Example 1: Construction and Identification of pRS423GPD_pyc2 Vector

To construct a vector expressing the pyc2 gene and the mdh3ΔSKL gene at the same time, a vector including each gene was constructed. The pyc2 gene having a length of 3543 bp was subjected to PCR amplification with the genomic DNA of pyc2_F (SEQ ID NO: 1), pyc2_R (SEQ ID NO: 2) primers, and S. cerevisiae D452-2. The amplified PCR product was treated with XhoI and XmaI restriction enzymes, and the two genes were ligation after the same restriction enzyme treatment with pRS423GPD vector. 2A is a cleavage map of the pRS423GPD_pyc2 vector. At this time, pRS423GPD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.

The recombinant vector was transformed and cloned into E. coli TOP10 (Invitrogen, Carlsbad, CA, USA), and finally pyc2_SQC1 (SEQ ID NO: 3), pyc2_SQC2 (SEQ ID NO: 4), pyc2_SQC3 (SEQ ID NO: 5), GPD_SQC_F (SEQ ID NO: 6), and CYC_SQC_R SEQ ID NO: 7) Gene was sequenced with a primer to confirm construction of the pRS423GPD_pyc2 vector. The pRS423GPD_pyc2 vector is a recombinant vector containing a pyc2 gene from S. cerevisiae.

SEQ ID NO: primer Sequence (5 'to 3') One pyc2_F tccccccgggatgagcagtagcaagaaatt 2 pyc2_R ccgctcgagttactttttttgggatgggg 3 pyc2_SQC1 tttgccccgtgaagttcgtga 4 pyc2_SQC2 ccggatggagacaagtgcta 5 pyc2_SQC3 caaccatcaattaatgcact 6 GPD_SQC_F gtaggtattgattgtaattctgtaaat 7 CYC_SQC_R tctcaagcaaggttttcagtataat

Preparation Example 2 Construction and Verification of pRS423GPD_mdh3ΔSKL Vector

 The mdh3ΔSKL gene, which has a length of 1023 bp, was used for the PCR reaction with genomic DNA of pfu polymerase, MDH3_F, MDH3_R primers and S. cerevisiae D452-2. The amplified PCR product and the pRS423GPD vector were treated with BamHI / EcoRI (mdh3ΔSKL) followed by ligartion reaction. The recombinant vector was transformed into E. coli TOP10. Genes were sequenced with GPD_SQC_F (SEQ ID NO: 6) and CYC_SQC_R (SEQ ID NO: 7) primers to confirm the construction of the pRS423GPD_mdh3ΔSKL vector. 2B is a cleavage map of the pRS423GPD mdh3ΔSKL vector. At this time, pRS423GPD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.

 The pRS423GPD_mdh3ΔSKL vector is a recombinant vector containing the mdh3 gene from S. cerevisiae.

SEQ ID NO: primer Sequence (5 'to 3') 10 mdh3_F cgggatccatggtcaaagtcgcaattct 11 mdh3_R cggaattctcaagagtctaggatgaaac

Preparation Example 3 Construction and Confirmation of pRS423GPD_pyc2_mdh3ΔSKL Vector

In order to produce malate in S. cerevisiae yeast, various organic acids including malate were produced by overexpressing the pyruvate carboxylase and malate dehydrogenase genes and the C4-organic acid transporter. To this end, first, in relation to malate production, a first recombinant vector (pRS423GPD_pyc2_mdh3ΔSKL vector) including pyc2 and mdh3ΔSKL genes was constructed.

In order to construct a vector expressing pyc2 and mdh3ΔSKL gene at the same time, GPD1 promoter, mdh3ΔSKL ORF, and CYC1 terminator (2000bp) cassette were amplified by PCR in pRS423GPD-mdh3ΔSKL vector constructed from Preparation Example 2 above, followed by SacI treatment. At the same time, the pRS423GPD_pyc2 vector constructed from Preparation Example 1 was subjected to ligation after SacI and CIAP treatment. Thereafter, E. coli was transformed into TOP10.

2C is a cleavage map of the pRS423GPD_pyc2_mdh3ΔSKL vector. At this time, pRS423GPD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter. The pRS423GPD_pyc2_mdh3ΔSKL vector is a recombinant vector of pRS423GPD containing both pyc2 and mdh3 genes from S. cerevisiae.

Preparation Example 4 Construction and Verification of pRS425GPD_spmae1 Vector

To clone the C4 organic acid transporter protein from the Schizosaccharomyce pombe strain, the genomic DNA of S. pombe was first extracted. Then, the genes were amplified by PCR through the spmae1_F (SEQ ID NO: 10) and spmae1_R (SEQ ID NO: 11) primers. The amplified spmae1 gene was treated with pstI and speI restriction enzymes, and the same restriction enzymes were also treated with the pRS425GPD vector to ligation the two genes. The recombinant vector was cloned by transforming E. coli TOP10 and finally constructing the pRS425PD_spmae1 vector by sequencing the gene with GPD_SQC_F (SEQ ID NO: 6) and CYC_SQC_R (SEQ ID NO: 7) primers.

 2D is a cleavage map of the pRS425PD_spmae1 vector. At this time, pRS425PD is a vector for overexpressing a foreign gene in the form of a plasmid, and includes a GPD promoter.

The pRS425PD_spmae1 vector is a recombinant vector of pRS425GPD containing the mae1 gene from S. pombe .

SEQ ID NO: primer Sequence (5 'to 3') 10 spmae1_F aactgcagttaaacgctttc 11 spmae1_R gactagtatgggtgaactcaaggaaatct

Preparation Examples 5 to 8: Construction of guide vectors (pRS42H_gRNA_adh1, p42H_gRNA_gpd1, p42H_gRNA_gpd2, p42H_gRNA_adh3 vectors construction) using CRISPR / Cas9

In order to inactivate adh1, the TGG sequence encoding tryptophan located 83rd from the start codon to downstream was designated as the PAM sequence and replaced with TAA, the stop codon.

First, the pRS414TEF-Cas9 vector labeled with Aureobasidine A was transformed into yeast cells. At this time, the pRS414TEF-Cas9 vector is a vector (Plasmid # 43802, Addgene) expressing the Cas9 endonuclease enzyme.

Next, a pRS42H_gRNA_adh1 vector expressing guide RNA was constructed. Conventional gRNA expression cassette (expression cassette) was designed to target the trp1 gene (target), using this, was changed to target the adh1 gene was used (Table 4). At this time, pRS42H_gRNA is a vector expressing guide RNA in yeast (Plasmid # 64331, Addgene).

SEQ ID NO: Gene name CRISPR target sequence 49 adh1 tgggtgaaaacgttaagggctgg 50 gpd1 tcgctccaatagtacaaatgtgg 51 gpd2 gtttcgtagaaggtatgggatgg 52 adh3 tacatgcttggcacggcgat

As described above, the plasmids in which the adh1 gene is inactivated are p42H_gRNA_adh1 (Preparation 5), p42H_gRNA_gpd1 (Preparation 6), p42H_gRNA_gpd2 (Preparation 7), and p42H_gRNA_adh3 (Preparation 8), and the p42H_gRNA_adh1 targets the dh1 gene in the genome. P42H_gRNA_gpd1 is a vector expressing a guide RNA targeting the gpd1 gene in the yeast genome, and p42H_gRNA_gpd2 is a guide RNA targeting the gpd2 gene in the yeast genome. P42H_gRNA_adh3 is a vector expressing adh3 gene-targeting guide RNA in the yeast genome.

Comparative Example 1: Construction of Recombinant Yeast Strain (DC2) for Organic Acid Production

S. cerevisiae D452-2 strain, a wild type yeast, will be referred to as 'D' in the present invention.

Next, S. cerevisiae D452-2 was transformed with pRS423GPD and pRS425GPD empty vectors without introducing a gene to construct a recombinant strain named 'DC2'.

Comparative Example 2 Construction of Recombinant Yeast Strain (D-Cas9) Using CRISPR / Cas9

A recombinant strain named 'D-Cas9' was constructed in which wild-type yeast S. cerevisiae D452-2 strain (D strain) was transformed with pRS414TEF-Cas9.

Comparative Example 3 Construction of Recombinant Yeast Strain (DC2-A1) in which Alcohol Production Pathway is Suppressed and Empty Vector Transduced

The DC2-A1 strain was constructed by transforming the D-A1 strain constructed from Example 2 with pRS423GPD and pRS425GPD empty vectors without introducing a gene.

Comparative Example 4 Construction of Recombinant Yeast Strain (DC3-A1G12) Transduced with an Empty Vector

The DC2-A1G12 strain was constructed by transforming the D-A1G12 strain constructed from Example 5 with pRS423GPD and pRS425GPD and pRS426GPD co-vectors without genes.

Example 1 Construction of Recombinant Yeast Strain (DM) for Organic Acid Production

S. cerevisiae D452-2 strain, a wild-type yeast was prepared, and the pRS423GPD_pyc2_mdh3ΔSKL vector constructed from Preparation Example 3 and the pRS425GPD_spmae1 vector constructed from Preparation Example 4 were transformed into S. cerevisiae D452-2 strain, and named 'DM'. Recombinant strains were constructed.

Example 2 Construction of Recombinant Yeast Strain (D-A1) with Inhibited Alcohol Production Pathway

A recombinant D-A1 strain was constructed that inactivated the gene adh1 gene encoding alcohol dehydrogenase I. Recombinant D-A1 strain was used to insert a stop codon to the gene in the genome using the CRISPR / Cas9 system. In other words, the strain of Example 2 is a recombinant yeast strain (S. cerevisiae D452-2 Δadh1) in which the adh1 gene is disrupted.

Specifically, using overlap PCR, the existing sequence was removed and then replaced with a 20 bp portion before the PAM sequence of adh1. The complete expression cassette was introduced into a gRNA pRS42H vector using Sac I and Kpn I restriction enzymes. Finally, co-transformation was performed with the Cas9 expression strain together with the donor DNA synthesized with the constructed pRS42H_gRNA_adh1 vector (Production Example 5). The transformed strains were incubated for 72 hours in YPD20 solid medium containing 0.5 μg / ml of aureobasidine A and 200 μg / mL of hygromycin. Four of the colonies thus obtained were selected for direct PCR. PCR fragments were prepared as primers to be amplified by adding 100 bp back and forth of the adh1 gene on gDNA. It was designed to obtain a PCR fragment of 1207 bp in total length. This was cloned into a T vector and commissioned for DNA sequencing analysis. As a result of DNA analysis, it was confirmed that the sequence present at 247 ~ 249 bp from 5 ′ of downstream of adh1 was substituted with TAA stop codon. Finally, it was confirmed that the adh1 gene was knocked out.

Example 3: Construction of a Recombinant Yeast Strain (DM-A1) with Alcohol Production Inhibited and Organic Acid Production Enhanced

The D-A1 strain constructed from Example 2 was transformed with the pRS423GPD_pyc2_mdh3ΔSKL vector constructed from Preparation Example 3 and the pRS425GPD_spmae1 vector constructed from Preparation Example 4, and named 'DM-A1'.

Example 4 Construction of D-A1G1 (Δadh1, Δgpd1 :: mdh3ΔSKL) Recombinant Yeast Strains from which the gpd1 Gene was Removed

In order to inactivate gpd1, the TGG sequence coding for tryptophan located at the 71st downstream from the start codon was designated as the PAM sequence, and the GPD1p_mdh3ΔSKL_CYC1t expression cassette was introduced into the genome while disrupting 5 to 620 bp of the gene including ATG. An experimental design was made. At the same time, a pRS42H_gRNA_gpd1 vector expressing guide RNA was constructed. First, since the existing gRNA expression cassette was designed to target the adh1 gene, the target sequence was changed to target gpd1. Overlap PCR eliminated the existing sequence and replaced it with the 20 bp fragment in front of the PAM sequence of gpd1. The completed gRNA expression cassette was introduced into pRS42H using sacI and kpnI. Donor DNA amplifies the 5 'to 3' sequences of the CYC1 terminator of the GPD1 sequence of the pRS423GPD vector and PCR amplifies using primers each containing 50 bp before and after the 620 bp portion of the gpd1 gene in the yeast genome at the terminal. The donor DNA was cloned by purification. Finally, co-transformation was performed with the D-A1-Cas9 strain containing the Cas9 vector together with the donor DNA purified from the pRS42H_gRNA_gpd1 vector constructed in Preparation Example 6. The transformed strains were incubated for 72 hours in YPD20 solid medium containing 0.5 μg / ml of aureobasidine A and 200 μg / mL of hygromycin. Four of the colonies thus obtained were selected and subjected to direct PCR. PCR fragments were prepared from a pair of primers of 20 bp in the 3 'direction from the 5' 10 bp of the gpd1 gene on the gDNA, and 20 bp from the 3 'end of the gpd1 gene ORF. When PCR is performed using this primer, 1206 bp when the experiment is successful, ie, when the gpd1 gene is crushed and the GPD1p_mdh3ΔSKL_CYC1t expression cassette is inserted into the genome, the 2586 bp long gene is amplified and the expression cassette is not inserted. It was designed to obtain a PCR fragment. As a result of PCR, the strain D-A1G1 (Δadh1, Δgpd1 :: mdh3SKL) was successfully constructed from the previously constructed D-A1 (adh1 deficient strain).

Example 5 Construction of D-A1G12 (Δadh1, Δgpd1 :: mdh3ΔSKL, Δgpd2) Strains from which the gpd2 Gene was Removed

To inactivate gpd2, the TGG sequence coding for tryptophan located at 309th downstream from the start codon was designated as the PAM sequence, and the experimental design was designed to remove 980bp of the gene from 5 'including ATG. At the same time, pRS42H_gRNA_gpd2 vector expressing guide RNA was constructed. First, since the existing gRNA expression cassette was designed to target the adh1 gene, the target sequence was changed to target gpd2. Overlap PCR eliminated the existing sequence and replaced it with the 20 bp fragment in front of the PAM sequence of gpd2. The completed gRNA expression cassette was introduced into pRS42H using sacI and kpnI. Donor DNA was purified after PCR amplification using primers each containing 50 bp before and after 620 bp from 5 'of the gpd2 gene in the yeast genome at the end while amplifying 5' to 3 'sequence of CYC1 terminator of GPD1 sequence of pRS423GPD vector. The donor DNA was cloned. Finally, the constructed pRS42H_gRNA_gpd2 vector was co-transformed with a D-A1-Cas9 strain containing a Cas9 vector (D-A1 strain containing pRS414TEF-Cas9) together with donor DNA. The transformed strains were incubated for 96 hours in YPD20 solid medium containing 0.5 μg / ml of aureobasidine A and 200 μg / mL of hygromycin. Ten of the colonies thus obtained were selected and subjected to direct PCR. PCR fragments were prepared from a pair of primers of 20bp in the 3 'direction from the 5' 230 bp of the gpd2 gene on the gDNA, and 20 bp from the 3 'end of the gpd2 gene ORF. When PCR was carried out using this primer, it was designed to obtain 1573 bp PCR fragment when the experiment was successful, that is, when the gpd2 gene was disrupted, the 593 bp gene was amplified and the expression cassette was not inserted. . As a result of PCR, D-A1G12 (Δadh1, Δgpd1 :: mdh3ΔSKL, Δgpd2) was successfully constructed from the previously constructed D-A1G1 (adh1, gpd1-deficient strain) strain.

Example 6: Construction of DM-A1G12 Recombinant Yeast Strain

The D-A1G12 (Δadh1, Δgpd1 :: mdh3ΔSKL, Δgpd2) strain constructed from Example 5 was transformed with the pRS423GPD_pyc2_mdh3ΔSKL vector constructed from Preparation Example 3 and the pRS425GPD_spmae1 vector constructed from Preparation Example 4, and designated as 'DM-A1G12'. It was.

Example 7 Construction of DMG-A1G12 Recombinant Yeast Strain

Another pathway that can biosynthesize malate in yeast is the glyoxylate cycle. The glyoxylic acid cycle is converted to glyoxylate and succinate by isocitrate and isocitrate lyase in the TCA cycle, and glyoxylate is a malate synthase. (malate synthase) is converted back to malate (malate).

In order to implement this glyoxylic acid cycle in the cytoplasm, the designed mls1ΔSKL gene was introduced into the pRS426GPD episomal vector by truncating the end 9 bp of the gene sequence of mls1, an expression enzyme in peroxysome.

To construct a vector expressing the icl1 gene and the mls1ΔSKL gene simultaneously, a vector including each gene was constructed. PCR amplification of the mls1ΔSKL gene having a length of 1665 bp with the genomic DNA of mls1_F, mls1_R primer, and S. cerevisiae D452-2 was performed.

The amplified PCR product was treated with XhoI and EcoRI restriction enzymes, and the same gene was treated with the pRS426GPD vector, followed by ligation of both genes. The recombinant vector was transformed into E. coli TOP10 and cloned. Finally, genes were sequenced with GPD_SQC_F and CYC_SQC_R primers to confirm pRS426GPD_mls1ΔSKL vector construction. The icl1 gene, which has a length of 1674 bp, uses genomic DNA of pfu polymerase, icl1_F, icl1_R primers and S. cerevisiae D452-2 for PCR. The amplified PCR product and pRS423GPD vector were treated with XhoI / EcoRI (icl1) and then subjected to ligation reaction. The recombinant vector was transformed into E. coli TOP10. In order to construct a vector expressing the mls1ΔSKL and icl1 genes at the same time, the GPD1 promoter, mls1ΔSKL ORF, and CYC1 terminator (2614bp) cassettes were amplified by PCR in the previously constructed pRS426GPD-mls1ΔSKL vector and subjected to SacI treatment. At the same time, the pRS426GPD_icl1 vector was ligation after SacI and CIAP treatment. Thereafter, E. coli was transformed into TOP10. The vectors used in the experiment are 'pRS426GPD', 'pRS426GPD_mls1ΔSKL', 'pRS426GPD_icl1', and 'pRS426GPD_mls1ΔSKL_icl1'. pRS426GPD is a vector for overexpressing a foreign gene in the form of a plasmid and is an empty vector containing a GPD promoter. pRS426GPD_mls1ΔSKL is a pRS426GPD vector containing the mls1 gene from S. cerevisiae (see FIG. 2F). pRS426GPD_icl1 is a pRS426GPD vector containing an icl1 gene derived from S. cerevisiae, and a cleavage map thereof is shown in FIG. 2E. pRS426GPD_mls1ΔSKL_icl1 is a pRS426GPD vector (see FIG. 2G) containing mls1 gene and icl1 gene from S. cerevisiae.

The previously constructed vector pRS426GPD_mls1ΔSKL_icl1 was simultaneously introduced into the D-A1G12 strain with a maleate metabolism-related cloning set to construct the strain and named 'DMG-A1G12'.

Example 8 Construction of D-A13G12 (Δadh1, Δadh3, Δgpd1 :: mdh3ΔSKL, Δgpd2) Strains from which the adh3 Gene was Removed

In order to inactivate adh3 , the TGG sequence coding for tryptophan, located at the 82nd downstream from the start codon, was designated as the PAM sequence, and the experimental design was designed to remove 275bp of the gene from 5 'including ATG. At the same time, pRS42H_gRNA_adh3 vector expressing guide RNA was constructed. First, since the existing gRNA expression cassette was designed to target the gpd2 gene, the target sequence was changed to target adh3 . The existing sequence was removed by overlap PCR and replaced with the 20 bp fragment in front of the PAM sequence of adh3. The complete expression cassette was introduced into a gRNA pRS42H using the Sac I and Kpn I. Donor DNA was purified by amplifying 90bp DNA using a pair of 60bp primers prepared for adh3 knockout using overlap PCR. Finally, co-transformation was performed with the D-A1G12-Cas9 strain containing the Cas9 vector (D-A1G12 strain containing pRS414TEF-Cas9) together with the donor DNA of the constructed pRS42H_gRNA_adh3 vector. The transformed strains were incubated for 120 hours in YPD20 solid medium containing 0.5 μg / ml of aureobasidine A and 200 μg / mL of hygromycin. Twelve of the colonies thus obtained were selected and subjected to direct PCR. PCR fragments were prepared from a pair of primers of 1000 bp in the 3 'direction from 180 bp in the 5' direction from the start codon of the adh3 gene on the gDNA. When PCR was performed using this primer, the experiment was successful, that is, when the adh3 gene was disrupted, the 906 bp long gene was amplified and was not designed to obtain 1180 bp PCR fragment. As a result of PCR, D-A13G12 (Δadh1, Δadh3, Δgpd1 :: mdh3SKL, Δgpd2) was successfully constructed from the previously constructed D-A1G1 (adh1, gpd1 deficient strain) strain.

Example 9 Construction of DM-A13G12 Recombinant Yeast Strain

The D-A13G12 (Δadh1, Δadh3, Δgpd1 :: mdh3ΔSKL, Δgpd2) strains constructed from Example 8 were transformed with the pRS423GPD_pyc2_mdh3ΔSKL vector constructed from Preparation Example 3 and the pRS425GPD_spmae1 vector constructed from Preparation Example 4 to obtain 'DM-A13G12'. It was named.

Primers, gRNAs, donor DNAs and base sequences of the genes used in Preparation Examples, Examples and Comparative Examples are as follows.

SEQ ID NO: primer Sequence (5 to 3) One pyc2_F tccccccgggatgagcagtagcaagaaatt 2 pyc2_R ccgctcgagttactttttttgggatgggg 3 pyc2_SQC1 tttgccccgtgaagttcgtga 4 pyc2_SQC2 ccggatggagacaagtgcta 5 pyc2_SQC3 caaccatcaattaatgcact 6 GPD_SQC_F gtaggtattgattgtaattctgtaaat 7 CYC_SQC_R tctcaagcaaggttttcagtataat 8 GPD_sacI cgagctcagtttatcattatcaatactc 9 CYC_sacI cgcgagctccaaattaaagccttcgag 10 mdh3_F cgggatccatggtcaaagtcgcaattct 11 mdh3_R cggaattctcaagagtctaggatgaaac 12 spmae1_F aactgcagttaaacgctttc 13 spmae1_R gactagtatgggtgaactcaaggaaatct 14 icl1_F ggaattcatgcctatccccgttggaaa 15 icl1_R ccgctcgagctatttctttacgccatttt 16 mls1_F ggaattcatggttaaggtcagtttgga 17 mls1_R ccgctcgagtcacaaatcagtgggcgtcgcct 18 SacI primer cgagctctctttgaaaagataatgtat 19 KpnI primer ggggtaccagacataaaaaacaaaaaaa 20 adh1_gRNA_F tgggtgaaaacgttaagggcgttttagagctagaaatagcaag 21 adh1_gRNA_R gcccttaacgttttcacccacgatcatttatctttcactgcgga 22 adh1_donor_F tccgatgctgacttgctgggtattatatgtgtgtaaaatagaaagagaacaattgacccg 23 adh1_donor_R tacaagacttgaaattttccttgcaataaccgggtcaattgttctctttctattttacac 24 adh1_sqc_F atgtctatcccagaaactca 25 adh1_sqc_R ttatttagaagtgtcaacaac 26 gpd1_gRNA_F tcgctccaatagtacaaatggttttagagctagaaatagcaag 27 gpd1_gRNA_R catttgtactattggagcgacgatcatttatctttcactgcgga 28 gpd1_donor_F tatattgtacaccccccccctccacaaacacaaatattgataatataaagtaaagggaacaaaagctggag 29 gpd1_donor_R tgtggaacaaggcctttagaaccttatggtcgacgtccttgccctcgccttagggcgaattgggtccgg 30 gpd1_sqc_F tccacaaacacaaatattga 31 gpd1_sqc_R ctaatcttcatgtagatcta 32 gpd2_gRNA_F gtttcgtagaaggtatgggagttttagagctagaaatagcaag 33 gpd2_gRNA_R tcccataccttctacgaaaccgatcatttatctttcactgcgga 34 gpd2_donor_F agattcaattctctttccctttccttttccttcgctccccttccttatca taaagggaacaaaagctggag 35 gpd2_donor_R cttgatagtaggtctcgactttggattctgggaaaaacattctaccgaac tagggcgaattgggtaccgg 36 gpd2_sqc_F ttctctaccctgtcattcta 37 gpd2_sqc_R ctattcgtcatcgatgtctagctc 38 adh3_gRNA `ctccgcagtgaaagataaatgatcgtacatgcttggcacggcgatgttttagagctagaaatagcaagtt 39 adh3_donor_F tatcttctgttcacagttaaaactaggaatagtatagtcataagtcattagtaggtggtc 40 adh3_donor_R ctagtttgacaactacaccagcaccttcatgaccacctactaatgacttatgactatact 41 adh3_sqc_F tcgccagctcctaaacgctggaag 42 adh3_sqc_R ctaaggcttctctcgtatcagctct 43 GPDp_mdh3SKL_CYCt expression cassette accctgtaaacagtttggtccctattgctgtggaaactttgaagaaaatgggtaagttcaaacctggaaacgttatgggtgtgacgaaccttgacctggtacgtgcagaaacctttttggtagattatttgatgctaaaaaaccccaaaattggacaagaacaagacaaaactacaatgcacagaaaggtcactgttattgggggtcattcaggggaaaccattatcccaataatcaccgacaaatcgctggtatttcaacttgataagcagtacgagcacttcattcatagggtccagttcggaggtgatgaaattgtcaaagctaaacagggcgccggttccgccacgttgtccatggcgttcgcgggggccaagtttgctgaagaagttttgaggagcttccataatgagaaaccagaaacggagtcactttccgcattcgtttatttaccaggcttaaaaaacggtaagaaagcgcagcaattagttggcgacaactctattgagtatttttccttgccaattgttttgagaaatggtagcgtagtatccatcgataccagtgttctggaaaaactgtctccgagagaggaacaactcgttaatactgcggtcaaagagctacgcaagaatattgaaaaaggcaagagtttcatcctagactcttgagaattcgatatcaagcttatcgataccgtcgacctcgagtcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttg 44 pyc2 accaaaaatttcctagcaccagcagaacctgatgaagaaatcgaagtcaccatcgaacaaggtaagactttgattatcaaattgcaagctgttggtgacttaaataagaaaactgggcaaagagaagtgtattttgaattgaacggtgaattaagaaagatcagagttgcagacaagtcacaaaacatacaatctgttgctaaaccaaaggctgatgtccacgatactcaccaaatcggtgcaccaatggctggtgttatcatagaagttaaagtacataaagggtctttggtgaaaaagggcgaatcgattgctgttttgagtgccatgaaaatggaaatggttgtctcttcaccagcagatggtcaagttaaagacgttttcattaaggatggtgaaagtgttgacgcatcagatttgttggttgtcctagaagaagaaaccctacccccatcccaaaaaaagtaa 45 mdh3SKL 46 spmae1 taaaatgatagattccaaagctttccaaatgtttggacatatcattggggtcattctttgtattcagtggatcctcctaatgtatttaatggtccgtgcgtttctcgtcaatgatctttgctatcctggcaaagacgaagatgcccatcctccaccaaaaccaaatacaggtgtccttacacttcaccggtgaaaaa 47 mls1SKL tgcgcaaatccctatcaaagacgacccggcagccaatgaaaaggccatgactaaagtccgtaatgataagattagagagctgacaaatggacatgatgggtcatgggttgcacacccagcactggcccctatttgtaatgaagttttcattaatatgggaacaccaaaccaaatctatttcattcctgaaaacgttgtaacggctgctaatctgctggaaaccaaaattccaaatggtgagattactaccgagggaattgtacaaaacttggatatcgggttgcagtacatggaagcttggctcagaggctctggatgtgtgcccatcaacaacttgatggaagacgccgccactgctgaagtgtctcgttgtcaattgtatcaatgggtgaaacacggtgttactctaaaggacacgggagaaaaggtcaccccagaattaaccgaaaagattctaaaagaacaagtggaaagactgtctaaggcaagtccattgggtgacaagaacaaattcgcgctggccgctaagtatttcttgccagaaatcagaggcgagaaattcagtgaatttttgactacattgttgtacgacgaaattgtgtccactaaggcgacgcccactgatttgtga 48 icl1 cacctctaaagtgggtccattgactgaaacatcccacagagaagccaagaagctcgctaaagaaattcttggccacgaaattttcttcgactgggagctaccacgcgtaagggaagggttgtaccgttacagaggtgggacgcaatgttctatcatgagggcccgtgcatttgctccatatgctgatttggtatggatggaatctaactacccagacttccaacaggccaaggagtttgcagaaggtgttaaagagaaattccctgaccaatggctagcttacaacttgtctccatcctttaactggccaaaagccatgtccgttgatgaacaacacaccttcatccaaaggctgggtgatctaggttacatctggcaatttatcacattggccggtttacacactaacgctttagctgtccataacttctctcgtgactttgccaaggatgggatgaaagcttatgcccagaatgttcagcagagggaaatggacgatggtgttgatgtgttgaaacatcaaaaatggtctggtgcggagtacatcgatgggttattgaagttagctcaaggtggtgttagcgcaacagctgctatgggaaccggtgtcacagaagatcaattcaaagaaaatggcgtaaagaaatag 49 adh1 tgggtgaaaacgttaagggctgg 50 gpd1 tcgctccaatagtacaaatgtgg 51 gpd2 gtttcgtagaaggtatgggatgg 52 adh3 tacatgcttggcacggcgat

Experimental Example 1: Characterization according to pyc2 and mdh3 genes

1) Growth Characteristics

First, a culture test was conducted for the D strain, a wild type yeast. Precultures were incubated for 16 h in 10 ml YPD20 medium in test tubes. The culture was performed at 50 rpm YP medium (1% (w / v) Yeast extract, 2% (w / v) Peptone) supplied with 20 g / L glucose as a carbon source at 100 rpm and 30 ° C. Inoculation DCW was inoculated at a concentration of 0.2 g / L.

The recombinant DM strain of Example 1, which is an organic acid-producing yeast, and the DC2 strain of Comparative Example 1, a control, were cultured as follows. Two strains were seeded in YNBD His / Leu (-) medium in a test tube for 36 hours, and then pre-cultured in 100 ml of the same composition for 36 hours. Then, incubated for 30 hours in 10 ml YPD20 medium. The main culture was performed at 50 rpm YP medium (1% (w / v) Yeast extract, 2% (w / v) Peptone) supplied with 50 g / L glucose as a carbon source at 100 rpm and 30 ° C. Inoculation DCW was inoculated at a concentration of 0.2 g / L. However, in this culture, sterilized 5% CaCO _{3 was} added.

3 is a batch culture of wild type yeast D strain (S. cerevisiae D452-2) and the recombinant strain of Comparative Example 1 and the recombinant strain of Example 1, glucose consumption, glycerol, ethanol, acetate, malate, A graph showing the amount of succinate produced. 3A shows the result of culturing the wild type D strain in YPD20 medium, and FIGS. 3B and 3C show the result of culturing the recombinant DC2 strain of Comparative Example 1 and the recombinant DM strain of Example 1 in YPD50 + 5% CaCO3 medium, respectively.

As shown in FIG. 3, the wild type D strain consumed all glucose at 12 hours of culture, and produced ethanol at a concentration of about 8.7 g / L.

On the other hand, it was confirmed that the recombinant DC2 strain (control) of Comparative Example 1 and the recombinant DM strain of Example 1 showed similar trends as a result of the culture. However, the recombinant DC2 strain (control) of Comparative Example 1 did not produce malate, which is an organic acid at all, but the recombinant DM strain of Example 1 was confirmed to produce malate at a concentration of about 2.7 g / L. This suggests that the pyc2 and mdh3 genes influence the production of organic acids.

Experimental Example 2: Characterization using adh1 crushed yeast

As a result of the analysis through Experimental Example 1, it was confirmed that the production of malate was increased in the recombinant yeast strain (Example 1, DM strain) transformed with a recombinant vector including the pyc2 gene and the mdh3 gene.

However, to induce higher malate production, ethanol metabolism pathways were tried to be suppressed. In the ethanol metabolic pathway, the adh1 gene encodes adh1p, and adh1p is known to play the most important role in the alcohol dehydrogenase complex of yeast. For the production of organic acids, the accumulation of pyruvic acid and acetyl CoA, which are used as precursors for the production of organic acids, is important.In order to verify this, a recombinant D-A1 strain in which the adh1 gene encoding alcohol dehydrogenase I is inactivated is constructed. It was. Recombinant D-A1 strain was used to insert a stop codon to the gene in the genome using the CRISPR / Cas9 system.

1) Growth Characteristics

The D-A1 strain of Example 2 was cultured as follows. First, preculture was incubated for 16 hours in 10 ml YPD20 medium in test tubes. The culture was performed at 50 rpm YP medium (1% (w / v) Yeast extract, 2% (w / v) Peptone) supplied with 20 g / L glucose as a carbon source at 100 rpm and 30 ° C. Inoculation DCW was 0.2 g / L concentration.

DM-A1 strain of Example 3 and DC2-A1 strain of Comparative Example 3 were cultured as follows. First, two strains were seeded in YNBD His / Leu (-) medium in a test tube for 36 hours, respectively, and then precultured in 100 ml of the same composition for 36 hours. This culture was performed for 30 hours in 10 ml YPD20 medium. The culture was carried out at 50 rpm YP medium (1% (w / v) Yeast extract, 2% (w / v) Peptone) with 50 g / L glucose as a carbon source at 100 rpm and 30 ° C. DCW was inoculated at a concentration of 0.2 g / L. Sterilized 5% CaCO ₃ was added to the main culture medium.

2) Conclusion

4 is a batch culture of the D-A1 strain of Example 2, DM-A1 strain of Example 3 and DC2-A1 strain of Comparative Example 3, glucose consumption, glycerol, ethanol, acetate, malate, A graph showing the amount of succinate produced. 4A shows the results of culturing the D-A1 strain of Example 2 in YPD20 medium, and FIGS. 4B and 4C show YPD50 + 5% CaCO3 of the DM-A1 strain of Example 3 and the DC2-A1 strain of Comparative Example 3, respectively. It is the result of culture in the medium.

4, it was confirmed that the glucose consumption of the D-A1 strain of Example 2 was slower than the glucose consumption of the D strain (see FIG. 3). Further, it was confirmed that the ethanol production of the Example 2 D-A1 strain was reduced to 50% or less compared to the D strain, and at the same time, the production of glycerol was increased. That is, it was confirmed that by inhibiting adh1, ethanol production can be suppressed and glycerol production can be enhanced. However, adh1 gene removal slowed cell growth and increased glycerol production.

In addition, it was confirmed that the DC2-A1 strain of Comparative Example 3 produced high glycerol and did not produce malate at all. On the contrary, it was confirmed that the DM-A1 strain of Example 3 produced malate at a concentration of about 7.6 g / L. That is, as a result of constructing a recombinant yeast strain that overexpressed the pyc2 and mdh3 genes and suppressed the adh1 gene, it was confirmed that the production of maleate, which was rarely produced, was markedly increased to 7.6 g / L.

Experimental Example 3 Analysis by Inhibition of Glycerol Metabolism Pathway

In order to solve the problems of cell growth and glycerol production caused by the removal of the adh1 gene found in Experiment 2, the gpd1 and gpd2 genes encoding glycerol-3-phosphate dehydrogenase were removed from the yeast genome and simultaneously the mdh3 gene By replacing expression cassette with glycerol, which is a byproduct of fermentation process, and inserting genes related to malate production into genome, we planned a strategy to maintain enzymatic activity even in long-term culture.

The gpd1 and gpd2 genes encode yeast glycerol-3-phosphate dehydrogenase, and the two gene inactivated yeasts use the CRISPR / Cas9 system to insert a gene expression cassette or remove some sequences of the genes in the genome. Was built in a way.

1) Growth Characteristics

The D-A1G12 strain of Example 5, which lacked gpd2 from the D-A1G1 strain of Example 4, was cultured as follows. Specifically, preculture was performed for 32 hours in 10 ml YPD20 medium in a test tube. The culture was performed at 50 rpm YP medium (1% (w / v) Yeast extract, 2% (w / v) Peptone) supplied with 20 g / L glucose as a carbon source for 30 hours at 100 rpm and 30 ° C. Inoculation DCW was 0.2 g / L concentration. Glucose consumption and fermentation byproducts were measured by HPLC.

The DM-A1G12 strain of Example 6 was scaled up after 48h incubation in two 10 ml YNBD his- and leu- media, as it was poured into two 500 ml bezel Erlenmeyer flasks containing 100 ml of the same composition. After 48 hours, the respective cultures were combined to measure the OD, and the YPD50 medium was inoculated with an initial OD of 2.0 and 5.0, respectively. The culture was performed at 50 rpm YP medium (1% (w / v) Yeast extract, 2% (w / v) Peptone) supplied with 50 g / L glucose as a carbon source at 100 rpm and 30 ° C. Inoculation DCW was inoculated at a concentration of 0.2 g / L. At this time, sterilized 5% CaCO ₃ was added. Fermentation was performed using an incubator set at 200 rpm and 30 ° C. and sampled at 8 hour intervals.

2) Conclusion

5 is a batch culture of the D-A1G12 strain of Example 5 and the DM-A1G12 strain of Example 6 to measure the glucose consumption, glycerol, ethanol, acetate, malate, succinate production over time It is a graph. 5A shows the result of culturing D-A1G12 strain in YPD20 medium, and FIG. 5B shows the result of culturing DM-A1G12 strain in YPD50 + 5% CaCO ₃ medium.

As shown in FIG. 5, the final cell concentration of the D-A1G12 strain of Example 5 was increased by about 2.6 times compared to the D-A1 strain. In addition, the D-A1G12 strain of Example 5 was not produced glycerol, while ethanol production was about two times increased compared to the D-A1 strain.

In addition, the DM-A1G12 strain of Example 6 was administered 50 g / L of high glucose, it was confirmed that the same as the D-A1G12 strain of Example 5 was consumed 30 hours ago. The final malate concentration was analyzed at 7.58 g / L. Glycerol was not observed at all, and the final ethanol concentration was 14.7 g / L, which was found to be significantly higher than DM-A1.

Experimental Example 4 Analysis by Introduction of Glyoxylate-Related Genes

Among the enzymes that form the glyoxylate cycle, the isocitrate lyase and malate synthase, which convert isocitric acid into glyoxylate and succinate, respectively The icl1 gene and mls1 gene were introduced into DM-A1G12 strain to analyze the effects of organic acid production on production.

1) Growth Characteristics (Introduction of Maleate and Glyoxylate Metabolic Pathways)

The DMG-A1G12 strain of Example 7 was incubated for 48 h in two 10 ml YNBD his-, leu- and ura- media, each placed in two 500 ml baffle Erlenmeyer flasks containing 100 ml of the same medium and scaled up. It was. This culture was incubated at 50 rpm YP medium (1% (w / v) Yeast extract, 2% (w / v) Peptone) supplied with 50 g / L glucose as a carbon source, at 100 rpm, 30 ℃. At this time, the inoculation DCW was 2 g / L concentration. Sterilized 5% CaCO ₃ was added to the present culture medium.

2) Conclusion

FIG. 6 is a graph showing the growth of glucose consumption, glycerol, ethanol, acetate, malate, and succinate over time by culturing the DMG-A1G12 strain of Example 7. The medium used was YPD50 + 5% CaCO ₃ .

7 is a graph showing the maleate concentration measured from the DM strain of Example 1, DM-A1G12 strain of Example 6, and DMG-A1G12 strain of Example 7 for 30 hours and measured therefrom.

6 and 7, the DMG-A1G12 strain of Example 7 produced about 1.5 times higher malate than the DM-A1G12 strain, and the malate conversion rate was 0.28, 1.6 times better than the consumed glucose. It was confirmed.

In addition, maleate was confirmed to be the highest in the DMG-A1G12 strain of Example 7.

Experimental Example 5: Characterization using ADH3 crushed yeast

Experimental Example 4 shows that the introduction of a gene that forms the glyoxylate cycle (glyoxylate cycle) into the yeast is effective in reducing ethanol, but it was found that still about 10 g / L of ethanol is produced. In order to further reduce the production of ethanol, a strain was constructed in which the adh3 gene encoding alcohol dehydrogenase III was removed from the yeast genome.

The adh3 gene encodes the yeast alcohol dehydrogenase III, and the gene inactivated yeast was constructed by removing some sequences of the gene in the genome using the CRISPR / Cas9 system.

1) Growth Characteristics

The D-A13G12 strain of Example 8, which lacked adh3 from the D-A1G12 strain of Example 5, was cultured as follows. Specifically, preculture was performed for 30 hours in 10 ml YPD20 medium in a test tube. The culture was performed at 50 rpm YP medium (1% (w / v) Yeast extract, 2% (w / v) Peptone) supplied with 20 g / L glucose as a carbon source at 100 rpm and 30 ° C. for 32 hours. Inoculation DCW was 0.2 g / L concentration. Glucose consumption and fermentation byproducts were measured by HPLC.

The DM-A13G12 strain of Example 9 was scaled up after 48h incubation in 10 ml YNBD his- and leu- media, as it was poured into two 500 ml baffle Erlenmeyer flasks containing 100 ml of the same composition. After 48 hours, the respective cultures were combined to measure the OD, and the YPD50 medium was inoculated with an initial OD of 2.0 and 5.0, respectively. The culture was performed at 50 rpm YP medium (1% (w / v) Yeast extract, 2% (w / v) Peptone) supplied with 50 g / L glucose as a carbon source at 100 rpm and 30 ° C. Inoculation DCW was inoculated at a concentration of 2 g / L. At this time, sterilized 5% CaCO ₃ was added. Fermentation was performed using an incubator set at 100 rpm, 30 ° C. and sampled at 8 hour intervals.

2) Conclusion

8 is a batch culture of the D-A13G12 strain of Example 8 and the DM-A13G12 strain of Example 9 to measure glucose consumption, glycerol, ethanol, acetate, malate, and succinate over time. It is a graph. FIG. 8A shows the result of culturing D-A13G12 strain in YPD20 medium, and FIG. 8B shows the result of culturing DM-A13G12 strain in YPD50 + 5% CaCO ₃ medium.

As shown in FIG. 8, the D-A13G12 strain of Example 8 was found to consume 12.8 g / L of glucose for 32 hours. This is about 40% lower glucose consumption rate compared to the D-A1G12 strain of Example 5.

In the D-A1G12 strain of Example 5 and the D-A13G12 strain of Example 8, the ethanol conversion amount of glucose (generated ethanol weight (g) / consumed glucose weight (g)) was calculated and compared. The D-A1G12 strain of 5 was 0.26 (g / g), and the D-A13G12 strain of Example 8 was 0.17 (g / g). That is, it was confirmed that the D-A13G12 strain of Example 8 had a lower ethanol conversion amount of glucose than the D-A1G12 strain of Example 5.

Meanwhile, DM-A13G12 strain of Example 9 was cultured by administering a high glucose of 50 g / L. It was confirmed that 50 g / L of glucose administered before the start of culture was completely consumed through 48 hours of incubation. This indicates that glucose consumption was lowered compared to the DMG-A1G12 strain of Example 7. However, glucose consumption rate was lowered. The final produced malate concentration was 9.51 g / L was confirmed to be maintained at a similar level to the DMG-A1G12 strain of Example 7.

Furthermore, the DM-A13G12 strain of Example 9 had a final ethanol concentration of 11.9 g / L, which is about 1.93 g / L higher than that of Example 7 DMG-A1G12. However, unlike the DMG-A1G12 strain of Example 9, the DM-A13G12 strain of Example 9 produced the same or similar levels of maleate as the DMG-A1G12 strain of Example 7, even though no glyoxylate metabolic pathway was introduced. This suggests that there is a remarkably significant meaning and effect.

<110> Kookmin University Industry Academy Cooperation Foundation <120> Recombinant yeasts of simultaneously producing ethanol and          C4-organic acids <130> HPC8031 <160> 52 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pyc2_F <400> 1 tccccccggg atgagcagta gcaagaaatt 30 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> pyc2_R <400> 2 ccgctcgagt tacttttttt gggatgggg 29 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pyc2_SQC1 <400> 3 tttgccccgt gaagttcgtg a 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pyc2_SQC2 <400> 4 ccggatggag acaagtgcta 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pyc2_SQC3 <400> 5 caaccatcaa ttaatgcact 20 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GPD_SQC_F <400> 6 gtaggtattg attgtaattc tgtaaat 27 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CYC_SQC_R <400> 7 tctcaagcaa ggttttcagt ataat 25 <210> 8 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> GPD_sacI <400> 8 cgagctcagt ttatcattat caatactc 28 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CYC_sacI <400> 9 cgcgagctcc aaattaaagc cttcgag 27 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> mdh3_F <400> 10 cgggatccat ggtcaaagtc gcaattct 28 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> mdh3_R <400> 11 cggaattctc aagagtctag gatgaaac 28 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> spmae1_F <400> 12 aactgcagtt aaacgctttc 20 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> spmae1_R <400> 13 gactagtatg ggtgaactca aggaaatct 29 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> icl1_F <400> 14 ggaattcatg cctatccccg ttggaaa 27 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> icl1_R <400> 15 ccgctcgagc tatttcttta cgccatttt 29 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> mls1_F <400> 16 ggaattcatg gttaaggtca gtttgga 27 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> mls1_R <400> 17 ccgctcgagt cacaaatcag tgggcgtcgc ct 32 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SacI primer <400> 18 cgagctctct ttgaaaagat aatgtat 27 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> KpnI primer <400> 19 ggggtaccag acataaaaaa caaaaaaa 28 <210> 20 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> adh1_gRNA_F <400> 20 tgggtgaaaa cgttaagggc gttttagagc tagaaatagc aag 43 <210> 21 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> adh1_gRNA_R <400> 21 gcccttaacg ttttcaccca cgatcattta tctttcactg cgga 44 <210> 22 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> adh1_donor_F <400> 22 tccgatgctg acttgctggg tattatatgt gtgtaaaata gaaagagaac aattgacccg 60                                                                           60 <210> 23 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> adh1_donor_R <400> 23 tacaagactt gaaattttcc ttgcaataac cgggtcaatt gttctctttc tattttacac 60                                                                           60 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> adh1_sqc_F <400> 24 atgtctatcc cagaaactca 20 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> adh1_sqc_R <400> 25 ttatttagaa gtgtcaacaa c 21 <210> 26 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> gpd1_gRNA_F <400> 26 tcgctccaat agtacaaatg gttttagagc tagaaatagc aag 43 <210> 27 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> gpd1_gRNA_R <400> 27 catttgtact attggagcga cgatcattta tctttcactg cgga 44 <210> 28 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> gpd1_donor_F <400> 28 tatattgtac accccccccc tccacaaaca caaatattga taatataaag taaagggaac 60 aaaagctgga g 71 <210> 29 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> gpd1_donor_R <400> 29 tgtggaacaa ggcctttaga accttatggt cgacgtcctt gccctcgcct tagggcgaat 60 tgggtccgg 69 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gpd1_sqc_F <400> 30 tccacaaaca caaatattga 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gpd1_sqc_R <400> 31 ctaatcttca tgtagatcta 20 <210> 32 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> gpd2_gRNA_F <400> 32 gtttcgtaga aggtatggga gttttagagc tagaaatagc aag 43 <210> 33 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> gpd2_gRNA_R <400> 33 tcccatacct tctacgaaac cgatcattta tctttcactg cgga 44 <210> 34 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> gpd2_donor_F <400> 34 agattcaatt ctctttccct ttccttttcc ttcgctcccc ttccttatca taaagggaac 60 aaaagctgga g 71 <210> 35 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> gpd2_donor_R <400> 35 cttgatagta ggtctcgact ttggattctg ggaaaaacat tctaccgaac tagggcgaat 60 tgggtaccgg 70 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gpd2_sqc_F <400> 36 ttctctaccc tgtcattcta 20 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> gpd2_sqc_R <400> 37 ctattcgtca tcgatgtcta gctc 24 <210> 38 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> adh3_gRNA <400> 38 ctccgcagtg aaagataaat gatcgtacat gcttggcacg gcgatgtttt agagctagaa 60 atagcaagtt 70 <210> 39 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> adh3_donor_F <400> 39 tatcttctgt tcacagttaa aactaggaat agtatagtca taagtcatta gtaggtggtc 60                                                                           60 <210> 40 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> adh3_donor_R <400> 40 ctagtttgac aactacacca gcaccttcat gaccacctac taatgactta tgactatact 60                                                                           60 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> adh3_sqc_F <400> 41 tcgccagctc ctaaacgctg gaag 24 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> adh3_sqc_R <400> 42 ctaaggcttc tctcgtatca gctct 25 <210> 43 <211> 1982 <212> DNA <213> Artificial Sequence <220> GPDp_mdh3 Delta SKL_CYCt expression cassette <400> 43 agtttatcat tatcaatact cgccatttca aagaatacgt aaataattaa tagtagtgat 60 tttcctaact ttatttagtc aaaaaattag ccttttaatt ctgctgtaac ccgtacatgc 120 ccaaaatagg gggcgggtta cacagaatat ataacatcgt aggtgtctgg gtgaacagtt 180 tattcctggc atccactaaa tataatggag cccgcttttt aagctggcat ccagaaaaaa 240 aaagaatccc agcaccaaaa tattgttttc ttcaccaacc atcagttcat aggtccattc 300 tcttagcgca actacagaga acaggggcac aaacaggcaa aaaacgggca caacctcaat 360 ggagtgatgc aacctgcctg gagtaaatga tgacacaagg caattgaccc acgcatgtat 420 ctatctcatt ttcttacacc ttctattacc ttctgctctc tctgatttgg aaaaagctga 480 aaaaaaaggt tgaaaccagt tccctgaaat tattccccta cttgactaat aagtatataa 540 agacggtagg tattgattgt aattctgtaa atctatttct taaacttctt aaattctact 600 tttatagtta gtcttttttt tagttttaaa acaccagaac ttagtttcga cggattctag 660 aactagtgga tccatggtca aagtcgcaat tcttggcgct tctggtggcg tgggacaacc 720 gctatcatta ctgctaaaat taagccctta cgtttccgag ctggcgttgt acgatatccg 780 agctgcggaa ggcattggta aggatttatc tcacatcaac accaactcaa gttgtgtcgg 840 ttatgataag gatagtattg agaacacctt gtcaaatgct caggtggtgc taataccggc 900 tggtgttccc agaaagcccg gtttaactag agatgatttg ttcaagatga acgccggtat 960 tgtcaaaagc ctggtaaccg ctgttggaaa gttcgcacca aatgcgagga ttttagtcat 1020 ttcaaaccct gtaaacagtt tggtccctat tgctgtggaa actttgaaga aaatgggtaa 1080 gttcaaacct ggaaacgtta tgggtgtgac gaaccttgac ctggtacgtg cagaaacctt 1140 tttggtagat tatttgatgc taaaaaaccc caaaattgga caagaacaag acaaaactac 1200 aatgcacaga aaggtcactg ttattggggg tcattcaggg gaaaccatta tcccaataat 1260 caccgacaaa tcgctggtat ttcaacttga taagcagtac gagcacttca ttcatagggt 1320 ccagttcgga ggtgatgaaa ttgtcaaagc taaacagggc gccggttccg ccacgttgtc 1380 catggcgttc gcgggggcca agtttgctga agaagttttg aggagcttcc ataatgagaa 1440 accagaaacg gagtcacttt ccgcattcgt ttatttacca ggcttaaaaa acggtaagaa 1500 agcgcagcaa ttagttggcg acaactctat tgagtatttt tccttgccaa ttgttttgag 1560 aaatggtagc gtagtatcca tcgataccag tgttctggaa aaactgtctc cgagagagga 1620 acaactcgtt aatactgcgg tcaaagagct acgcaagaat attgaaaaag gcaagagttt 1680 catcctagac tcttgagaat tcgatatcaa gcttatcgat accgtcgacc tcgagtcatg 1740 taattagtta tgtcacgctt acattcacgc cctcccccca catccgctct aaccgaaaag 1800 gaaggagtta gacaacctga agtctaggtc cctatttatt tttttatagt tatgttagta 1860 ttaagaacgt tatttatatt tcaaattttt cttttttttc tgtacagacg cgtgtacgca 1920 tgtaacatta tactgaaaac cttgcttgag aaggttttgg gacgctcgaa ggctttaatt 1980 tg 1982 <210> 44 <211> 3543 <212> DNA <213> Artificial Sequence <220> <223> pyc2 <400> 44 atgagcagta gcaagaaatt ggccggtctt agggacaatt tcagtttgct cggcgaaaag 60 aataagatct tggtcgccaa tagaggtgaa attccgatta gaatttttag atctgctcat 120 gagctgtcta tgagaaccat cgccatatac tcccatgagg accgtctttc aatgcacagg 180 ttgaaggcgg acgaagcgta tgttatcggg gaggagggcc agtatacacc tgtgggtgct 240 tacttggcaa tggacgagat catcgaaatt gcaaagaagc ataaggtgga tttcatccat 300 ccaggttatg ggttcttgtc tgaaaattcg gaatttgccg acaaagtagt gaaggccggt 360 atcacttgga tcggccctcc agctgaagtt attgactctg tgggtgacaa agtctctgcc 420 agacacttgg cagcaagagc taacgttcct accgttcccg gtactccagg acctatcgaa 480 actgtgcaag aggcacttga cttcgttaat gaatacggct acccggtgat cattaaggcc 540 gcctttggtg gtggtggtag aggtatgaga gtcgttagag aaggtgacga cgtggcagat 600 gcctttcaac gtgctacctc cgaagcccgt actgccttcg gtaatggtac ctgctttgtg 660 gaaagattct tggacaagcc aaagcatatt gaagttcaat tgttggctga taaccacgga 720 aacgtggttc atcttttcga aagagactgt tctgtgcaaa gaagacacca aaaagttgtc 780 gaagtcgctc cagcaaagac tttgccccgt gaagttcgtg acgctatttt gacagatgct 840 gttaaattag ctaaggtatg tggttacaga aacgcaggta ccgccgaatt cttggttgac 900 aaccaaaaca gacactattt cattgaaatt aatccaagaa ttcaagtgga gcataccatc 960 actgaagaaa tcaccggtat tgacattgtt tctgcccaaa tccagattgc cgcaggtgcc 1020 actttgactc aactaggtct attacaggat aaaatcacca cccgtgggtt ttccatccaa 1080 tgtcgtatta ccactgaaga tccctctaag aatttccaac cggataccgg tcgcctggag 1140 gtctatcgtt ctgccggtgg taatggtgtg agattggacg gtggtaacgc ttatgcaggt 1200 gctactatct cgcctcacta cgactcaatg ctggtcaaat gttcatgctc tggttctact 1260 tatgaaatcg tccgtaggaa gatgattcgt gccctgatcg aattcagaat cagaggtgtt 1320 aagaccaaca ttcccttcct attgactctt ttgaccaatc cagtttttat tgagggtaca 1380 tactggacga cttttattga cgacacccca caactgttcc aaatggtatc gtcacaaaac 1440 agagcgcaaa aactgttaca ctatttggca gacttggcag ttaacggttc ttctattaag 1500 ggtcaaattg gcttgccaaa actaaaatca aatccaagtg tcccccattt gcacgatgct 1560 cagggcaatg tcatcaacgt tacaaagtct gcaccaccat ccggatggag acaagtgcta 1620 ctggaaaagg gaccatctga atttgccaag caagtcagac agttcaatgg tactctactg 1680 atggacacca cctggagaga cgctcatcaa tctctacttg caacaagagt cagaacccac 1740 gatttggcta caatcgctcc aacaaccgca catgcccttg caggtgcttt cgctttagaa 1800 tgttggggtg gtgctacatt cgacgttgca atgagattct tgcatgagga tccatgggaa 1860 cgtctgagaa aattaagatc tctggtgcct aatattccat tccaaatgtt attacgtggt 1920 gccaacggtg tggcttactc ttcattacct gacaatgcta ttgaccattt tgtcaagcaa 1980 gccaaggata atggtgttga tatatttaga gtttttgatg ccttgaatga tttagaacaa 2040 ttaaaagttg gtgtgaatgc tgtcaagaag gccggtggtg ttgtcgaagc tactgtttgt 2100 tactctggtg acatgcttca gccaggtaag aaatacaact tagactacta cctagaagtt 2160 gttgaaaaaa tagttcaaat gggtacacat atcttgggta ttaaggatat ggcaggtact 2220 atgaaaccgg ccgctgccaa attattaatt ggctccctaa gaaccagata tccggattta 2280 ccaattcatg ttcacagtca tgactccgca ggtactgctg ttgcgtctat gactgcatgt 2340 gccctagcag gtgctgatgt tgtcgatgta gctatcaatt caatgtcggg cttaacttcc 2400 caaccatcaa ttaatgcact gttggcttca ttagaaggta acattgatac tgggattaac 2460 gttgagcatg ttcgtgaatt agatgcatac tgggccgaaa tgagactgtt gtattcttgt 2520 ttcgaggccg acttgaaggg accagatcca gaagtttacc aacatgaaat cccaggtggt 2580 caattgacta acttgttatt ccaagctcaa caactgggtc ttggtgaaca atgggctgaa 2640 actaaaagag cttacagaga agccaattac ctactgggag atattgttaa agttacccca 2700 acttctaagg ttgtcggtga tttagctcaa ttcatggttt ctaacaaact gacttccgac 2760 gatattagac gtttagctaa ttctttggac tttcctgact ctgttatgga cttttttgaa 2820 ggtttaattg gtcaaccata cggtgggttc ccagaaccat taagatctga tgtattgaga 2880 aacaagagaa gaaagttgac gtgccgtcca ggtttagaat tagaaccatt tgatctcgaa 2940 aaaattagag aagacttgca gaacagattc ggtgatattg atgaatgcga tgttgcttct 3000 tacaatatgt atccaagggt ctatgaagat ttccaaaaga tcagagaaac atacggtgat 3060 ttatcagttc taccaaccaa aaatttccta gcaccagcag aacctgatga agaaatcgaa 3120 gtcaccatcg aacaaggtaa gactttgatt atcaaattgc aagctgttgg tgacttaaat 3180 aagaaaactg ggcaaagaga agtgtatttt gaattgaacg gtgaattaag aaagatcaga 3240 gttgcagaca agtcacaaaa catacaatct gttgctaaac caaaggctga tgtccacgat 3300 actcaccaaa tcggtgcacc aatggctggt gttatcatag aagttaaagt acataaaggg 3360 tctttggtga aaaagggcga atcgattgct gttttgagtg ccatgaaaat ggaaatggtt 3420 gtctcttcac cagcagatgg tcaagttaaa gacgttttca ttaaggatgg tgaaagtgtt 3480 gacgcatcag atttgttggt tgtcctagaa gaagaaaccc tacccccatc ccaaaaaaag 3540 taa 3543 <210> 45 <211> 1023 <212> DNA <213> Artificial Sequence <220> <223> mdh3 Delta SKL <400> 45 atggtcaaag tcgcaattct tggcgcttct ggtggcgtgg gacaaccgct atcattactg 60 ctaaaattaa gcccttacgt ttccgagctg gcgttgtacg atatccgagc tgcggaaggc 120 attggtaagg atttatctca catcaacacc aactcaagtt gtgtcggtta tgataaggat 180 agtattgaga acaccttgtc aaatgctcag gtggtgctaa taccggctgg tgttcccaga 240 aagcccggtt taactagaga tgatttgttc aagatgaacg ccggtattgt caaaagcctg 300 gtaaccgctg ttggaaagtt cgcaccaaat gcgaggattt tagtcatttc aaaccctgta 360 aacagtttgg tccctattgc tgtggaaact ttgaagaaaa tgggtaagtt caaacctgga 420 aacgttatgg gtgtgacgaa ccttgacctg gtacgtgcag aaaccttttt ggtagattat 480 ttgatgctaa aaaaccccaa aattggacaa gaacaagaca aaactacaat gcacagaaag 540 gtcactgtta ttgggggtca ttcaggggaa accattatcc caataatcac cgacaaatcg 600 ctggtatttc aacttgataa gcagtacgag cacttcattc atagggtcca gttcggaggt 660 gatgaaattg tcaaagctaa acagggcgcc ggttccgcca cgttgtccat ggcgttcgcg 720 ggggccaagt ttgctgaaga agttttgagg agcttccata atgagaaacc agaaacggag 780 tcactttccg cattcgttta tttaccaggc ttaaaaaacg gtaagaaagc gcagcaatta 840 gttggcgaca actctattga gtatttttcc ttgccaattg ttttgagaaa tggtagcgta 900 gtatccatcg ataccagtgt tctggaaaaa ctgtctccga gagaggaaca actcgttaat 960 actgcggtca aagagctacg caagaatatt gaaaaaggca agagtttcat cctagactct 1020 tga 1023 <210> 46 <211> 1317 <212> DNA <213> Artificial Sequence <220> <223> spmae1 <400> 46 atgggtgaac tcaaggaaat cttgaaacag aggtatcatg agttgcttga ctggaatgtc 60 aaagcccctc atgtccctct cagtcaacga ctgaagcatt ttacatggtc ttggtttgca 120 tgtactatgg caactggtgg tgttggtttg attattggtt ctttcccctt tcgattttat 180 ggtcttaata caattggcaa aattgtttat attcttcaaa tctttttgtt ttctctcttt 240 ggatcatgca tgctttttcg ctttattaaa tatccttcaa ctatcaagga ttcctggaac 300 catcatttgg aaaagctttt cattgctact tgtcttcttt caatatccac gttcatcgac 360 atgcttgcca tatacgccta tcctgatacc ggcgagtgga tggtgtgggt cattcgaatc 420 ctttattaca tttacgttgc agtatccttt atatactgcg taatggcttt ttttacaatt 480 ttcaacaacc atgtatatac cattgaaacc gcatctcctg cttggattct tcctattttc 540 cctcctatga tttgtggtgt cattgctggc gccgtcaatt ctacacaacc cgctcatcaa 600 ttaaaaaata tggttatctt tggtatcctc tttcaaggac ttggtttttg ggtttatctt 660 ttactgtttg ccgtcaatgt cttacggttt tttactgtag gcctggcaaa accccaagat 720 cgacctggta tgtttatgtt tgtcggtcca ccagctttct caggtttggc cttaattaat 780 attgcgcgtg gtgctatggg cagtcgccct tatatttttg ttggcgccaa ctcatccgag 840 tatcttggtt ttgtttctac ctttatggct atttttattt ggggtcttgc tgcttggtgt 900 tactgtctcg ccatggttag ctttttagcg ggctttttca ctcgagcccc tctcaagttt 960 gcttgtggat ggtttgcatt cattttcccc aacgtgggtt ttgttaattg taccattgag 1020 ataggtaaaa tgatagattc caaagctttc caaatgtttg gacatatcat tggggtcatt 1080 ctttgtattc agtggatcct cctaatgtat ttaatggtcc gtgcgtttct cgtcaatgat 1140 ctttgctatc ctggcaaaga cgaagatgcc catcctccac caaaaccaaa tacaggtgtc 1200 cttaacccta ccttcccacc tgaaaaagca cctgcatctt tggaaaaagt cgatacacat 1260 gtcacatcta ctggtggtga atcggatcct cctagtagtg aacatgaaag cgtttaa 1317 <210> 47 <211> 1656 <212> DNA <213> Artificial Sequence <220> <223> mls1 Delta SKL <400> 47 atggttaagg tcagtttgga taacgtcaaa ttactggtgg atgttgataa ggagcctttc 60 tttaaaccat ctagtactac agtgggagat attcttacca aggatgctct agagttcatt 120 gttcttttac acagaacttt caacaacaag agaaaacaat tattggaaaa cagacaagtt 180 gttcagaaga aattagactc gggctcctat catctggatt tcctgcctga aactgcaaat 240 attagaaatg atcccacttg gcaaggtcca attttggcac cggggttaat taataggtca 300 acggaaatca cagggcctcc attgagaaat atgctgatca acgctttgaa tgctcctgtg 360 aacacctata tgactgattt tgaagattca gcttcaccta cttggaacaa catggtttac 420 ggtcaagtta atctctacga cgcgatcaga aatcaaatcg attttgacac accaagaaaa 480 tcgtacaaat tgaatggaaa tgtggccaac ttgcccacta ttatcgtgag accccgtggt 540 tggcacatgg tggaaaagca cctttatgta gatgatgaac caatcagcgc ttccatcttt 600 gattttggtt tatatttcta ccataatgcc aaagaattaa tcaaattggg caaaggtcct 660 tacttctatt tgccaaagat ggagcaccac ttggaagcta aactatggaa cgacgtcttc 720 tgtgtagctc aagattacat tgggatccca aggggtacaa tcagagctac tgtgttgatt 780 gaaactttgc ctgctgcttt ccaaatggaa gagatcatct atcaattaag acaacattct 840 agtgggttga attgcggacg ttgggactat attttctcta caatcaagag attaagaaat 900 gatcctaatc acattttgcc caatagaaat caagtgacta tgacttcccc attcatggat 960 gcatacgtga aaagattaat caatacctgt catcggaggg gtgttcatgc catgggtggt 1020 atggctgcgc aaatccctat caaagacgac ccggcagcca atgaaaaggc catgactaaa 1080 gtccgtaatg ataagattag agagctgaca aatggacatg atgggtcatg ggttgcacac 1140 ccagcactgg cccctatttg taatgaagtt ttcattaata tgggaacacc aaaccaaatc 1200 tatttcattc ctgaaaacgt tgtaacggct gctaatctgc tggaaaccaa aattccaaat 1260 ggtgagatta ctaccgaggg aattgtacaa aacttggata tcgggttgca gtacatggaa 1320 gcttggctca gaggctctgg atgtgtgccc atcaacaact tgatggaaga cgccgccact 1380 gctgaagtgt ctcgttgtca attgtatcaa tgggtgaaac acggtgttac tctaaaggac 1440 acgggagaaa aggtcacccc agaattaacc gaaaagattc taaaagaaca agtggaaaga 1500 ctgtctaagg caagtccatt gggtgacaag aacaaattcg cgctggccgc taagtatttc 1560 ttgccagaaa tcagaggcga gaaattcagt gaatttttga ctacattgtt gtacgacgaa 1620 attgtgtcca ctaaggcgac gcccactgat ttgtga 1656 <210> 48 <211> 1674 <212> DNA <213> Artificial Sequence <220> <223> icl1 <400> 48 atgcctatcc ccgttggaaa tacgaagaac gattttgcag ctttacaagc aaaactagat 60 gcagatgctg ccgaaattga gaaatggtgg tctgactcac gttggagtaa gactaagaga 120 aattattcag ccagagatat tgctgttaga cgcgggacat tcccaccaat cgaataccca 180 tcttcggtca tggccagaaa attattcaag gtattagaga agcatcacaa tgagggtaca 240 gtctctaaaa ctttcggtgc cctagatcct gtccagattt ctcaaatggc aaaatactta 300 gacacaatct atatttctgg ttggcagtgt tcatcaactg cttccacctc aaatgaacct 360 ggtccagact tagctgatta tccaatggac accgttccaa acaaagtgga acatttgttc 420 aaggcccaat tgtttcacga cagaaaacaa ctagaggcac ggtcaaaggc taaatctcag 480 gaagaactcg atgagatggg tgccccaatt gactacctaa caccaattgt cgctgatgca 540 gacgcaggcc acggcggttt aaccgcagtc ttcaaattga ccaagatgtt cattgagcgt 600 ggtgctgctg ggatccacat ggaagaccag acatctacaa ataagaaatg tgggcatatg 660 gcaggaagat gtgttatacc cgttcaggaa catgttaaca gattggtgac tattagaatg 720 tgtgctgata tcatgcattc tgacttaatt gtcgttgcta ggactgattc agaagcagcc 780 actttgatta gctcaaccat cgataccaga gatcattatt tcattgtcgg tgccaccaat 840 ccaaatatcg agccatttgc cgaagtttta aatgatgcca tcatgagtgg tgcatcagga 900 caagaactag ctgacattga acaaaaatgg tgtagagacg ctggactcaa gttattccat 960 gaagccgtca ttgatgaaat tgaaagatca gccctgtcaa ataagcaaga attgattaag 1020 aaattcacct ctaaagtggg tccattgact gaaacatccc acagagaagc caagaagctc 1080 gctaaagaaa ttcttggcca cgaaattttc ttcgactggg agctaccacg cgtaagggaa 1140 gggttgtacc gttacagagg tgggacgcaa tgttctatca tgagggcccg tgcatttgct 1200 ccatatgctg atttggtatg gatggaatct aactacccag acttccaaca ggccaaggag 1260 tttgcagaag gtgttaaaga gaaattccct gaccaatggc tagcttacaa cttgtctcca 1320 tcctttaact ggccaaaagc catgtccgtt gatgaacaac acaccttcat ccaaaggctg 1380 ggtgatctag gttacatctg gcaatttatc acattggccg gtttacacac taacgcttta 1440 gctgtccata acttctctcg tgactttgcc aaggatggga tgaaagctta tgcccagaat 1500 gttcagcaga gggaaatgga cgatggtgtt gatgtgttga aacatcaaaa atggtctggt 1560 gcggagtaca tcgatgggtt attgaagtta gctcaaggtg gtgttagcgc aacagctgct 1620 atgggaaccg gtgtcacaga agatcaattc aaagaaaatg gcgtaaagaa atag 1674 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> adh1 <400> 49 tgggtgaaaa cgttaagggc tgg 23 <210> 50 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> gpd1 <400> 50 tcgctccaat agtacaaatg tgg 23 <210> 51 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> gpd2 <400> 51 gtttcgtaga aggtatggga tgg 23 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> adh3 <400> 52 tacatgcttg gcacggcgat 20

Claims (12)

pyc2 gene and mdh3 gene are introduced,
Recombinant yeast with increased production of C4 organic acid, wherein any one or more genes selected from adh1, adh2, adh3, adh4, adh5, adh6 and adh7 are inactivated. The method of claim 1,
The recombinant yeast is recombinant yeast, characterized in that the gpd1 gene and gpd2 gene is further inactivated. The method of claim 1,
The recombinant yeast is a recombinant yeast, characterized in that the mls1 gene and icl1 gene is further introduced. The method of claim 1,
The recombinant yeast is recombinant yeast, characterized in that the spmae1 gene encoding the C4 organic acid transporter protein is further introduced. The method of claim 1,
The pyc2 gene is represented by SEQ ID NO: 44, and the mdh3 gene is recombinant yeast, characterized in that represented by SEQ ID NO: 45. The method of claim 1,
Recombinant yeast, characterized in that the sequence present in the position 247 ~ 249 bp from the 5 'to the downstream of the adh1 gene is replaced with a TAA stop codon is defective. The method of claim 2,
The gpd1 gene is recombinant yeast, characterized in that the gpd1 and gpd2 genes are inactivated by the introduction of the genome of the expression cassette consisting of SEQ ID NO: 43. The method of claim 3, wherein
The mls1 gene is represented by SEQ ID NO: 47, and the icl1 gene is recombinant yeast, characterized in that represented by SEQ ID NO: 48. The method of claim 4, wherein
The spmae1 gene is recombinant yeast, characterized in that represented by SEQ ID NO: 46. The method of claim 1,
The yeast is recombinant yeast, characterized in that using Saccharomyces cerevisiae strain as a host cell. The method of claim 10,
The strain is recombinant yeast, characterized in that the D452-2 strain. 1) preparing any one recombinant yeast selected from claims 1 to 10; And
2) C4 organic acid production method comprising the step of culturing the recombinant yeast in a medium.

Images