KR20190135296A - Composition for immune enhancement comprising porcine reproductive and respiratory syndrome virus Nsp1 protein - Google Patents

Abstract

The present invention relates to a use for immune enhancement of porcine reproductive and respiratory syndrome virus (PRRSV) non-structural protein 1 (Nsp1) protein. Specifically, the present invention relates to a recombinant expression vector having a cleavage map of FIG. 1, into which a PRRSV Nsp1 gene is introduced, a transformed cell line that overexpresses the Nsp1 protein transformed with the recombinant expression vector, an Nsp1 protein; a recombinant vector comprising a gene sequence encoding the protein; or an immune enhancing composition comprising the cell line transformed with the recombinant vector as an active ingredient and an immune enhancing method using the composition.

Description

Composition for immune enhancement comprising porcine reproductive and respiratory syndrome virus Nsp1 protein}

The present invention relates to a composition for immunopotentiation comprising swine respiratory syndrome virus Nsp1 protein as an active ingredient.

Swine Respiratory Syndrome (PRRS) virus is now the most damaging disease in the swine industry worldwide. The loss was most pronounced at the time of the first occurrence of the disease, but with ongoing research, the PRRS virus is also important as a factor in inducing Porcine Respiratory Disease Comple (PRDC) or post-weaning neoplastic syndrome. Is recognized. The PRRS virus, which causes swine respiratory syndrome, is largely divided into North American type and European type, and there are many species due to the mutation. In addition, it destroys alveolar macrophages, making secondary infections of other pathogens more likely to occur, directly causing interstitial pneumonia in the lungs, and acute infection with sows, which can cause abortion with high fever.

The PRRS virus causes swine respiratory syndrome through the pig's nasal cavity, muscles, oral cavity, uterus and vagina. In general, pigs are more susceptible to non-oral infections than oral infections. Types of infection of the PPRS virus include non-indirect spreading, vertical infections, persistent infections, spread within farms, and spread between farms. Non-indirect transmission can occur through equipment, tools, clothing, water, food, mediated insects (mosquitoes, flies), airborne droplets, meat gravy, etc., within 60 minutes of contact with pigs acutely infected with the PRRS virus. PPRS virus is also detected in worker's work clothes, boots, hands, etc. Indirect transmission of the PRRS virus may be further facilitated, especially in cold weather below freezing winter.

The clinical manifestations of the PRRS virus vary depending on the species of the virus, the immune status and susceptibility of infected pigs, the complex infectious disease, and other management factors. Currently, the diagnosis of PRRS virus mainly consists of antigen detection using PCR, antibody measurement using ELISA, and serum antibody test. However, rapid diagnosis has not been made, and there is no development of a therapeutic agent that can effectively treat diseases caused by viral infection. I can't do it.

Therefore, there is a need for the development of new technologies that can enhance the immune system in a fundamental way to prevent and treat diseases caused by various viral infections, including the PRRS virus.

Republic of Korea Patent No. 10-1438542

Therefore, the present inventors have found that the porcine respiratory syndrome virus (PRRSV) non-structural protein 1 (Nsp1) enhances the phagocytosis of macrophages and ultimately has an immunostimulating effect. It was confirmed that the expression of Rac1 and the expression of Rac1 can be enhanced to enhance immune activity through the enhancement of phagocytosis of porcine macrophages.

Accordingly, it is an object of the present invention to provide a recombinant expression vector having a cleavage map of FIG. 1 into which a swine respiratory syndrome virus (PRRSV) Nsp1 (Non-structural protein 1) gene is introduced.

Another object of the present invention is to provide a transformed cell line that overexpresses the Nsp1 protein transformed with the recombinant expression vector.

Still another object of the present invention is a Nsp1 (Non-structural protein 1) protein; A recombinant vector comprising a gene sequence encoding the protein; Or to provide an immuno-enhancing composition comprising the cell line transformed with the recombinant vector as an active ingredient.

Still another object of the present invention is to provide an immune enhancing method comprising administering the composition of claim 5 to a mammal other than a human.

In order to achieve the above object, the present invention provides a recombinant expression vector having a cleavage map of FIG. 1 into which porcine respiratory syndrome virus (PRRSV) Nsp1 (Non-structural protein 1) gene is introduced.

In one embodiment of the invention, the Nsp1 (Non-structural protein 1) gene may be composed of the nucleotide sequence of SEQ ID NO: 1.

The present invention also provides a transformed cell line overexpressing the Nsp1 protein transformed with the recombinant expression vector.

In one embodiment of the present invention, the Nsp1 protein may be composed of the amino acid sequence of SEQ ID NO: 2.

In addition, the present invention is Nsp1 (Non-structural protein 1) protein; A recombinant vector comprising a gene sequence encoding the protein; Or it provides a composition for immuno-enhancing comprising the cell line transformed with the recombinant vector as an active ingredient.

In one embodiment of the present invention, the Nsp1 protein is composed of the amino acid sequence of SEQ ID NO: 2, the gene is composed of the nucleotide sequence of SEQ ID NO: 1, the recombinant vector may have a cleavage map of FIG. .

In one embodiment of the present invention, the composition may have the activity of reducing the expression of Smad4, increasing the expression of Rac1, and enhancing the phagocytosis of macrophages.

Furthermore, the present invention provides a method for boosting immunity, comprising administering the composition of claim 5 to a mammal other than a human.

Nsp1 (Non-structural protein 1) protein according to the present invention mediates the reduction of Smad4 expression through proteolysis by ubiquitin-proteasome, while increasing the expression of Rac1, which induces phagocytosis, ultimately in macrophages. Increasing phagocytosis can induce an immune boosting effect. Therefore, Nsp1 (Non-structural protein 1) protein according to the present invention can be used as a novel immune enhancer and furthermore useful for vaccines for the prevention or treatment of infectious diseases.

Figure 1 shows a schematic diagram of the recombinant vector introduced PRRSV Nsp1 gene in one embodiment of the present invention.
Figure 2 shows that after introducing the PRRSV Nsp1 gene introduced recombinant vector into the macrophage 3D4 / 31 cell line, the expression of Nsp1 was confirmed by RT-PCR analysis.
3 shows Western blot expression levels of Smad4 in porcine macrophage cell lines overexpressed with PRRSV Nsp1, and 3a shows the expression levels of Smad4 expressed in whole cells, cytoplasm and nucleus of Nsp1 protein overexpressed porcine macrophage cell lines. 3b is to confirm the expression level of Smad4 after treatment with cyclohexamide hourly, 3c is to confirm the expression level of Smad4 after treatment with MG132.
Figure 4 shows that the expression level of Rac1 in porcine macrophage cell line overexpressed PRRSV Nsp1 gene confirmed by RT-PCR analysis.
Figure 5 shows the results of confirming the phagocytosis of porcine macrophage cell line overexpressed PRRSV Nsp1 gene.

The present invention is characterized by providing a use of porcine respiratory syndrome virus (PRRSV) non-structural protein 1 (Nsp1) protein as a novel immune enhancer.

The present inventors prepared a recombinant expression vector capable of overexpressing Nsp1 to identify the role of porcine respiratory syndrome virus (PRRSV) non-structural protein 1 (Nsp1) as an immune enhancer, and the vector was expressed in pig macrophages. After introduction and overexpression, expression levels of Smad4 and Rac1 proteins were measured in cells into which the Nsp1 gene was introduced and in cell lines into which the gene was not introduced.

As a result, it was confirmed that overexpression of Nsp1 mediated the decrease of Smad4 expression through proteolysis by ubiquitin-proteosomes and that Rac1 expression, which enhances phagocytosis of macrophages, could be increased.

The PRRS virus (PRRSV), the causative agent of the genital respiratory syndrome (PRRS), is a positive single-stranded RNA envelope virus and belongs to the Arteriviridae family. The genome of the virus is 15kb and has at least 10 ORFs (Open reading frames). ORF1a and ORF1b carry 75% of the entire genome, and the expressed protein produces 14 Nsp proteins. Nsp1, made from PRRSV ORF1a, consists of 383 amino acids and consists of two subunits, Nsp1α and Nsp1β. It also has a zinc finger motif, which is known to be necessary for the transcription of subgenomic mRNAs during PPRSV replication.

In addition, Smad4 is a component of the Smad pathway, involved in signal transduction in the TGF-β pathway, and is a Co-smad (commone regulator smad) that is unique in mammals as a protein. It is combined with Smad2 / 3 to form a heterotrimeric complex and participates in nuclear translocation. The complex is known to bind to Smad (binding elements) in DNA and regulate genes such as integrin, E-cadherin and collagen. On the other hand, in the present invention, it was confirmed that overexpression of Nsp1 reduces the expression of Smad4 by mediating the proteolytic action of Smad4 by ubiquitin-proteasome.

Rac1 is a GTPase belonging to the Rho family that is involved in macrophage phagocytosis and is involved in cell growth, cytoskeletal reorganization, and antimicrobial toxicity. Rac1 is involved in cell mobility through actin networks and is known to induce phagocytosis through membrane remodeling when activated in macrophages.

In addition, macrophage (macrophage) is one of the important innate immune cells constituting our body, distributed in various forms in all tissues and serves to protect the body through phagocytosis of external pathogens and toxic substances invaded in normal state To perform. In addition, the action of macrophages is known to be important for the main immune response, such as adaptive immune, wound healing, inflammatory response.

In addition, macrophages not only have phagocytosis, which eats antigens that have invaded our bodies, but also act as antigen-directing cells that display fragmented antigen fragments on the cell surface to inform T cells and secrete various cytokines. Induces an inflammatory response and acts to activate immune cells.

In this regard, it was confirmed through experiments that Nsp1 overexpression of the present invention can induce the effect of increasing the expression of Rac1, and furthermore, it can increase the phagocytosis of porcine macrophage lines, ultimately inducing immunopotentiating activity. It was.

Therefore, the present invention can provide a recombinant expression vector into which the swine respiratory syndrome virus (PRRSV) Nsp1 (Non-structural protein 1) gene is introduced, and preferably, the expression vector may have a cleavage map of FIG. 1.

The present invention also provides a transformed cell line that overexpresses the Nsp1 protein transformed with the recombinant expression vector of the present invention.

In the present invention, the cell line may be prepared by a transformation method commonly used in the art. Conventional molecular biology, microbiology, immunology and recombinant DNA techniques and the like can be used in the technical scope of the art.

In the present invention, the cell line is not particularly limited as long as it can overexpress Nsp1 according to the present invention, but in one embodiment of the present invention, 293GPG cells (Ory et al., 1996), which are cell lines packaged with retroviruses, are included. Was used. Using the cell line has the advantage of increasing the expression efficiency.

In addition, the present invention is Nsp1 (Non-structural protein 1) protein; A recombinant vector comprising a gene sequence encoding the protein; Or it may provide an immuno-enhancing composition comprising the cell line transformed with the recombinant vector as an active ingredient.

Preferably, the Nsp1 protein consists of an amino acid sequence of SEQ ID NO: 2, the gene consists of a nucleotide sequence of SEQ ID NO: 1, and the recombinant vector may have a cleavage map of FIG.

In the present invention, the composition for immunopotentiation may be a medicament that enhances specific immune responses against vaccines or inoculum. The immunopotentiating composition is any substance which, when incorporated into a vaccine or inoculum, generally or specifically serves to accelerate, prolong or enhance the quality of specific immunoreactivity to immunogenic substances during its manufacture. Or as an agent.

In a preferred form, the immunopotentiating composition of the present invention may comprise additional ingredients known to those skilled in the art and may comprise one or more veterinary acceptable carriers. "Veterinally acceptable carrier" includes any and all solvents, dispersion media, coatings, adjuvant, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic, absorption delaying agents, and the like.

Usually, an immunopotentiating composition is typically used as an immunopotentiating composition in which an effective amount of an adjuvant is dissolved or dispersed in a pharmaceutically acceptable diluent. The amount of use may vary widely in different host animals, depending on the T-cell stimulating immunogenic polypeptide portion used and the construct used. Typical amounts are about 1 microgram (μg) Ng / kg Nsp1 protein per kg body weight to about 1 milligram (mg / kg) per kg host weight. More common amounts are from about 5 μg / kg body weight to about 0.5 mg / kg body weight. The diluent is typically water based and may include one or more additional adjuvant, buffers, salts and viscosity improvers. The components of the diluents are substances that are often present in vaccines or inoculum.

The immunopotentiating composition of the present invention can be administered orally or parenterally. Suitable dosages of the immunopotentiating composition of the present invention are factors such as formulation method, mode of administration, age, weight, sex, degree of disease symptom, food, time of administration, route of administration, rate of excretion, and response to response of the subject animal. And those skilled in the art can readily determine and prescribe dosages effective for treatment or prophylaxis.

An effective amount of Nsp1 according to the present invention means, but is not limited to, the amount of antigen that Nsp1 can induce or induce an immune response, the effective amount is at least 10 weeks, preferably at least 12 weeks, more preferably at least Preferably defined as the amount of antigen that confers a 20 week immune duration (DOI).

In general, the cell lines included in the immuno-enhancing composition may be inoculated into humans or mammals at an appropriate concentration, if necessary, and may be inoculated into mammals other than humans. For example, after measuring the OD value at OD 600, the animal may be inoculated with a value of about 0.5 to 1.5 x 10 ^ 10 CFU / ml. However, the dosage is not limited to this, and finally can be appropriately determined by the veterinarian's judgment in consideration of the type of formulation, the method of administration, age, weight, and symptoms.

The cell line or Nsp1 protein according to the present invention has an effect of reducing the expression of Smad4 and increasing the expression of Rac1, and inducing a strong immune response through enhanced phagocytosis of macrophages.

Furthermore, the present invention can provide a method for boosting immunity, comprising the step of administering an immuno-enhancing composition according to the present invention to a mammal other than human.

In addition, the present invention may provide a method for preventing or treating an infectious disease, comprising the step of administering an immuno-enhancing composition according to the present invention to a mammal other than a human.

The infectious disease may include a disease caused by infection of harmful substances including various viruses, bacteria and bacteria such as PRRSV. In particular, the most important in the prevention of infectious diseases is the development of more efficient vaccines, and in the case of vaccines, it is urgent to develop new immunostimulants or adjuvants, because the same antigen depends on which immunoadjuvant is used for a vaccine of the same efficacy. This is because the immune response to the response can be enhanced more efficiently.

In this regard, the present invention can activate the macrophage phagocytic effect of the macrophage by introducing Nsp1 protein or gene into macrophages or dendritic cells, which are the main antigen presenting cells that initiate the immune response. Can be promoted.

Therefore, the immuno-enhancing composition of the present invention can induce immunity promotion and can prevent or treat infectious diseases.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are intended to illustrate the present invention more specifically, but the scope of the present invention is not limited to these examples.

<Example 1>

Production of a Recombinant Expression Vector Incorporating the Porcine Respiratory Syndrome Virus (PRRSV) Nsp1 Gene

Nsp1 sequences were synthesized according to base sequences obtained from a gene database (NCBI genebank) for Nsp1 cDNA construction of porcine respiratory syndrome virus (PRRSV). Thereafter, primers were prepared according to the nucleotide sequences obtained from the genetic database, and then PRRSV Nsp1 cDNA was obtained through Reverse Transcription Polymerase Chain Reaction (RT-PCR), and then restriction enzymes EcoRI and SalI were obtained. The PRRSV Nsp1 cDNA gene treated with restriction enzyme was inserted into the retrovirus vector (pBabe-pruo). The vector map of the PRRSV Nsp1 overexpression recombinant vector constructed through the above process is shown in Figure 1, the primer sequence used in the experiment is shown in Table 1, the gene sequence of the PRRSV Nsp1 cDNA is shown in SEQ ID NO: 1.

Primers for PRRSV Nsp1 cDNA Synthesis primer Sequence (5'-3 ') GeneBank Access number PRRSV Nsp1
Forward direction CCGGAATTCATGTCTGGGATACTTGAT (SEQ ID NO: 3) U87392
Reverse ACGCGTCGACTCAGTACCACTTGTGACTGCC (SEQ ID NO: 4)

< Example  2>

Preparation of Transgenic Cell Lines Overexpressing PRRSV Nsp1 Protein

In Example 1, the pBabe-puro vector into which the PRRSV Nsp1 cDNA was inserted was overexpressed in a pig macrophage (3D4 / 31 cell line) using a 293GPG cell line operated by a tetracycline off system. First 293GPG cells were dispensed into 5 x 10 ⁶ cells in tissue culture plates and cultured in DMEM medium containing 10% fetal calf serum. After 24 hours, when the cells grow to fill 70-80% of the well surface, 1μg of the PRRSV Nsp1 protein expression vector DNA prepared in Example 1 was mixed with 6μg of Lipofectamine plus (Invitrogen) in DMEM medium without serum. And 293GPG cells, respectively. Thereafter, a culture supernatant containing a virus containing the PRRSV Nsp1 gene generated from 293GPG cells was obtained, treated with 3D4 / 31 cells, which are host cells, and cultured for 5 hours, and then replaced with a medium containing 10% of serum. Incubation was further time and this process was repeated three times.

Then, 1.5 μg / ml of puromycin antibiotics were isolated to isolate cells transduced with PRRSV Nsp1, and then PRRSV Nsp1 protein was overexpressed by obtaining cells expressing the antibiotic-resistant PRRSV Nsp1 protein. The resulting transformed cell line was obtained. Thereafter, 200 μl of chloroform (sigma) per 1 ml of Trizol (Invitrogen) was treated with a cell line to isolate total RNA from the cell line, and the extracted 1 μg mRNA was used as a template for the reverse transcription of Superscript III (Invitrogen). CDNA was synthesized by reverse transcriptase chain polymerization using an enzyme (Reverse transcriptase). Thereafter, the cDNA as a template was used to perform reverse transcription polymerase chain reaction using the primers of Table 2 below, and the expression level of the PRRSV Nsp1 gene was measured. Here, the control group used mRNA of the 3D4 / 31 cell line (mock) expressing only the pBabe-puro vector to which the PRRSV Nsp1 gene was not inserted.

Primer for RT-PCR reaction to measure the expression level of PRRSV Nsp1 gene primer Sequence (5'-3 ') GeneBank Access number PRRSV Nsp1
Forward direction GCCTCAGTGCACGGTCTCTCCTT (SEQ ID NO: 5) U87392 Reverse GGCTGTGAAGGCGAACTTAGA (SEQ ID NO: 6) pGAPDH
Forward direction ATGACCACAGTCCATGCCATC (SEQ ID NO: 7) NM_001206359 Reverse CCTGCTTCACCACCTTCTTG (SEQ ID NO: 8)

As a result, as shown in FIG. 2, it was confirmed that the Nsp1 gene was overexpressed in the 3D4 / 31 cell line into which the PRRSV Nsp1 gene prepared in the present invention was introduced.

<Example 3>

PRRSV Nsp1  Overexpressed 3D4 / 31 cell line Of Smad4  Reduced expression

The expression level of Smad4 protein in porcine macrophages (3D4 / 31) overexpressing PRRSV Nsp1 protein was confirmed by Western blotting. First, 3D4 / 31 cells overexpressing the PRRSV Nsp1 protein prepared in Example 2 were prepared using a RIPA lysis buffer (RIPA lysis buffer, 50 mM Tris, 150 mM NaCl, 1.0% NP-) containing a protease inhibitor cocktail. 40, 0.5% deoxycholate, 0.1% SDS), followed by electrophoresis on a 10% SDS polyacrylamide gel, and the proteins were transferred to a Hybond-P PVDF membrane (GE Healthcare, Buckinghamshire, UK). . After the anti-Smad4 antibody (Abcam) that specifically binds to the pig C1qBP molecule to the membrane (membrane) was developed using the ECL system (GE healthcare, Buckinghamshire, UK) to measure the expression of Smad4 protein Is shown in Figure 3a. At this time, β-actin was used as an internal control.

As a result, it was found that the expression of Smad4 protein was reduced in the nucleus, cytosol and cells in the porcine macrophages (3D4 / 31) overexpressing PRRSV Nsp1 protein. That is, these results indicate that the PRRSV Nsp1 protein has an action of inhibiting the expression or activity of the Smad4 protein.

Furthermore, the inventors of the present invention, in order to specifically investigate the mechanism of decreasing the expression of Smad4 by the PRRSV Nsp1 protein, first treated 100 μg / ml of cyclohexamide (Cycloheximide), a protein synthesis inhibitor, to the cell line for each hour, and then Western blot. The expression level of Smad4 was analyzed, and MG132 (20 μM), a proteosome inhibitor that degrades protein through ubiquininated protein, was treated over time, followed by the same method to analyze the expression level of Smad4. It was.

As a result, the expression of Smad4 was decreased in both the cytoplasm and the nucleus of the cyclohexamide-treated cell line, and the expression of Smad4 was more markedly decreased in the pig macrophage cell line overexpressing PRRSV Nsp1 protein. Appeared (see FIG. 2B). On the other hand, when MG132 was treated, it was confirmed that the expression of Smad4 was suppressed by cyclohexamide in porcine macrophage cell lines overexpressed with PRRSV Nsp1 protein. In other words, the expression of Smad4 in pig macrophage cell line overexpressed with PRRSV Nsp1 protein was decreased when cyclohexamide was treated. However, the group treated with the proteosome inhibitor MG132 was lower than the group treated with MG132. The expression was shown to be increased (see FIG. 3C).

<Example 4>

PRRSV Nsp1  Overexpressed 3D4 / 31 cell line Rac1  Decreased expression of

Real-time PCR was performed to confirm the expression level of porcine Rac1 gene in PRRSV Nsp1 overexpressed porcine macrophage. To this end, Mock / 3D4 / 31 cells (control) and PRRSV Nsp1 / 3D4 / 31 cells (Nsp1 overexpressing cell line) were collected, RNA was isolated and cDNA synthesized by the method described in the above example, and real-time PCR was performed. .

As a result, as shown in FIG. 4, the expression of the Rac1 gene was increased in the cell line in which PRRSV Nsp1 was overexpressed. Therefore, PRRSV Nsp1 increased the expression of the Rac1 gene, but it was found that the activity of reducing the expression of Smad4.

< Example  5>

PRRSV Nsp1  Macrophage caused by overexpression 3D4 Phagocytic activity analysis of cell lines

Furthermore, the present inventors confirmed whether the PRRSV Nsp1 of the present invention has an immunostimulating effect through increased phagocytic activity of macrophages. Phagocytes ingest foreign substances or bacteria that invade from the outside to remove them.

For such phagocytosis analysis, first, PRRSV NSP1 protein overexpressing porcine macrophages were inoculated into 6 well plates at 5x10 ⁵ cells per well, 10% calf serum and 1% penicillin / streptomycin, 10 mM HEPES, 1 mM sodium pyruvate and 4.5 g Cultured in RPMI 1640 medium containing / L glucose. After 24 hours, when the cells grow to cover 40-60% of the well surface, yellow-green fluorescent microspheres (size 2.0 μm, FluoSpheres carboxylate modified microspheres, Invitrogen) fluorescent beads were diluted 1: 500 in 1 ml of medium. After that, the cells were incubated for 4 hours at 37 ° C. Thereafter, the fluorescent beads absorbed through phagocytosis in the cells were analyzed by flow cytometry.

As a result, as shown in FIG. 5, the macrophage cell line in which the PRRSV Nsp1 protein was overexpressed was found to have significantly increased phagocytosis compared to the control group.

Based on these results, the present inventors can effectively induce an immune response by promoting phagocytosis of macrophages in the PRRSV Nsp1 protein, and thus can be used as an adjuvant for immune augmentation and further induced by immunosuppression. It was confirmed that it can be used as a therapeutic and vaccine adjuvant for preventing or treating infectious diseases.

So far I looked at the center of the preferred embodiment for the present invention. Those skilled in the art will appreciate that the present invention can be implemented in a modified form without departing from the essential features of the present invention. Therefore, the disclosed embodiments should be considered in descriptive sense only and not for purposes of limitation. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope will be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Korea University <120> Composition for immune enhancement comprising porcine          reproductive and respiratory syndrome virus Nsp1 protein <130> NPDC69125 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 1146 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence for PRRSV Nsp1 <400> 1 atgtctggga tacttgatcg gtgcacgtgt acccccaatg ccagggtgtt tatggcggag 60 ggccaagtct actgcacacg atgcctcagt gcacggtctc tccttcccct gaacctccaa 120 gtttctgagc tcggggtgct aggcctattc tacaggcccg aagagccact ccggtggacg 180 ttgccacgtg cattccccac tgttgagtgc tcccccgccg gggcctgctg gctttctgca 240 atctttccaa tcgcacgaat gaccagtgga aacctgaact tccaacaaag aatggtacgg 300 gtcgcagctg agctttacag agccggccag ctcacccctg cagtcttgaa ggctctacaa 360 gtttatgaac ggggttgccg ctggtacccc attgttggac ctgtccctgg agtggccgtt 420 ttcgccaatt ccctacatgt gagtgataaa cctttcccgg gagcaactca cgtgttgacc 480 aacctgccgc tcccgcagag acccaagcct gaagactttt gcccctttga gtgtgctatg 540 gctactgtct atgacattgg tcatgacgcc gtcatgtatg tggccgaaag gaaagtctcc 600 tgggcccctc gtggcgggga tgaagtgaaa tttgaagctg tccccgggga gttgaagttg 660 attgcgaacc ggctccgcac ctccttcccg ccccaccaca cagtggacat gtctaagttc 720 gccttcacag cccctgggtg tggtgtttct atgcgggtcg aacgccaaca cggctgcctt 780 cccgctgaca ctgtccctga aggcaactgc tggtggagct tgtttgactt gcttccactg 840 gaagttcaga acaaagaaat tcgccatgct aaccaatttg gctaccagac caagcatggt 900 gtctctggca agtacctaca gcggaggctg caagttaatg gtctccgagc agtaactgac 960 ctaaacggac ctatcgtcgt acagtacttc tccgttaagg agagttggat ccgccatttg 1020 aaactggcgg gagaacccag ctactctggg tttgaggacc tcctcagaat aagggttgag 1080 cctaacacgt cgccattggc tgacaaggaa gaaaaaattt tccggtttgg cagtcacaag 1140 tggtac 1146 <210> 2 <211> 383 <212> PRT <213> Artificial Sequence <220> <223> Amino acid for PRRSV Nsp1 <400> 2 Met Ser Gly Ile Leu Asp Arg Cys Thr Cys Thr Pro Asn Ala Arg Val   1 5 10 15 Phe Met Ala Glu Gly Gln Val Tyr Cys Thr Arg Cys Leu Ser Ala Arg              20 25 30 Ser Leu Leu Pro Leu Asn Leu Gln Val Ser Glu Leu Gly Val Leu Gly          35 40 45 Leu Phe Tyr Arg Pro Glu Glu Pro Leu Arg Trp Thr Leu Pro Arg Ala      50 55 60 Phe Pro Thr Val Glu Cys Ser Pro Ala Gly Ala Cys Trp Leu Ser Ala  65 70 75 80 Ile Phe Pro Ile Ala Arg Met Thr Ser Gly Asn Leu Asn Phe Gln Gln                  85 90 95 Arg Met Val Arg Val Ala Ala Glu Leu Tyr Arg Ala Gly Gln Leu Thr             100 105 110 Pro Ala Val Leu Lys Ala Leu Gln Val Tyr Glu Arg Gly Cys Arg Trp         115 120 125 Tyr Pro Ile Val Gly Pro Val Pro Gly Val Ala Val Phe Ala Asn Ser     130 135 140 Leu His Val Ser Asp Lys Pro Phe Pro Gly Ala Thr His Val Leu Thr 145 150 155 160 Asn Leu Pro Leu Pro Gln Arg Pro Lys Pro Glu Asp Phe Cys Pro Phe                 165 170 175 Glu Cys Ala Met Ala Thr Val Tyr Asp Ile Gly His Asp Ala Val Met             180 185 190 Tyr Val Ala Glu Arg Lys Val Ser Trp Ala Pro Arg Gly Gly Asp Glu         195 200 205 Val Lys Phe Glu Ala Val Pro Gly Glu Leu Lys Leu Ile Ala Asn Arg     210 215 220 Leu Arg Thr Ser Phe Pro Pro His His Thr Val Asp Met Ser Lys Phe 225 230 235 240 Ala Phe Thr Ala Pro Gly Cys Gly Val Ser Met Arg Val Glu Arg Gln                 245 250 255 His Gly Cys Leu Pro Ala Asp Thr Val Pro Glu Gly Asn Cys Trp Trp             260 265 270 Ser Leu Phe Asp Leu Leu Pro Leu Glu Val Gln Asn Lys Glu Ile Arg         275 280 285 His Ala Asn Gln Phe Gly Tyr Gln Thr Lys His Gly Val Ser Gly Lys     290 295 300 Tyr Leu Gln Arg Arg Leu Gln Val Asn Gly Leu Arg Ala Val Thr Asp 305 310 315 320 Leu Asn Gly Pro Ile Val Val Gln Tyr Phe Ser Val Lys Glu Ser Trp                 325 330 335 Ile Arg His Leu Lys Leu Ala Gly Glu Pro Ser Tyr Ser Gly Phe Glu             340 345 350 Asp Leu Leu Arg Ile Arg Val Glu Pro Asn Thr Ser Pro Leu Ala Asp         355 360 365 Lys Glu Glu Lys Ile Phe Arg Phe Gly Ser His Lys Trp Tyr ***     370 375 380 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PRRSV Nsp1 Forward primer <400> 3 ccggaattca tgtctgggat acttgat 27 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> PRRSV Nsp1 Reverse primer <400> 4 acgcgtcgac tcagtaccac ttgtgactgc c 31 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PRRSV Nsp1 Forward primer <400> 5 gcctcagtgc acggtctctc ctt 23 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PRRSV Nsp1 Reverse primer <400> 6 ggctgtgaag gcgaacttag a 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pGAPDH Forward primer <400> 7 atgaccacag tccatgccat c 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> P223 pGAPDH Reverse primer <400> 8 cctgcttcac caccttcttg 20

Claims (8)

Pig Reproductive Syndrome Syndrome Virus (PRRSV) A recombinant expression vector having a cleavage map of FIG. 1 into which a non-structural protein 1 (Nsp1) gene is introduced. The method of claim 1,
The Nsp1 (Non-structural protein 1) gene, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 1, recombinant expression vector. A transformed cell line that overexpresses the Nsp1 protein transformed with the recombinant expression vector of claim 1. The method of claim 3,
The Nsp1 protein, characterized in that consisting of the amino acid sequence of SEQ ID NO: 2, a transformed cell line. Nsp1 (Non-structural protein 1) protein; A recombinant vector comprising a gene sequence encoding the protein; Or comprising a cell line transformed with the recombinant vector as an active ingredient, the composition for immuno-enhancing. The method of claim 5,
The Nsp1 protein is composed of the amino acid sequence of SEQ ID NO: 2, the gene is composed of the nucleotide sequence of SEQ ID NO: 1, the recombinant vector, characterized in that having a cleavage map of Figure 1, the composition for immuno-enhancing. The method of claim 5,
The composition reduces the expression of Smad4,
Increase the expression of Rac1,
Immunopotentiating composition, characterized in that it has an activity for enhancing the phagocytosis of macrophages. A method of boosting immune, comprising administering the composition of claim 5 to a mammal other than a human.

Images