KR20190132639A - Adeno-associated virus (AAV) clade F vectors and uses thereof - Google Patents

Abstract

A recombinant adeno-associated virus (rAAV) vector comprising an AAVhu68 capsid produced in a production system comprising a nucleotide sequence of SEQ ID NO: 1, or at least 75% identical to the sequence encoding SEQ ID NO: 2. The AAVhu68 capsid comprises a subgroup of highly deamidated asparagine residues in an asparagine-glycine pair in the amino acid sequence of SEQ ID NO: 2. Also provided are compositions containing such rAAV and uses thereof. In addition, an rAAV is provided having an engineered AAV capsid comprising at least one subpopulation of vp1 or vp2 protein with Val at amino acid position 157 in relation to AAVhu68 vp1 numbering.

Description

Adeno-associated virus (AAV) clade F vectors and uses thereof

A statement about federally sponsored research or development

This application includes studies supported under W911NF-13-2-0036 by the Defense Advanced Research Projects Agency (DARPA). The US government may have certain rights in this invention.

Adeno-associated virus (AAV), a member of the parvovirus family, is a small unsealed icosahedron virus with a single stranded linear DNA (ssDNA) genome about 4.7 kilobases (kb) long. The wild type genome includes an inverted terminal repeat (IRT) at both ends of the DNA strand, and two open reading frames (ORFs): rep and cap. Rep consists of four overlapping genes that encode the rep protein needed for the AAV life cycle, and the cap contains overlapping nucleotide sequences of the capsid proteins: VP1, VP2 and VP3, which self assemble to form icosahedral symmetry capsids. .

AAV is also depen for assignment in a virus (Dependovirus), because it was found as a contaminant in the virus purified adenovirus stocks. The life cycle of AAV includes the incubation period where the AAV genome is specifically integrated into the host chromosome after infection and the infective phase after the adenovirus or herpes simplex virus infection, the integrated genome is then rescued, replicated and packaged in the infectious virus. . The nature of non-pathogenic, infectious broad host ranges such as non-dividing cells, and potential site-specific chromosomal integration make AAV an attractive tool for gene delivery.

Recombinant adeno-associated virus (rAAV) vectors derived from replication defective human parvoviruses have been described as suitable vehicles for gene delivery. Typically, the functional rep gene and cap gene are removed from the vector to produce a replication-incompatible vector. This function is provided during the vector production system but is not present in the final vector.

To date, there have been several different well characterized AAVs isolated from human or non-human primates (NHPs). Different antigenic types of AAV have been shown to exhibit different transfection efficiencies and to exhibit tropism for different cells or tissues. Many different AAV clades are described in WO 2005/033321, including Clade F, which has been identified as having only three members AAV9, AAVhu31 and AAVhu32. Structural analysis of AAV9 is described in M. A. DiMattia et al, J. Virol. (June 2012) vol. 86 no. 12 6947-6958. This document reports that AAV9 is encoded by the cap gene and has (total) 60 copies of three variable proteins (vp) with overlapping sequences. This includes VP1 (87kDa), VP2 (73kDa) and VP3 (62kDa), each present in a predicted ratio of 1: 1: 10. The entire sequence of VP3 is contained in VP2, and all of VP2 is contained in VP1. VP1 has a unique N-terminal domain. Purified coordinates and structural factors are available from the RCSB PDB database under accession number 3UX1.

Several different AAV9 variants have been engineered to detarget or target different tissues (N. Pulicheria, "Engineering Liver-detargeted AAV9 Vectors for Cardiac and Musculoskeletal Gene Transfer", Molecular Therapy, Vol, 19, no. 6, p. 1070-1078 (June 2011)]. The development of AAV9 variants for delivering genes through the blood brain barrier has been reported (see, eg, BE Deverman et al, Nature Biotech, Vol. 34, No. 2, p 204-211 (published online 1 Feb). 2016) and Caltech press release, A. Wetherston, www.neurology-central.com/2016/02/10/successful-delivery-of-genes-through-the-blood-brain-barrier/ , accessed 10/05/2016 See also International Patent WO 2016/0492301 and US Pat. No. 8,734,809].

Desired are AAV-based constructs for the delivery of heterologous molecules.

Novel AAVhu68 capsid and rep sequences are described, which are useful for the production of vectors for delivering nucleic acid molecules to host cells. In certain embodiments, at least 75%, at least 80%, at least 85%, at least 90% of SEQ ID NO: 1, at least 70% identical to SEQ ID NO: 1 encoding the nucleic acid sequence of SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 2 A recombinant AAV is provided having an AAVhu68 capsid encoded by at least 95%, at least 97%, or at least 99% identical nucleic acid sequences.

In one embodiment, a recombinant adeno-associated virus (rAAV) is provided comprising: (A) an AAV68 capsid comprising one or more of the following: (1) the predicted amino acid sequence of SEQ ID NOs: 1-736 From a nucleic acid sequence that is at least 70% identical to AAVhu68 vp1 protein produced by expression from a nucleic acid sequence encoding, vp1 protein produced from SEQ ID NO: 1 or SEQ ID NO: 1 encoding the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2 Produced vp1 protein; An AAVhu68 vp2 protein produced by expression from a nucleic acid sequence encoding a predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, a vp2 protein produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 1 or A vp2 protein produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 1 encoding the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, at least about amino acids 203 to 736 of SEQ ID NO: At least about amino acids 203 to 736 of AAVhu68 vp3, a vp3 protein produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 1 or produced by expression from a nucleic acid sequence encoding a predicted amino acid sequence of Book encoding the predicted amino acid sequence AAV containing the vp3 protein produced from at least 607 nucleotides to at least 70% identical with the nucleic acid sequence of No. 1 2211 hu68; And / or (2) a heterogeneous population of vp1 protein optionally containing valine at position 157 and / or glutamic acid at position 67, a heterogeneous population of vp2 protein optionally comprising valine at position 157, and a vp3 protein AAV capsid proteins comprising a heterogeneous population, wherein at least the vp1 protein and a subpopulation of vp2 proteins comprise valine at position 157 based on the numbering of the vp1 capsid of SEQ ID NO: 2 and optionally further add glutamic acid at position 67 Inclusive); And / or (3) a heterogeneous population of vp1 proteins that is a product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a vp2 protein that is a product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2 The heterologous population of the vp3 protein, which is a product of the heterologous population and the nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 2, wherein the vp1 protein, vp2 protein and vp3 protein are at least two highly desorbed within the asparagine-glycine pair in SEQ ID NO: 2 A subpopulation containing an amino acid modification comprising amided asparagine (N), and optionally further comprising a subgroup comprising other deamidated amino acids, wherein deamidation is accompanied by amino acid changes. Resulting); And (B) a vector genome in an AAVhu68 capsid, the vector genome comprising a non-AAV nucleic acid sequence encoding a product operably linked to an AAV inverted terminal repeat sequence and a sequence directing expression of the product in a host cell. Said vector genome comprising a molecule. For example, four residues (N57, N329, N452, N512) routinely exhibit high levels of deamidation. Additional residues (N94, N253, N270, N304, N409, N477, and Q599) also exhibit up to about 20% deamidation level over various lots.

In certain embodiments, the deamidated asparagine is deamidated with aspartic acid, isaspartic acid, interconverted aspartic acid / isoaspartic acid pairs, or combinations thereof. In certain embodiments, the deamidated glutamine (s) are deamidated with (α) -glutamic acid, γ-glutamic acid, interconverting (α) -glutamic acid / γ-glutamic acid pairs, or combinations thereof.

In certain embodiments, the AAVhu68 capsid comprises a subpopulation having one or more of the following: (a) Asparagine (N) in an asparagine-glycine pair located at position 57 of the vp1 protein, based on the numbering of SEQ ID NO: 2 At least 65% of are deamidated; (b) at least 75% of N in the asparagine-glycine pair at position 329 of the vp1, v2 and vp3 proteins is deamidated based on the residue numbering of the amino acid sequence of SEQ ID NO: 2; (c) at least 50% of N in the asparagine-glycine pair at position 452 of the vp1, v2 and vp3 proteins is deamidated based on the residue numbering of the amino acid sequence of SEQ ID NO: 2; And / or (d) at least 75% of N in the asparagine-glycine pair at position 512 of the vp1, v2 and vp3 proteins based on residue numbering of the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the hu68 capsid comprises a subpopulation of vp1 wherein 75% to 100% of N at position 57 of the vp1 protein is deamidated, as determined using mass spectrometry. In certain embodiments the hu68 capsid is a vp1 protein, vp2 protein, and / or vp3 at 75% to 100% of N at position 329 deamidated, based on the numbering of SEQ ID NO: 2, as determined using mass spectrometry Include a subset of proteins. In certain embodiments the hu68 capsid is a vp1 protein, vp2 protein and / or vp3 de 75% to 100% of N at position 452, based on the numbering of SEQ ID NO: 2, as determined using mass spectrometry Include a subset of proteins. In certain embodiments, the hu68 capsid comprises a subpopulation of vp1 protein, vp2 protein, and / or vp3 protein at 75% to 100% of N at position 512 based on the numbering of SEQ ID NO: 2 . In certain embodiments, the nucleic acid sequence encoding a protein is SEQ ID NO: 1 or at least 80% to at least 99% identical to SEQ ID NO: 1 encoding the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the sequence is at least 80% to 97% identical to SEQ ID NO: 1. In certain embodiments, the rAAVhu68 capsid has an amino acid modification from SEQ ID NO: 2 comprising at least about 50 to 100% deamidation at at least four positions selected from one or more of N57, 329, 452, 512 and combinations thereof And a subpopulation of at least vp1, vp2 and / or vp3 proteins having In certain embodiments, hu68 capsids are N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, N598, Q599, N628, N651, N663, And a subpopulation of vp1, vp2 and / or vp3 proteins further comprising 1% to about 40% deamidation at position N709, and at least one or more combinations thereof. In certain embodiments, the hu68 capsid is one or more of at least one of acetylated lysine, phosphorylated serine and / or threonine, isomerized aspartic acid, oxidized tryptophan and / or methionine, or amideated amino acids Subpopulations of vp1, vp2 and / or vp3 proteins further comprising one or more modifications selected from the modifications. In certain embodiments, rAAVhu68 comprises about 60 total capsid proteins in a ratio of about 1 vp1 to vp2 of about 1 to 1.5 to vp3 protein of 3 to 10. In certain embodiments, the AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 vp2 to 3 to 9 vp3 protein. In certain embodiments, the vector genome comprises an AAV ITR sequence from an AAV source other than AAVhu68.

In certain embodiments, a composition is provided comprising a mixed population of recombinant adeno-associated virus hu68 (rAAVhu68), wherein each of rAAVhu68 is independently selected from rAAVhu68 as described herein. In certain embodiments, the average AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 to 1.5 vp2 to 3 to 10 vp3 protein. In certain embodiments, the average AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 vp2 to 3 to 6 vp3 protein. In certain embodiments, the composition is formulated for intravertebral delivery, and the vector genome comprises a nucleic acid sequence that encodes a product for delivery to the central nervous system. In certain embodiments, the composition is formulated for intravenous delivery. In certain embodiments, the vector genome comprises a nucleic acid sequence encoding an anti-HER2 antibody. In certain embodiments, the composition is formulated for intranasal or intramuscular delivery. In certain embodiments, the composition comprises at least an rAAVhu68 vector stock and an optional carrier, excipient and / or preservative.

In certain embodiments, the use of rAAVhu68 or a composition as described herein for delivering a desired gene product to a subject in need thereof is provided.

In certain embodiments, rAAV production systems are provided that are useful for producing recombinant AAVhu68. Such production systems include (a) an AAVhu68 capsid nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2; (b) a nucleic acid molecule suitable for packaging in an AAVhu68 capsid, wherein the nucleic acid molecule encodes a gene product operably linked to at least one AAV inverted terminal repeat (ITR) and a sequence directing expression of the product in a host cell. Comprises an AAV nucleic acid sequence; And (c) sufficient AAV rep function and helper function to allow packaging of the nucleic acid molecule within the recombinant AAVhu68 capsid. In certain embodiments, the nucleic acid sequence of (a) comprises a sequence that is at least 70% to at least 99% identical to SEQ ID NO: 1 encoding at least SEQ ID NO: 1, or the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the system optionally further comprises a nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 1 encoding the AAVhu68 vp3 of about aa 203 to about amino acid 736 of SEQ ID NO. In certain embodiments, the system comprises a human embryonic kidney 293 cell or baculovirus system.

In certain embodiments, a method of reducing deamidation of AAVhu68 capsid is provided. The method includes producing an AAVhu68 capsid from a nucleic acid sequence containing a modified AAVhu68 vp codon, the nucleic acid sequence being one of the arginine-glycine pairs located at positions 58, 330, 453 and / or 513 in SEQ ID NO: 2. Modified codons encode amino acids other than glycine, including glycine codons independently modified from one to three. In certain embodiments, the method comprises producing an AAVhu68 capsid from a nucleic acid sequence containing a modified AAVhu68 vp codon, wherein the nucleic acid sequence is located at positions 57, 329, 452 and / or 512 in SEQ ID NO: 2. Modified codons encode amino acids that are not arginine, including arginine codons independently modified in one to three of the arginine-glycine pairs. In certain embodiments, each modified codon encodes a different amino acid. In certain embodiments, two or more modified codons encode the same amino acid. In certain embodiments, the mutant AAVhu68 capsid as described herein contains mutations in arginine-glycine pairs such that glycine is changed to alanine or serine. Mutant AAVhu68 capsid may contain 1, 2 or 3 mutants, where reference AAVhu68 originally contains 4 NG pairs. In certain embodiments, the mutant AAVhu68 capsid contains a single mutation in the NG pair. In certain embodiments, mutant AAV capsids contain mutations in two different NG pairs. In certain embodiments, the mutant AAVhu68 capsids are two different NG pairs located at structurally separated positions in the AAVhu68 capsid. In certain embodiments, the mutation is not in the VP1-specific region. In certain embodiments, one of the mutations is in the VP1-specific region. Optionally, the mutant AAVhu6 capsid contains no modifications within the NG pair but contains mutations to minimize or eliminate deamidation in one or more asparagine or glutamine located above the NG pair.

In certain embodiments, a mutant rAAVhu68 is provided comprising a modified rAAVhu68 capsid with reduced deamidation as compared to the modified AAVhu68 capsid produced using the methods described herein.

In still further embodiments, a method of increasing the yield and / or packaging efficiency of a recombinant adeno-associated (rAAV) vector is provided. The method includes engineering the AAV capsid gene to express vp1 protein Val at amino acid position 157, wherein the numbering of amino acid residues is based on the full length vp1 (SEQ ID NO: 2) of AAVhu68. In certain embodiments, clade F rAAV is provided having glutamic acid (Glu or E) at amino acid position 67 based on the numbering of SEQ ID NO: 2.

In still further embodiments, engineered rAAVs produced in accordance with the present invention are provided.

In further embodiments, AAVhu68 particles are provided that express anti-HER2 antibodies useful for the treatment and / or prevention of HER2 + cancers.

In still further embodiments, a nucleic acid molecule is provided wherein the nucleic acid molecule comprises a nucleic acid sequence encoding an AAVhu68 rep protein or a functional fragment thereof under the control of an exogenous regulatory control sequence directing expression in a host cell. In one embodiment, the rep protein has the amino acid sequence of SEQ ID NO: 4, or a functional fragment thereof.

These and other aspects of the invention will be apparent from the following detailed description of the invention.

FIG. 1 shows AAVhu68 (SEQ ID NO: 6), AAVhu31 (labeled hu.31 in alignment) [SEQ ID NO 10] and AAVhu32 (labeled hu.32 in alignment) [SEQ ID NO: 11] FIG. 16 provides an alignment showing the amino acid sequence of the vp1 capsid protein of (labeled hu.68.vp1 in the alignment). Compared with AAV9, AAVhu31 and AAVhu32, two mutations (A67E and A157V) were found to be important in AAVhu68 and are shown as circles in the figure.
2A-2C provide alignment of nucleic acid sequences encoding the vp1 capsid protein of AAVhu68 with AAV9, AAVhu31 [SEQ ID NO: 12] and AAVhu32 [SEQ ID NO: 13].
3A and 3B are graphs showing the yield of AAVhu.68 compared to the yield of AAV9. The experiment was performed as described in Example 2. n = 6. P values were calculated and shown in the figures.
3A shows the yield of AAVhu.68 and AAV9 from total lysate. The P value was calculated to be 0.4173 and determined to be insignificant.
3B shows the yield of AAVhu.68 and AAV9 from culture supernatants. The yield of AAVhu.68 in the supernatant was significantly higher than that of AAV9, with a p value of 0.0003.
4A-4C provide immunohistochemical staining of various organs (heart, liver, lung and muscle) from mice administered AAVhu68.CB7.nLacZ at 5 × 10 ¹¹ GC. Samples were prepared and treated as described in Example 3. Samples were counterstained with eosin appearing in red. Positive staining for LacZ, which appears in blue, indicates successful transduction of AAVhu68.
4A provides immunohistochemical staining of various organs (heart, liver, lung and muscle) from mice administered AAVhu68.CB7.nLacZ at 5 × 10 ¹¹ GC intravenously (IV). All tested organs showed AAVhu68 transduction, but a preference for heart and liver over lung and muscle was observed.
4B provides immunohistochemical staining of various organs (heart, liver, lung and muscle) from mice administered AAVhu68.CB7.nLacZ at 5 × 10 ¹¹ GC intramuscularly (IM). Heart, liver and muscle showed a high transduction rate of AAVhu68, but no transduction was observed in the lung.
4C provides immunohistochemical staining of various organs (heart, liver, lung and muscle) from mice administered AAVhu68.CB7.nLacZ at 5 × 10 ¹¹ GC intranasally (IN). Interspersed transduction was observed in the heart, liver, muscles and lungs.
5A-5C show various brain regions from the mice administered AAVhu68.GFP or AAV9.GFP at a dose of 1 × 10 ¹⁰ GC or 1 × 10 ¹¹ GC (horse hippocampus, FIG. 5A; motor cortex, FIG. 5B; and cerebellum). , FIG. 5C) provides a fluorescence microscope image. Samples were prepared and treated as described in Example 4. Positive signals from GFP, shown in green, indicate successful transduction of the AAV vector.
5A is a fluorescence microscope image of hippocampus slides from mice administered AAVhu68.GFP or AAV9.GFP at a dose of 1 × 10 ¹⁰ GC or 1 × 10 ¹¹ GC. Corresponding samples from untreated mice stained with nucleic acid dyes appearing in blue served as negative controls. Transduction of AAV vectors was observed in all tested samples except from mice injected with 1 × 10 ¹⁰ GC of AAV9.GFP.
5B is a fluorescence microscopic image of the motor cortex from mice administered AAVhu68.GFP or AAV9.GFP at a dose of 1 × 10 ¹⁰ GC or 1 × 10 ¹¹ GC. Better transduction of AAVhu68.GFP was observed in the motor cortex compared to that of AAV9.
5C is a fluorescence microscopic image of the cerebellum from mice administered AAVhu68.GFP or AAV9.GFP at a dose of 1 × 10 ¹⁰ GC or 1 × 10 ¹¹ GC. Successful transduction of AAVhu68.GFP was observed when mice were injected with 1 × 10 ¹¹ GC of vector.
6A-6D are microscopic images of various organs (liver, kidney, heart and pancreas) from mice administered AAVhu68.GFP intravenously. Samples were prepared and treated as described in Example 4. Positive signals from GFP, shown in green, indicate successful transduction of the AAV vector. Clear organ phases appearing in black and white were provided for organ morphology, but corresponding red fluorescent channels were provided as negative controls where possible.
6A is a microscopic image of representative liver flakes from a mouse administered AAVhu68.GFP intravenously. A positive signal in green was observed.
6B shows microscopic images of representative kidney slices from mice administered AAVhu68.GFP intravenously. A positive signal in green was observed.
6C shows microscopic images of representative heart slices from mice administered AAVhu68.GFP intravenously. A positive signal in green was observed.
6D shows microscopic images of representative pancreatic flakes from mice administered AAVhu68.GFP intravenously. A positive signal in green was observed.
FIG. 7 is a diagram of a device for intraracisternal delivery, including an optional introducer needle for a coaxial insertion method (this is a 10cc vector syringe, a 10cc prefilled flush syringe, a T-connector extension set, 22Gx5 " Spinal needle, including optional 18Gx3.5 "introducer needle).
8A and 8B show the production yields for two different AAVhu68 vectors made at small scale (FIG. 8A) and very large scale (Mega, FIG. 8B), compared to vectors with different capsids. Small using a vector having a AAVhu68, AAV9, AAV8 or AAV8 triple capsid and having a vector genome (CMV.ff luciferase.SV40) comprising a cytomegalovirus promoter (CMV), a firefly luciferase coding sequence and an SV40 poly A Data for scale vector preparation was generated. Mega scale preparation was evaluated using AAVhu68, AAV9, AAV8 or AAV8 triple vectors with a vector genome with CMV promoter, intron, immunoadhesin coding sequence (201 Ig IA) and SV40 poly A.
FIG. 9 provides production purity for AAVhu68 vectors prepared on a mega scale compared to vectors with different capsids, including AAV8 triples, AAV9 and AAV8. Formulations were evaluated using AAVhu68, AAV9, AAV8 or AAV8 triple vectors comprising a vector genome with CMV promoter, intron, immunoadhesive coding sequence (201 Ig IA) and SV40 poly A.
10A and 10B show 3 × 10 ¹¹ GC / mouse (FIG. 10A) or 3 × 10 ¹⁰ GC / mouse (FIG. 10B) compared to transgene expression levels of vectors with different capsids including AAV8 triples, AAV9 and AAV8. A diagram of transgene expression levels of the AAVhu68 vector in male RAG KO mice (n = 5 / group) injected with intramuscularly). The transgene expressed by the rAAV vector is an immunoadhesive coding sequence (201 Ig IA). The experiment was performed as described in detail in Example 8.
11A and 11B show male C57BL / 6J mice injected intramuscularly at 3 × 10 ¹¹ GC / mouse (n = 5 /, compared to transgene expression levels of vectors with different capsids including AAV8 triples, AAV9 and AAV8). FIG. 11 provides transgene expression levels of AAVhu68 vectors in liver (FIG. 11A) or muscle (FIG. 11B) of the group. The transgene expressed by the rAAV vector is Firefly Luciferase. The experiment was performed as described in detail in Example 9.
FIG. 12 shows AAVhu68 in male and female cynomolgus macaques injected intramuscularly with 1 × 10 ¹³ GC / kg body weight vector compared to transgene expression levels of vectors with different capsids including AAV8 triple, AAV9 and AAV8. A diagram providing the level of transgene expression of the vector. The transgene expressed by the rAAV vector is an immunoadhesive coding sequence (201 Ig IA). The experiment was performed as detailed in Example 10.

Provided herein is a nucleic acid sequence and amino acid of a novel isolated adeno-associated virus (AAV), referred to herein as AAVhu68, which is included in Clade F. AAVhu68 (previously referred to herein as AAV3G2) differs from another Clade F virus AAV9 (SEQ ID NO: 5) in which the two encoded amino acids at positions vp1, 67 and 157 of SEQ ID NO: 2. In contrast, the other clade F AAVs (AAV9, hu31, hu31) have Ala at position 67 and Ala at position 157. Novel AAVhu68 capsids and / or engineered AAV capsids having valine (Val or V) at position 157 and optionally glutamic acid (Glu or E) at position 67 based on the numbering of SEQ ID NO: 2 are provided. In certain embodiments, the ratio of vp3 protein in AAVhu68 capsid to vp1 protein and vp2 protein is lower than previously described for the capsid of AAV9 and other clade F AAV. In certain embodiments, the AAVhu68 capsid is comprised of AAVhu68 vp1 protein, AAVhu68 vp2 protein, and AAVhu68 vp3 protein in a ratio of vp3: vp1: 1 to about 1.5 vp2: 3 to about 10. In certain embodiments, the rAAVhu68 virus stock or population of rAAVhu68 comprises an average total of about 60 vp1, vp2, and vp3 proteins in the AAVhu68 capsid, present in an average vp1: vp2: vp3 ratio of about 1: about 1: about 3 to 6 Having a composition. The AAV capsids described herein are useful for generating recombinant AAV (rAAV) vectors that provide good yield and / or packaging efficiency, and for providing rAAV vectors useful for transducing many different cell and tissue types. These cell and tissue types include lung, heart, muscle, liver, pancreas, kidney, brain, hippocampus, motor cortex, cerebellum, nasal epithelial cells, cardiac muscle cells or cardiomyocytes, hepatocytes, lung endothelial cells, myocytes, lungs. Epithelial cells, islet cells, lobe cells, kidney cells, and motor neurons may be included, but are not limited to these.

"Recombinant AAV" or "rAAV" is a DNAse-resistant virus particle containing a vector genome containing two elements, an AAV capsid and at least a non-AAV coding sequence packaged within an AAV capsid. Unless otherwise specified, these terms may be used interchangeably with the phrase “rAAV vector”. rAAV is a "replicating-defective virus" or "viral vector" because it lacks any functional AAV rep gene or functional AAV cap gene and cannot produce progeny. In certain embodiments, the only AAV sequence is an AAV inverted terminal repeat, typically located at the extreme 5 'and 3' ends of the vector genome to enable the gene and regulatory sequences located between the ITRs to be packaged within the AAV capsid. Subsequence (ITR).

As used herein, "vector genome" refers to a nucleic acid sequence packaged inside an rAAV capsid that forms viral particles. This nucleic acid sequence contains an AAV inverted terminal repeat sequence (ITR). In the examples herein, the vector genome contains at least 5 'to 3', AAV 5 'ITR, coding sequence (s), and AAV 3' ITR. ITRs from AAV2, a source AAV different from the capsid, or a full length ITR, may be selected. In certain embodiments, the ITR is derived from the same AAV source as the AAV or transcomplementing AAV that provides rep function during production. In addition, other ITRs may be used. In addition, the vector genome contains regulatory sequences that direct expression of the gene product. Suitable components of the vector genome are discussed in more detail herein.

rAAVhu68 consists of the AAVhu68 capsid and vector genome. The AAVhu68 capsid is an assembly of a heterogeneous population of vp1, a heterogeneous population of vp2, and a heterogeneous population of vp3 protein. When used to refer to a vp capsid protein as used herein, the term “heterologous” or any grammatical modification thereof refers to, for example, a vp1, vp2 or vp3 monomer (protein) having a different modified amino acid sequence. Refers to a group of unequal elements. SEQ ID NO: 2 provides the encoded amino acid sequence of the AAVhu68 vp1 protein.

The AAVhu68 capsid contains subpopulations in vp1 protein, vp2 protein and vp3 protein with modifications from the amino acid residues predicted in SEQ ID NO: 2. This subgroup contains, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations include at least one, two, three, or four highly deamidated asparagine (N) positions within the asparagine-glycine pair in SEQ ID NO: 2 and optionally other deamidated Further comprising amino acids, wherein deamidation results in amino acid changes and other selective modifications. SEQ ID NO: 14 provides the amino acid sequence of the modified AAVhu68 capsid, which describes the positions that may have some percentage of deamidated or otherwise modified amino acids. Various combinations of these and other variations are described herein.

As used herein, a “subpopulation” of a vp protein, unless otherwise specified, has in common at least one defined feature and has at least one group member to fewer than all members of the reference group It refers to a group of vp protein consisting of. For example, a “subpopulation” of vp1 protein is at least one (1) vp1 protein, unless otherwise specified, and less than all vp1 proteins in the assembled AAV capsid. The "subpopulation" of vp3 protein may be less than one (1) vp3 protein to all vp3 proteins in the assembled AAV capsid, unless otherwise specified. For example, the vp1 protein can be a subpopulation of the vp protein; The vp2 protein may be a separate subpopulation of the vp protein, and vp3 is a further subset of the vp protein in the assembled AAV capsid. In another example, the vp1 protein, vp2 protein, and vp3 protein can be used in combination with different modifications, eg, at least one, two, three, or four highly deamidated asparagine, for example in asparagine-glycine pairs. It may contain a subgroup having.

Unless otherwise specified, highly deamidated silver is at least 45% deamidated, at least 50% deamidated, at least 60% as compared to the predicted amino acid sequence at the reference amino acid position. Of deamidated, at least 65% of deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 97%, 99%, up to about 100% Deamidated (e.g., at least 80% of asparagine at amino acid 57 of SEQ ID NO: 2 may be deamidated based on total vp1 protein or 20% of asparagine at amino acid 409 of SEQ ID NO: 2 Deamidated based on total vp1 protein, vp2 protein and vp3 protein). Such percentages can be determined using 2D-gel, mass spectrometry techniques, or other suitable technique.

Without wishing to be bound by theory, deamidation of at least highly deamidated residues in the vp protein in the AAVhu68 capsid is believed to be primarily non-enzymatic in nature, which means that the selected asparagine, to a lesser extent, deamidates glutamine residues. It is caused by functional groups in the capsid proteins to be purified. Efficient capsid assembly of most deamidated vp1 proteins suggests that this event occurs after capsid assembly or that deamidation in individual monomers (vp1, vp2 or vp3) is structurally well tolerated and greatly affects assembly kinetics. Indicates no madness. In general, large-scale deamidation in the VP1-specific (VP1-u) region (about aa 1 to 137), which is considered to be located internally prior to cell influx, may result in VP deamidation occurring prior to capsid assembly. Imply that there is.

Without wishing to be bound by theory, deamidation of N may occur by the backbone nitrogen atom of its C-terminal residue performing a nucleophilic attack on the Asn side chain amide group carbon atom. It is believed that intermediate ring-closed succinimide residues are formed. Succinimide residues are then subjected to rapid hydrolysis to yield the final product Aspartic Acid (Asp) or IsoAspartic Acid (IsoAsp). Thus, in certain embodiments, deamidation of asparagine (N or Asn) produces Asp or IsoAsp, which can be interconverted through, for example, succinimide intermediates, as described below.

As provided herein, each deamidated N of SEQ ID NO: 2 is independently an aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate and / or an interconversion blend of Asp and isoAsp or these It can be a combination of. Any suitable ratio of α- and isaspartic acid may be present. For example, in certain embodiments, the ratio is aspartic acid to isoaspartic acid of 10: 1 to 1:10, aspartic acid to isoaspartic acid of about 50:50, or aspartic acid of about 1: 3 Acid to isoaspartic acid, or another selected ratio.

In certain embodiments, one or more glutamines (Q) in SEQ ID NO: 2 are deamidated with glutamic acid (Glu), that is, α-glutamic acid, γ-glutamic acid (Glu), or a blend of α-glutamic acid and γ-glutamic acid, It can be interconverted through the usual glutarimide intermediates. Any suitable ratio of α-glutamic acid and γ-glutamic acid may be present. For example, in certain embodiments, the ratio may be α to γ from 10: 1 to 1:10, α: γ from about 50:50, or α: γ from about 1: 3, or another selected ratio.

Thus, rAAVhu68 comprises a subgroup within the rAAVhu68 capsid of vp1, vp2 and / or vp3 proteins with deamidated amino acids, including at least one subgroup comprising at least one highly deamidated asparagine do. Other modifications may also include isomerization, particularly at selected aspartic acid (D or Asp) residue positions. In yet other embodiments, the modification may comprise amidation at the Asp position.

In certain embodiments, the AAVhu68 capsid contains a subpopulation of vp1, vp2, and vp3 having at least 4 to at least about 25 deamidated amino acid residue positions, and at least one thereof compared to the encoded amino acid sequence of SEQ ID NO: 2 To 10% deamidated. Most of these may be N residues. However, Q residues can also be deamidated.

In certain embodiments, the AAV68 capsid is further characterized by one or more of the following. AAV hu68 capsid proteins include: AAVhu68 vp1 protein, vp1 protein produced from SEQ ID NO: 1 or SEQ ID NO: 2, produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of SEQ ID NO: 1 to 736 of SEQ ID NO: 2 A vp1 protein produced from a nucleic acid sequence that is at least 70% identical to SEQ ID NO: 1 encoding the predicted amino acid sequence of 1 to 736; An AAVhu68 vp2 protein produced by expression from a nucleic acid sequence encoding a predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, a vp2 protein produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 1 or A vp2 protein produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 1 encoding the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, at least about amino acids 203 to 736 of SEQ ID NO: At least about amino acids 203 to 736 of AAVhu68 vp3, a vp3 protein produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 1 or produced by expression from a nucleic acid sequence encoding a predicted amino acid sequence of Book encoding the predicted amino acid sequence The vp3 protein produced from the nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of the number 1.

Additionally or alternatively, a heterogeneous population of vp1 protein, optionally comprising valine at position 157, optionally a heterogeneous population of vp2 protein, including a valine at position 157, and an AAV capsid comprising a heterogeneous population of vp3 protein, Wherein at least the subpopulations of vp1 protein and vp2 protein comprise valine at position 157 based on the numbering of the vp1 capsid of SEQ ID NO: 2, and optionally further comprise glutamic acid at position 67. Additionally or alternatively, the heterologous population of vp1 proteins, the product of the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, the vp2 protein, the product of the nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2 AAVhu68 capsids are provided comprising a heterologous population of and a heterologous population of vp3 proteins, the product of a nucleic acid sequence encoding at least amino acids 203-736 of SEQ ID NO: 2, wherein the vp1 protein, vp2 protein, and vp3 protein are subtypes having amino acid modifications. Contains a population

The AAVhu68 vp1 protein, vp2 protein and vp3 protein are typically expressed as alternative splice variants encoded by the same nucleic acid sequence encoding the full length vp1 amino acid sequence (amino acids 1 to 736) of SEQ ID NO: 2. Optionally, the vp1-coding sequence is used alone to express vp1 protein, vp2 protein and vp3 protein. Alternatively, this sequence may comprise the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 2, lacking a vp1-specific region (about aa 1 to about aa 137) and / or a vp2-specific region (about aa 1 to about aa 202) (about aa 203). To 736), or a complementary strand, corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO: 1), or at least 70% to at least with SEQ ID NO: 1 encoding aa 203 to 736 of SEQ ID NO: 2 99% (eg, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) can be co-expressed with one or more of the nucleic acid sequences encoding the same sequence. Additionally, or in the alternative, the vp1-coding and / or vp2-coding sequences may comprise the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 2, lacking the vp1-specific region (about aa 1 to about 137), or about aa 138-736, or Strands complementary thereto, corresponding mRNAs or tRNAs (nt 412 to nt 22121 of SEQ ID NO: 1), or at least 70% to at least 99% (eg, SEQ ID NO: 1 encoding aa 138 to 736 of SEQ ID NO: 2) At least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) with the nucleic acid sequence encoding the same sequence.

As described herein, rAAVhu68 is derived from an AAVhu68 nucleic acid encoding the vp1 amino acid sequence of SEQ ID NO: 2, and optionally from a further nucleic acid sequence encoding, for example, a vp 3 protein without the vp1 and / or vp2-specific regions. RAAVhu68 capsid produced in a production system that expresses a capsid. RAAVhu68, derived from the preparation using the single nucleic acid sequence vp1, produces a heterogeneous population of vp1 protein, vp2 protein and vp3 protein. More particularly, the AAVhu68 capsid contains subpopulations in vp1 protein, vp2 protein and vp3 protein with modifications from the amino acid residues predicted in SEQ ID NO: 2. This subgroup contains, at a minimum, deamidated asparagine (N or Asn) residues. For example, asparagine in asparagine-glycine pairs is highly deamidated.

In one embodiment, the AAVhu68 vp1 nucleic acid sequence has the sequence of SEQ ID NO: 1, or a strand complementary thereto, eg, the corresponding mRNA or tRNA. In certain embodiments, vp2 and / or vp3 proteins may additionally or alternatively be expressed from nucleic acid sequences different from vp1, eg, to alter the ratio of vp proteins in a selected expression system. In certain embodiments, the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 2 without the vp1-specific region (about aa 1 to about aa 137) and / or vp2-specific region (about aa 1 to about aa 202) (about aa 203 to 736) ), Or a strand complementary thereto, corresponding mRNA or tRNA (from about nt 607 to about nt 2211 of SEQ ID NO: 1) is also provided. In certain embodiments, the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 2, lacking the vp1-specific region (about aa 1 to about 137), or strand complementary thereto, corresponding mRNA or tRNA (SEQ ID NO: 1) Also provided are nucleic acid sequences encoding nt 412 to 2211).

However, other nucleic acid sequences encoding the amino acid sequence of SEQ ID NO: 2 can be selected for use in preparing the rAAVhu68 capsid. In certain embodiments, the nucleic acid sequence is at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 1 encoding SEQ ID NO: 2 95%, at least 97%, at least 99% identical sequences. In certain embodiments, the nucleic acid sequence is from about nt 412 to about nt 2211 of SEQ ID NO: 1 encoding the nucleic acid sequence of SEQ ID NO: 1 or the vp2 capsid protein of SEQ ID NO: 2 (about aa 138 to 736) and at least 70% to 99. %, At least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical sequences. In certain embodiments, the nucleic acid sequence comprises at least 70% to 99 of SEQ ID NO: 1 encoding the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 1 or the vp3 capsid protein of SEQ ID NO: 2 (about aa 203 to 736). %, At least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical sequences.

Designing nucleic acid sequences encoding such AAVhu68 capsids, including DNA (genome or cDNA), or RNA (eg, mRNA), is within the skill of the art. In certain embodiments, nucleic acid sequences encoding AAVhu68 vp1 capsid proteins are provided in SEQ ID NO: 1 (see also FIGS. 1B-1D). In other embodiments, nucleic acid sequences of 70% to 99.9% identity with SEQ ID NO: 1 can be selected to express the AAVhu68 capsid protein. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9 % same. Such nucleic acid sequences can be codon-optimized for expression in selected systems (ie, cell types) that can be designed by a variety of methods. Such optimization is performed using available online (eg, GeneArt) methods, published methods, or companies providing codon optimization services, such as DNA2.0 (Menlo Park, CA, USA). Can be. One codon optimization method is described, for example, in WO 2015/012924, which is incorporated by reference in its entirety (see, eg, US Patent Publication No. 2014/0032186 and US Patents, for example). See publication 2006/0136184). Suitably, the overall length of the open reading frame ORF for this product is modified. However, in some embodiments, fragments of the ORF may be altered. By using one of these methods, frequencies can be applied to any given polypeptide sequence, and nucleic acid fragments of codon-optimized coding regions encoding the polypeptide can be produced. Multiple choices are available to effect actual changes to the codons or to synthesize codon-optimized cryptographic domains as described herein. Such modifications or synthesis can be carried out using standard and routine molecular biology manipulations well known to those skilled in the art. In one approach, spanning a series of complementary oligonucleotide pairs of 80 to 90 nucleotides each and the length of the desired sequence is synthesized by standard methods. Such oligonucleotide pairs are synthesized so that, when annealed, they form double-stranded fragments of 80 to 90 base pairs containing cohesive ends, e.g., each oligonucleotide in the pair is a different oligo in the pair. Synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10 or more bases beyond the region complementary to the nucleotide. The single stranded end of each pair of oligonucleotides is designed to anneal with the single stranded end of another pair of oligonucleotides. Oligonucleotide pairs are allowed to be annealed, then approximately 5 to 6 of these double stranded fragments are allowed to anneal together through cohesive single stranded ends, which are then ligated together and are standard bacterial cloning vectors, eg, It is cloned into a TOPO® vector available from Invitrogen Corporation (Carlsbad, Calif.). The construct is then sequenced by standard methods. Several of these constructs, consisting of 5-6 fragments of 80-90 base pair fragments ie fragments of about 500 base pairs ligated together, are prepared so that the entire desired sequence is represented in a series of plasmid constructs. . The insert of this plasmid is then cleaved with appropriate restriction enzymes and ligated together to form the final construct. The final construct is then cloned and sequenced in standard bacterial cloning vectors. Additional methods will be readily apparent to those skilled in the art. Gene synthesis methods are also readily available commercially.

In certain embodiments, the asparagine (N) in the N-G pair in AAVhu68 vp1 protein, vp2 protein, and vp3 protein is highly deamidated. In certain embodiments, the AAVhu68 capsid contains a subpopulation of AAV vp1, vp2 and / or vp3 capsid proteins having at least four asparagine (N) positions within the highly deamidated AAVhu68 capsid protein. In certain embodiments, about 20-50% of the N-N pairs (except N-N-N triples) exhibit deamidation. In certain embodiments, the first N is deamidated. In certain embodiments, the second N is deamidated. In certain embodiments, the deamidation is about 15% to about 25% deamidation. Deamidation at Q at position 259 of SEQ ID NO: 2 is about 8% to about 42% of the AAVhu68 vp1, vp2 and vp3 capsid proteins of the AAVhu68 protein.

In certain embodiments, the rAAVhu68 capsid is further characterized by the amidation of vp1 protein, vp2 protein, and vp3 protein at D297. In certain embodiments, based on the numbering of SEQ ID NO: 2, from about 70% to about 75% of D at position 297 of the vp1, vp2, and / or vp3 proteins in the AAVhu68 capsid is amidated.

In certain embodiments, at least one Asp in vp1, vp2 and / or vp3 of the capsid isomerizes to D-Asp. Such isomers are generally present in an amount of less than about 1% of Asp at one or more of residue positions 97, 107, 384, based on the numbering of SEQ ID NO: 2.

In certain embodiments, rAAVhu68 is a vp1 protein, a vp2 protein, and a subpopulation comprising a combination of 1, 2, 3, 4 or more deamidated residues at the positions mentioned in the table below has an AAVhu68 capsid with vp3 protein. Deamidation in rAAV can be determined using 2D gel electrophoresis, and / or mass spectrometry, and / or protein modeling techniques. Online chromatography can be performed using a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF (Thermo Fisher Scientific) with an Acclaim PepMap column and NanoFlex source. . MS data is obtained using a data dependent Top-20 method for Q Exactive HF, which dynamically selects the most abundant not-yet-sequenced precursor ions from irradiation scans (200-2000 m / z). . Sequencing was performed through high energy impact fission fragmentation using target values of 1e5 ions determined with predicted automatic gain control, and isolation of precursors was performed with a window of 4 m / z. The irradiation scan was obtained with a resolution of 120,000 at m / z 200. The resolution for the HCD spectrum can be set to 30,000 at m / z200 using a maximum ion implantation of 50 ms and a normalized collision energy of 30. S-lens RF levels can be set at 50 to provide optimal delivery of the m / z region occupied by the peptide from digestion. Precursor ions can be excluded from the fragmentation selection in a single, unassigned, or 6 and higher charge state. BioPharma Finder 1.0 software (Thermo Fisher Scientific) can be used for analysis of the acquired data. For peptide mapping, carbamididomethylation set as fixed modification; And search using a short-term protein FASTA database with oxidation, deamidation, and phosphorylation, 10-ppm mass accuracy, high protease specificity, and a confidence level of 0.8 for MS / MS spectra set as variable modifications. . Examples of suitable proteases can include, for example, trypsin or chymotrypsin. Mass spectrometric identification of deamidated peptides is relatively simple because deamidation adds to the mass of the intact molecule + 0.984Da (mass difference between -OH and -NH ₂ groups). Percentage deamidation of a specific peptide is determined by dividing the mass area of the deamidated peptide by the sum of the areas of the deamidated peptide and the native peptide. In view of the number of possible deamidation sites, deamidated isobaric species at different sites can move simultaneously in a single peak. In conclusion, fragment ions derived from peptides having multiple potential deamidation sites can be used to locate or distinguish multiple sites of deamidation. In such cases, the relative intensities in the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and is dependent on the deamidation site. It will be understood by those skilled in the art that many variations on this exemplary method may be used. For example, a suitable mass spectrometer, for example, Quadrupole time of flight mass spectrometers (QTOF), such as Waters Xevo or Agilent 6530 or orbitrap instruments, such as Orbitrap Fusion or Orbitrap Velos (Thermo Fisher) It may include. Suitably liquid chromatography systems include, for example, Acquity UPLC systems (1100 or 1200 series) from Waters or Agilent systems. Suitable data analysis software includes, for example, MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fisher Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics). Solutions)). Further other techniques are described, for example, in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255-267, published online June 16, 2017.

In certain embodiments, the AAVhu68 capsid has a capsid protein at least 45% of the N residues deamidated at at least one of positions N57, N329, N452, and / or N512 based on the numbering of the amino acid sequence of SEQ ID NO: 2 It is characterized by. In certain embodiments, at least about 60%, at least about 70% of N residues at one or more of these NG positions (ie, N57, N329, N452, and / or N512 based on the numbering of the amino acid sequences of SEQ ID NO: 2) , At least about 80%, or at least 90% is deamidated. In these or other embodiments, the AAVhu68 capsid may further comprise N94, N253, N270, N304, N409, N477, and / or about 1% to about 20% of the N residues based on the numbering of the amino acid sequences of SEQ ID NO: 2. And a population of proteins having deamidation at one or more of positions Q599. In certain embodiments, AAVhu68 is N35, N57, N66, N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N329, based on at least numbering of amino acid sequences of SEQ ID NO: 2 Of a vp1, vp2 and / or vp3 protein deimidized at one or more of positions N336, N409, N410, N452, N477, N515, N598, Q599, N628, N651, N663, N709, N735, or a combination thereof Include subgroups. In certain embodiments, the capsid protein may have one or more amided amino acids.

Further other modifications are observed, most of which do not convert one amino acid to a different amino acid group. Optionally, at least one Lys in vp1, vp2 and vp3 of the capsid is acetylated. Optionally, at least one Asp in vp1, vp2 and / or vp3 of the capsid isomerizes to D-Asp. Optionally, at least one S (Ser, Serine) in vp1, vp2 and / or vp3 of the capsid is phosphorylated. Optionally, at least one T (Thr, threonine) in vp1, vp2 and / or vp3 of the capsid is phosphorylated. Optionally, at least one W (trp, tryptophan) at vp1, vp2 and / or vp3 of the capsid is oxidized. Optionally, at least one M (Met, methionine) in vp1, vp2 and / or vp3 of the capsid is oxidized. In certain embodiments, the capsid proteins have one or more phosphorylation. For example, certain vp1 capsid proteins can be phosphorylated at position 149.

In certain embodiments, the AAVhu68 capsid is a heterogeneous population of vp1 proteins, the product of the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, wherein the vp1 protein is glutamic acid (Glu) at position 67 and / or valine at position 157 (Val). )); A heterogeneous population of vp2 proteins, optionally including valine at position 157; And a heterogeneous population of vp3 proteins. The AAVhu68 capsid contains at least one subgroup, wherein at least 65% of asparagine (N) and vp1 in the asparagine-glycine pair located at position 57 of the vp1 protein, based on the residue numbering of the amino acid sequence of SEQ ID NO: 2 At least 70% of the asparagine (N) in the asparagine-glycine pair at positions 329, 452 and / or 512 of the v2 and vp3 proteins are deamidated, where deamidation results in amino acid changes.

As discussed in more detail herein, deamidated asparagine may be deamidated as aspartic acid, isoaspartic acid, interconverted aspartic acid / isoaspartic acid pairs, or combinations thereof. . In certain embodiments, rAAVhu68 is further characterized by one of the following: (a) each vp2 protein is independently a product of a nucleic acid sequence encoding at least the vp2 protein of SEQ ID NO: 2; (b) each vp3 protein is independently a product of a nucleic acid sequence encoding at least the vp3 protein of SEQ ID NO: 2; (c) the nucleic acid sequence encoding the vp1 protein is at least 70% to at least 99% (eg, at least 85%, at least 90%, at least) and SEQ ID NO: 1 encoding SEQ ID NO: 1 or SEQ ID NO: 2 95%, at least 97%, at least 98% or at least 99%) identical sequences. Optionally, the sequence is used alone to express vp1 protein, vp2 protein and vp3 protein. Alternatively, this sequence may comprise the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 2, lacking a vp1-specific region (about aa 1 to about aa 137) and / or a vp2-specific region (about aa 1 to about aa 202) (about aa 203). To 736), or a complementary strand, corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO: 1), or at least 70% to at least with SEQ ID NO: 1 encoding aa 203 to 736 of SEQ ID NO: 2 99% (eg, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) can be co-expressed with one or more of the nucleic acid sequences encoding the same sequence. Additionally, or in the alternative, the vp1-coding and / or vp2-coding sequences may comprise the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 2, lacking the vp1-specific region (about aa 1 to about 137), or about aa 138-736, or Strands complementary thereto, corresponding mRNAs or tRNAs (nt 412 to nt 2211 of SEQ ID NO: 1), or at least 70% to at least 99% (eg, SEQ ID NO: 1 encoding aa 138 to 736 of SEQ ID NO: 2) At least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) with the nucleic acid sequence encoding the same sequence.

Additionally or alternatively, rAAVhu68 is based on at least numbering of SEQ ID NO: 2, N57, N66, N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N329, N336, N409 A subset of vp1, vp2 and / or vp3 proteins deimidized at one or more of positions N410, N452, N477, N512, N515, N598, Q599, N628, N651, N663, N709, or a combination thereof Including; (e) rAAVhu68 capsids are based on the numbering of SEQ ID NO: 2, N66, N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, N598 And a subpopulation of vp1, vp2 and / or vp3 proteins comprising 1% to 20% deamidation at positions Q599, N628, N651, N663, N709, and at least one of the combinations thereof; (f) the rAAVhu68 capsid comprises a subpopulation of vp1 wherein 65% to 100% of N at position 57 of the vp1 protein is deamidated, based on the numbering of SEQ ID NO: 2; (g) the rAAVhu68 capsid comprises a subpopulation of vp1 wherein 75% to 100% of N at position 57 of the vp1 protein is deamidated; (h) the rAAVhu68 capsid comprises a subpopulation of vp1 protein, vp2 protein and / or vp3 protein where 80% to 100% of N at position 329 is deamidated, based on the numbering of SEQ ID NO: 2; (i) the rAAVhu68 capsid comprises a subset of vp1 protein, vp2 protein and / or vp3 protein where 80% to 100% of N at position 452 is deamidated, based on the numbering of SEQ ID NO: 2; (j) the rAAVhu68 capsid comprises a subpopulation of vp1 protein, vp2 protein and / or vp3 protein where 80% to 100% of N at position 512 is deamidated, based on the numbering of SEQ ID NO: 2; (k) rAAV comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 to 1.5 vp2 to 3 to 10 vp3 proteins; (l) rAAV comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 vp2 to 3 to 9 vp3 protein.

In certain embodiments, AAVhu68 is modified to change glycine in asparagine-glycine pairs to reduce deamidation. In another embodiment, asparagine is a different amino acid, for example glutamine that amidates at a slower rate; Or amino acids deficient in amide groups (eg, glutamine and asparagine contain amide groups); And / or to amino acids lacking amine groups (eg lysine, arginine and histidine contain amide groups). As used herein, amino acids lacking an amide or amine side chain are, for example, glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine or tryptophan, and / or Refers to proline. For example, the modifications described may be present in one, two or three of the asparagine-glycine pairs found in the encoded AAVhu68 amino acid sequence. In certain embodiments, this modification does not occur in all four of the asparagine-glycine pairs. Thus, methods for reducing deamidation of AAVhu68 and / or engineered AAVhu68 variants have lower deamidation rates. Additionally, or in the alternative, one or more other amide amino acids may be changed to nonamide amino acids to reduce deamidation of AAVhu68.

Such amino acid modifications can be carried out by conventional genetic engineering techniques. For example, a nucleic acid sequence containing a modified AAVhu68 vp codon can be generated, wherein one of the codons encoding glycine at positions 58, 330, 453 and / or 513 in SEQ ID NO: 2 (arginine-glycine pair) 3 to 3 are modified to encode amino acids other than glycine. In certain embodiments, the nucleic acid sequence containing the modified arginine codon is engineered from one to three of the arginine-glycine pairs located at positions 57, 329, 452 and / or 512 in SEQ ID NO: 2, such that the modified codon It encodes amino acids that are not arginine. Each modified codon may encode a different amino acid. Alternatively, one or more of the altered codons may encode the same amino acid. In certain embodiments, such modified AAVhu68 nucleic acid sequences can be used to generate mutant rAAVhu68 with capsids having lower deamidation than native hu68 capsids. Such mutant rAAVhu68 may have reduced immunity and / or increase stability to storage, in particular storage in suspension form. As used herein, "codon" refers to three nucleotides of a sequence that encodes an amino acid.

As used herein, “encoded amino acid sequence” refers to an amino acid predicted based on the translation of a known DNA codon of a named nucleic acid sequence to be translated into an amino acid. The table below shows DNA codons and twenty common amino acids, representing both single letter code (SLC) and three letter code (3LC).

AAVhu68 capsids may be useful in certain embodiments. For example, such capsids can be used to generate monoclonal antibodies and / or generate reagents useful in assays for monitoring AAVhu68 concentration levels in gene therapy patients. Techniques for generating useful anti-AAVhu68 antibodies, labels of such antibodies or empty capsids, and suitable assay formats are known to those skilled in the art.

In certain embodiments, at least 70%, at least 70% of a sequence encoding a vp1 amino acid sequence of SEQ ID NO: 2 having a nucleic acid sequence of SEQ ID NO: 1 or a modification (eg, deamidated amino acid) as described herein; Provided herein are sequences that are 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical. In certain embodiments, the vp1 amino acid sequence is shown in SEQ ID NO: 14.

As used herein, the term “clade” refers to a bootstrap value of at least 75% (at least 1000 copies) and 0.05 or less, based on the alignment of the AAV vp1 amino acid sequence when it is associated with a group of AAVs. Refers to a group of AAVs that are phylogenetically related to each other, as determined using a neighbor-joining algorithm by Poisson correction distance measurement of a. Neighbor-connection algorithms are described in the literature (see, eg, M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000))). Computer programs are available, for example, the MEGA v2.1 program implements a modified Nei-Gojobori method, using these techniques and computer programs, and sequences of AAV vp1 capsid proteins, those skilled in the art It can be readily determined whether is included in one or another of the clades identified herein or not in such a clade (eg, G Gao, et al , J Virol, 2004). Jun; 78 (10: 6381-6388), which identifies clades A, B, C, D, E and F and provides the nucleic acid sequences of the new AAV, Genbank Accession Nos. AY530553 to AY530629, as well as international patents See WO2005 / 033321) .

In one embodiment, the invention provides an engineered molecule comprising a spacer sequence between an AAVhu68 vp1 coding sequence and an AAVhu68 rep coding sequence. This coding sequence is atgacttaaaccaggt, SEQ ID NO: 9. The coding sequence for rep52 of AAVhu68 is shown in SEQ ID NO: 3. The rep52 protein sequence is shown in SEQ ID NO: 4.

In one embodiment, a method of increasing the yield of rAAV is provided to increase the amount of rAAV present in the supernatant prior to or without requiring cell lysis. The method includes manipulating the AAV vp1 capsid gene to express a capsid protein having Glu at position 67 and Val at position 157 based on an alignment with amino acid numbering of the AAVhu68 vp1 capsid protein. In another embodiment, the method comprises manipulating the AAVhu68 vp1 capsid gene to express a capsid protein having a Val at position 157 and no Glu at position 67. Such other AAVs can be readily selected from other clades F AAVs of clades A, B, C, D or E, or AAV. In certain embodiments, the AAV is selected from clades C, D, E or F. In other embodiments, the AAV is selected from clades C, D or E.

In another embodiment, the method includes increasing the yield of rAAV to increase the amount of rAAV present in the supernatant prior to or without requiring cell lysis. The method comprises the step of manipulating the AAV vp1 capsid gene to express a capsid protein with Glu at position 67, Val at position 157 or both based on alignment with amino acid numbering of the AAVhu68 vp1 capsid protein. do. In another embodiment, the method comprises manipulating the VP2 capsid gene to express a capsid protein having a Val at position 157. In yet other embodiments, the rAAV has a modified capsid comprising both vp1 and vp2 capsid proteins having Glu at position 67 and Val at position 157.

In yet another embodiment, the AAVhu68 can be engineered to have Ser, Gly, Ser or Thr at position 67, with reference to vp1 numbering [SEQ ID NO: 2], while holding Val at position 157. In a still further embodiment, the AAVhu68 can be manipulated to have Ile or Leu at position 157, with reference to vp1 numbering [SEQ ID NO: 2]. In still further embodiments, AAVhu68 may be engineered to have Ser, Gly, Ser or Thr at position 67 and Ile or Leu at position 157, with reference to vp1 numbering [SEQ ID NO: 2].

In a further embodiment, there is provided a method of packaging a transgene into clade F AAV, which provides at least a 15% increase in yield of the packaged vector as compared to AAV9, the method comprising the steps of: Culturing. In certain embodiments, the increase is a yield increase of at least 90%. In another embodiment, the increase is a yield increase of at least 200%.

In comparison between AAVhu68 and AAVrh10, AAVhu68 was found to provide better transduction efficiency than AAVrh10 at low doses (eg about 1 × 10 ⁹ GC) after intracerebroventricular administration. In a further comparison between AAVhu68 and AAV9, it was found that AAVhu68 provides better transduction efficiency than AAV9 in the cerebellum, motor cortex and hippocampus (eg at about 1 × 10 ¹¹ GC) of the brain after intravascular cerebrovascular administration. .

In certain embodiments, the invention provides an AAVhu68 vector comprising a vector genome that expresses an antibody directed against the HER2 receptor. Such vectors are useful for the treatment and / or prevention of cancer.

As used herein, “AAV9 capsid” is a self-assembled AAV capsid consisting of a number of AAV9 vp proteins. The AAV9 vp protein typically has a nucleic acid sequence of SEQ ID NO: 5 or at least 70%, at least 75%, at least 80%, at least 85%, at least 90, encoding the vp1 amino acid sequence of SEQ ID NO: 6 (Genbank Accession: AAS99264) %, At least 95%, at least 97%, at least 99% are expressed as alternative splice variants encoded by the same sequence. Such splice variants produce proteins of different lengths of SEQ ID NO: 6. In certain embodiments, “AAV9 capsid” comprises an AAV having an amino acid sequence that is 99% identical to AAS99264 or 99% identical to SEQ ID NO: 6 (see also US Pat. No. US7906111 and WO2005 / 033321). As used herein, “AAV9 variant” includes, for example, those described in WO2016 / 049230, US Pat. No. 8,927,514, US 2015/0344911, and US 8,734,809.

Capsids, methods for generating coding sequences therefor, and methods for producing rAAV viral vectors are described (eg, Gao, et al, Proc. Natl. Acad. Sci. USA 100 (10), 6081-6086). (2003) and US Patent US 2013 / 0045186A1).

The term "substantial homology" or "substantial similarity", when referred to a nucleic acid or fragment thereof, is an aligned sequence when optimally aligned with another nucleic acid (or complementary strand thereof) to have the appropriate nucleotide insertion or deletion At least about 95-99% of nucleotide sequence identity is present. Preferably, homology is over the full length sequence, or an open reading frame thereof, or another suitable fragment that is at least 15 nucleotides in length. Examples of suitable fragments are described herein.

The terms "sequence identity", "percent sequence identity", or "same percentage" in reference to a nucleic acid sequence refer to residues in the same two sequences when aligned for maximum relevance. The length of the sequence identity comparison may be for the full length of the genome, the full length of the gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, which is preferred. However, for example, identity between smaller fragments of at least about 9 nucleotides, typically at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desirable. . Similarly, “percent sequence identity” can be readily determined for amino acid sequences across the full length of the protein or fragments thereof. Suitably, the fragment may be at least about 8 amino acids in length and up to about 700 amino acids. Examples of suitable fragments are described herein.

The term "substantial homology" or "substantial similarity", when referred to an amino acid or fragment thereof, is an aligned sequence when optimally aligned with another amino acid (or complementary strand thereof) to have an appropriate amino acid insertion or deletion At least about 95-99% amino acid sequence identity is shown. Preferably, homology is over the full length sequence, or a protein thereof, eg, a cap protein, a rep protein, or a fragment thereof that is at least 8 amino acids, or more preferably at least 15 amino acids in length. Examples of suitable fragments are described herein.

The term "highly conserved" means at least 80% identity, preferably at least 90% identity, more preferably greater than 97% identity. Identity is easily determined by one skilled in the art according to algorithms and computer programs known to those skilled in the art.

In general, when referring to “identity”, “homology”, or “similarity” between two different adeno-associated viruses, “identity”, “homology” or “similarity” refers to a “aligned” sequence. Is determined. A "aligned" sequence or "alignment" usually refers to a number of nucleic acid sequences or protein (amino acid) sequences that contain modifications to bases or amino acids that are missing or added when compared to a reference sequence. In an example, AAV alignment is performed using published AAV9 sequences as reference points. Alignment is performed using any of a variety of public or commercially available multiple sequence alignment programs. Examples of such programs include "Clustal Omega""ClustalW","CAP Sequence Assembly", "MAP", and "MEME", which are accessible through a web server on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, vector NTI is also used. There are also a number of algorithms known in the art that can be used to determine nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using Fasta programs in the GCG version 6.1 ^(TM). Fasta ^(TM) provides an alignment and percent sequence identity of the best overlap region between the sequences of the questions and search sequences. For example, the percent sequence identity between nucleic acid sequences is Fasta ™ with default parameters (word size of 6 and NOPAM factor for scoring matrix) as provided in GCG version 6.1 (incorporated herein by reference ⁾ . Can be determined using. Many sequence alignment programs, such as the "Clustal Omega""ClustalX","MAP","PIMA","MSA","BLOCKMAKER","MEME", and "Match-Box" programs, are also amino acid sequences. Available for. Generally, any of these programs are used in the default settings, but those skilled in the art can change these settings as needed. Alternatively, one skilled in the art can use another algorithm or computer program that provides at least the same level of identity or alignment as provided by the referenced algorithms and programs (eg, JD Thomson et al, Nucl. Acids.Res., "A comprehensive comparison of multiple sequence alignments", 27 (13): 2682-2690 (1999).

I. rAAV Vectors

As indicated above, the novel AAVhu68 sequences and proteins are useful for the production of rAAV and also for recombinant AAV vectors, which may be antisense delivery vectors, gene therapy vectors, or vaccine vectors. In addition, the engineered AAV capsids described herein, eg, having a mutant amino acid at positions 67, 157, or both, for the numbering of the vp1 capsid protein in SEQ ID NO: 2, can be used to target cells and tissues. RAAV vectors can be engineered to deliver a number of suitable nucleic acid molecules.

Genomic sequences packaged in AAV capsids and delivered to host cells typically consist of at least a transgene and its regulatory sequences and AAV inverted terminal repeats (ITRs). Both single-stranded AAV and self-complementary (sc) AAVs are included in rAAV. Transgenes are nucleic acid coding sequences that are heterologous to a vector sequence, which encodes a polypeptide, protein, functional RNA molecule (eg, miRNA, miRNA inhibitor) or other gene of interest. The nucleic acid coding sequence is operably linked to regulatory elements in a manner that allows transgene transcription, translation and / or expression in cells of the target tissue.

The AAV sequence of the vector typically includes cis-acting 5 'and 3' inverted terminal repeat sequences (see, eg, BJ Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155 168 (1990)). The ITR sequence is about 145 bp in length. Preferably, substantially the entire sequence encoding the ITR is used in this molecule, but some slight modification of this sequence is acceptable. The ability to modify such ITR sequences is within the skill of one in the art (see, eg, Sambrook et al, "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K Fisher et al., J. Virol., 70: 520 532 (1996). Examples of such molecules used in the present invention are cis-acting "plasmids in which the selected transgene sequence and associated regulatory elements contain transgenes flanked by 5 'and 3' AAV ITR sequences". In one embodiment, the ITR is derived from a different AAV than feeding the capsid. In one embodiment, the ITR sequence is from AAV2. A shortened version of the 5 'ITR, called ΔITR, which lacks the D-sequence and terminal resolution site (trs) is described. In other embodiments, full length AAV 5 'and 3' ITRs are used. However, ITRs from other AAV sources can be selected. If the source of ITR is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be referred to as a pseudotype. However, other configurations of these elements may be suitable.

In addition to the key elements identified above for recombinant AAV vectors, the vectors may also be transfected in a manner that permits transcription, translation and / or expression in cells infected with a virus produced by the invention or transfected with a plasmid vector. It includes conventional control elements that need to be operatively connected to the gen. As used herein, “operably linked” sequences include both expression control sequences adjacent to the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.

Regulatory control elements typically contain a promoter sequence located as part of an expression control sequence, eg, located between a selected 5 'ITR sequence and a coding sequence. Constitutive promoters, modulatory promoters (see, eg, WO 2011/126808 and WO 2013/04943), tissue specific promoters, or promoters that are responsive to physiological signals are described in the vectors described herein. Can be used and utilized. Promoter (s) may be derived from different sources, for example human cytomegalovirus (CMV) extreme early enhancer / promoter, SV40 early enhancer / promoter, JC polymovirus promoter, myelin basic protein (MBP) or glial fibrous acidic protein ( GFAP) promoter, herpes simplex virus (HSV-1) latent related promoter (LAP), Raus sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) ) Promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), chicken beta-actin promoter and the like. In addition to a promoter, the vector may comprise one or more other suitable transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; Sequences that stabilize cytoplasmic mRNA such as WPRE; Sequences that enhance translation efficiency (ie Kozak consensus sequence); Sequences that enhance protein stability; And, if desired, sequences that enhance the secretion of the encoded product. An example of a suitable enhancer is a CMV enhancer. Other suitable enhancers include those suitable for the target tissue indication of interest. In one embodiment, the expression cassette comprises one or more expression enhancers. In one embodiment, the expression cassette contains two or more expression enhancers. These enhancers may be the same or different from each other. For example, the enhancer may include a CMV extreme early enhancer. Such enhancers can be in two copies located adjacent to each other. Alternatively, double copies of an enhancer can be separated by one or more sequences. In another embodiment, the expression cassette further contains an intron, eg, chicken beta-actin intron. Other suitable introns include those known in the art and are described, for example, in WO 2011/126808. Examples of suitable polyA sequences include, for example, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyA. Optionally, one or more sequences can be selected to stabilize the mRNA. An example of such a sequence is a modified WPRE sequence, which can be engineered upstream of the polyA sequence and downstream of the coding sequence [see, for example, MA Zanta-Boussif, et al, Gene Therapy (2009) 16: 605-619].

Such rAAVs are particularly well suited for gene delivery for therapeutic purposes and for immunization, including induction of protective immunity. In addition, the compositions of the present invention can also be used for the production of the desired gene product in vitro. For in vitro production, the desired product (e.g., a protein) may be transfected into a host cell with rAAV containing a molecule encoding the desired product, followed by culturing the cell culture under conditions that allow expression. Can be obtained from the culture. The expressed product can then be purified and isolated if necessary. Techniques suitable for transfection, cell culture, purification and isolation are known in the art.

In certain embodiments, the rAAV or composition as provided herein does not contain an anti-influenza antibody or immunoglobulin construct. In certain embodiments, an rAAV or composition as provided herein does not contain an SMN coding sequence.

Therapeutic Genes and Gene Products

Useful products encoded by transgenes can replace binding or deficient genes, inactivate or “knock out” or “knock down” expression of genes that are expressed at undesirable high levels, or desired treatments. It includes various gene products that deliver gene products that have an effect. In most embodiments, the therapy will be "somatic gene therapy", ie delivery using cells of the body that do not produce sperm or eggs. In certain embodiments, the transgene expressing protein has a sequence of native human sequences. However, in other embodiments, the synthetic protein is expressed. Such proteins may be intended for the treatment of humans or, in other embodiments, may be designed for the treatment of companion animals such as animals, including, for example, dog or cat populations, or for the treatment of other animals in contact with livestock or human populations. .

Examples of suitable gene products may include those associated with familial dyslipidemia, muscular dystrophy, cystic fibrosis, rare or orphan disease. Examples of such rare diseases include spinal muscular atrophy (SMA), Huntington's disease, Rett Syndrome (e.g., methyl-CpG-binding protein 2 (MeCP2); UniProtKB-P51608), muscular dystrophy (muscular) Atrophic lateral sclerosis: ALS), Duchenne-type muscular dystrophy, Frederick's ataxia (e.g., prataxin), Progranulin (PRGN) (non-Alzheimer's brain degeneration, such as anterior temporal dementia (FTD), progressive analogy) Progressive non-fluent aphasia (PNFA) and semantic demential (eg, www.orpha.net/consor/cgi-bin/Disease_Search_List.php; rarediseases.info.nih. gov / diseases ).

Examples of suitable genes include, for example, hormones and growth and differentiation factors such as, but not limited to, insulin, glucagon, glucagon-like peptide-1 (GLP1), growth hormone (GH), parathyroid hormone (PTH), growth Hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietin, angiostatin, granulocyte colony Stimulating factor (GCSF), erythropoietin (EPO) (including, for example, human, dog or cat epoch), connective tissue growth factor (CTGF), neurotrophic factor (eg, basic fibroblast growth factor) growth factor: bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), platelet derived growth factor (PDGF), insulin growth factors I and II (IGF-I and IGF-II), transgenic growth factor any one of the α phases, such as TGFα, activin, inhibin, or Any of the bone forming proteins (BMP), BMP 1-15, any of the growth factor heregluin / neuregulin / ARIA / neu differentiation factor (NDF), nerve growth factor ( NGF), brain derived neurotrophic factor (BDNF), neurotrophin NT-3 and NT-4 / 5, ciliated neurotrophic factor (CNTF), glial cell line derived neurotrophic factor (GDNF), neuroturin, agrin, semaphore Any one of the family of lin / collapsin, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrin, noggin, sonic hedgehog and Tyrosine hydroxylase.

Other useful transgene products include cytokines and lymphokines, such as thrombopoietin (TPO), interleukin (IL) IL-1 to IL-36 (eg, human interleukin IL-1, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-6, IL-8, IL-12, IL-11, IL-12, IL-13, IL-18, IL-31, IL- 35), monocyte chemotactic protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factor α and β, interferon α, β, γ, stem cell factor, flk-2 / flt3 ligand And proteins that regulate the immune system, including but not limited to these. Gene products produced by the immune system are also useful in the present invention. This includes, but is not limited to, immunoglobulin IgG, IgM, IgA, IgD and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cell receptors, class I and class II MHC molecules , As well as engineered immunoglobulins and MHC molecules. For example, in certain embodiments, rAAV antibodies can be designed to deliver dog or cat antibodies, eg, anti-IgE, anti-IL31, anti-CD20, anti-NGF, anti-GnRH, and the like. Useful gene products also include complement regulatory proteins such as complement regulatory proteins, membrane acceptor proteins (MCPs), decay accelerating factor (DAF), CR1, CF2, CD59, and C1 esterase inhibitors (C1-INH). ).

Further other useful gene products include any of the receptors for hormones, growth factors, cytokines, lymphokines, regulatory proteins and immune system proteins. The present invention includes receptors for cholesterol control and / or lipid regulation, such as lipoprotein lipoprotein (LDL) receptors, high density lipoprotein (HDL) receptors, high low density lipoprotein (VLDL) receptors and scavenger receptors. The invention also includes gene products such as members of the steroid hormone receptor superfamily, such as glucocorticoid receptors and estrogen receptors, vitamin D receptors and other nuclear receptors. Useful gene products also include transcription factors such as Jun, fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C / EBP, SP1, CCAAT-box binding protein, Interferon Regulatory Factor (IRF-1), Wilms Tumor Protein, ETS-binding protein, STAT , Forkhead family of GATA-box binding proteins such as GATA-3 and winged helix proteins.

Other useful gene products are carbamoyl synthetase I, ornithine transcarbamylase (OTC), arginosuccinate synthetase, arginosuccinate lyase (ASL) for the treatment of arginosuccinate lyase deficiency, argina Agents, fumaryl acetate hydrolase, phenylalanine hydroxylase, alpha-1 antitrypsin, rhesus alpha-fetoprotein (AFP), rhesus chorionic gonadotropin (CG), glucose-6-phosphatase, portobili Nogen deaminase, cystathion beta-synthase, branched keto acid decarboxylase, albumin, isovaleryl-coA dehydrogenase, pyridionyl CoA carboxylase, methyl malonyl CoA mutase, glutaryl coA Dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylate, liver phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-protein, cystic fibrosis membrane Regulator (cystic fibrosis transmembrane regulator: CFTR) [e.g., dystrophin mini-or micro] sequence, and a dystrophin gene product comprises. Further other useful gene products include those that may be useful in enzymes, such as enzyme replacement therapy, which are useful for a variety of conditions resulting from deficient activity of the enzyme. For example, enzymes containing mannose-6-phosphate can be used in therapy for lysosomal storage diseases (eg , suitable genes include coding for β-glucuronidase (GUSB)).

In certain embodiments, rAAV may be used in a gene editing system, which may comprise co-administration of one rAAV or multiple rAAV stocks. For example, rAAV can be engineered to deliver SpCas9, SaCas9, ARCUS, Cpf1, and other suitable gene editing constructs.

Further other useful gene products include hemophilia, such as hemophilia B (including factor IX) and hemophilia A (factor VIII and its variants such as the light and heavy chains of the heterodimer and B-defective domains; US Pat. No. 6,200,560 and US Patent 6,221,349). In some embodiments, the transgene first comprises the first 57 base pairs of the Factor VIII heavy chain encoding a 10 amino acid signal sequence as well as a human growth hormone (hGH) polyadenylation sequence. In an alternative embodiment, the transgene may contain five amino acids from the N-terminus of the B domain as well as the A1 and A2 domains, and / or 85 amino acids of the C-terminal of the A3, C1 and C2 domains as well as the B domain. Additionally included. In yet another embodiment, the nucleic acids encoding factor VIII heavy and light chains are provided as a single small gene separated by the 42 nucleic acid codes for the 14 amino acids of the B domain (US Pat. No. 6,200,560),

Other useful gene products include non-naturally occurring polypeptides such as chimeric or hybrid polypeptides having non-naturally occurring amino acid sequences containing insertions, deletions or amino acid substitutions. For example, single chain engineered immunoglobulins may be useful in certain patients with weakened immunity. Other types of unnaturally occurring gene sequences include antisense molecules and catalytic nucleic acids such as ribozymes that can be used to reduce overexpression of a target.

Reduction and / or regulation of gene expression is particularly desirable for the treatment of hyperproliferative conditions characterized by overproliferation of cells, such as in cancer and psoriasis. Target polypeptides include those that are produced exclusively or at higher levels in hyperproliferative cells as compared to normal cells. Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn and translocation genes bcr / abl, ras, src, P53, neu, trk and EGRF. In addition to oncogene products as target antigens, target polypeptides for anticancer treatment and prophylaxis include variable regions of antibodies produced by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas, which also, in part, In an embodiment, it is used as a target antigen for autoimmune disease. Polypeptides found at higher levels in tumor cells can be used as target polypeptides, including those recognized by other tumor associated polypeptides such as monoclonal antibody 17-1A and folate binding polypeptides.

Other suitable therapeutic polypeptides and proteins can be used to treat individuals suffering from autoimmune diseases and disorders by conferring a broad protective immune response against targets associated with autoimmunity, including cell receptors and cells producing “self” -induced antibodies. Includes what may be useful. T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, Reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatitis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis. Each of these diseases is characterized by a T cell receptor (TCR) that binds to endogenous antigens and initiates an inflammatory cascade associated with autoimmune disease.

Additional exemplary genes that can be delivered via rAAV include, but are not limited to, glucose-6-phosphatase associated with glycogen storage disease or deficiency type 1A (GSD1), phosphoenolpyruvate-carboxykinase associated with PEPCK deficiency ( PEPCK); Cyclin-dependent kinase-like 5 (CDKL5), also known as serine / threonine kinase 9 (STK9), associated with seizures and severe neurodevelopmental injury; Galactose-1 phosphate uridil transferase associated with galactosemia; Phenylalanine hydroxylase associated with phenylketonuria (PKU); Branched chain alpha-ketosan dehydrogenases associated with maple syrupuria; Fumarylacetoacetate hydrolase associated with tyrosinemia type 1; Methylmalonyl-CoA mutases associated with methylmalonemia; Medium chain acyl CoA dehydrogenase associated with medium chain acetyl CoA deficiency; Ornithine transcarbamylase (OTC) associated with ornithine transcarbamylase deficiency; Arginosuccinic acid synthetase (ASS1) associated with citrulline; Lecithin-cholesterol acyltransferase (LCAT) deficiency; Methylmalonic acidemia (MMA); Niemann-Pick disease, type C1); Propionic acidemia (PA); Low density lipoprotein receptor (LDLR) proteins associated with familial dyslipidemia (FH); UDP-glucuronosyltransferase associated with Crigler-Najjar disease; Adenosine deaminase associated with severe combined immunodeficiency disease; Hypoxanthine guanine phosphoribosyl transferase associated with Gout and Lesch-Nyan syndrome; Biotinidase associated with biotinidase deficiency; Alpha-galactosidase A (α-Gal A) associated with Fabry disease); ATP7B associated with Wilson's disease; Beta-glucocerebrosidase associated with Gaucher disease types 2 and 3; Peroxysome membrane protein 70 kDa associated with Zellweger syndrome; Arylsulfatase A (ARSA) associated with infectious white matter dystrophy, galactocerebrosidase (GALC) enzyme associated with crabe disease, alpha-glucosidase (GAA) associated with Pompe disease; Sphingomyelinase (SMPD1) gene associated with Nimanpick disease type A; Arginosuccinate synthase associated with adult onset type II citrullineemia (CTLN2); Carbamoyl-phosphate synthase 1 (CPS1) associated with urea circuit failure; Survival motor neuron (SMN) proteins associated with spinal muscular atrophy; Ceramidase associated with Faber liposarcoma; B-hexosaminidase associated with GM2 ganglioside accumulation and Tay-Sachs disease and Sandhoff disease; Aspartylglucosaminidases associated with aspartyl-glucosamineuria; A-fucosidase associated with fucoside accumulation; Α-mannosidase associated with alpha-mannoside accumulation; Porphobilinogen deaminase associated with acute intermittent porphyrinosis (AIP); Alpha-1 antitrypsin for the treatment of alpha-1 antitrypsin deficiency (pulmonary emphysema); Erythropoietin for the treatment of anemia due to thalassemia or kidney failure; Vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor for the treatment of ischemic diseases; Thrombomodulin and tissue factor pathway inhibitors for the treatment of occluded blood vessels as recognized, for example, in atherosclerosis, thrombosis or embolism; Aromatic amino acid decarboxylase (AADC), and tyrosine hydroxylase (TH) for the treatment of Parkinson's disease; Beta adrenergic receptor, antisense or mutant form of myovesicle adenosine triphosphatase-2, phosphoramban (SERCA2) and cardiac adenylyl cyclase for the treatment of congestive heart failure; Tumor suppressor genes for the treatment of various cancers such as p53; Cytokines for the treatment of inflammatory and immune disorders and death of cancer, such as one of various interleukins; Dystrophin or minidstropin and eutropin or minieutropin for the treatment of muscular dystrophy; And insulin or GLP-1 for the treatment of diabetes.

Additional genes and diseases of interest are, for example, dystonin gene related diseases, such as hereditary sensory and autonomic neuropathy type VI (DST gene encodes dystonin; dual AAV vectors encode proteins (about 7570 aa). May be necessary due to the size of)); SCN9A related diseases (loss of function mutants cause pain numbness, and acquisition of function mutants causes pain conditions, such as dermatitis). Another condition is Charcot-Marie-Tooth type 1F due to mutations in the NEFL gene (nerve filament light chain) characterized by progressive peripheral motor and sensory neuropathy with variable clinical and electrophysiological manifestations. And 2E.

In certain embodiments, the rAAV described herein can be used for the treatment of mucopolysaccharide (MPS) disorders. Such rAAVs include nucleic acid sequences encoding α-L-iduroidase (IDUA) for the treatment of MPS I (Wurler, Hurler-Scheie and Scheie syndromes); Nucleic acid sequences encoding iduronate-2-sulfatase (IDS) for the treatment of MPS II (Hunter Syndrome); Nucleic acid sequences encoding sulfamidase (SGSH) for the treatment of MPSIII A, B, C, and D (San Filippo Syndrome); Nucleic acid sequences encoding N-acetylgalactosamine-6-sulfate sulfatase (GALNS) for the treatment of MPS IV A and B (Morquio syndrome); Nucleic acid sequences encoding arylsulfatase B (ARSB) for the treatment of MPS VI (Maroteaux-Lamy syndrome); Nucleic acid sequences encoding hyaluronidase for the treatment of MPSIIX (hyaluronidase deficiency) and nucleic acid sequences encoding betaglucuronidase for the treatment of MPS VII (Sly syndrome). Can be.

Immunogenic Transgene

In some embodiments, an rAAV vector comprising a nucleic acid encoding a gene product associated with the cancer (eg, a tumor suppressor) can be used to treat the cancer by administering the rAAV carrying the rAAV vector to a subject having the cancer. have. In some embodiments, cancers are employed using rAAV vectors that include nucleic acids encoding small interfering nucleic acids (eg, shRNA, miRNA) that inhibit expression of a gene product (eg, oncogene) associated with cancer. Cancer can be treated by administering to a subject having rAAV carrying the rAAV vector. In some embodiments, an rAAV vector comprising a nucleic acid encoding a gene product associated with cancer (or functional RNA that inhibits expression of a gene associated with cancer) is, for example, a therapeutic agent for studying cancer or treating cancer. It can be used for research purposes to identify it. The following is a non-limiting list of exemplary genes known to be associated with the development of cancer (eg, oncogenes and tumor suppressors): AARS, ABCB1, ABCC4, ABI2, ABL1, ABL2, ACK1, ACP2, ACY1, ADSL, AK1, AKR1C2, AKT1, ALB, ANPEP, ANXA5, ANXA7, AP2M1, APC, ARHGAP5, ARHGEF5, ARID4A, ASNS, ATF4, ATM, ATP5B, ATP5O, AXL, BARD1, BAX, BCL2, BHLHB BRCA1, BRCA2, BTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBLB, CCL2, CCND1, CCND2, CCND3, CCNE1, CCT5, CCYR61, CD24, CD44, CD59, CDC20, CDC25, CDC25A, CDC25B CDK10, CDK4, CDK5, CDK9, CDKL1, CDKN1A, CDKN1B, CDKN1C, CDKN2A, CDKN2B, CDKN2D, CEBPG, CENPC1, CGRRF1, CHAF1A, CIB1, CKMT1, CLK1, CLK2, CLAK1, CLA3 COX7A2, CRAT, CRHR1, CSF1R, CSK, CSNK1G2, CTNNA1, CTNNB1, CTPS, CTSC, CTSD, CUL1, CYR61, DCC, DCN, DDX10, DEK, DHCR7, DHRS2, DHX8, DLG3, DVL2, DVL3, EDL2 E2F5, EGFR, EGR1, EIF5, EPHA2, ERBB2, ERBB3, ERBB4, ERCC3, ETV1, ETV3, ETV6, F2R, FASTK, FBN1, FBN2, FES, FG FR1, FGR, FKBP8, FN1, FOS, FOSL1, FOSL2, FOXG1A, FOXO1A, FRAP1, FRZB, FTL, FZD2, FZD5, FZD9, G22P1, GAS6, GCN5L2, GDF15, GNA13, GNAS, GNB2, GNB2, GNB2, GNB2 GSK3A, GSPT1, GTF2I, HDAC1, HDGF, HMMR, HPRT1, HRB, HSPA4, HSPA5, HSPA8, HSPB1, HSPH1, HYAL1, HYOU1, ICAM1, ID1, ID2, IDUA, IER3, IFITM1, IGF1R, IGF2R, IGF3BP IGFBP5, IL1B, ILK, ING1, IRF3, ITGA3, ITGA6, ITGB4, JAK1, JARID1A, JUN, JUNB, JUND, K-ALPHA-1, KIT, KITLG, KLK10, KPNA2, KRAS2, KRT18, KRT2A, KRT9, LAMB1, LAMP2, LCK, LCN2, LEP, LITAF, LRPAP1, LTF, LYN, LZTR1, MADH1, MAP2K2, MAP3K8, MAPK12, MAPK13, MAPKAPK3, MAPRE1, MARS, MASI, MCC, MCM2, MCM4, MDM2, MDM4, MDM4, MDM4 MICB, MLLT3, MME, MMP1, MMP14, MMP17, MMP2, MNDA, MSH2, MSH6, MT3, MYB, MYBL1, MYBL2, MYC, MYCL1, MYCN, MYD88, MYL9, MYLK, NE01, NF1, NF2, NFKB1, NFKB2, NFSF7, NID, NINE, NMBR, NME1, NME2, NME3, NOTCH1, NOTCH2, NOTCH4, NPM1, NQO1, NR1D1, NR2F1, NR2F6, NRAS, NRG1, NSEP1, OSM, PA2G4, PABPC1, PCNA, PCTK1, PCT2 PDGFA, PDGFB, PDGFRA, PDPK1, PEA1 5, PFDN4, PFDN5, PGAM1, PHB, PIK3CA, PIK3CB, PIK3CG, PIM1, PKM2, PKMYT1, PLK2, PPARD, PPARG, PPIH, PPP1CA, PPP2R5A, PRDX2, PRDX4, PRK1BP, PRKCSS1A, PMA PTEN, PTGS1, PTMA, PTN, PTPRN, RAB5A, RAC1, RAD50, RAF1, RALBP1, RAP1A, RARA, RARB, RASGRF1, RB1, RBBP4, RBL2, REA, REL, RELA, RELB, RET, RFC2, RGS19, RHOA, RHOB, RHOC, RHOD, RIPK1, RPN2, RPS6 KB1, RRM1, SARS, SELENBP1, SEMA3C, SEMA4D, SEPP1, SERPINH1, SFN, SFPQ, SFRS7, HB, SHH, SIAH2, SIVA, SIVA TP53, SKI, SKIL, SLC16 SLC1A4, SLC20A1, SMO, sphingomyelin phosphodiesterase 1 (SMPD1), SNAI2, SND1, SNRPB2, S0CS1, S0CS3, SOD1, SORT1, SPINT2, SPRY2, SRC, SRPX, STAT1, STAT2, STAT3, STAT5B , TAF1, TBL3, TBRG4, TCF1, TCF7L2, TFAP2C, TFDP1, TFDP2, TGFA, TGFB1, TGFBI, TGFBR2, TGFBR3, THBS1, TIE, TIMP1, TIMP3, TJP1, TK1, TLE1, TNF1, TNFR10, TNFR10 , TNFRSF6, TNFSF7, TNK1, TOB1, TP53, TP53BP2, TP5313, TP73, TPBG, TPT1, TRADD, TRAM1, TRRAP, TSG101, TUFM, TXNRD1, TYRO3, UBC, UBE2 L6, UCHL1, USP7, VDAC1, VEGF, VHL, VIL2, WEE1, WNT1, WNT2, WNT2B, WNT3, WNT5A, WT1, XRCC1, YES1, YWHAB, YWHAZ, ZAP70, and ZNF9.

The rAAV vector may comprise a nucleic acid encoding a protein or functional RNA that regulates apoptosis as a transgene. The following is a non-limiting list of nucleic acids encoding genes associated with apoptosis and products of these genes and their analogs, and encoding small interfering nucleic acids (eg shRNA, miRNA) that inhibit the expression of these genes and their analogs. This is useful as a transgene in certain embodiments of the present invention: RPS27A, ABL1, AKT1, APAF1, BAD, BAG1, BAG3, BAG4, BAK1, BAX, BCL10, BCL2, BCL2A1, BCL2L1, BCL2L10, BCL2L11, BCL2L12, BCL213 , BCL2L2, BCLAF1, BFAR, BID, BIK, NAIP, BIRC2, BIRC3, XIAP, BIRC5, BIRC6, BIRC7, BIRC8, BNIP1, BNIP2, BNIP3, BNIP3L, BOK, BRAF, CARD1O, CARD11, NLRC4, CARD14 , CARD6, CARDS, CARDS, CASP1, CASP10, CASP14, CASP2, CASP3, CASP4, CASP5, CASP6, CASP7, CASP8, CASP9, CFLAR, CIDEA, CIDEB, CRADD, DAPK1, DAPK2, DFFA, DFFB, FADD, GADD45A, GDNF , HRK, IGF1R, LTA, LTBR, MCL1, NOL3, PYCARD, RIPK1, RIPK2, TNF, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, TNFRSF11B, TNFRSF12A, TNFRSF14, TNFRSF19, TNFRSF19 FRSF1A, TNFRSF1B, TNFRSF21, TNFRSF25, CD40, FAS, TNFRSF6B, CD27, TNFRSF9, TNFSF10, TNFSF14, TNFSF18, CD40LG, FASLG, CD70, TNFSF8, TNFSF9, TP53, TRTPAF, TRTP, AF3 TRAF4, and TRAF5.

Useful gene products also include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression through target RNA transcript cleavage / lysis or translational repression of target messenger RNA (mRNA). miRNA is typically expressed naturally as the final 19-25 untranslated RNA product. miRNAs exhibit activity through sequence specific interactions with the 3 ′ untranslated region (UTR) of the target mRNA. Such endogenously expressed miRNAs are then processed into miRNA duplexes to form hairpin precursors that are further processed into “mature” single stranded miRNA molecules. Such mature miRNAs guide miRISC, a multiprotein complex that identifies a target site, for example in the 3 'UTR region of the target mRNA, based on its complementarity to the mature miRNA.

The following non-limiting examples of miRNA genes and their analogs are useful as genes or targets for small interfering nucleic acids (eg, miRNA sponges, antisense oligonucleotides, TuD RNAs) encoded by genes in certain embodiments of the method: hsa -let-7a, hsa-let-7a *, hsa-let-7b, hsa-let-7b *, hsa-let-7c, hsa-let-7c *, hsa-let-7d, hsa-let-7d * , hsa-let-7e, hsa-let-7e *, hsa-let-7f, hsa-let-7f-1 *, hsa-let-7f-2 *, hsa-let-7g, hsa-let-7g * , hsa-let-71, hsa-let-71 *, hsa-miR-1, hsa-miR-100, hsa-miR-100 *, hsa-miR-101, hsa-miR-101 *, hsa-miR- 103, hsa-miR-105, hsa-miR-105 *, hsa-miR-106a, hsa-miR-106a *, hsa-miR-106b, hsa-miR-106b *, hsa-miR-107, hsa-miR -10a, hsa-miR-10a *, hsa-miR-10b, hsa-miR-10b *, hsa-miR-1178, hsa-miR-1179, hsa-miR-1180, hsa-miR-1181, hsa-miR -1182, hsa-miR-1183, hsa-miR-1184, hsa-miR-1185, hsa-miR-1197, hsa-miR-1200, hsa-miR-1201, hsa-miR-1202, hsa-miR-1203 , hsa-miR-1204, hsa-miR-1205, hsa-miR-1206, hsa-miR-1207-3p, hs a-miR-1207-5p, hsa-miR-1208, hsa-miR-122, hsa-miR-122 *, hsa-miR-1224-3p, hsa-miR-1224-5p, hsa-miR-1225-3p , hsa-miR-1225-5p, hsa-miR-1226, hsa-miR-1226 *, hsa-miR-1227, hsa-miR-1228, hsa-miR-1228 *, hsa-miR-1229, hsa-miR -1231, hsa-miR-1233, hsa-miR-1234, hsa-miR-1236, hsa-miR-1237, hsa-miR-1238, hsa-miR-124, hsa-miR-124 *, hsa-miR- 1243, hsa-miR-1244, hsa-miR-1245, hsa-miR-1246, hsa-miR-1247, hsa-miR-1248, hsa-miR-1249, hsa-miR-1250, hsa-miR-1251, hsa-miR-1252, hsa-miR-1253, hsa-miR-1254, hsa-miR-1255a, hsa-miR-1255b, hsa-miR-1256, hsa-miR-1257, hsa-miR-1258, hsa- miR-1259, hsa-miR-125 a-3p, hsa-miR-125a-5p, hsa-miR-125b, hsa-miR-125b-1 *, hsa-miR-125b-2 *, hsa-miR-126 , hsa-miR-126 *, hsa-miR-1260, hsa-miR-1261, hsa-miR-1262, hsa-miR-1263, hsa-miR-1264, hsa-miR-1265, hsa-miR-1266, hsa-miR-1267, hsa-miR-1268, hsa-miR-1269, hsa-miR-1270, hsa-miR-1271, hsa-miR-1272, hsa-miR-1273, hsa-miR-127-3p, hsa-miR-1274a, hsa-miR-1274b, hsa-miR-1275, hsa-miR-127-5p, hsa-miR-1276, hsa-miR-1277, hsa-miR-1278, h sa-miR-1279, hsa-miR-128, hsa-miR-1280, hsa-miR-1281, hsa-miR-1282, hsa-miR-1283, hsa-miR-1284, hsa-miR-1285, hsa- miR-1286, hsa-miR-1287, hsa-miR-1288, hsa-miR-1289, hsa-miR-129 *, hsa-miR-12.90, hsa-miR-1291, hsa-miR-1292, hsa-miR -1293, hsa-miR-129-3p, hsa-miR-1294, hsa-miR-1295, hsa-miR-129-5p, hsa-miR-1296, hsa-miR-1297, hsa-miR-1298, hsa -miR-1299, hsa-miR-1300, hsa-miR-1301, hsa-miR-1302, hsa-miR-1303, hsa-miR-1304, hsa-miR-1305, hsa-miR-1306, hsa-miR -1307, hsa-miR-1308, hsa-miR-130a, hsa-miR.-130a *, hsa-miR-130b, hsa-miR-130b *, hsa-miR-132, hsa-miR-132 *, hsa -miR-1321, hsa-miR-1322, hsa-miR-1323, hsa-miR-1324, hsa-miR-133a, hsa-miR-133b, hsa-miR-134, hsa-miR-135a, hsa-miR -135a *, hsa-miR-135b, hsa-miR-135b *, hsa-miR-136, hsa-miR-136 *, hsa-miR-137, hsa-miR-138, hsa-miR-138-1 * , hsa-miR-138-2 *, hsa-miR-139-3p, hsa-miR-139-5p, hsa-miR-140-3p, hsa-miR-140-5p, hsa-miR-141, hsa- miR-141 *, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143, hsa-miR-143 *, hsa-miR-144, hsa-miR-144 *, hsa-miR -145, hsa-m iR-145 *, hsa-miR-146a, hsa-miR-146a *, hsa-miR-146b-3p, hsa-miR-146b-5p, hsa-miR-147, hsa-miR-147b, hsa-miR- 148a, hsa-miR-148a *, hsa-miR-148b, hsa-miR-148b *, hsa-miR-149, hsa-miR-149 *, hsa-miR-150, hsa-miR-150 *, hsa- miR-1.51-3p, hsa-miR-151-5p, hsa-miR-152, hsa-miR-153, hsa-miR-154, hsa-miR-154 *, hsa-miR-155, hsa-miR-155 *, hsa-miR-15a, hsa-miR-15a *, hsa-miR-15b, hsa-miR-15b *, hsa-miR-16, hsa-miR-16-1 *, hsa-miR-16-2 *, hsa-miR-17, hsa-miR-17 *, hsa-miR-181a, hsa-miR-181a *, hsa-miR-181a-2 *, hsa-miR-181b, hsa-miR-181c, hsa -miR-181c *, hsa-miR-181d, hsa-miR-182, hsa-miR-182 *, hsa-miR-1825, hsa-miR-1826, hsa-miR-1827, hsa-miR-183, hsa -miR-183 *, hsa-miR-184, hsa-miR-185, hsa-miR-185 *, hsa-miR-186, hsa-miR-186 *, hsa-miR-187, hsa-miR-187 * , hsa-miR-1.88-3p, hsa-miR-188-5p, hsa-miR-18a, hsa-miR-18a *, hsa-miR-18b, hsa-miR-18b *, hsa-miR-190, hsa -miR-190b, hsa-miR-191, hsa-miR-191 *, hsa-miR-192, hsa-miR-192 *, hsa-miR-193a-3p, hsa-miR-193a-5p, hsa-miR -193b, hsa-miR-193b *, hsa-miR-194, hsa-miR-194 *, hsa- miR-195, hsa-miR-195 *, hsa-miR-196a, hsa-miR-196a *, hsa-miR-196b, hsa-miR-197, hsa-miR-198, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a, hsa-miR-19a *, hsa-miR-19b, hsa-miR-19b-1 *, hsa-miR-19b- 2 *, hsa-miR-200a, hsa-miR-200a *, hsa-miR-200b, hsa-miR-200b *, hsa-miR-200c, hsa-miR-200c *, hsa-miR-202, hsa- miR-202 *, hsa-miR-203, hsa-miR-204, hsa-miR-205, hsa-miR-206, hsa-miR-208a, hsa-miR-208b, hsa-miR-20a, hsa-miR ~ 20a *, hsa-miR-20b, hsa-miR-20b *, hsa-miR-21, hsa-miR-21 *, hsa-miR-210, hsa-miR-211, hsa-miR-212, hsa- miR-214, hsa-miR-214 *, hsa-miR-215, hsa-miR-216a, hsa-miR-216b, hsa-miR-217, hsa-miR-218, hsa-miR-218-1 *, hsa-miR-218-2 *, hsa-miR-219-l-3p, hsa-miR-219-2-3p, hsa-miR-219-5p, hsa-miR-22, hsa-miR-22 *, hsa-miR-220a, hsa-miR-220b, hsa-miR-220c, hsa-miR-221, hsa-miR-221 *, hsa-miR-222, hsa-miR-222 *, hsa-miR-223, hsa-miR-223 *, hsa-miR-224, hsa-miR-23a, hsa-miR-23a *, hsa-miR-23b, hsa-miR-23b *, hsa-miR-24, hsa-miR-24 -1 *, hsa-miR-24-2 *, hsa-miR-25, hsa-miR-25 *, hsa-miR-26a, hsa-miR-26a-1 *, hsa-miR-26a-2 *, hsa-miR-26b, hsa-miR-26b *, hsa-miR-27a, hsa-miR-27a *, hsa-miR-27b, hsa-miR-27b *, hsa-miR-28-3p, hsa-miR-28-5p, hsa-miR-296-3p, hsa-miR-296-5p, hsa-miR-297, hsa-miR-298 , hsa-miR-299-3p, hsa-miR-299-5p, hsa-miR-29a, hsa-miR-29a *, hsa-miR-29b, hsa-miR-296-1 *, hsa-miR-296 -2. *, Hsa-miR-29c, hsa-miR-29c *, hsa-miR-300, hsa-miR-301a, hsa-miR-301b, hsa-miR-302a, hsa-miR-302a *, hsa -miR-302b, hsa-miR-302b *, hsa-miR-302c, hsa-miR-302c *, hsa-miR-302d, hsa-miR-302d *, hsa-miR-302e, hsa-miR-302f, hsa-miR-30a, hsa-miR-30a *, hsa-miR-30b, hsa-miR-30b *, hsa-miR-30c, hsa-miR-30c-1 *, hsa-miR-30c-2 *, hsa-miR-30d, hsa-miR-30d *, hsa-miR-30e, hsa-miR-30e *, hsa-miR-31, hsa-miR-31 *, hsa-miR-32, hsa-miR-32 *, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-323-3p, hsa-miR-323-5p, hsa-miR-324-3p, hsa-miR-324-5p, hsa-miR-325, hsa-miR-326, hsa-miR-328, hsa-miR-329, hsa-miR-330-3p, hsa-miR-330-5p, hsa- miR-331-3p, hsa-miR-331-5p, hsa-miR-335, hsa-miR-335 *, hsa-miR-337-3p, hsa-miR-337-5p, hsa-miR-338-3p, hsa-miR-338-5p, hsa-miR-339-3p, hsa-miR-339-5p, hsa-miR-33a, hsa-miR- 33a *, hsa-miR-33b, hsa-miR-33b *, hsa-miR-340, hsa-miR-340 *, hsa-miR-342-3p, hsa-miR-342-5p, hsa-miR-345 , hsa-miR-346, hsa-miR-34a, hsa-miR-34a *, hsa-miR-34b, hsa-miR-34b *, hsa-miR-34c-3p, hsa-miR-34c-5p, hsa -miR-361-3p, hsa-miR-361-5p, hsa-miR-362-3p, hsa-miR-362-5p, hsa-miR-363, hsa-miR-363 *, hsa-miR-365, hsa-miR-367, hsa-miR-367 *, hsa-miR-369-3p, hsa-miR-369-5p, hsa-miR-370, hsa-miR-371-3p, hsa-miR-371-5p , hsa-miR-372, hsa-miR-373, hsa-miR-373 *, hsa-miR-374a, hsa-miR-374a *, hsa-miR-374b, hsa-miR-374b *, hsa-miR- 375, hsa-miR-376a, hsa-miR-376a *, hsa-miR-376b, hsa-miR-376c, hsa-miR-377, hsa-miR-377 *, hsa-miR-378, hsa-miR- 378 *, hsa-miR-379, hsa-miR-379 *, hsa-miR-380, hsa-miR-380 *, hsa-miR-381, hsa-miR-382, hsa-miR-383, hsa-miR -384, hsa-miR-409-3p, hsa-miR-409-5p, hsa-miR-410, hsa-miR-411, hsa-miR-411 *, hsa-miR-412, hsa-miR-421, hsa-miR-422a, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424, hs a-miR-424 *, hsa-miR-425, hsa-miR-425 *, hsa-miR-429, hsa-miR-431, hsa-miR-431 *, hsa-miR-432, hsa-miR-432 *, hsa-miR-433, hsa-miR-448, hsa-miR-449a, hsa-miR-449b, hsa-miR-450a, hsa-miR-450b-3p, hsa-miR-450b-5p, hsa- miR-451, hsa-miR-452, hsa-miR-452 *, hsa-miR-453, hsa-miR-454, hsa-miR-454 *, hsa-miR-455-3p, hsa-miR-455- 5p, hsa-miR-483-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-485-3p, hsa-miR-485-5p, hsa-miR-486-3p, hsa- miR-486-5p, hsa-miR-487a, hsa-miR-487b, hsa-miR-488, hsa-miR-488 *, hsa-miR-489, hsa-miR-490-3p, hsa-miR-490 -5p, hsa-miR-491-3p, hsa-miR-491-5p, hsa-miR-492, hsa-miR-493, hsa-miR-493 *, hsa-miR-494, hsa-miR-495, hsa-miR-496, hsa-miR-497, hsa-miR-497 *, hsa-miR-498, hsa-miR-499-3p, hsa-miR-499-5p, hsa-miR-500, hsa-miR -500 *, hsa-miR-501-3p, hsa-miR-501-5p, hsa-miR-502-3p, hsa-miR-502-5p, hsa-miR-503, hsa-miR-504, hsa- miR-505, hsa-miR-505 *, hsa-miR-506, hsa-miR-507, hsa-miR-508-3p, hsa-miR-508-5p, hsa-miR-509-3-5p, hsa -miR-509-3p, hsa-miR-509-5p, hsa-miR-510, hsa-miR-511, hsa-miR- 512-3p, hsa-miR-512-5p, hsa-miR-513a-3p, hsa-miR-513a-5p, hsa-miR-513b, hsa-miR-513c, hsa-miR-514, hsa-miR- 515-3p, hsa-miR-515-5p, hsa-miR-516a-3p, hsa-miR-516a-5p, hsa-miR-516b, hsa-miR-517 *, hsa-miR-517a, hsa-miR -517b, hsa-miR-517c, hsa-miR-518a-3p, hsa-miR-518a-5p, hsa-miR-518b, hsa-miR-518c, hsa-miR-518c *, hsa-miR-518d- 3p, hsa-miR-518d-5p, hsa-miR-518e, hsa-miR-518e *, hsa-miR-518f, hsa-miR-518f *, hsa-miR-519a, hsa-miR-519b-3p, hsa-miR-519c-3p, hsa-miR-519d, hsa-miR-519e, hsa-miR-519e *, hsa-miR-520a-3p, hsa-miR-520a-5p, hsa-miR-520b, hsa -miR-520c-3p, hsa-miR-520d-3p, hsa-miR-520d-5p, hsa-miR-520e, hsa-miR-520f, hsa-miR-520g, hsa-miR-520h, hsa-miR -521, hsa-miR-522, hsa-miR-523, hsa-miR-524-3p, hsa-miR-524-5p, hsa-miR-525-3p, hsa-miR-525-5p, hsa-miR -526b, hsa-miR-526b *, hsa-miR-532-3p, hsa-miR-532-5p, hsa-miR-539, hsa-miR-541, hsa-miR-541 *, hsa-miR-542 -3p, hsa-miR-542-5p, hsa-miR-543, hsa-miR-544, hsa-miR-545, hsa-miR-545 *, hsa-miR-548a-3p, hsa-miR-548a- 5p, hsa-miR-548b-3p, hsa-miR-5 486-5p, hsa-miR-548c-3p, hsa-miR-548c-5p, hsa-miR-548d-3p, hsa-miR-548d-5p, hsa-miR-548e, hsa-miR-548f, hsa- miR-548g, hsa-miR-548h, hsa-miR-548i, hsa-miR-548j, hsa-miR-548k, hsa-miR-5481, hsa-miR-548m, hsa-miR-548n, hsa-miR- 548o, hsa-miR-548p, hsa-miR-549, hsa-miR-550, hsa-miR-550 *, hsa-miR-551a, hsa-miR-551b, hsa-miR-551b *, hsa-miR- 552, hsa-miR-553, hsa-miR-554, hsa-miR-555, hsa-miR-556-3p, hsa-miR-556-5p, hsa-miR-557, hsa-miR-558, hsa- miR-559, hsa-miR-561, hsa-miR-562, hsa-miR-563, hsa-miR-564, hsa-miR-566, hsa-miR-567, hsa-miR-568, hsa-miR- 569, hsa-miR-570, hsa-miR-571, hsa-miR-572, hsa-miR-573, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-575, hsa- miR-576-3p, hsa-miR-576-5p, hsa-miR-577, hsa-miR-578, hsa-miR-579, hsa-miR-580, hsa-miR-581, hsa-miR-582- 3p, hsa-miR-582-5p, hsa-miR-583, hsa-miR-584, hsa-miR-585, hsa-miR-586, hsa-miR-587, hsa-miR-588, hsa-miR- 589, hsa-miR-589 *, hsa-miR-590-3p, hsa-miR-590-5p, hsa-miR-591, hsa-miR-592, hsa-miR-593, hsa-miR-593 *, hsa-miR-595, hsa-miR-596, hsa- miR-597, hsa-miR-598, hsa-miR-599, hsa-miR-600, hsa-miR-601, hsa-miR-602, hsa-miR-603, hsa-miR-604, hsa-miR- 605, hsa-miR-606, hsa-miR-607, hsa-miR-608, hsa-miR-609, hsa-miR-610, hsa-miR-611, hsa-miR-612, hsa-miR-613, hsa-miR-614, hsa-miR-615-3p, hsa-miR-615-5p, hsa-miR-616, hsa-miR-616 *, hsa-miR-617, hsa-miR-618, hsa-miR -619, hsa-miR-620, hsa-miR-621, hsa-miR-622, hsa-miR-623, hsa-miR-624, hsa-miR-624 *, hsa-miR-62.5, hsa-miR- 625 *, hsa-miR-626, hsa-miR-627, hsa-miR-628-3p, hsa-miR-628-5p, hsa-miR-629, hsa-miR-629 *, hsa-miR-630, hsa-miR-631, hsa-miR-632, hsa-miR-633, hsa-miR-634, hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa- miR-639, hsa-miR-640, hsa-miR-641, hsa-miR-642, hsa-miR-643, hsa-miR-644, hsa-miR-645, hsa-miR-646, hsa-miR- 647, hsa-miR-648, hsa-miR-649, hsa-miR-650, hsa-miR-651, hsa-miR-652, hsa-miR-653, hsa-miR-654-3p, hsa-miR- 654-5p, hsa-miR-655, hsa-miR-656, hsa-miR-657, hsa-miR-658, hsa-miR-659, hsa-miR-660, hsa-miR-661, hsa-miR- 662, hsa-miR-663, hsa-miR-663b, hsa-m iR-664, hsa-miR-664 *, hsa-miR-665, hsa-miR-668, hsa-miR-671-3p, hsa-miR-671-5p, hsa-miR-675, hsa-miR-7 , hsa-miR-708, hsa-miR-708 *, hsa-miR-7-1 *, hsa-miR-7-2 *, hsa-miR-72.0, hsa-miR-744, hsa-miR-744 * , hsa-miR-758, hsa-miR-760, hsa-miR-765, hsa-miR-766, hsa-miR-767-3p, hsa-miR-767-5p, hsa-miR-768-3p, hsa -miR-768-5p, hsa-miR-769-3p, hsa-miR-769-5p, hsa-miR-770-5p, hsa-miR-802, hsa-miR-873, hsa-miR-874, hsa -miR-875-3p, hsa-miR-875-5p, hsa-miR-876-3p, hsa-miR-876-5p, hsa-miR-877, hsa-miR-877 *, hsa-miR-885- 3p, hsa-miR-885-5p, hsa-miR-886-3p, hsa-miR-886-5p, hsa-miR-887, hsa-miR-888, hsa-miR-888 *, hsa-miR-889 , hsa-miR-890, hsa-miR-891a, hsa-miR-891b, hsa-miR-892a, hsa-miR-892b, hsa-miR-9, hsa-miR-9 *, hsa-miR-920, hsa-miR-921, hsa-miR-922, hsa-miR-923, hsa-miR-924, hsa-miR-92a, hsa-miR-92a-1 *, hsa-miR-92a-2 *, hsa- miR-92b, hsa-miR-92b *, hsa-miR-93, hsa-miR-93 *, hsa-miR-933, hsa-miR-934, hsa-miR-935, hsa-miR-936, hsa- miR-937, hsa-miR-938, hsa-miR-939, hsa-miR-940, hsa-miR-941, hsa-miR-942, hsa-m iR-943, hsa-miR-944, hsa-miR-95, hsa-miR-96, hsa-miR-96 *, hsa-miR-98, hsa-miR-99a, hsa-miR-99a *, hsa- miR-99b, and hsa-miR-99b *. For example, miRNAs targeting chromosome 8 open reading frame 72 (C9orf72) expressing superoxide dimutase (SOD1) associated with amyotrophic lateral sclerosis (ALS) may be of interest.

miRNA inhibits the function of the mRNA it targets and, consequently, the expression of the polypeptide encoded by the mRNA. Thus, blocking (partially or completely) the activity of the miRNA (eg, silencing the miRNA) can effectively induce or restore the expression of a polypeptide whose expression is inhibited (derepression of the polypeptide). ). In one embodiment, deinhibition of the polypeptide encoded by the mRNA target of the miRNA is achieved by inhibiting miRNA activity in the cell through any one of a variety of methods. For example, the blocking of activity of miRNAs is achieved by hybridization with small interfering nucleic acids (eg, antisense oligonucleotides, miRNA sponges, TuD RNAs) that are complementary or substantially complementary to miRNAs, thereby allowing miRNAs to target mRNAs thereof. Interactions can be blocked. As used herein, small interfering nucleic acids that are substantially complementary to miRNA can hybridize with miRNA to block the activity of the miRNA. In some embodiments, small interfering nucleic acids that are substantially complementary to miRNAs are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 It is a small interfering nucleic acid that is complementary to miRNA in all but four bases. "miRNA inhibitors" are agents that block miRNA function, expression and / or processing. For example, such molecules include microRNA specific antisense, microRN A sponge, tough decoy RNA (TuD RNA) and microRNA oligonucleotides (double strands, hairpins) that inhibit the interaction of miRNA with the Drosha complex. Short oligonucleotides), but is not limited to these.

Further other useful genes may include encoding immunoglobulins that confer passive immunity to the pathogen. An "immunoglobulin molecule" is a protein that contains the immunologically active portions of an immunoglobulin heavy chain and an immunoglobulin light chain that can be covalently bound together and specifically combined with an antigen. Immunoglobulin molecules have any type (eg, IgG, IgE, IgM, IgD, IgA and IgY), class (eg , IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclasses. The terms "antibody" and "immunoglobulin" may be used interchangeably herein.

An “immunoglobulin heavy chain” is a polypeptide that contains at least a portion of an antigen binding domain of an immunoglobulin and at least a portion of a variable region of an immunoglobulin heavy chain or at least a portion of a constant region of an immunoglobulin heavy chain. Thus, immunoglobulin derived heavy chains have regions with significant amino acid sequence homology with many of the immunoglobulin genes. For example, the heavy chain in the Fab fragment is an immunoglobulin-derived heavy chain.

An “immunoglobulin light chain” is a polypeptide that contains at least a portion of an antigen binding domain of an immunoglobulin and at least a portion of a variable region or at least a portion of a constant region of an immunoglobulin light chain. Thus, immunoglobulin derived light chains have significant areas of amino acid homology with members of many immunoglobulin genes.

An "immunoadhesive" is a chimeric antibody-like molecule that combines a functional domain of a binding protein, typically a receptor, a ligand, or a cell-adhesive molecule, with an immunoglobulin constant domain, typically including hinge and FC regions.

A “fragment antigen-binding (Fab) fragment” is a region on an antibody that binds to an antigen. It consists of one constant domain and one variable domain of each of the heavy and light chains.

Anti-pathogen constructs are selected based on the causative agent (pathogen) for the disease for which prophylaxis is sought. These pathogens can be of viral, bacterial or fungal origin and can be used to prevent infections against human diseases in humans or to prevent veterinary diseases in non-human mammals or other animals.

rAAV may include genes encoding antibodies against viral pathogens, and in particular neutralizing antibodies. Such anti-viral antibodies may include anti-influenza antibodies directed against one or more of influenza A, influenza B, and influenza C. Type A viruses are the most lethal human pathogens. Antigens of influenza A associated with pandemic are: H1N1, which caused the Spanish flu in 1918 and swine flu in 2009; H2N2, which caused Asian flu in 1957; H3N2, which caused Hong Kong flu in 1968; H5N1, which caused bird flu in 2004; H7N7; H1N2; H9N2; H7N2; H7N3; And H10N7. Other target pathogen viruses include arenaviruses (including funin, machupo, and Lassa), filoviruses (including Marburg and Ebola), hantaviruses, and picomoviridae ( Rhinoviruses, including echoviruses, coronaviruses, paramyxoviruses, morbiliviruses, respiratory syncytial viruses, topaviruses, coxsackieviruses, JC viruses, parvovirus B19, parainfluenza, adenoviruses, leoviruses, and soybeans Spear (natural head)), and sarcoma (pox) from the poxvirus family, and shingles (pseudorabies). Viral hemorrhagic fever is caused by members of the Arenavirus family (Lasa fever) (also associated with lymphocytic choroidal meningitis (LCM)), filovirus (Ebola virus), and hantavirus (puremala) do. Members of picomavirus (subfamily of rhinoviruses) are associated with colds in humans. The Coronavirus family includes non-human viruses such as infectious bronchitis virus (poultry), swine infectious bronchitis gastrointestinal virus (pig), swine erythrocyte coagulation encephalitis virus (pig), feline infectious peritonitis virus (cat), feline intestinal coronavirus (cat) ), Dog coronavirus (dog). Human bronchial coronavirus is believed to be associated with cold, non-A, hepatitis B or C, and severe acute respiratory syndrome (SARS). Paramyxoviruses include parainfluenza virus type 1, parainfluenza virus type 3, bovine parainfluenza virus type 3, rubula virus (pandemic mumps virus, parainfluenza virus type 2, parainfluenza virus type 4, Newcastle disease virus (chicken), Morbiviruses, including herniation, measles, and canine measles, and pneumoviruses including respiratory syncytial virus (RSV). Viruses and porcine parvoviruses The adenovirus family includes viruses that cause respiratory diseases (EX, AD7, ARD, OB) Thus, in certain embodiments, rAAV vectors as described herein are anti- Ebola antibodies, eg 2G4, 4G7, 13C6, anti-influenza antibodies, eg Well, the FI6, CR8033 and wherein -RSV antibody, for example, be engineered to express a non - mainstream Thank Farley, non - mainstream Thank motor.

Neutralizing antibody constructs against bacterial pathogens may also be selected for use in the present invention. In one embodiment, the neutralizing antibody construct is directed against the bacteria itself. In another embodiment, the neutralizing antibody construct is directed against toxins produced by bacteria. Airborne bacterial pathogens include, for example, Neisseria meningitidis (meningitis), Klebsiella pneumonia (pneumonia), Pseudomonas aeruginosa (pneumonia), labor (Pseudomonas pseudomallei) (pneumonia), Pseudomonas Malay (Pseudomonas mallei) (pneumonia), Acinetobacter (Acinetobacter) (pneumonia), morak Cellar Qatar Harleys (Moraxella catarrhalis), morak Cellar Raku appears (Moraxella lacunata) rugi Pseudomonas ah , Alcaligenes (Alkaligenes), cardiolipin tumefaciens (Cardiobacterium), Haemophilus influenzae (Haemophilus influenzae) (forward), Haemophilus parainfluenza (Haemophilus pafainfluenzae), Bordetella Peer-to-cis (Bordetella pertussis) (whooping cough), Fran when cellar Tula Lancesis (pneumonia / fever), Legionella pneumonia (Veterinary disease), Chlamydia psittaci (pneumonia), Chlamydia pneumoniae ( pneumonia ) ), Mycobacterium tuberculosis (TB), Mycobacterium kansasii (TB), Mycobacterium avium (pneumonia), Nocadia Nocardia asteroides (pneumonia), Bacillus anthracis (anthrax), Staphylococcus aureus (pneumonia), Streptococcus pyognes enes ) (scarlet fever), Streptococcus pneumoniae (pneumonia), Corynebacteria diphtheria (diphtheria), Mycoplasma pneumoniae (pneumonia).

rAAV may include antibodies to causative agents of anthrax, a toxin produced by bacterial pathogens such as Bacillus anthracis, and in particular genes encoding neutralizing antibodies . Neutralizing antibodies to edema factor (PA), one of three peptides that form toxoids, are described. The other two polypeptides consist of lethal factor (LF) and edema factor (EF). Anti-PA neutralizing antibodies have been described as effective for passive immunity to anthrax (see, eg, US Pat. No. 7,442,373; R. Sawada-Hirai et al, J Immune Based Ther Vaccines. 2004; 2: 5. (on-line 2004 May 12)]. Additional other anti-thrax toxin neutralizing antibodies may be described and / or generated. Similarly, neutralizing antibodies against other bacteria and / or bacterial toxins can be used to generate AAV-delivered anti-pathogen constructs as described herein.

Antibodies to infectious diseases include, for example, Aspergillus spp., Absidia corymbifera , Rhixpus stolonifer , Mucor plumbeaus , Cryptococcus Neoformans (Crytococcus neoformans ), Histoplasm capsulatum , Blastomyces dermatitidis , Coccidioides immitis , Penicillium species, Micropolyspora faeni , Thermoactinomyces vulgaris , Alternaria alternate , Cladosporium spp., Helminthosporium , and star It can be caused by parasites or fungi, including Stachybotrys species.

rAAV is a disease such as Alzheimer's disease (AD), Parkinson's disease (PD), GBA-Parkinson's disease, rheumatoid arthritis (RA), irritable bowel syndrome (IBS), chronic obstructive pulmonary disease (COPD), cancer, tumors, systemic sclerosis, Genes encoding antibodies of pathogen agents of asthma and other diseases, and in particular neutralizing antibodies. Such antibodies include, but are not limited to, for example, alpha-synuclein, anti-vascular endothelial growth factor (VEGF) (anti-VEGF), anti-VEGFA, anti-PD-1, anti-PDL1, anti-CTLA-4, Anti-TNF-alpha, anti-IL-17, anti-IL-23, anti-IL-21, anti-IL-6, anti-IL-6 receptor, anti-IL-5, anti-IL-7, anti Factor XII, anti-IL-2, anti-HIV, anti-IgE, anti-tumor necrosis factor receptor-1 (TNFR1), anti-notch 2/3, anti-notch 1, anti-0X40, anti-erb- b2 receptor tyrosine kinase 3 (ErbB3), anti-ErbB2, anti-beta cell mature antigen, anti-B lymphocyte stimulator, anti-CD20, anti-HER2, anti-granulocyte macrophage colony-stimulating factor, anti-onco Statin M (OSM), anti-lymphocyte activating gene 3 (LAG3) protein, anti-CCL20, anti-serum amyloid P component (SAP), anti-prolyl hydroxylase inhibitor, anti-CD38, anti-glycoprotein IIb / IIIa, anti-CD52, anti-CD30, anti-IL-1beta, anti-epidermal growth factor receptor, anti-CD25, anti-RANK ligand, anti-complementary protein C5, anti-CD11a, anti-CD3 receptor, anti- Alpha-4 (α4) Inte Lin, wherein -RSV F protein, and anti-integrin α ₄ β ₇ may be. Still other pathogens and diseases will be apparent to those skilled in the art. Other suitable antibodies are useful for treating Alzheimer's disease, in particular for example, anti-beta-amyloid (eg crenezumab, solanezumab, aducanumab), anti-beta-amyloid fibril, anti Beta-amyloid plaques, anti-tau, bapineuzumab, and the like. Other antibodies suitable for treating various indications include, for example, those described in patent PCT / US2016 / 058968, filed Oct. 27, 2016 and published as WO 2017 / 075119A1.

II. rAAV vector production

For use in producing AAV viral vectors (eg , recombinant (r) AAV), the expression cassette may be retained on any suitable vector, eg, a plasmid, that is delivered to a packaging host cell. Plasmids useful in the present invention can be engineered such that they are suitable for replication and packaging in vitro, particularly in prokaryotic cells, insect cells, mammalian cells. Suitable transfection techniques and packaging techniques of host cells are known and / or can be readily designed by those skilled in the art.

Methods of generating and isolating AAVs suitable for use as vectors are known in the art (see, eg, Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development , production and clinical applications, " Adv. Biochem. Engin / Biotechnol. 99: 119-145; Buning et al., 2008," Recent developments in adeno-associated virus vector technology, " J. Gene Med. 10: 717-733 And references cited below, each of which is incorporated herein by reference in their entirety). In order to package a gene in a virion, the ITR is the only AAV component that needs to be cis in the same construct as the nucleic acid molecule containing the expression cassette (s). Cap and rep genes can be supplied in trans.

In one embodiment, the expression cassettes described herein are engineered in a genetic element (eg, a shuffle plasmid) that delivers an immunoglobulin construct sequence retained thereon into packaging host cells for the production of viral vectors. . In one embodiment, the selected genetic elements are to be delivered to AAV packaging cells by any suitable method, including transfection, electroinvasion, liposome delivery, membrane fusion techniques, high speed DNA-coated pellets, viral infections, and plasma fusions. Can be. Stable AAV packaging cells can also be prepared. Alternatively, expression cassettes can be used to generate viral vectors other than AAV or for the production of mixtures of antibodies in vitro. Methods used to prepare such constructs are known to those skilled in the art of nucleic acid engineering, and include genetic engineering, recombinant engineering, and synthetic techniques (see, eg, Molecular Cloning: A Laboratory Manual, ed. Green). and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012)].

The term "AAV intermediate" or "AAV vector intermediate" refers to an assembled rAAV capsid lacking the desired genomic sequence packaged therein. They may also be referred to as "hollow" capsids. Such capsids may not contain any detectable genomic sequence of the expression cassette or may contain only partially packaged genomic sequences that are insufficient to achieve expression of the gene product. These hollow capsids are nonfunctional for delivering the gene of interest to the host cell.

Recombinant adeno-associated viruses (AAV) described herein can be generated using known techniques (eg, International Patent WO 2003/042397; WO 2005/033321, WO 2006/110689). US Patent No. US 7588772 B2). Such methods include nucleic acid sequences encoding AAV capsid proteins; Functional rep genes; At least an expression cassette consisting of an AAV inverted terminal repeat (ITR) and a transgene; And culturing a host cell containing sufficient helper function to allow packaging of the expression cassette into the AAV capsid protein. Capsids, methods for generating coding sequences therefor, and methods for producing rAAV viral vectors are described (eg, Gao, et al, Proc. Natl. Acad. Sci. USA 100 (10), 6081-6086). (2003) and US Patent US 2013 / 0045186A1).

In one embodiment, production cell cultures are provided that are useful for producing recombinant AAVhu68. Such cell cultures include nucleic acids that express AAVhu68 capsid proteins in host cells; Nucleic acid molecules suitable for packaging in a vector genome containing AAVhu68 capsids, eg, non-AAV nucleic acid sequences encoding gene products operably linked to sequences that direct expression of the product in AAV ITRs and host cells; And sufficient AAV rep function and adenovirus helper function to allow packaging of the nucleic acid molecule in the recombinant AAVhu68 capsid. In one embodiment, the cell culture consists of mammalian cells (eg, in particular human embryonic kidney 293 cells) or insect cells (eg, baculovirus).

Optionally, the rep function is provided by AAV but not hu68. In certain embodiments, at least a portion of the rep function is derived from AAVhu68. For example, note that the rep sequence encodes the rep protein of SEQ ID NO: 4, and functional fragments thereof. AAV rep may be encoded by the nucleic acid sequence of SEQ ID NO: 3. In another embodiment, the rep protein is a heterologous rep protein other than AAVhu68rep, such as, but not limited to, AAV1 rep protein, AAV2 rep protein, AAV3 rep protein, AAV4 rep protein, AAV5 rep protein, AAV6 rep protein, AAV7 rep protein , AAV8 rep protein; Or rep 78, rep 68, rep 52, rep 40, rep68 / 78 and rep40 / 52; Or fragments thereof; Or another source. Optionally, the rep and cap sequences are on the same genetic element in cell culture. There may be a spacer between the rep sequence and the cap gene. Optionally, the spacer is atgacttaaaccaggt SEQ ID NO: 9. Any of these AAVhu68 or mutant AAV capsid sequences may be present under the control of exogenous regulatory control sequences that direct expression in the host cell.

In one embodiment, the cells are prepared in a suitable cell culture (eg, HEK 293) cells. Methods of making gene therapies described herein include methods well known in the art, such as the generation of plasmid DNA, the generation of vectors and the purification of vectors used for the generation of gene therapy vectors. In some embodiments, the gene therapy vector is an AAV vector and the resulting plasmids are AAV cis-plasmids encoding the AAV genome and genes of interest, AAV trans-plasmids containing AAV rep and cap genes, and adenovirus helper plasmids. The vector generation process involves method steps such as initiation of cell culture, passage of cells, seeding of cells, transfection of plasmid DNA into cells, medium exchange following transfection with serum-free medium, and vector-containing cells and cultures. Collection of the medium. The harvested vector-containing cells and culture medium are referred to herein as crude cell harvests. In another system, gene therapy vectors are introduced by infection with baculovirus-based vectors into insect cells. For reviews of such production systems, see, for example, Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20: 922 -929], the contents of which are incorporated herein by reference in their entirety. Methods of making and using these and other AAV production systems are described in the following US patents, the contents of each of which are incorporated herein by reference in their entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; And 7,439,065.

The crude cell harvest is then subjected to enrichment of the vector harvest, diafiltration of the vector harvest, microfluidization of the vector harvest, degradation of the nuclease vector harvest, filtration of microfluidized intermediates, purification of the crude by chromatography, Process steps such as crude purification by ultracentrifugation, buffer exchange by tangential flow filtration and / or formulation and filtration to produce bulk vectors can be carried out.

At high salt concentrations, the vector drug product is then purified using two-step affinity chromatography purification by anion exchange resin chromatography and the hollow capsid is removed. Such methods are described in International Patent Application No. PCT / US2016 / 065970, filed Dec. 9, 2016, and its priority document, US Patent Application No. 62 / 322,071, filed April 13, 2016, incorporated herein by reference. ) And 62 / 226,357 filed December 11, 2015, entitled "Scalable Purification Method for AAV9." Purification Methods for AAV8, International Patent Application No. PCT / US2016 / 065976, filed December 9, 2016 and its priority document US Patent Application No. 62 / 322,098, filed April 13, 2016 and 62 / 266,341 (filed December 11, 2015) and purification methods for rh10, International Patent Application No. PCT / US16 / 66013 (filed December 9, 2016) and its priority document, US Patent Application No. 62 / 322,055 (Filed April 13, 2016) and 62 / 266,347 (named “Scalable Purification Method for AAVrh10”, also filed December 11, 2015), and purification methods for AAV1, International Patent Application No. PCT / US2016 / 065974, filed December 9, 2016, and its priority document US Patent Application Nos. 62 / 322,083, filed April 13, 2016, and 62 / 26,351 ("Scalable Purification Method for AAV1", The filing date of December 11, 2015 is incorporated herein by reference in its entirety.

In order to calculate the hollow particle and total particle content, the VP3 band volume (eg, in the examples herein, iodixanol gradient-purified formulation, where # of GC = # of particles) was loaded. Plot against GC particles. The number of particles in the band volume of the EUT peak is calculated using the resulting linear equation (y = mx + c). The number of particles per 20 μl loaded (pt) is then multiplied by 50 to give particles (pt) / ml. Pt / ml divided by GC / ml gives the ratio of particles to genomic copy (pt / GC). Pt / ml-GC / ml gives hollow pt / ml. Divide the hollow pt / ml by pt / ml and multiply by 100 to give the percentage of hollow particles.

In general, assay methods for AAV vector particles and hollow capsids with packaged genomes are known in the art (see, eg, Grimm et al., Gene Therapy (1999) 6: 1322-1330; Sommer). et al., Molec. Ther . (2003) 7: 122-128). To test for denatured capsid, the method consists of treating the treated AAV stock with any gel capable of separating three capsid proteins, eg, a gradient gel containing 3-8% tris-acetate in buffer. Applying to SDS-polyacrylamide gel electrophoresis, followed by developing the gel until the sample material is separated, and blotting the gel onto a nylon or nitrocellulose membrane, preferably nylon Include. The anti-AAV capsid antibodies are then used as primary antibodies that bind to denatured capsid proteins, preferably anti-AAV capsid monoclonal antibodies, most preferably B1 anti-AAV-2 monoclonal antibodies (Wobus et al. , J. Virol . (2000) 74: 9281-9293). Subsequently, an anti-IgG antibody, most preferably a hose, that contains a detection molecule that binds to a secondary antibody, ie a primary antibody, and detects binding to the primary antibody, more preferably covalently attached thereto. Those that are both anti-mouse IgG antibodies covalently linked to the radish peroxidase are used. The method for detecting binding is used to semi-quantitatively determine the binding between primary and secondary antibodies, preferably the detection method is radioisotope emission, electromagnetic radiation, or colorimetric change, most preferably chemiluminescence. Detection kits can be detected. For example, for SDS-PAGE, samples from the column fractions can be taken and heated in SDS-PAGE loading buffer containing a reducing agent (eg, DTT), and the capsid proteins pre-cast ) Was partitioned on a gradient polyacrylamide gel (eg, Novex). Silver staining can be performed using SilverXpress (Invitrogen, Calif., USA) or using other suitable dyeing methods, ie, SYPRO Ruby or Coomassie stains, according to the manufacturer's instructions. . In one embodiment, the concentration of AAV vector genome (vg) in the column fraction can be measured by quantitative real time PCR (Q-PCR). Samples are diluted and digested with DNase I (or other suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the sample is diluted further, the DNA sequence between the primers is amplified using the specific tag only (TaqMan) ^{(trade name)} fluorescence circle probes and primers. The number of cycles (threshold cycle, Ct) required to reach the defined fluorescence level is measured for each sample on an Applied Biosystems Prism 7700 sequence detection system. Standard curves are generated in Q-PCR reactions using plasmid DNA containing the same sequence as contained in the AAV vector. The vector genome titer is determined by normalizing it to the Ct value of the plasmid standard curve using the cycle threshold (Ct) value obtained from the sample. Endpoint assays based on digital PCR can also be used.

In one aspect, an optimized q-PCR method using a broad spectral serine protease, such as proteinase K (eg, commercially available from Qiagen) is used. More specifically, the optimized qPCR genomic titer assay, after DNase I digestion, is diluted with proteinase K buffer, treated with proteinase K, and thermally inactivated, except that similar. Suitably the sample is diluted with an amount of proteinase K buffer equal to the sample size. Proteinase K buffer can be concentrated to at least twofold. Typically, proteinase K treatment is about 0.2 mg / ml, but may vary from 0.1 mg / ml to about 1 mg / ml. The treatment step is generally performed at about 55 ° C. for about 15 minutes, but at a lower temperature (eg, about 37 ° C. to about 50 ° C.) for a longer time period (eg, about 20 minutes to about 30 minutes). Or for shorter time periods (eg, about 5-10 minutes) at higher temperatures (eg, up to about 60 ° C.). Similarly, thermal inactivation is generally at about 95 ° C. for about 15 minutes, but the temperature may be lower (eg, about 70 to about 90 ° C.) and the time may be extended (eg , About 20 minutes to about 30 minutes). The sample is then diluted (eg 1000-fold) and subjected to the Takman assay as described in the standard assay.

Additionally or alternatively, Droplet digital PCR (ddPCR) can be used. For example, methods for determining single-stranded and self-complementary AAV vector genomic titers by ddPCR have been described (eg, M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr; 25 (2): 115-25.doi: 10.1089 / hgtb.2013.131.Epub 2014 Feb 14].

Briefly, the method of isolating rAAVhu68 particles having a genomic sequence packaged from genome-defective AAVhu68 intermediates provides high-speed performance while monitoring suspensions containing recombinant AAVhu68 virus particles and AAVhu689 capsid intermediates for ultraviolet absorbance at about 260 and about 280 Application to liquid chromatography, wherein AAVhu68 virus particles and AAVhu68 intermediates are bound to a strong anion exchange resin equilibrated at pH 10.2 and subjected to a salt gradient. Although less suitable for RAAV9hu68, the pH may range from about 10.0 to 10.4. In this method, the AAVhu68 whole capsid is separated from the eluted fraction when the ratio of A260 / A280 reaches the inflection point. In one example, the affinity for the chromatography step, the dialyzed product was filtered off to capture efficiently captured by the AAV2 / hu68 serotype Select (Select Capture) _{(trade name)} Poros -AAV2 / 9 affinity resin (Life Technologies LTD. (Life Technologies Applies to)). Under these ionic conditions, a significant percentage of remaining cellular DNA and protein flows through the column, effectively trapping the AAV particles.

III. Compositions and Uses

Provided herein are compositions containing at least one rAAV stock (eg, rAAVhu68 stock or mutant rAAV stock) and an optional carrier, excipient and / or preservative. rAAV stock refers to the same plurality of rAAV vectors, eg, in the amounts described below in the discussion of concentrations and dosage units.

As used herein, "carrier" refers to any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. Include. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that, when administered to a host, do not produce an allergy or similar unexpected response. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, endoplasmic reticulum and the like can be used to introduce the compositions of the invention into suitable host cells. In particular, rAAV vector delivery vector genomes may be encapsulated and formulated in lipid particles, liposomes, vesicles, nanospheres or nanoparticles for delivery.

In one embodiment, the composition comprises a final formulation suitable for delivery to a subject, which is, for example, an aqueous liquid suspension buffered at physiologically compatible pH and salt concentrations. Optionally, at least one surfactant is present in the formulation. In another embodiment, the composition can be transported as a concentrate that is diluted for administration to a subject. In another embodiment, the composition can be lyophilized and reconstituted at the time of administration.

Suitable surfactants, or combinations of surfactants, may be selected from nonionic surfactants that are nontoxic. In one embodiment, a bifunctional block copolymer surfactant terminated at the primary hydroxyl group, for example Poloxamer® F68, also known as Poloxamer 188 and having a neutral pH. BASF has an average molecular weight of 8400. Nonionic triblock copolymers composed of different surfactants and other poloxamers, ie, central hydrophobic chains of polyoxypropylene (poly (propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly (ethylene oxide)), Choice of SOLUTOL HS 15 (Macrogol-15 hydroxystearate), LABRASOL (polyoxy capryl glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol and polyethylene glycol Can be. In one embodiment, the formulation contains poloxamer. These copolymers are usually named with the letters "P" (for poloxamer) followed by three numbers: the first two numbers x 100 give the approximate molecular weight of the polyoxypropylene core, and the last number x 10 is poly Provide the percentage of oxyethylene content. In one embodiment poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005% to about 0.001% of the suspension.

The vector is sufficient in amount to be transfected into the cell to provide gene transfer and expression at a level sufficient to provide therapeutic benefit without undue side effects or with medically acceptable physiological effects that can be determined by one of ordinary skill in the medical arts. Is administered. Conventional pharmaceutically acceptable routes of administration include, but are not limited to , direct delivery to a desired organ (eg , liver (optionally through the hepatic artery), lungs, heart, eyes, kidneys), oral, inhalation, intranasal, spinal Intraluminal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal or other parenteral routes of administration include, but are not limited to these. Alternatively or in addition, routes of administration may be combined if desired.

The dosage of the viral vector will depend primarily on factors such as the condition to be treated, the age, weight and health of the patient and may therefore vary from patient to patient. For example, therapeutically effective human dosages of viral vectors generally range from about 25 to about 1000 microliters for 100 ml of a solution containing a concentration of about 1 × 10 ⁹ to 1 × 10 ¹⁶ genomic viral vectors. . Dosages will be adjusted to balance the therapeutic benefit against any side effects, which doses may vary depending on the therapeutic use used for the recombinant vector. The expression level of the transgene product can be monitored to determine the frequency of administration that produces the viral vector, preferably the AAV vector containing the small gene. Alternatively, dosage regimens similar to those described for therapeutic purposes can be used for immunization with the compositions of the present invention.

The replication-defective viral composition includes all integer or fractional amounts within the range, from about 1.0 × 10 ⁹ GC to about 1.0 × 10 ¹⁶ GC (when treating an average subject weighing about 70 kg), preferably in a human patient And can be formulated in dosage units so as to contain an amount of replication-defective virus in the range from 1.0 × 10 ¹² GC to 1.0 × 10 ¹⁴ GC. In one embodiment, the composition comprises at least 1 × 10 ⁹ , 2 × 10 ⁹ , 3 × 10 ⁹ , 4 × 10 ⁹ , 5 × 10 ⁹ , 6 × 10 ⁹ per dose, including any integer or fractional amount in the range , 7 × 10 ⁹ , 8 × 10 ⁹ , or 9 × 10 ⁹ GC. In yet another embodiment, the composition comprises at least 1 × 10 ¹⁰ , 2 × 10 ¹⁰ , It is formulated to contain 3 × 10 ¹⁰ , 4 × 10 ¹⁰ , 5 × 10 ¹⁰ , 6 × 10 ¹⁰ , 7 × 10 ¹⁰ , 8 × 10 ¹⁰ , or 9 × 10 ¹⁰ GC. In yet another embodiment, the composition comprises at least 1 × 10 ¹¹ , 2 × 10 ¹⁰ , It is formulated to contain 3 × 10 ¹¹ , 4 × 10 ¹¹ , 5 × 10 ¹¹ , 6 × 10 ¹¹ , 7 × 10 ¹¹ , 8 × 10 ¹¹ , or 9 × 10 ¹¹ GC. In another embodiment, the composition comprises at least 1 × 10 ¹² , 2 × 10 ¹² , per dose, including any integer or fractional amount within a range It is formulated to contain 3 × 10 ¹² , 4 × 10 ¹² , 5 × 10 ¹² , 6 × 10 ¹² , 7 × 10 ¹² , 8 × 10 ¹² , or 9 × 10 ¹² GC. In yet another embodiment, the composition comprises at least 1 × 10 ¹³ , 2 × 10 ¹³ , 3 × 10 ¹³ , 4 × 10 ¹³ , 5 × 10 ¹³ , 6 × 10 per dose, including any integer or fractional amount in the range Formulated to contain ¹³ , 7 × 10 ¹³ , 8 × 10 ¹³ , or 9 × 10 ¹³ GC. In yet another embodiment, the composition comprises at least 1 × 10 ¹⁴ , 2 × 10 ¹⁴ , 3 × 10 ¹⁴ , 4 × 10 ¹⁴ , 5 × 10 ¹⁴ , 6 × 10 per dose, including any integer or fractional amount in the range Formulated to contain ¹⁴ , 7 × 10 ¹⁴ , 8 × 10 ¹⁴ , or 9 × 10 ¹⁴ GC. In yet another embodiment, the composition comprises at least 1 × 10 ¹⁵ , 2 × 10 ¹⁵ , 3 × 10 ¹⁵ , 4 × 10 ¹⁵ , 5 × 10 ¹⁵ , 6 × 10 per dose, including any integer or fractional amount in the range Formulated to contain ¹⁵ , 7 × 10 ¹⁵ , 8 × 10 ¹⁵ , or 9 × 10 ¹⁵ GC. In one embodiment, for human application, the dose may range from 1 × 10 ¹⁰ to about 1 × 10 ¹² GC per dose, including all integer or fractional amounts within a range.

Such doses may vary from about 25 to about 1000 milliliters or higher volume, including any number within the range, depending on the size of the area to be treated, the viral titer used, the route of administration and the effect of the desired method. It can be administered in a carrier, excipient or buffered formulation. In one embodiment, the volume of carrier, excipient or buffer is at least about 25 μl. In one embodiment, the volume is about 50 μl. In yet another embodiment, the volume is about 75 μl. In yet another embodiment, the volume is about 100 μl. In yet another embodiment, the volume is about 125 μl. In yet another embodiment, the volume is about 150 μl. In yet another embodiment, the volume is about 175 μl. In yet another embodiment, the volume is about 200 μl. In yet another embodiment, the volume is about 225 μl. In yet another embodiment, the volume is about 250 μl. In yet another embodiment, the volume is about 275 μl. In yet another embodiment, the volume is about 300 μl. In yet another embodiment, the volume is about 325 μl. In yet another embodiment, the volume is about 350 μl. In yet another embodiment, the volume is about 375 μl. In yet another embodiment, the volume is about 400 μl. In yet another embodiment, the volume is about 450 μl. In yet another embodiment, the volume is about 500 μl. In yet another embodiment, the volume is about 550 μl. In yet another embodiment, the volume is about 600 μl. In yet another embodiment, the volume is about 650 μl. In yet another embodiment, the volume is about 700 μl. In yet another embodiment, the volume is about 700-1000 μl.

In certain embodiments, the dose may range from about 1 × 10 ⁹ GC / g brain mass to about 1 × 10 ¹² GC / g brain mass. In certain embodiments, the dose may range from about 3 × 10 ¹⁰ GC / g brain mass to about 3 × 10 ¹¹ GC / g brain mass. In certain embodiments, the dose may range from about 5 × 10 ¹⁰ GC / g brain mass to about 1.85 × 10 ¹¹ GC / g brain mass.

In one embodiment, the viral construct may be delivered at a dose of at least about at least 1 × 10 ⁹ GC to about 1 × 10 ¹⁵ , or about 1 × 10 ¹¹ to 5 × 10 ¹³ GC. Suitable volumes for the delivery of these doses and concentrations can be determined by one skilled in the art. For example, a volume of about 1 μl to 150 ml can be selected, and a higher volume is selected for adults. Typically, suitable volumes are from about 0.5 ml to about 10 ml for newborn infants, and from about 0.5 ml to about 15 ml may be selected for older infants. For toddlers, a volume of about 0.5 ml to about 20 ml may be selected. For children, a volume of up to about 30 ml can be selected. For early teens and teens, a volume of up to about 50 ml can be selected. In yet another embodiment, the patient can be provided with a selected intraluminal administration in a volume of about 5 ml to about 15 ml or a volume of about 7.5 ml to about 10 ml. Other suitable volumes and dosages can be determined. The dosage will be adjusted to balance the therapeutic benefit against any side effects, which dosage may vary depending upon the therapeutic application in which the recombinant vector is used.

The recombinant vector described above can be delivered to a host cell according to published methods. Preferably, rAAV suspended in a physiologically compatible carrier can be administered to human or non-human mammal patients. In certain embodiments, for administration to human patients, rAAV is suitably suspended in an aqueous solution containing saline, surfactant, and physiologically compatible salts or mixtures of salts. Suitably the formulation is adjusted to a physiologically acceptable pH, for example pH 6-9, or pH 6.5-7.5, pH 7.0-7.7, or pH 7.2-7.7. Since the pH of the cerebrospinal fluid is about 7.28 to about 7.32, for intrathecal delivery, pH within this range may be desirable; For intravenous delivery, a pH of about 6.8 to about 7.2 may be desirable. However, the widest range and different pH within these subranges can be selected for different delivery routes.

In yet another embodiment, the composition comprises a carrier, diluent, excipient and / or adjuvant. Suitable carriers can be readily selected by those skilled in the art in view of the indications to which the delivery virus will be associated. For example, one suitable carrier includes saline, which may be formulated with a variety of buffer solutions (eg, phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should contain components that prevent rAAV from sticking to the fusion tubing but do not interfere with rAAV binding activity in vivo. Suitable surfactants, or combinations of surfactants, may be selected from nonionic surfactants that are nontoxic. In one embodiment, a bifunctional block copolymer surfactant terminated with a primary hydroxyl group is selected, for example Pluronic® F68 [Baspsa], also known as poloxamer 188. , It has a neutral pH and a weight average molecular weight of 8400. Nonionic triblock copolymers composed of different surfactants and other poloxamers, ie, central hydrophobic chains of polyoxypropylene (polypropylene oxide) flanked by two hydrophilic chains of polyoxyethylene (poly (ethylene oxide)) , SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (polyoxy capryl glyceride), polyoxyoleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol and polyethylene glycol may be selected . In one embodiment, the formulation contains poloxamer. These copolymers are typically named three letters following the letter “P” (for poloxamer): the first two numbers × 100 give the approximate molecular weight of the polyoxypropylene core, and the last numbers × 10 are poly Provide the percentage of oxyethylene content. In one embodiment poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005% to about 0.001% of the suspension. In one example, the formulation is, for example, in water, sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (eg magnesium sulfate.7H ₂ O), potassium chloride, calcium chloride (eg calcium chloride.2H ₂ O), Buffered saline solution comprising at least one of dibasic sodium phosphate, and mixtures thereof. Suitably, for intrathecal delivery, osmolality is within a range compatible with cerebrospinal fluid (eg, about 275 to about 290) (see emedicine.medscape.com/=article/2093316-overview, for example). ). Optionally, for intrathecal delivery, commercially available diluents can be used as suspending agents or in combination with other suspending agents and other optional excipients (eg, Elliotts B® solution). See Lukare Medical). In another embodiment, the formulation may contain one or more penetration enhancers. Examples of suitable permeation enhancers are, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9 -Laurel ether, or EDTA.

Optionally, the compositions of the present invention may contain other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers, in addition to rAAV and carrier (s). Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

The composition according to the invention may comprise a pharmaceutically acceptable carrier as defined above. Suitably, the compositions described herein are designed for delivery to a subject suspended in a pharmaceutically suitable carrier and / or for delivery to a subject via injection, osmotic pump, intrathecal catheter, or by other device or route. Effective amounts of one or more AAVs in admixture with suitable excipients. In one example, the composition is formulated for intrathecal delivery.

As used herein, the term “intravertebral delivery” or “intravertebral administration” refers to the route of administration for the drug via injection into the spinal canal, more specifically subarachnoid space, such that the drug reaches the cerebrospinal fluid (CSF). Refers to. Intravertebral delivery may include lumbar puncture, intraventricular (including intracranial (ICV)), suboccipital / intracisternal, and / or C1-2 punctures. . For example, the material may be introduced for diffusion through the subarachnoid space by lumbar puncture. In another example, the injection can be done into a cisterna magna.

As used herein, the term “intra-tanal delivery” or “intra-tanal administration” refers to the cerebrospinal fluid of the large cerebellar medullary fluid directly, more specifically through subepithelial puncture or by direct injection into the aperitase tank or permanently. Refers to the route of administration for the drug that is through the tube disposed as.

IV. Apparatus and Methods for Delivering Pharmaceutical Compositions to Cerebrospinal Fluid

In one aspect, the vectors provided herein can be administered intrathecalally via the methods and / or devices provided herein and further described in FIG. 7. Alternatively, other devices and methods may be selected. The method includes advancing a spinal needle to a patient's large tank, connecting the length of the flexible tubing to the proximal hub of the spinal needle, and connecting the output port of the valve to the proximal end of the flexible tubing, and said advancing and connecting After the step and after allowing the tubing to self-prime into the cerebrospinal fluid of the patient, connecting a first container containing any amount of isotonic solution to the flush inlet port of the valve, and then any amount of the pharmaceutical composition Connecting the second vessel containing to a vector inlet port of the valve. After connecting the first vessel and the second vessel to the valve, a path for fluid flow is opened between the vector inlet port and the outlet port of the valve, the pharmaceutical composition is injected into the patient through the spinal needle, and the After injection, the path for fluid flow is opened through the flush inlet port and the outlet port of the valve, and the isotonic solution is injected into the spinal needle so that the pharmaceutical composition is flushed to the patient.

In another aspect, an apparatus for intra-tank delivery of a pharmaceutical composition is provided. The device includes a first container containing any amount of the pharmaceutical composition, a second container containing an isotonic solution, and a spinal needle from which the pharmaceutical composition can be directly discharged from the device into the cerebrospinal fluid in the patient's basin. . The apparatus comprises a first inlet port connected to each other to a first container, a second inlet port connected to each other to a second container, an outlet port connected to each other to a spinal needle, and for controlling flow through the spinal needle of the pharmaceutical composition and isotonic solution And a valve having a luer lock.

 As used herein, the term computed tomography (CT) refers to radiography in which a three-dimensional image of a body structure is constructed by a computer from a series of planar cross-sectional images produced along an axis.

The device or medical device 10 shown in FIG. 7 includes one or more containers 12 and 14 interconnected via a valve 16. Containers 12 and 14 each provide a new source of pharmaceutical composition, drug, vector, or similar material and a new source of isotonic solution, such as saline. The containers 12 and 14 can be in any form of medical device that allows for injection of a fluid to a patient.

By way of example, each container 12 and 14 may be provided in the form of a syringe, cannula, or the like. For example, in the illustrated embodiment, the container 12 is provided as a separate syringe containing any amount of the pharmaceutical composition and is referred to herein as a "vector syringe." For illustrative purposes only, the container 12 may contain about 10 cc of pharmaceutical composition, and the like.

Similarly, the container 14 may be provided in the form of a separate syringe, cannula, etc. containing the amount of saline solution and may be referred to as a "flush syringe". For illustrative purposes only, vessel 14 may contain about 10 cc of saline solution.

Alternatively, the containers 12 and 14 may be provided in a form other than a syringe and may be integrated into a single device, such as an integrated medical injection device comprising a pair of separate chambers (one and a saline solution for pharmaceutical compositions). Have one). In addition, the size of the chamber or vessel may be provided as needed to contain the desired amount of fluid.

In the illustrated embodiment, the valve 16 is provided as a four-way stopcock with a swivel male luer lock 18. The valve 16 is connected to the vessels 12 and 14 (ie, the vector syringe and the flush syringe in the illustrated embodiment), and the swivel male luer lock has a path through the valve 16 to the vessels 12 and 14. It is possible to close or open for each. In this manner, the path through valve 16 may be closed for both the vector syringe and the flush syringe or may be open for the selected one of the vector syringe and the flush syringe. As an alternative to the four-way stopcock, the valve may be a three-way stopcock or a fluid control device.

In the illustrated embodiment, the valve 16 is connected to one end of the length of the extension tubing 20 or to a similar conduit for the fluid. Tubing 20 may be selected based on the desired length or internal volume. By way of example only, tubing may be about 6 to 7 inches long.

In the illustrated embodiment, the opposite end 22 of the tubing 12 is connected to the T-connector extension set 24, which in turn is connected to the spinal needle 26. By way of example, the needle 26 may be a 5 inch, 22 or 25 gauge spinal needle. Also, as an option, spinal needle 26 may be connected to introducer needle 28, such as 3 and 1/2 inch, 18 gauge introducer needles.

In use, spinal needle 26 and / or optional introducer needle 28 may be advanced to the patient towards the basin. After needle advancement, computed tomography (CT) images can be obtained that allow visualization of the needles 26 and / or 28 and corresponding soft tissues (eg, lateral muscle, bone, brain stem and spinal cord). Correct needle placement is confirmed by observation of the cerebrospinal fluid (CSF) in the needle hub and visualization of the needle tip in the tank. Thereafter, a relatively short elongated tubing 20 may be attached to the inserted spinal needle 26, and then a four-way stopcock 16 may be attached to the opposite end of the tubing 20.

The assembly is allowed to "self-prime" into the patient's CSF. Thereafter, a prefilled normal saline flush syringe 14 is attached to the flush inlet port of the four-way stopcock 16 and the vector syringe 12 containing the pharmaceutical composition is a four-way stopcock 16. Vector is attached to the inlet port. Thereafter, the output port of the stopcock 16 is opened with respect to the vector syringe 12 and the contents of the vector syringe can be slowly injected into the patient through the valve 16 and the assembled device over a period of time. For purposes of example only, this time period may be approximately one to two minutes and / or any other time desired.

After the contents of the vector syringe 12 have been injected, the swivel lock 18 on the stopcock 16 may be prepared using the prefilled flush syringe 14 with the stopcock 16 and the needle assembly attached thereto. Rotate to the second position to allow flushing with physiological saline. By way of example only, 1 to 2 cc of physiological saline may be used; More or less amounts can be used as needed. Physiological saline is injected into the patient through a device in which all or most of the pharmaceutical composition is assembled to ensure that little or no pharmaceutical composition remains in the assembled device.

After the assembled device is flushed with saline, its fully assembled device, including the needle (s), extension tubing, stopcock, and syringe, is removed from the subject and a biohazardous waste receptacle or thick container on the surgical tray for disposal. For needle (s)).

The screening process can be performed by the research director, which can ultimately lead to an in-tank (IC) procedure. The study lead may describe the process, procedure, dosing procedure itself and any possible safety risks to provide safe information to the subject (or designated caregiver). History, accompanying medications, physical examinations, vital signs, electrocardiograms (ECGs), and laboratory test results have been obtained or performed, for use in screening assessments of subject eligibility for IC procedures, neuroradiologists, neurosurgeons, and anesthesiologists It is provided to the doctor.

To allow an appropriate time to review eligibility, the following procedure can be performed at any time between the first screening visit and up to one week before the study visit. For example, on day 0, head / neck magnetic resonance imaging (MRI) can be obtained with or without gadolinium (ie, eGFR> 30 ml / min / 1.73 m 2). In addition to head / neck MRI, the investigator may determine the need for any further evaluation of the neck through oyster / kidney studies. MRI protocols may include T1, T2, DTI, FLAIR, and CINE protocol images.

In addition, head / neck MRA / MRV can be obtained according to an institutional protocol that allows for proper assessment of CSF flow and identification of possible blocking or lack of communication between CSF spaces (ie, history of intradural / dural transcutaneous surgery). Subjects may be excluded or further testing (eg, radionucleotide cisternography may be required).

Neuroradiologists, neurosurgeons, and anesthesiologists ultimately discuss and determine the eligibility of each subject for IC procedures based on all available information (scans, medical history, physical examinations, labs, etc.). Keeping in mind the special physiological needs of MPS subjects, anesthesia preoperative assessments that also provide a detailed assessment of the airways, neck (shortened / thick) and range of hair movement (degree of neck bending) are also “-28 days” to “1 day Can be obtained from.

Prior to the IC procedure, the CT Suite will confirm the presence of the following equipment and medication: Adult lumbar puncture (LP) kit (supplied according to the organ); BD (Becton Dickinson) 22 or 25 gauge x 3-7 "spinal needle (Quincke bevel); coaxial introducer needle, used at the discretion of the interventionalist (for the introduction of spinal needle); swivel (spin 4 way small bore stopcock with male luer lock, T-connector extension set (tubing) with female luer lock adapter, approximate length 6.7 inches; Omnipaque 180 (iohexel), for intrathecal administration; Iodinated contrast agent for intravenous (IV) administration; 1% lidocaine solution for injection (if not provided in the adult LP kit); prefilled 10cc physiological saline (sterile) flush syringe; radiopaque marker (s); surgery Preparation equipment / razors; pillows / supports to allow proper placement of intubated subjects; endotracheal intubation equipment, general anesthesia machines and mechanical ventilation; intraoperative neurophysiological monitoring (IONM) equipment (and required personnel); and vectors 10cc containing Fraud; therefore a separate pharmaceutical Manual Ready to carry in the CT / operating room (OR) suite.

The informed consent form for the procedure is identified and documented in the medical record and / or study file. Separate agreements for procedures from the radiology and anesthesia department staff are obtained in accordance with institutional requirements. Subjects allow intravenous access (eg, two IV access sites) placed in appropriate hospital care units in accordance with institutional guidelines. Intravenous fluids are administered at the discretion of the anesthesiologist. At the discretion of the anesthesiologist and in accordance with institutional guidelines, the subject may be guided or done with endotracheal intubation with administration of general anesthetics in the appropriate patient care unit, waiting area, or surgical / CT procedure space.

Lumbar puncture is performed first to remove 5cc of cerebrospinal fluid (CSF), and then contrast medium (omnipaque 180) is injected into the spinal cavity to help visualize the large tank. Appropriate subject placement manipulations can be performed to enable diffusion of contrast agents within the aquarium.

Intraoperative neurophysiological monitoring (IONM) equipment is attached to the subject. The subject is placed on the CT scanner table in prone or side position. Appropriate staff must be present to ensure object stability during transport and placement. If deemed appropriate, subjects may be placed in a manner that provides neck bending to the extent determined to be safe during preoperative evaluation and using normal neurophysiological monitor signals documented after placement.

Identify and identify the following staff on site: mediator / neurosurgeon performing the procedure; Anesthesiologist and respiratory technician (s); Nurses and assistant doctors; CT (or OR) technique; Neurophysiology technicians; And Site Coordinator. A “time-out” can be completed in accordance with the Joint Commission / Hospital Protocol to correctly correct the presence of the correct subject, procedure, site, placement, and all essential equipment in the space. The responsible site investigator can then confirm with the staff whether he / she can proceed to subject preparation.

The skin of the subject under the skull base is shaved as appropriate. CT scout imaging is performed, and then the target location is localized, and if it is determined that the mediator is needed to image the vessel, an IV contrast agent is used to perform a preliminary procedural CT. The target site (bath) is identified, the needle trajectory is planned, the skin is surgically prepared and covered using sterilization techniques according to institutional guidelines. The radiopaque marker is placed at the target skin location as indicated by the mediator. The skin under the marker is anesthetized through penetration into 1% lidocaine. Subsequently, with the choice of using a coaxial introducer needle, the 22G or 25G spinal needle is advanced towards the aquaria.

After needle advancement, CT images are obtained using the thinnest CT slice thickness (ideally 2.5 mm or less) feasible using institutional equipment. Sequential CT images are obtained using the lowest possible radiation dose that allows for proper visualization of the needle and the corresponding soft tissue (eg, lateral muscle, bone, brain stem and spinal cord). Correct needle placement is confirmed by observation of the CSF in the needle hub and visualization of the needle tip in the tank.

The mediator ensures that the vector syringe is placed close to or outside the sterile field. Prior to handling or administering the pharmaceutical composition in the vector syringe, staff assisting the procedure in the sterile field wear gloves, masks and eye protectors.

The extension tubing is attached to the inserted spinal needle, which is then attached to the 4-way stopcock. After this device is “self-primed” with the subject's CSF, a 10 cc prefilled physiological saline flush syringe is attached to the flush inlet port of the 4-way stopcock. The vector syringe is then provided to the mediator and attached to the vector inlet port on the 4-way stop cock.

Open the stopcock's exit port against the vector syringe by placing the swivel lock of the stopcock in the first position, then slowly inject the contents of the vector syringe, taking care not to apply excessive force on the plunger of the syringe during injection (Over about 1-2 minutes). After injecting the contents of the vector syringe, the swivel lock of the stopcock is turned to the second position so that it can be flushed with 1-2 cc physiological saline using a prefilled flush syringe with the stopcock and needle assembly attached.

When ready, the moderator then informs the staff that he / she will remove the device from the subject. In a single action, the needle, elongated tubing, stopcock, and syringe are slowly removed from the subject and placed in a biohazardous waste receptacle or thick container (for the needles) on the surgical tray for disposal.

The needle insertion site is examined for signs of bleeding or CSF leakage and treated as suggested by the investigator. The site is dressed using gauze, surgical tape and / or Tegaderm dressing as shown. The subject is then removed from the CT scanner and laid flat on the stretcher. Appropriate staff are present to ensure object stability during transport and placement.

Anesthesia is discontinued and the subject is cared for according to institutional guidelines for post-anesthesia care. The neurophysiological monitor is removed from the subject. The head of the stretcher on which the subject is lying should be slightly raised during recovery (about 30 degrees). Subjects are transferred to appropriate post anesthesia care units in accordance with institutional guidelines. After the subject has properly restored consciousness and has become stable, he / she will be moved to the appropriate place / unit for protocol delegation assessment. Neurological assessments will be followed according to the protocol, and the primary investigator will supervise the subject treatment in collaboration with hospitals and research staff.

In one embodiment, a method of delivery of a composition provided herein comprises advancing a spinal needle into a log of a patient; Connecting the length of the soluble tubing to the proximal hub of the spinal needle and connecting the outlet port of the valve to the proximal end of the flexible tubing; After the advancing and connecting step and after allowing the tubing to self-prime into the cerebrospinal fluid of the patient, connecting a first vessel containing any amount of isotonic solution to the flush inlet port of the valve, and then any Connecting a second container containing an amount of the pharmaceutical composition to the vector inlet port of the valve; After connecting the first vessel and the second vessel to the valve, opening a path for fluid flow between the vector inlet port and the outlet port of the valve, and injecting the pharmaceutical composition through the spinal needle to the patient; And after injecting the pharmaceutical composition, opening a path for fluid flow through the flush inlet port and the outlet port of the valve and injecting an isotonic solution with a spinal needle to flush the pharmaceutical composition to the patient. do. In certain embodiments, the method further includes identifying proper placement of the distal tip of the spinal needle in the basin prior to connecting the tubing and valve to the hub of the spinal needle. In certain embodiments, the step of identifying includes visualizing a distal tip of the spinal needle in the tank using computed tomography (CT) images. In certain embodiments, the step of identifying comprises observing the presence of cerebrospinal fluid in the patient at the hub of the spinal needle.

In the method described above, the valve exits from the flush inlet port while simultaneously blocking flow through the vector inlet port and a first position allowing flow from the vector inlet port to the outlet port while simultaneously blocking flow through the flush inlet port. A stopcock having a swivel luer lock adapted to the swivel to a second position that allows flow to the port, wherein the swivel luer lock is disposed in the first position when the pharmaceutical composition is injected into the patient, When the pharmaceutical composition is flushed to the patient by an isotonic solution, it is placed in the second position. In certain embodiments, after isotonic solution is injected into the spinal needle to flush the pharmaceutical composition within the patient, the tubing, the valve, and the spinal needle connected to it as an assembly are ejected from the patient. In a particular embodiment, the valve is a four-way stopcock with a swivel male luer lock. In certain embodiments, the first container and the second container are separate syringes. In certain embodiments, the T-connector is located at the hub of the spinal needle and connects the tubing to each other to the spinal needle. Optionally, the spinal needle comprises an introducer needle at the distal end of the spinal needle. The spinal needle can be a 5 inch, 22 or 24 gauge spinal needle. In certain embodiments, the introducer needle is a 3.5 inch, 18 gauge introducer needle.

In certain aspects, the method includes at least a first container for containing any amount of the pharmaceutical composition; A second container for containing an isotonic solution; Spinal needles, wherein the pharmaceutical composition can be directly discharged from the device into cerebrospinal fluid in the patient's basin; And a luer for controlling flow through the spinal needle of the pharmaceutical composition and isotonic solution, and a first inlet port interconnected to the first container, a second inlet port interconnected to the second container, an outlet port interconnected to the spinal needle Use a device consisting of a valve with a lock. In a particular embodiment, the valve is in a first position allowing flow from the first inlet port to the outlet port while simultaneously blocking flow through the second inlet port and the second inlet port while simultaneously blocking flow through the first inlet port. Stopcock with a swivel luer lock adapted to the swivel to a second position that allows flow from the outlet port to the outlet port. Optionally, the valve is a four-way stopcock with a swivel male luer lock. In certain embodiments, the first container and the second container are separate syringes. In certain embodiments, the spinal needles are connected to each other to the valve through the length of the flexible tubing. The T-connector can connect the tubing to each other to the spinal needle. In certain embodiments, the spinal needle is a 5 inch, 22 or 24 gauge spinal needle. In certain embodiments, the device further comprises an introducer needle connected to the distal end of the spinal needle. Optionally, the introducer needle is a 3.5 inch, 18 gauge introducer needle.

Such methods and such devices may be optionally used respectively for intrathecal delivery of the compositions provided herein. Alternatively, other methods and devices can be used for such intrathecal delivery.

In certain embodiments, a composition is provided comprising a rAAVhu68.anti-HER2 antibody, wherein the AAV vector carries a nucleic acid expression cassette encoding an immunoglobulin construct and regulatory sequences that direct expression of the immunoglobulin in the selected cell. After administration of the vector to the CNS, the vector delivers the expression cassette to the CNS and expresses the proteinaceous immunoglobulin construct in vivo. The use of the compositions described herein in anti-neoplastic methods, such as in the use of these compositions in anti-neoplastic therapies, which may optionally include the delivery of one or more other anti-neoplastic or other active agents Are described.

The composition may contain a single type of AAVhu68 vector as described herein containing an expression cassette for delivering anti-neoplastic in vivo. Alternatively, the composition may contain two or more different AAV vectors, each of which may package different expression cassettes therein. For example, two or more different AAVs may have different expression cassettes that express immunoglobulin polypeptides that are assembled in vivo to form a monofunctional immunoglobulin construct. In another example, two or more AAVs may have different expression cassettes expressing immunoglobulin polypeptides for different targets, eg, two are two functional immunoglobulin constructs (eg , anti-Her2 Immunoglobulin constructs and a second anti-neoplastic immunoglobulin construct). As yet another alternative, two or more different AAVs can express an immunoglobulin construct directed to the same target, wherein one of the immunoglobulin constructs is modified to remove FcRn binding and a second immunoglobulin construct Offerings have the ability to bind to FcRn or have improved ability to bind to it. Such compositions may be useful for simultaneously providing antibodies with increased retention in brain area and antibodies for systemic delivery of immunoglobulin constructs.

Optionally, one or both of these immunoglobulin constructs described herein have improved ADCC activity. Therapies as described herein, in addition to one or more of the combinations described herein, may be combined with one of anti-neoplastic biological drugs, anti-neoplastic small molecule drugs, chemotherapeutic agents, immune enhancers, radiation, surgery, or the like. Additional combinations may be included. Biological drugs as described herein are based on peptides, polypeptides, proteins, enzymes, nucleic acid molecules, vectors (including viral vectors), and the like.

Suitably, the compositions described herein may be suspended in one or more pharmaceutically acceptable carriers designed for delivery to a subject via injection, osmotic pump, intrathecal catheter or for delivery by another device or route. An anti-neoplastic effective amount of AAVhu68. In one example, the composition is formulated for intrathecal delivery. As used herein, injection into the intravertebral delivery spinal canal, more specifically, subarachnoid space. However, other delivery routes may be selected, and pharmaceutically acceptable carriers for AAV compositions may be selected from other suitable direct or systemic routes, for example intracranial, intranasal, intracranial, intracranial fluid delivery, ie Ommaya reservoir.

The composition may be formulated in dosage units to contain an amount of AAV ranging from about 1 × 10 ⁹ genomic copy (GC) to about 5 × 10 ¹³ GC (when treating an average subject weighing 70 kg body weight). In one embodiment, a spinal tap is performed wherein from about 15 ml (or less) to about 40 ml of CSF is removed and the vector is mixed with CSF and / or suspended in a compatible carrier and delivered to the subject do. In one example, the vector concentration is about 3 × 10 ¹³ GC, other amounts, such as about 1 × 10 ⁹ GC, about 5 × 10 ⁹ GC, about 1 × 10 ¹⁰ GC, about 5 × 10 ¹⁰ GC, about 1 × 10 ¹¹ GC, about 5 × 10 ¹¹ GC, about 1 × 10 ¹² GC, about 5 × 10 ¹² GC, or about 1.0 × 10 ¹³ GC.

In one embodiment, the compositions described herein are used in a method for delaying tumor growth. In yet another embodiment, the compositions described herein are useful for reducing tumor size in a subject. In further embodiments, the compositions described herein are useful for reducing the number of cancer cells in non-solid tumor cancers. In another embodiment, the compositions provided herein are used in a method of increasing overall survival and / or progression free survival in a patient. Anti-neoplastic immunoglobulin constructs are selected in view of the neoplasm to be treated. For example, for the treatment of metastatic breast cancer in the brain, expression cassettes for anti-HER antibodies can be engineered with the recombinant AAV described herein. Optionally, the AAV compositions described herein are administered in the absence of additional exogenous pharmacological or chemical agents or other physical disruption of the blood brain barrier. In combination therapy, the AAV-delivered immunoglobulin constructs described herein may be used before, during or after the start of treatment with any other agent as well as any combination thereof, ie the start of anti-neoplastic therapy. Before and after start, before and after start, during and after start, or before start, during start and after start. For example, AAV can be administered 1 to 30 days, preferably 3 to 20 days, more preferably 5 to 12 days before the start of radiation therapy. In another embodiment of the invention, the chemotherapy is administered concurrently with AAV-mediated immunoglobulin (antibody) therapy, more preferably after this. In yet other embodiments, the compositions of the invention can be combined with other biological agents, such as recombinant monoclonal antibody drugs, antibody-drug conjugates, and the like. In addition, combinations of different AAV-delivery immunoglobulin constructs as discussed above can be used in such therapies. Any suitable method or route can be used to administer the AAVhu68.anti-Her2-containing composition as described herein, and optionally, to co-administer the anti-neoplastic agent and / or antagonist of other receptors. have. Anti-neoplastic agent therapies used in accordance with the present invention include any therapy deemed optimally suitable for the treatment of neoplastic conditions in a patient. Different malignancies may require the use of specific anti-tumor antibodies and specific anti-neoplastic agents, which will be determined per patient. Routes of administration include, for example, systemic, oral, intravenous, intraperitoneal, subcutaneous, or intramuscular administration. The amount of antagonist administered depends on a number of factors, including, for example, the type of antagonist, the type and severity of the tumor to be treated, and the route of administration of the antagonist.

It should be noted that singular expression refers to one or more. As such, the singular forms “a” and “at least one” are used interchangeably herein.

The words "comprise", "comprises", and "comprising" are to be understood as inclusive and not exclusive. The words "consist of," "consisting of," and variations thereof are to be understood as exclusive, not inclusive. Where various embodiments are presented herein using the expression “comprising” under different circumstances, related embodiments are intended to be described and described using the expression “consisting of” or “consisting essentially of”.

As used herein, the term “about” means 10% variation (± 10%) from a given reference value unless otherwise indicated.

As used herein, "disease", "disorder" and "condition" are used interchangeably to indicate abnormal conditions in a subject.

Unless defined otherwise herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art, and provide those skilled in the art with general guidance on many of the terms used in this application. Reference is made to the published literature.

The term "expression" is used herein in its broadest sense and includes the production of RNA or RNA and proteins. In the context of RNA, the term “expression” or “translation” relates in particular to the production of peptides or proteins. Expression can be transient or stable.

As used herein, the term “NAb titer” is a measure of how much neutralizing antibody (eg, anti-AAV Nab) is produced that neutralizes the physiological effects of a targeted epitope (eg, AAV). Anti-AAV NAb titers are described, for example, in Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses. Journal of Infectious Diseases, 2009. 199 (3): p. 381-390, can be measured as described.

As used herein, "expression cassette" refers to a nucleic acid molecule comprising a coding sequence, a promoter, and may include other regulatory sequences for this. In certain embodiments, the vector genome may contain two or more expression cassettes. In other embodiments, the term “transgene” may be used interchangeably with “expression cassette”. Typically, such expression cassettes for generating viral vectors contain coding sequences and other expression control sequences for the gene products described herein flanked by the packaging signal of the viral genome, such as those described herein.

The abbreviation “sc” refers to self-complementarity. "Self-complementary AAV" refers to a construct in which the coding region carried by the recombinant AAV nucleic acid sequence is designed to form an intramolecular double stranded DNA template. Upon infection, without waiting for cell mediated synthesis of the second strand, two complementary halves of the scAAV will associate to form one double stranded DNA (dsDNA) ready for immediate replication and transcription (eg, DM McCarty et al, "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248-1254]. Self-complementary AAV is described, for example, in US Pat. No. 6,596,535, each of which is incorporated herein by reference in its entirety; 7,125,717; 7,125,717; And 7,456,683.

As used herein, the term “operably linked” refers to both expression control sequences adjacent to the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.

The term “heterologous (heterologous)” when used in connection with a protein or nucleic acid denotes that the protein or nucleic acid comprises two or more sequences or subsequences that are not originally found in the same relationship with each other. For example, nucleic acids having two or more sequences from unrelated genes arranged to produce new functional nucleic acids are typically produced recombinantly. For example, in one embodiment, the nucleic acid has a promoter from one gene that is arranged to drive expression of coding sequences from different genes. Thus, in terms of coding sequences, promoters are heterologous.

"Clone-defective virus" or "viral vector" refers to a synthetic or artificial viral particle in which an expression cassette containing the gene of interest is packaged in a viral capsid or envelope, wherein any packaged also in the viral capsid or envelope The viral genomic sequence is replication-defective; That is, they cannot produce progeny virions but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome is "gutless"-only contains genes of interest flanked by signals necessary for amplification and packaging of the artificial genome. May be supplied during production). Thus, it is considered safe for use in gene therapy because replication and infection by progeny virions cannot occur except in the presence of viral enzymes required for replication.

In many instances, rAAV particles are referred to as "DNase resistance". However, in addition to these endonucleases (DNase), other endo- and exo-nucleases can also be used in the purification steps described herein to remove contaminated nucleic acid. Such nucleases can be selected to degrade single stranded DNA and / or double stranded DNA, and RNA. This step may contain a single nuclease, or a mixture of nucleases directed at different targets, and may be endonucleases or exonucleases.

The term “nuclease-tolerance” refers to the degradation of a nuclease incubation step designed to remove contaminated nucleic acid that may be present from the production process, where the AAV capsid is fully assembled around an expression cassette designed to deliver the gene to a host cell. Protecting these genomic sequences from digestion).

As used herein, "effective amount" refers to the amount of rAAV composition expressed in a target cell by delivering the amount of gene product from the vector genome. Effective amounts can be determined based on animal models, not on human patients. Examples of suitable murine (murine) models are described herein.

In certain embodiments, an rAAV or composition as provided herein excludes an anti-influenza antibody or immunoglobulin construct. In certain embodiments, an rAAV or composition as provided herein excludes a spinal muscular atrophy (SMA) gene or SMN coding sequence.

The term "translation" in the context of the present invention relates to a process in ribosomes, wherein the mRNA strand controls the assembly of the amino acid sequence to produce a protein or peptide.

As used throughout this specification and claims, the terms “comprising”, “containing”, “including”, and variations thereof include other components, elements, integers, steps, and the like. In contrast, the terminology made and variations thereof excludes other components, elements, integers, steps, and the like.

It should be noted that singular expression refers to one or more, for example "enhancer" is understood to represent one or more enhancer (s). As such, the singular forms “a” and “at least one” are used interchangeably herein.

As described above, the term “about” when used to modify numerical values means a variation of ± 10% unless otherwise specified.

The following examples are illustrative only and are not intended to limit the invention.

EXAMPLE

In certain embodiments, AAVhu68 capsids have also been found to yield good AAV9 belonging to clade F. Changes in the amino acids of either or both of glutamic acid at position 67 (Vlu) and valine at position 157 (Val) can confer such increased yields. In certain embodiments, the vector with AAVhu68 capsid provides at least a 15% increase in yield of the packaged vector when compared to a vector based on AAV9. In comparison between AAVhu68 and AAVrh10, AAVhu68 was found to provide better transduction efficiency than AAVrh10 at low doses (eg about 1 × 10 ⁹ ) following intracerebroventricular administration.

Example 1

A. Identification of AAVhu68

Tissue DNA was extracted from human tissue samples as PCR templates using a QIAamp column (Qiagen) according to the manufacturer's instructions with the following modifications. Q5 DNA polymerase (Q5® Hot Start High-Fidelity 2X Master Mix, NEB) was selected for its significantly higher fidelity and strong efficiency, as described by Gao, et al [Proc Natl Acad Sci USA, 2002 Sep 3, 99 (18): 11854-11859 (Epub 2002 Aug 21)], and recovered the full-length VP1 gene of potential AAV from the sample as described, and the modified primer set is as follows: instead of AV1NS, GCTGCGYCAACTGGACCAATGAGAAC primer, prm504 [SEQ ID NO: 7] was used, and instead of reverse primer AV2CAS, prm505: CGCAGAGACCAAGTTCAACTGAAACGA [SEQ ID NO: 8] was used. PCR conditions were modified as follows:

PCR program

A band of about 3 kb from the PCR was cleaved from the gel; DNA was extracted with QIAquick Gel Extraction Kit (Qiagen) and cloned into Zero Blunt® TOPO® PCR Cloning Kit (Thermo Fisher Scientific). The plasmid was sequenced to obtain the full length of the AAV VP1 gene. In most of the samples, at least three plasmids were fully sequenced and the consensus sequence was derived as the final AAV sequence for that sample.

The obtained nucleic acid sequence encoding the vp1 capsid protein of AAVhu68 is provided in SEQ ID NO: 1 (see also FIGS. 2A-2C). The vp1 amino acid sequence of AAVhu68 is provided in FIG. 1 and SEQ ID NO. Compared with AAV9, AAVhu31 and AAVhu32, two mutations (A67E and A157V) were identified as important in AAVhu68 (circled in FIG. 1).

This amplification method also provided a spacer sequence between the vp1 coding sequence and the rep coding sequence. This coding sequence is atgacttaaaccaggt, SEQ ID NO: 9. The coding sequence for rep52 of AAVhu68 is shown in SEQ ID NO: 3. The rep52 protein sequence is also shown in SEQ ID NO: 4.

The pAAV2 / hu68 trans plasmid was then prepared by loading the VP1 gene of hu68 into the pAAV2 / 9 backbone instead of the AAV9 VP1 gene to evaluate packaging efficiency, yield and transduction properties. The pAAV2 / 9 plasmid contains AAV2 5 'and 3' ITRs flanking the capsid gene and is based on the Pen Vector Core (University of Pennsylvania, Philadelphia, Pennsylvania, pennvectorcore.med.upenn.edu Available from].

B. Characterization of AAVhu68

Although this phenomenon has not already been observed or described in adeno-associated virus capsids, it has been found that other proteins and peptides are susceptible to various chemical modifications, both in vivo as well as in vitro. One of the most frequent modifications is the deamidation of asparagine, a spontaneous non-enzymatic reaction. In general, the half-life of asparaginyl deamidation under physiological conditions (pH 7.4, 37 ° C.) is about 1 to 1000 days. A similar series of reactions takes place at the glutamine to glutamate residues, but this reaction is much slower than the reaction of its asparagine counterpart.

In short peptides, the formation of cyclic intermediates is controlled by the primary sequence, but the secondary, tertiary and quaternary structures in the protein have additional effects. Thus, the deamidation rate of each protein amide is uniquely determined. Mass spectrometric identification of deamidated peptides is relatively simple because deamidation adds to the mass of the intact molecule + 0.984Da (mass difference between -OH and -NH ₂ groups). Because deamidation is a stable modification in the gas phase, the MS / MS spectrum can indicate the location of deamidation even in the presence of some potential deamidation sites.

Four AAVhu68 vectors were prepared using one of four vector genomes unrelated to this study, each of which was prepared using the conventional triple transfection method in 293 cells. For a general description of such techniques, see, eg, Bell CL, et al., "The AAV9 receptor and its modification to improve in vivo lung gene transfer in mice.", J Clin Invest. 2011; 121: 2427-2435. Briefly, the sequences to be packaged (chicken β-actin) flanked by AAV2 inverted terminal repeats by triple transfection of HEK293 cells with plasmids encoding the AAV2 rep gene and AAVhu68 cap gene and adenovirus helper plasmid (pAdΔF6) The plasmid encoding the gene product expressed from the promoter, intron and growth hormone polyA) was packaged. The resulting AAV virus particles can be purified using CsCl gradient centrifugation, concentrated and frozen for future use.

Denaturation and alkylation: To 100 μg thawed virus preparation (protein solution) 2 μl of 1M dithiothreitol (DTT) and 2 μl of 8M guanidine hydrochloride (GndHCl) are added and incubated at 90 ° C. for 10 minutes. The solution is cooled to room temperature, then 5 μl of freshly prepared 1M iodoacetamide (IAM) is added and incubated in the dark for 30 minutes at room temperature. After 30 minutes, 1 μl of 1M DTT is added to stop the alkylation reaction.

Digestion: To the denatured protein solution is added 20 mM ammonium bicarbonate, pH 7.5 to 8, in a volume diluting the final GndHCl concentration to 800 mM. Protease solution (trypsin or chymotrypsin) is added at a protease to protein ratio of 1:20 and incubated overnight at 37 ° C. After digestion, the digestion reaction is stopped by adding TFA to a final concentration of 0.5%.

Mass Spectroscopy: Approximately 1 microgram of the combined digestion mixture is analyzed by UHPLC-MS / MS. LC is performed on an UltiMate 3000 RSLCnano System (Thermo Scientific). Mobile Phase A is MilliQ water containing 0.1% formic acid. Mobile phase B is acetonitrile containing 0.1% formic acid. The LC gradient is performed from 4% B to 6% B for 15 minutes, then to 10% B for 25 minutes (40 minutes total), and then to 30% B for 46 minutes (86 minutes total). The sample is loaded directly into the column. Column size is 75 cm x 15 um I.D. and filled with 2 micron C18 medium (Acclaim PepMap). The LC is connected to a quadrupole-Obitlab mass spectrometer (Q-Exactive HF, Thermo Scientific) via nanoplex electrospray ionization using a source. The column is heated to 35 ° C. and an electrospray voltage of 2.2 kV is applied. The mass spectrometer is programmed to obtain tandem mass spectra from the top 20 ions. The full MS resolution is 120,000 and the MS / MS resolution is 30,000. The normalized collision energy is set to 30, the automatic gain control is set to 1e5, the maximum charge MS is set to 100 ms, and the maximum charge MS / MS is set to 50 ms.

Data Processing: Mass spectrometer raw data files were analyzed by BioPharma Finder 1.0 (Thermo Scientific). In short, all explorations include 10 ppm precursor mass tolerance, 5 ppm fragment mass tolerance, trypsin cleavage, up to 1 lost cleavage, fixed modifications of cysteine alkylation, methionine / tryptophan oxidation, asparagine / glutamine deamidation, phosphorylation Variable modifications of methylation and amidation were required.

In the table below, T refers to trypsin and C refers to chymotrypsin.

In the case of the AAVhu68 capsid protein, four residues (N57, N329, N452, N512) routinely exhibit high levels of deamidation, which in most cases is greater than 90% over various lots. Additional asparagine residues (N94, N253, N270, N304, N409, N477) and Q599) also exhibit up to about 20% deamidation level over various lots. Deamidation levels were first identified by trypsin digestion and verified by chymotrypsin digestion.

Example 2-Yield of AAVhu68 Vector

AAVhu68 and AAV9 vectors bearing various tags, such as GFP and LacZ, were generated and evaluated. Each vector is described by Gao et al [Gao, Guang-Ping, et al. "Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy." Proceedings of the National Academy of Sciences 99.18 (2002): 11854-11859, were generated using triple transfection techniques in 293 cells.

A. Production of pAAVhu68 Trans Plasmid

The nucleic acid sequence encoding the vp1 capsid protein is provided in SEQ ID NO: 1.

The pAAV2 / hu68 trans plasmid was prepared by loading the VP1 gene of hu68 into the pAAV2 / 9 backbone instead of the AAV9 VP1 gene to evaluate packaging efficiency, yield and transduction properties. The pAAV2 / 9 plasmid contains AAV2 5 'and 3' ITRs flanking the capsid gene and is available from Pen Vector Core (University of Pennsylvania, Pennsylvania, Pennsylvania, pennvectorcore.med.upenn.edu).

B. Yield of AAVhu68 Vector

293 cells were cultured and DMEM containing 4.5 g / L glucose, L-glutamine and sodium pyruvate supplemented with 10% fetal calf serum, 5% CO _{2 in} 1 × (Dulbecco's variant of Eagles minimum essential medium) It was kept at 37 ° C. under an atmosphere with. Vector plasmids were replaced with pAAV2 / hu68 or pAAV2 / 9, as described by Gao et al [Gao, Guang-Ping, et al. Transfection techniques were performed as described in "" Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. "Proceedings of the National Academy of Sciences 99.18 (2002): 11854-11859]. The gen (expression cassette) was CB7.CI.ff luciferase.RBG Transfected cells were further cultured in 6-well plates Supernatants as well as total lysates of cells were described in Gao et al [Gao, Guangping, et al. Rabbit beta-globin of transgenes (expression cassette) as described in "Purification of recombinant adeno-associated virus vectors by column chromatography and its performance in vivo." Human gene therapy 11.15 (2000): 2079-2091. Collected for virus quantitation via Takman (Applied Biosystems) analysis by using primers and probes targeting the polyA region, 6 pAAV2 / 9 plasmids and 6 pAAs Yields of the V2 / hu.68 plasmids were compared head-to-head in 6-well plates with respect to both supernatant titers and total lysate titers, each plasmid derived from a separate bacterial colony.

The yield of AAVhu68 was found to be similar to that of AAV9 with respect to total lysate (FIG. 3A, n = 6, p = 0.42). However, in the supernatant, the yield of AAVhu68 was significantly higher than that of AAV9 (FIG. 3B, n = 6, p = 0.00303). Thus, AAVhu68 has proven to be a better vector compared to AAV9 with respect to production because the supernatant is harvested during cell-lamination and virus production.

Example 3 In Vivo Transduction of AAVhu68.LacZ

AAVhu68.CB7.nLacZ (also referred to as AAVhu68.LacZ) was generated by inserting a sequence (nLacZ) encoding nuclear-localized bacteria β-galactosidase and then producing as described in Example 2. In order to evaluate the packaging efficiency, yield, transduction properties, transduction efficiency and flavour of AAVhu68 in vivo, mice were treated with 5 × 10 ¹¹ genomic copies of the AAVhu68.LacZ vector in various methods of administration, including intravenous, intramuscular and Injection is by intranasal administration. Two weeks after vector administration, mice were sacrificed and muscle, lung, liver and heart were collected. Frozen slices of each organ were prepared, processed and analyzed as conventional protocols for detecting LacZ gene expression [Bell, Peter, et al. "An optimized protocol for detection of E. coli β-galactosidase in lung tissue following gene transfer." Histochemistry and cell biology 124.1 (2005): 77-85]. Positive staining for LacZ, which appears in blue (FIGS. 4A-4C), indicates successful transduction of AAVhu68.

As shown in FIG. 4A, after the vector was introduced into the mouse via intravenous injection (IV), all tested organs (heart, liver, lung and muscle) showed AAVhu68 transduction, Liver preference is observed. After the vector was introduced into the mouse via intramuscular injection (IM), the heart, liver and muscle showed a high transduction rate of AAVhu68, but no transduction was observed in the lung. When intranasal administration was performed, interspersed transduction was observed in the heart, liver, muscles and lungs.

These results showed that AAVhu68 showed high transduction efficiency and broad tissue / organ orientation.

Example 4-In vivo of AAVhu68.GFP compared to AAV9.GFP Transduction

AAVhu68.GFP and AAV9.GFP were generated by inserting a gene encoding green fluorescent protein (GFP) as a gene and then producing as described in Example 2. To assess the packaging efficiency, yield, transduction properties, transduction efficiency and orientation of AAVhu68 and AAV9 in vivo, mice were dosed with AAVhu68.GFP or AAV9.GFP at a dose of 1 × 10 ¹⁰ GC or 1 × 10 ¹¹ GC. Administered. Two weeks after vector administration, mice were sacrificed and brain, muscle, lung, liver and heart were collected. Wang et al. Wang L, et al., Hum Gene Ther. 2011 Nov; 22 (11): 1389-401; Wang L, et al., Mol Ther. 2010 Jan; 18 (1): 126-34], frozen flakes of each organ were prepared and processed to visualize GFP expression. Positive staining for GFP that appears in green (FIGS. 5A-5C and 6A-6D) indicates successful transduction of test vectors.

Slices from various brain regions (hippocampus, motor cortex and cerebellum) of mice with intravascular cerebrovascular administration of the vectors were examined. Transduction of AAV vectors was observed in all tested hippocampal samples except from mice injected with 1 × 10 ¹⁰ GC of AAV9.GFP. Better transduction of AAVhu68.GFP compared to that of AAV9 was observed in the motor cortex. In addition, transduction in the cerebellum of AAVhu68.GFP was observed only in mice injected with 1 × 10 ¹⁰ GC vector. Thus, AAVhu68 showed higher transduction efficiency as well as a wider range of fragrances in the brain than AAV9.

In further experiments, various organs such as liver, kidney, heart and pancreas were prepared from mice administered AAVhu68.GFP intravenously, and described by Wang et al [Wang L, Calcedo R, Bell P, Lin J, Grant]. RL, Siegel DL, Wilson JM, Hum Gene Ther. 2011 Nov; 22 (11): 1389-401; Wang L, Calcedo R, Wang H, Bell P, Grant R, Vandenberghe LH, Sanmiguel J, Morizono H, Batshaw ML, Wilson JM, Mol Ther. 2010 Jan; 18 (1): 126-34]. Positive signals from GFP, shown in green, indicate successful transduction of the AAV vector. Clear organ phases appearing in black and white were provided for organ morphology, but the corresponding red fluorescent channel served as a negative control.

A strong positive signal, shown in green, was observed in the liver and kidney, heart and pancreas likewise exhibited the transduction of the vector, indicating a broad tissue / organ orientation of the AAVhu68 vector.

Example 5-Yield and in vivo transduction of AAV vectors with A67E and A157V mutations

To increase the yield and / or packaging efficiency of the recombinant adeno-associated (rAAV) vector, the AAV capsid gene is expressed as an AAV capsid gene expressing the vp1 protein with Glu at amino acid position 67 and / or Val with amino acid position 157. For example, engineered with AAV9, AAVhu31 and AAVhu32, wherein the numbering of amino acid residues is based on the numbering of AAVhu68 (SEQ ID NO: 5). The AAV vectors were prepared according to Example 2 and evaluated for the yield of each vector. In vivo transduction efficiency and tissue / organ / region orientation are further assessed as illustrated in conventional methods, such as Example 3.

Example 6 Intraluminal AAVhu68.CMV.PI.hTrastuzumab.SV40 for Prevention of Human HER2 + Breast Cancer Brain Metastasis

A. Summary

The objective of this study was to determine the recombinant Adeno-associated virus AAVhu68.CMV.PI.h trastuzumab.SV40, an antigenic type AAVhu68 containing a trastuzumab expression cassette for the prevention of human HER2 + breast cancer brain metastasis in xenograft mouse models. (AAVhu68. Trastuzumab) was to test the therapeutic efficacy. Trastuzumab (Herceptin®, Roche) is a humanized monoclonal antibody (mAb) directed against HER2 that, when used intravenously in chemotherapy to treat systemic HER2 + disease, prolongs patient survival. )to be. However, the blood-brain barrier rejects Herceptin® administered intravenously into the central nervous system, making it impossible to effectively treat HER2 + breast cancer brain metastases. Some case reports indicate that intrathecal-administered Herceptin® can increase the survival of patients with HER2 + meningoid disease or stop the progression of HER2 + lesion metastasis [J. Bendell, et al, Central nervous system metastases in women who receive trastuzumab based therapy for metastatic breast carcinoma. Cancer. 97, 2972-2977 (2003); D. J. Slamon, et al., Use of Chemotherapy plus a Monoclonal Antibody against HER2 for Metastatic Breast Cancer That Overexpresses HER2. N. Engl. J. Med. 344, 783-792 (2001), M. A. Cobleigh, et al, Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J. Clin. Oncol. 17, 2639-2648 (1999), Zagouri F, et al, (2013). Intrathecal administration of trastuzumab for the treatment of meningeal carcinomatosis in HER2-positive metastatic breast cancer: a systematic review and pooled analysis. Breast Cancer Res Treat, 139 (1): 13-22., Bousquet G, et al. (2016). Intrathecal Trastuzumab Halts Progression of CNS Metastases in Breast Cancer. J Clin Oncol. 34 (16): e151-155. However, CSF is rapidly turned over, possibly undermining the therapeutic effect of IT Herceptin® due to the highly variable CSF pharmacokinetic profile. The purpose of AAVhu68. Trastuzumab treatment is to provide localized long-term expression of AA Vhu6 8. trastuzumab in the brain parenchyma itself, thereby preventing development, slowing growth, improving survival, or associated with HER2 + BCBM. It is to increase the clinical scale of quality.

AAVhu68. Trastuzumab is intracranial in 6-9 week old RAG1 ^-/- mice at four different doses (1.00 × 10 ¹⁰ , 3.00 × 10 ¹⁰ , 1.00 × 10 ¹¹ , and 3.00 × 10 ¹¹ GC / animal). Administration was by intraracranioventricular injection (ICV). BT474.M1.ffluc cells derived from the HER2 + human vascular carcinoma cell line were transplanted after at least 21 days. Mice were observed daily and euthanized at the end of the study. Brain tissue was collected at necropsy to determine tumor volume. Prophylactic ICV administration of AAVhu68.CMV.PI.htrastuzumab.SV40 in the RAG1 ^-/- xenograft model of HER2 + breast cancer brain metastasis, concluded that this experiment significantly reduced tumor volume in all dose tests. Together, these results show that AAVhu68. Improves survival of patients with HER2 + BCBM. The therapeutic efficacy of trastuzumab has been demonstrated.

B. The purpose of this study was to investigate the minimal essential dose (MED) of AAVhu68. Trastuzumab for tumor prevention in a RAG1 ^{− / −} xenograft model of HER2 + BCBM by study of tumor volume. The vector is AAVhu68.CMV.PI.h trastuzumab. SV40 or AAVhu68. Trastuzumab.

ddPCR titer: 7.38 × 10 ¹³ GC / mL

Endotoxin: less than 2.0EU / ml

Purity: 100%

Phosphate Buffered Saline (PBS) (No Treatment Control)

The ability of AAVhu68. Trastuzumab to provide tumor prevention was assessed using the RAG1 ^-/- murine xenograft model of HER2 + BCBM. Immunodeficiency mouse models allow the growth of orthotopic tumors of human origin in mice without rejection by the mouse immune system. In addition, RAG1 ^{− / −} mice do not have endogenous IgG, allowing trastuzumab to be quantified by Protein A ELISA.

Test article and negative control were diluted to appropriate concentrations with sterile phosphate buffered saline (PBS). The vector was administered ICV to the left lateral ventricle.

Various routes for the CSF approach can be used to perform intraluminal AAV delivery. The ICV route was chosen because it is minimally noninvasive (compared to the tank route requiring incision through the skin and muscles of the neck) and does not require any surgical procedure in the mouse. By our experiments and other researchers, it has already been demonstrated that single injections of AAV9 vectors into cerebrospinal fluid (ICV or macropump) in both mice and large animals target neurons throughout the entire brain [Dirren at al. (2014). Intracerebroventricular Injection Of Adeno-Associated Vims 6 And 9 Vectors For Cell Type-Specific Transgene Expression In The Spinal Cord. Hum. Gene. Therapy 25, 109-120, Snyder et al. (2011). Comparison Of Adeno-Associated Viral Vector Serotypes For Spinal Cord And Motor Neuron Gene Delivery. Hum. Gene Ther 22, 1129-1135, Bucher et al. (2014). Intracistemal Delivery Of AAV9 Results In Oligodendrocyte And Motor Neuron Transduction In The Whole Central Nervous System Of Cats. Gene Therapy 21, 522-528, Hinderer et al. (2014). Intrathecal Gene Therapy Corrects CNS Pathology In A Feline Model Of Mucopolysaccharidosis I. Mol Ther: 22,2018-2027].

C. Tumor Cell Transplantation in RAG1-/-Mice

To generate a mouse xenograft model for HER2 + BCBM, a human HER2 + vascular cell carcinoma cell line transduced with the Firefly Luciferase, BT474-M1.ffluc was used. For the injection procedure, mice were anesthetized with ketamine / xylazine. Shears the scalp and neck. Time Delayed-Release 17-β Estaradiol Pellets (1.7 mg, 90-day release, Innovative Research of America) was implanted subcutaneously in the back of the neck and every 90 days during the study. Readminister. Mice were fixed to the stereotactic device. Exposed skin was wiped with povidone-iodine and 70% ethanol. A 1 cm front and back incision was made at the top of the skull. Bregma was identified. The pneumatic drill was placed in the bregma, and then moved 0.8 mm rear and 2.2 mm left of the bregma, at which time a burr hole was drilled in the skull. 25 μl of Hamilton syringes were loaded with 5 μl of tumor cell suspension (50:50 MatriGel®: 100,000 total cells in PBS). The needles were brought into bregma and moved to the coordinates presented above and then penetrated into the brain parenchyma at 4.0 mm. The needle was then lifted 1.0 mm back onto the needle track to create a pocket for tumor cells to be injected. The needle was held in position for 5 minutes. Next, 5 μl of cell suspension was injected over 10 minutes using an autoinjector. The needle was held in place for 5 minutes after the injection was complete and then slowly removed. The incision on the skull was sutured with 4.0 bikes and mice were given subcutaneously with 15 mg / kg Enrofloxacin (Bielsa) in sterile PBS with 0.3 mg / kg buprenorphine in sterile PBS.

Mice were monitored daily. When dying, mice were over-exposed to CO2 and euthanized by cervical rupture. At necropsy, the brain was isolated and cut coronally through the tumor injection needle track.

Tumor Volume: Measurement of the 35-day tumor diameter was performed using a digital vernier caliper (Thermo Fisher). Brains were harvested at necropsy. Tumors were isolated from surrounding brain tissue using blunt dissection on tumor injection needle tracks. The tumor diameter was then measured in three dimensions (x, y and z) and the tumor volume was calculated as the volume of the ellipsoid, 4/3 * pi * x / 2 * y / 2 * z / 2. The right hemisphere, the opposite hemisphere against the vector injection and tumor implant sites, was preserved in formalin. Excised tumors were pooled by dose cohort and preserved in formally. Tumor volume comparisons were performed in GraphPad Prism 7 using the Mann-Whitney test.

D. Results

Tumor Volume: IT AAVhu68. Trastuzumab To determine if tumor prevention slowed tumor growth, we measured tumor diameter 35 days after transplantation. The median volume of tumors (0.4 mm 3, n = 10) from the group given the highest dose of AAVhu68. Trastuzumab tumor prophylaxis was significantly smaller than mice not given any treatment (26.1 mm, n = 9). All mice given lower doses of AAVhu68. Trastuzumab had significantly smaller tumors compared to no treatment. The median tumor volume of mice given 1.00 × 10 ¹⁰ GC / mouse was calculated to be statistically equivalent to the median tumor volume of mice given 3.00 × 10 ¹⁰ GC / mouse (p = 0.6029). Importantly, two mice in group 1, one mouse in group 2, three mice in group 3 and three mice in group 4 had no significantly visible tumor at the time of dissection.

At all doses, IT administration of AAVhu68. Trastuzumab is significantly at D35 days post-tumor transplantation when administered prophylactically in the RAG1 ^-/- murine xenograft model of HER2 + BCBM using the HER2 + BT474.M1 human vascular carcinoma cell line. Followed by a smaller lieutenant volume. The AAVhu68. Trastuzumab MED measured in this study was 1.00 × 10 ¹⁰ GC / mouse.

Example 7 Production Yield and Purity for AAVhu68 Vectors

Recombinant adeno-associated (rAAV) vectors with different capsids, ie two different sets of vectors with different capsids, such as AAVhu68, AAV8 triple, AAV8 and AAV9, were prepared and prepared.

Briefly, on a small scale production of a set of vectors with a vector genome (CMV.ff luciferase.SV40) comprising the presented capsid and cytomegalovirus promoter (CMV), firefly luciferase coding sequence, and SV40 poly A And the yield of each vector was evaluated. The results show that the AAV9 vector provided the highest yield, while the AAVhu68 vector was next second (FIG. 8A). AAV8 and AAV8 triple vectors also gave yields greater than 4 × 10 ¹³ GC (FIG. 8A).

The remaining set of vectors having the presented capsid and vector genome (CMV.PI.201Ig IA.SV40) comprising the CMV promoter, intron, immunoadhesive coding sequence (201 Ig IA) and SV40 poly A, were mega scaled according to conventional methods. Were produced and evaluated for the yield and purity of each vector. The results are shown in FIGS. 8B and 9.

Similar to the production yield on a small scale, the AAV9 vector provided the highest yield at about 5.7 × 10 ¹⁴ GC, while the AAVhu68 vector was next at about 3.8 × 10 ¹⁴ GC (FIG. 8B). The AAV8 vector yielded about 3.6 × 10 ¹⁴ GC and the AAV8 triple yielded about 1.8 × 10 ¹⁴ GC (FIG. 8B). The purity of the formulations tested is comparable in the range of about 97.4% to about 98.6%.

Example 8 rAAV Vectors in Male RAG KO Mice.

Gene expression was tested in vivo using rAAV vectors with different capsids, including AAVhu68, AAV8 triple, AAV8 and AAV9, expressing the secreted transgene product 201Ig IA.

Male RAG KO mice (n = 5 / group) 6-8 weeks old were administered intramuscularly into the gastrocnemius muscle with test vectors 3 × 10 ¹¹ GC / mouse or 3 × 10 ¹⁰ GC / mouse using a Hamilton syringe. Serum was collected weekly from mice administered with the vector expressing the protein secreted by submandibular bleeding into the serum collection tube. Transgene expression levels are described in serum by Greig et al., Intramuscular Injection of AAV8 in Mice and Macaques Is Associated with Substantial Hepatic Targeting and Transgene Expression, PLoS One. 2014 Nov 13; 9 (11): e 112268.doi: 10.1371 / joumal.pone.0112268. eCollection 2014 was measured by ELISA.

As shown in FIGS. 10A and 10B, AAVhu68, AAV8 and AAV9 vectors expressed transgene at similar levels, while AAV8 triple vectors expressed better after IM injection in mice. At the lower doses tested (ie 3 × 10 ¹⁰ GC / mouse), the difference in expression with AAV8 triples is significant.

Example 9 Transgene Expression of rAAV Vectors in Male C57BL / 6J Mice.

Expression in liver and muscle was tested in vivo using rAAV vectors with different capsids, including AAVhu68, AAV8 triple, AAV8 and AAV9, and expressing Firefly luciferase (ffLuc) as a transgene.

Male C57BL / 6J mice (n = 5 / group) aged 6 to 8 weeks were administered intramuscularly into the gastrocnemius muscle using a Hamilton syringe with a vector of 3 × 10 ¹¹ GC / mouse. As previously described (Greig et al., PLoS One 2014 , cited above) ffLuc expression was visualized by systemic bioluminescence imaging.

As shown in FIGS. 11A and 11B, AAVhu68, AAV8 and AAV9 vectors were expressed at similar levels in both muscle and liver, while AAV8 triple vectors had reduced expression in the liver and improved expression in muscle.

Example 10 rAAV Vectors in Male and Female Cynomolgus Macaques.

Transgene expression was tested in cynomolgus macaques using rAAV vectors with different capsids, including AAVhu68, AAV8 triple, AAV8 and AAV9, and expressing secreted transgene 201Ig IA.

Male and female cynomolgus macaques with NAb titers for injected vectors less than 1: 5 at the start of the study were given 1 ml injection / kg body weight (vector concentration of 10 ¹³ GC / ml) for vector biodistribution studies. As a vector expressing 201Ig IA from one of the four vector capsids (AAV8 triple, AAVhu68, AAV9, or AAV8) as a dose of 10 ¹³ GC / kg, intramuscularly in the lateral muscles of both the right and left legs Administered. Blood samples were taken prior to the study and weekly during the study through venipuncture of the femoral vein. Transgene expression levels were measured in serum by ELISA as previously described (Greig et al., PLoS One 2014 , cited above).

As shown in FIG. 12, AAVhu68 and AAV8 triples express better than AAV9 and AAV8 vectors after IM injection.

All documents cited herein are U.S. Provisional Patent Application No. 62 / 614,002, filed Jan. 5, 2018, U.S. Provisional Patent Application No. 62 / 591,001, filed Nov. 27, 2017, and U.S. Provisional Patent Application. Incorporated by reference herein as in US Pat. No. 62 / 464,748, filed Feb. 28, 2017. The sequence listing submitted with this specification under the file name "17-7986 Seq Listing_ST25.txt" and the sequences and text therein are incorporated by reference. Although the present invention has been described with reference to specific embodiments, it will be appreciated that modifications may be made without departing from the spirit of the invention. Such modifications are intended to be included within the scope of the appended claims.

(Sequence list free text)

The following information provides sequence containing free text under the number identifier.

                         SEQUENCE LISTING <110> The Trustees of the University of Pennsylvania   <120> Novel AAV Isolate and Uses Therefore <130> WO / 2018/160582 <140> PCT / US2018 / 019992 <141> 2018-02-27 <150> US 62 / 464,748 <151> 2017-02-28 <150> US 62 / 591,002 <151> 2017-11-28   <150> US 62 / 614,002 <151> 2018-01-05   <160> 14 <170> PatentIn version 3.5 <210> 1 <211> 2211 <212> DNA <213> Artificial Sequence <220> <223> AAVhu68 vp1 capsid of Homo Sapiens origin <220> <221> CDS (222) (1) .. (2211) <400> 1 atg gct gcc gat ggt tat ctt cca gat tgg ctc gag gac aac ctc agt 48 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 gaa ggc att cgc gag tgg tgg gct ttg aaa cct gga gcc cct caa ccc 96 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro             20 25 30 aag gca aat caa caa cat caa gac aac gct cgg ggt ctt gtg ctt ccg 144 Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro         35 40 45 ggt tac aaa tac ctt gga ccc ggc aac gga ctc gac aag ggg gag ccg 192 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro     50 55 60 gtc aac gaa gca gac gcg gcg gcc ctc gag cac gac aag gcc tac gac 240 Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 cag cag ctc aag gcc gga gac aac ccg tac ctc aag tac aac cac gcc 288 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala                 85 90 95 gac gcc gag ttc cag gag cgg ctc aaa gaa gat acg tct ttt ggg ggc 336 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly             100 105 110 aac ctc ggg cga gca gtc ttc cag gcc aaa aag agg ctt ctt gaa cct 384 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro         115 120 125 ctt ggt ctg gtt gag gaa gcg gct aag acg gct cct gga aag aag agg 432 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg     130 135 140 cct gta gag cag tct cct cag gaa ccg gac tcc tcc gtg ggt att ggc 480 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Val Gly Ile Gly 145 150 155 160 aaa tcg ggt gca cag ccc gct aaa aag aga ctc aat ttc ggt cag act 528 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr                 165 170 175 ggc gac aca gag tca gtc ccc gac cct caa cca atc gga gaa cct ccc 576 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro             180 185 190 gca gcc ccc tca ggt gtg gga tct ctt aca atg gct tca ggt ggt ggc 624 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly         195 200 205 gca cca gtg gca gac aat aac gaa ggt gcc gat gga gtg ggt agt tcc 672 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser     210 215 220 tcg gga aat tgg cat tgc gat tcc caa tgg ctg ggg gac aga gtc atc 720 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 acc acc agc acc cga acc tgg gcc ctg ccc acc tac aac aat cac ctc 768 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu                 245 250 255 tac aag caa atc tcc aac agc aca tct gga gga tct tca aat gac aac 816 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn             260 265 270 gcc tac ttc ggc tac agc acc ccc tgg ggg tat ttt gac ttc aac aga 864 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg         275 280 285 ttc cac tgc cac ttc tca cca cgt gac tgg caa aga ctc atc aac aac 912 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn     290 295 300 aac tgg gga ttc cgg cct aag cga ctc aac ttc aag ctc ttc aac att 960 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 cag gtc aaa gag gtt acg gac aac aat gga gtc aag acc atc gct aat 1008 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn                 325 330 335 aac ctt acc agc acg gtc cag gtc ttc acg gac tca gac tat cag ctc 1056 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu             340 345 350 ccg tac gtg ctc ggg tcg gct cac gag ggc tgc ctc ccg ccg ttc cca 1104 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro         355 360 365 gcg gac gtt ttc atg att cct cag tac ggg tat cta acg ctt aat gat 1152 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp     370 375 380 gga agc caa gcc gtg ggt cgt tcg tcc ttt tac tgc ctg gaa tat ttc 1200 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 ccg tcg caa atg cta aga acg ggt aac aac ttc cag ttc agc tac gag 1248 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu                 405 410 415 ttt gag aac gta cct ttc cat agc agc tat gct cac agc caa agc ctg 1296 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu             420 425 430 gac cga ctc atg aat cca ctc atc gac caa tac ttg tac tat ctc tca 1344 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser         435 440 445 aag act att aac ggt tct gga cag aat caa caa acg cta aaa ttc agt 1392 Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser     450 455 460 gtg gcc gga ccc agc aac atg gct gtc cag gga aga aac tac ata cct 1440 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470 475 480 gga ccc agc tac cga caa caa cgt gtc tca acc act gtg act caa aac 1488 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn                 485 490 495 aac aac agc gaa ttt gct tgg cct gga gct tct tct tgg gct ctc aat 1536 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn             500 505 510 gga cgt aat agc ttg atg aat cct gga cct gct atg gcc agc cac aaa 1584 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys         515 520 525 gaa gga gag gac cgt ttc ttt cct ttg tct gga tct tta att ttt ggc 1632 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly     530 535 540 aaa caa gga act gga aga gac aac gtg gat gcg gac aaa gtc atg ata 1680 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 acc aac gaa gaa gaa att aaa act acc aac cca gta gca acg gag tcc 1728 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser                 565 570 575 tat gga caa gtg gcc aca aac cac cag agt gcc caa gca cag gcg cag 1776 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln             580 585 590 acc ggc tgg gtt caa aac caa gga ata ctt ccg ggt atg gtt tgg cag 1824 Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln         595 600 605 gac aga gat gtg tac ctg caa gga ccc att tgg gcc aaa att cct cac 1872 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His     610 615 620 acg gac ggc aac ttt cac cct tct ccg ctg atg gga ggg ttt gga atg 1920 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met 625 630 635 640 aag cac ccg cct cct cag atc ctc atc aaa aac aca cct gta cct gcg 1968 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala                 645 650 655 gat cct cca acg gct ttc aac aag gac aag ctg aac tct ttc atc acc 2016 Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr             660 665 670 cag tat tct act ggc caa gtc agc gtg gag att gag tgg gag ctg cag 2064 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln         675 680 685 aag gaa aac agc aag cgc tgg aac ccg gag atc cag tac act tcc aac 2112 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn     690 695 700 tat tac aag tct aat aat gtt gaa ttt gct gtt aat act gaa ggt gtt 2160 Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val 705 710 715 720 tat tct gaa ccc cgc ccc att ggc acc aga tac ctg act cgt aat ctg 2208 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu                 725 730 735 taa 2211 <210> 2 <211> 736 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 2 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro             20 25 30 Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro         35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro     50 55 60 Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala                 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly             100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro         115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg     130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Val Gly Ile Gly 145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr                 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro             180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly         195 200 205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser     210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu                 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn             260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg         275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn     290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn                 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu             340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro         355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp     370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu                 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu             420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser         435 440 445 Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser     450 455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn                 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn             500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys         515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly     530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser                 565 570 575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln             580 585 590 Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln         595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His     610 615 620 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala                 645 650 655 Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr             660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln         675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn     690 695 700 Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu                 725 730 735 <210> 3 <211> 1866 <212> DNA <213> Artificial Sequence <220> <223> AAVhu68 rep gene of homo sapiens origin <220> <221> CDS (222) (1) .. (1866) <400> 3 atg ccg ggg ttt tac gag att gtg att aag gtc ccc agc gac ctt gac 48 Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp 1 5 10 15 gag cat ctg ccc ggc att tct gac agc ttt gtg aac tgg gtg gcc gag 96 Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu             20 25 30 aag gaa tgg gag ttg ccg cca gat tct gac atg gat ctg aat ctg att 144 Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile         35 40 45 gag cag gca ccc ctg acc gtg gcc gag aag ctg cag cgc gac ttt ctg 192 Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu     50 55 60 acg gaa tgg cgc cgt gtg agt aag gcc ccg gag gct ctt ttc ttt gtg 240 Thr Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val 65 70 75 80 caa ttt gag aag gga gag agc tac ttc cac atg cac gtg ctc gtg gaa 288 Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Met His Val Leu Val Glu                 85 90 95 acc acc ggg gtg aaa tcc atg gtt ttg gga cgt ttc ctg agt cag att 336 Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile             100 105 110 cgc gaa aaa ctg att cag aga att tac cgc ggg atc gag ccg act ttg 384 Arg Glu Lys Leu Ile Gln Arg Ile Tyr Arg Gly Ile Glu Pro Thr Leu         115 120 125 cca aac tgg ttc gcg gtc aca aag acc aga aat ggc gcc gga ggc ggg 432 Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly     130 135 140 aac aag gtg gtg gat gag tgc tac atc ccc aat tac ttg ctc ccc aaa 480 Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys 145 150 155 160 acc cag cct gag ctc cag tgg gcg tgg act aat atg gaa cag tat tta 528 Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Gln Tyr Leu                 165 170 175 agc gcc tgt ttg aat ctc acg gag cgt aaa cgg ttg gtg gcg cag cat 576 Ser Ala Cys Leu Asn Leu Thr Glu Arg Lys Arg Leu Val Ala Gln His             180 185 190 ctg acg cac gtg tcg cag acg cag gag cag aac aaa gag aat cag aat 624 Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn         195 200 205 ccc aat tct gat gcg ccg gtg atc aga tca aaa act tca gcc agg tac 672 Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr     210 215 220 atg gag ctg gtc ggg tgg ctc gtg gac aag ggg att acc tcg gag aag 720 Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys 225 230 235 240 cag tgg atc cag gag gac cag gcc tca tac atc tcc ttc aat gcg gcc 768 Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala                 245 250 255 tcc aac tcg cgg tcc caa atc aag gtc gcc ttg gac aat gcg gga aag 816 Ser Asn Ser Arg Ser Gln Ile Lys Val Ala Leu Asp Asn Ala Gly Lys             260 265 270 att atg agc ctg act aaa acc gcc ccc gac tac ctg gtg ggc cag cag 864 Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln         275 280 285 ccc gtg gag gac att tcc agc aat cgg att tat aaa att ttg gaa cta 912 Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu     290 295 300 aac ggg tac gat ccc caa tat gcg gct tcc gtc ttt ctg gga tgg gcc 960 Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala 305 310 315 320 acg aaa aag ttc ggc aag agg aac acc atc tgg ctg ttt ggg cct gca 1008 Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala                 325 330 335 act acc ggg aag acc aac atc gcg gag gcc ata gcc cac act gtg ccc 1056 Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro             340 345 350 ttc tac ggg tgc gta aac tgg acc aat gag aac ttt ccc ttc aac gac 1104 Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp         355 360 365 tgt gtc gac aag atg gtg atc tgg tgg gag gag ggg aag atg acc gcc 1152 Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala     370 375 380 aag gtc gtg gag tcg gcc aaa gcc att ctc gga gga agc aag gtg cgc 1200 Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg 385 390 395 400 gtg gac cag aaa tgc aag tcc tcg gcc cag ata gac ccg act ccc gtg 1248 Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val                 405 410 415 atc gtc acc tcc aac acc aac atg tgc gcc gtg att gac ggg aac tca 1296 Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser             420 425 430 acg acc ttc gaa cac cag cag ccg ttg caa gac cgg atg ttc aaa ttt 1344 Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe         435 440 445 gaa ctc acc cgc cgt ctg gat cat gac ttt ggg aag gtc acc aag cag 1392 Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln     450 455 460 gaa gtc aaa gac ttt ttc cgg tgg gca aag gat cac gtg gtt gag gtg 1440 Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val 465 470 475 480 gag cat gaa ttc tac gtc aaa aag ggt gga gcc aag aaa aga ccc gcc 1488 Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala                 485 490 495 ccc agt gac gca gat ata agt gag ccc aaa cgg gtg cgc gag tca gtt 1536 Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val             500 505 510 gcg cag cca tcg acg tca gac gcg gaa gct tcg atc aac tac gcg gac 1584 Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp         515 520 525 agg tac caa aac aaa tgt tct cgt cac gtg ggc atg aat ctg atg ctg 1632 Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu     530 535 540 ttt ccc tgc aga caa tgc gag aga ctg aat cag aat tca aat atc tgc 1680 Phe Pro Cys Arg Gln Cys Glu Arg Leu Asn Gln Asn Ser Asn Ile Cys 545 550 555 560 ttc act cac ggt gtc aaa gac tgt tta gag tgc ttt ccc gtg tca gaa 1728 Phe Thr His Gly Val Lys Asp Cys Leu Glu Cys Phe Pro Val Ser Glu                 565 570 575 tct caa ccc gtt tct gtc gtc aaa aag gcg tat cag aaa ctg tgc tac 1776 Ser Gln Pro Val Ser Val Val Lys Lys Ala Tyr Gln Lys Leu Cys Tyr             580 585 590 att cat cac atc atg gga aag gtg cca gac gct tgc act gct tgc gac 1824 Ile His His Ile Met Gly Lys Val Pro Asp Ala Cys Thr Ala Cys Asp         595 600 605 ctg gtc aat gtg gac ttg gat gac tgt gtt tct gaa caa taa 1866 Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln     610 615 620 <210> 4 <211> 621 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 4 Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp 1 5 10 15 Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu             20 25 30 Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile         35 40 45 Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu     50 55 60 Thr Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val 65 70 75 80 Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Met His Val Leu Val Glu                 85 90 95 Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile             100 105 110 Arg Glu Lys Leu Ile Gln Arg Ile Tyr Arg Gly Ile Glu Pro Thr Leu         115 120 125 Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly     130 135 140 Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys 145 150 155 160 Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Gln Tyr Leu                 165 170 175 Ser Ala Cys Leu Asn Leu Thr Glu Arg Lys Arg Leu Val Ala Gln His             180 185 190 Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn         195 200 205 Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr     210 215 220 Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys 225 230 235 240 Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala                 245 250 255 Ser Asn Ser Arg Ser Gln Ile Lys Val Ala Leu Asp Asn Ala Gly Lys             260 265 270 Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln         275 280 285 Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu     290 295 300 Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala 305 310 315 320 Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala                 325 330 335 Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro             340 345 350 Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp         355 360 365 Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala     370 375 380 Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg 385 390 395 400 Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val                 405 410 415 Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser             420 425 430 Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe         435 440 445 Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln     450 455 460 Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val 465 470 475 480 Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala                 485 490 495 Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val             500 505 510 Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp         515 520 525 Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu     530 535 540 Phe Pro Cys Arg Gln Cys Glu Arg Leu Asn Gln Asn Ser Asn Ile Cys 545 550 555 560 Phe Thr His Gly Val Lys Asp Cys Leu Glu Cys Phe Pro Val Ser Glu                 565 570 575 Ser Gln Pro Val Ser Val Val Lys Lys Ala Tyr Gln Lys Leu Cys Tyr             580 585 590 Ile His His Ile Met Gly Lys Val Pro Asp Ala Cys Thr Ala Cys Asp         595 600 605 Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln     610 615 620 <210> 5 <211> 2208 <212> DNA <213> Artificial Sequence <220> <223> AAV9 VP1 capsid of homo sapiens origin <220> <221> CDS (222) (1) .. (2208) <223> AAV9 VP1 Capsid <400> 5 atg gct gcc gat ggt tat ctt cca gat tgg ctc gag gac aac ctt agt 48 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 gaa gga att cgc gag tgg tgg gct ttg aaa cct gga gcc cct caa ccc 96 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro             20 25 30 aag gca aat caa caa cat caa gac aac gct cga ggt ctt gtg ctt ccg 144 Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro         35 40 45 ggt tac aaa tac ctt gga ccc ggc aac gga ctc gac aag ggg gag ccg 192 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro     50 55 60 gtc aac gca gca gac gcg gcg gcc ctc gag cac gac aag gcc tac gac 240 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 cag cag ctc aag gcc gga gac aac ccg tac ctc aag tac aac cac gcc 288 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala                 85 90 95 gac gcc gag ttc cag gag cgg ctc aaa gaa gat acg tct ttt ggg ggc 336 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly             100 105 110 aac ctc ggg cga gca gtc ttc cag gcc aaa aag agg ctt ctt gaa cct 384 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro         115 120 125 ctt ggt ctg gtt gag gaa gcg gct aag acg gct cct gga aag aag agg 432 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg     130 135 140 cct gta gag cag tct cct cag gaa ccg gac tcc tcc gcg ggt att ggc 480 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly 145 150 155 160 aaa tcg ggt gca cag ccc gct aaa aag aga ctc aat ttc ggt cag act 528 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr                 165 170 175 ggc gac aca gag tca gtc cca gac cct caa cca atc gga gaa cct ccc 576 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro             180 185 190 gca gcc ccc tca ggt gtg gga tct ctt aca atg gct tca ggt ggt ggc 624 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly         195 200 205 gca cca gtg gca gac aat aac gaa ggt gcc gat gga gtg ggt agt tcc 672 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser     210 215 220 tcg gga aat tgg cat tgc gat tcc caa tgg ctg ggg gac aga gtc atc 720 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 acc acc agc acc cga acc tgg gcc ctg ccc acc tac aac aat cac ctc 768 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu                 245 250 255 tac aag caa atc tcc aac agc aca tct gga gga tct tca aat gac aac 816 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn             260 265 270 gcc tac ttc ggc tac agc acc ccc tgg ggg tat ttt gac ttc aac aga 864 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg         275 280 285 ttc cac tgc cac ttc tca cca cgt gac tgg cag cga ctc atc aac aac 912 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn     290 295 300 aac tgg gga ttc cgg cct aag cga ctc aac ttc aag ctc ttc aac att 960 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 cag gtc aaa gag gtt acg gac aac aat gga gtc aag acc atc gcc aat 1008 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn                 325 330 335 aac ctt acc agc acg gtc cag gtc ttc acg gac tca gac tat cag ctc 1056 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu             340 345 350 ccg tac gtg ctc ggg tcg gct cac gag ggc tgc ctc ccg ccg ttc cca 1104 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro         355 360 365 gcg gac gtt ttc atg att cct cag tac ggg tat ctg acg ctt aat gat 1152 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp     370 375 380 gga agc cag gcc gtg ggt cgt tcg tcc ttt tac tgc ctg gaa tat ttc 1200 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 ccg tcg caa atg cta aga acg ggt aac aac ttc cag ttc agc tac gag 1248 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu                 405 410 415 ttt gag aac gta cct ttc cat agc agc tac gct cac agc caa agc ctg 1296 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu             420 425 430 gac cga cta atg aat cca ctc atc gac caa tac ttg tac tat ctc tca 1344 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser         435 440 445 aag act att aac ggt tct gga cag aat caa caa acg cta aaa ttc agt 1392 Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser     450 455 460 gtg gcc gga ccc agc aac atg gct gtc cag gga aga aac tac ata cct 1440 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470 475 480 gga ccc agc tac cga caa caa cgt gtc tca acc act gtg act caa aac 1488 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn                 485 490 495 aac aac agc gaa ttt gct tgg cct gga gct tct tct tgg gct ctc aat 1536 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn             500 505 510 gga cgt aat agc ttg atg aat cct gga cct gct atg gcc agc cac aaa 1584 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys         515 520 525 gaa gga gag gac cgt ttc ttt cct ttg tct gga tct tta att ttt ggc 1632 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly     530 535 540 aaa caa gga act gga aga gac aac gtg gat gcg gac aaa gtc atg ata 1680 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 acc aac gaa gaa gaa att aaa act act aac ccg gta gca acg gag tcc 1728 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser                 565 570 575 tat gga caa gtg gcc aca aac cac cag agt gcc caa gca cag gcg cag 1776 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln             580 585 590 acc ggc tgg gtt caa aac caa gga ata ctt ccg ggt atg gtt tgg cag 1824 Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln         595 600 605 gac aga gat gtg tac ctg caa gga ccc att tgg gcc aaa att cct cac 1872 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His     610 615 620 acg gac ggc aac ttt cac cct tct ccg ctg atg gga ggg ttt gga atg 1920 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met 625 630 635 640 aag cac ccg cct cct cag atc ctc atc aaa aac aca cct gta cct gcg 1968 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala                 645 650 655 gat cct cca acg gcc ttc aac aag gac aag ctg aac tct ttc atc acc 2016 Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr             660 665 670 cag tat tct act ggc caa gtc agc gtg gag atc gag tgg gag ctg cag 2064 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln         675 680 685 aag gaa aac agc aag cgc tgg aac ccg gag atc cag tac act tcc aac 2112 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn     690 695 700 tat tac aag tct aat aat gtt gaa ttt gct gtt aat act gaa ggt gta 2160 Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val 705 710 715 720 tat agt gaa ccc cgc ccc att ggc acc aga tac ctg act cgt aat ctg 2208 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu                 725 730 735 <210> 6 <211> 736 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 6 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro             20 25 30 Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro         35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro     50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala                 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly             100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro         115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg     130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly 145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr                 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro             180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly         195 200 205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser     210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu                 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn             260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg         275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn     290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn                 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu             340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro         355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp     370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu                 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu             420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser         435 440 445 Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser     450 455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn                 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn             500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys         515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly     530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser                 565 570 575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln             580 585 590 Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln         595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His     610 615 620 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala                 645 650 655 Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr             660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln         675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn     690 695 700 Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu                 725 730 735 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer prm504 <400> 7 gctgcgycaa ctggaccaat gagaac 26 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer prm505 <400> 8 cgcagagacc aagttcaact gaaacga 27 <210> 9 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> AAVhu68 spacer sequence <400> 9 atgacttaaa ccaggt 16 <210> 10 <211> 736 <212> PRT <213> Artificial Sequence <220> <223> AAVhu31 vp1 capsid protein <400> 10 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser 1 5 10 15 Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro             20 25 30 Lys Pro Ala Glu Arg His Lys Asp Asp Ser Arg Gly Leu Val Leu Pro         35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro     50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala                 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly             100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro         115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg     130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly 145 150 155 160 Lys Ser Gly Ser Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr                 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro             180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly         195 200 205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser     210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu                 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn             260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg         275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn     290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn                 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu             340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro         355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp     370 375 380 Gly Gly Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu                 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu             420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser         435 440 445 Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser     450 455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn                 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn             500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys         515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly     530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser                 565 570 575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln             580 585 590 Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln         595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His     610 615 620 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala                 645 650 655 Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr             660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln         675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn     690 695 700 Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Ser Thr Glu Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu                 725 730 735 <210> 11 <211> 736 <212> PRT <213> Artificial sequence <220> <223> AAVhu32 vp1 capsid protein <400> 11 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser 1 5 10 15 Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro             20 25 30 Lys Pro Ala Glu Arg His Lys Asp Asp Ser Arg Gly Leu Val Leu Pro         35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro     50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala                 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly             100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro         115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg     130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly 145 150 155 160 Lys Ser Gly Ser Gln Pro Ala Lys Lys Lys Leu Asn Phe Gly Gln Thr                 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro             180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly         195 200 205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser     210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu                 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn             260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg         275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn     290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn                 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu             340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro         355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp     370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu                 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu             420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser         435 440 445 Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser     450 455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn                 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn             500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys         515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly     530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser                 565 570 575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Gln Ala Gln             580 585 590 Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln         595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His     610 615 620 Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala                 645 650 655 Asp Pro Pro Thr Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr             660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln         675 680 685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn     690 695 700 Tyr Tyr Lys Ser Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu                 725 730 735 <210> 12 <211> 2211 <212> DNA <213> Artificial sequence <220> <223> AAVhu31 vp1 coding sequence <400> 12 atggctgccg atggttatct tccagattgg ctcgaggaca accttagtga aggaattcgc 60 gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca acatcaagac 120 aacgctcgag gtcttgtgct tccgggttac aaataccttg gacccggcaa cggactcgac 180 aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac 240 cagcagctca aggccggaga caacccgtac ctcaagtaca accacgccga cgccgagttc 300 caggagcggc tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360 gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct 420 ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc gggtattggc 480 aaatcgggtg cacagcccgc taaaaagaga ctcaatttcg gtcagactgg cgacacagag 540 tcagtcccag accctcaacc aatcggagaa cctcccgcag ccccctcagg tgtgggatct 600 cttacaatgg cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga 660 gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc 720 accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta caagcaaatc 780 tccaacagca catctggagg atcttcaaat gacaacgcct acttcggcta cagcaccccc 840 tgggggtatt ttgacttcaa cagattccac tgccacttct caccacgtga ctggcagcga 900 ctcatcaaca acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt 960 caggtcaaag aggttacgga caacaatgga gtcaagacca tcgccaataa ccttaccagc 1020 acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg gtcggctcac 1080 gagggctgcc tcccgccgtt cccagcggac gttttcatga ttcctcagta cgggtatctg 1140 acgcttaatg atggaagcca ggccgtgggt cgttcgtcct tttactgcct ggaatatttc 1200 ccgtcgcaaa tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta 1260 cctttccata gcagctacgc tcacagccaa agcctggacc gactaatgaa tccactcatc 1320 gaccaatact tgtactatct ctcaaagact attaacggtt ctggacagaa tcaacaaacg 1380 ctaaaattca gtgtggccgg acccagcaac atggctgtcc agggaagaaa ctacatacct 1440 ggacccagct accgacaaca acgtgtctca accactgtga ctcaaaacaa caacagcgaa 1500 tttgcttggc ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct 1560 ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct 1620 ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa agtcatgata 1680 accaacgaag aagaaattaa aactactaac ccggtagcaa cggagtccta tggacaagtg 1740 gccacaaacc accagagtgc ccaagcacag gcgcagaccg gctgggttca aaaccaagga 1800 atacttccgg gtatggtttg gcaggacaga gatgtgtacc tgcaaggacc catttgggcc 1860 aaaattcctc acacggacgg caactttcac ccttctccgc tgatgggagg gtttggaatg 1920 aagcacccgc ctcctcagat cctcatcaaa aacacacctg tacctgcgga tcctccaacg 1980 gccttcaaca aggacaagct gaactctttc atcacccagt attctactgg ccaagtcagc 2040 gtggagatcg agtgggagct gcagaaggaa aacagcaagc gctggaaccc ggagatccag 2100 tacacttcca actattacaa gtctaataat gttgaatttg ctgttaatac tgaaggtgta 2160 tatagtgaac cccgccccat tggcaccaga tacctgactc gtaatctgta a 2211 <210> 13 <211> 2211 <212> DNA <213> Artificial sequence <220> <223> AAVhu32 vp1 coding sequence <400> 13 atggctgccg atggttatct tccagattgg ctcgaggaca ctctctctga aggaataaga 60 cagtggtgga agctcaaacc tggcccacca ccaccaaagc ccgcagagcg gcataaggac 120 gacagcaggg gtcttgtgct tcctgggtac aagtacctcg gacccggcaa cggactcgac 180 aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac 240 cagcagctca aggccggaga caacccgtac ctcaagtaca accacgccga cgccgagttc 300 caggagcggc tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360 gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct 420 ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc gggtattggc 480 aaatcgggtt cacagcccgc taaaaagaaa ctcaatttcg gtcagactgg cgacacagag 540 tcagtccccg accctcaacc aatcggagaa cctcccgcag ccccctcagg tgtgggatct 600 cttacaatgg cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga 660 gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc 720 accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta caagcaaatc 780 tccaacagca catctggagg atcttcaaat gacaacgcct acttcggcta cagcaccccc 840 tgggggtatt ttgacttcaa cagattccac tgccacttct caccacgtga ctggcagcga 900 ctcatcaaca acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt 960 caggtcaaag aggttacgga caacaatgga gtcaagacca tcgccaataa ccttaccagc 1020 acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg gtcggctcac 1080 gagggctgcc tcccgccgtt cccagcggac gttttcatga ttcctcagta cgggtatctg 1140 acgcttaatg atgggagcca ggccgtgggt cgttcgtcct tttactgcct ggaatatttc 1200 ccgtcgcaaa tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta 1260 cctttccata gcagctacgc tcacagccaa agcctggacc gactaatgaa tccactcatc 1320 gaccaatact tgtactatct ctcaaagact attaacggtt ctggacagaa tcaacaaacg 1380 ctaaaattca gcgtggccgg acccagcaac atggctgtcc agggaagaaa ctacatacct 1440 ggacccagct accgacaaca acgtgtctca accactgtga ctcaaaacaa caacagcgaa 1500 tttgcttggc ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct 1560 ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct 1620 ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa agtcatgata 1680 accaacgaag aagaaattaa aactactaac ccggtagcaa cggagtccta tggacaagtg 1740 gccacaaacc accagagtgc ccaagcacag gcgcagaccg gctgggttca aaaccaagga 1800 atacttccgg gtatggtttg gcaggacaga gatgtgtacc tgcaaggacc catttgggcc 1860 aaaattcctc acacggacgg caactttcac ccttctccgc taatgggagg gtttggaatg 1920 aagcacccgc ctcctcagat cctcatcaaa aacacacctg tacctgcgga tcctccaacg 1980 gctttcaata aggacaagct gaactctttc atcacccagt attctactgg ccaagtcagc 2040 gtggagattg agtgggagct gcagaaggaa aacagcaagc gctggaaccc ggagatccag 2100 tacacttcca actattacaa gtctaataat gttgaatttg ctgttaatac tgaaggtgta 2160 tatagtgaac cccgccccat tggcaccaga tacctgactc gtaatctgta a 2211 <210> 14 <211> 736 <212> PRT <213> Artificial Sequence <220> <223> modified hu68 vp1 <220> <221> MISC_FEATURE (222) (23) .. (23) X223 may be W (Trp, tryptophan), or oxidated W. <220> <221> MISC_FEATURE (222) (35) .. (35) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (57) .. (57) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (66) .. (66) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (94) .. (94) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (97) .. (97) Xa may be D (asp, aspartic acid), or isomerized D. <220> <221> MISC_FEATURE <222> (107) .. (107) Xa may be D (asp, aspartic acid), or isomerized D. <220> <221> misc_feature <222> (113) .. (113) <223> Xaa can be any naturally occurring amino acid <220> <221> MISC_FEATURE 222 (149) .. (149) <223> Xaa may be S (Ser, serine), or Phosphorilated S <220> <221> MISC_FEATURE 222 (149) .. (149) <223> Xaa may be S (Ser, serine), or Phosphorylated S <220> <221> MISC_FEATURE (247) (247) .. (247) Xaa may be W (Trp, tryptophan), or oxidated W (e.g., kynurenine). <220> <221> MISC_FEATURE (253) .. (253) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (259) .. (259) <223> Xaa represents Q, or Q deamidated to glutamic acid        (alpha-glutamic acid), gamma-glutamic acid (Glu), or a blend of        alpha- and gamma-glutamic acid <220> <221> MISC_FEATURE <222> (270) .. (270) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (297) .. (297) 223 Xaa represents D (Asp, aspartic acid) or amindated D to N (Asn,        asparagine) <220> <221> MISC_FEATURE (222) (304) .. (304) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (306) .. (306) Xaa may be W (Trp, tryptophan), or oxidated W (e.g., kynurenine). <220> <221> MISC_FEATURE (222) (314) .. (314) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (319) .. (319) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (329) .. (329) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (332) .. (332) <223> Xaa may be K (lys, lysine), or acetylated K <220> <221> MISC_FEATURE 222 (336) .. (336) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (384) .. (384) Xa may be D (asp, aspartic acid), or isomerized D. <220> <221> MISC_FEATURE (222) (404) .. (404) 223 Xaa may be M (Met, Methionine), or oxidated M. <220> <221> MISC_FEATURE (222) (409) .. (409) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (436) .. (436) 223 Xaa may be M (Met, Methionine), or oxidated M. <220> <221> MISC_FEATURE <222> (452) .. (452) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE <222> (477) .. (477) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (499) .. (499) <223> Xaa may be S (Ser, serine), or Phosphorylated S <220> <221> MISC_FEATURE <222> (512) .. (512) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE 222 (515) .. (515) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE 518 (518) .. (518) 223 Xaa may be M (Met, Methionine), or oxidated M. <220> <221> MISC_FEATURE 222 (524) .. (524) 223 Xaa may be M (Met, Methionine), or oxidated M. <220> <221> MISC_FEATURE <222> (559) .. (559) 223 Xaa may be M (Met, Methionine), or oxidated M. <220> <221> MISC_FEATURE (569) .. (569) <223> Xaa may be T (Thr, threonine), or Phosphorylated T <220> <221> MISC_FEATURE <222> (586) .. (586) <223> Xaa may be S (Ser, serine), or Phosphorylated S <220> <221> MISC_FEATURE (599) .. (599) <223> Xaa represents Q, or Q deamidated to glutamic acid        (alpha-glutamic acid), gamma-glutamic acid (Glu), or a blend of        alpha- and gamma-glutamic acid <220> <221> MISC_FEATURE 222 (605) .. (605) 223 Xaa may be M (Met, Methionine), or oxidated M. <220> <221> MISC_FEATURE <222> (619) .. (619) Xaa may be W (Trp, tryptophan), or oxidated W (e.g., kynurenine). <220> <221> MISC_FEATURE <222> (628) .. (628) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (640) .. (640) 223 Xaa may be M (Met, Methionine), or oxidated M. <220> <221> MISC_FEATURE (222) (651) .. (651) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (663) .. (663) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE (222) (666) .. (666) <223> Xaa may be K (lys, lysine), or acetylated K <220> <221> MISC_FEATURE (689) .. (689) <223> Xaa may be K (lys, lysine), or acetylated K <220> <221> MISC_FEATURE (222) (693) .. (693) <223> Xaa may be K (lys, lysine), or acetylated K <220> <221> MISC_FEATURE (222) (695) .. (695) X223 may be W (Trp, tryptophan), or oxidated W. <220> <221> MISC_FEATURE (709) .. (709) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <220> <221> MISC_FEATURE 222 (735) .. (735) <223> Xaa may be Asn, or deamidated to Asp, isoAsp, or Asp / isoAsp <400> 14 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Xaa Ala Leu Lys Pro Gly Ala Pro Gln Pro             20 25 30 Lys Ala Xaa Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro         35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Xaa Gly Leu Asp Lys Gly Glu Pro     50 55 60 Val Xaa Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Xaa His Ala                 85 90 95 Xaa Ala Glu Phe Gln Glu Arg Leu Lys Glu Xaa Thr Ser Phe Gly Gly             100 105 110 Xaa Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro         115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg     130 135 140 Pro Val Glu Gln Xaa Pro Gln Glu Pro Asp Ser Ser Val Gly Ile Gly 145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr                 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro             180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly         195 200 205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser     210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Xaa Ala Leu Pro Thr Tyr Xaa Asn His Leu                 245 250 255 Tyr Lys Xaa Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Xaa Asp Asn             260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg         275 280 285 Phe His Cys His Phe Ser Pro Arg Xaa Trp Gln Arg Leu Ile Asn Xaa     290 295 300 Asn Xaa Gly Phe Arg Pro Lys Arg Leu Xaa Phe Lys Leu Phe Xaa Ile 305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Xaa Gly Val Xaa Thr Ile Ala Xaa                 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu             340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro         355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Xaa     370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Xaa Leu Arg Thr Gly Xaa Asn Phe Gln Phe Ser Tyr Glu                 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu             420 425 430 Asp Arg Leu Xaa Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser         435 440 445 Lys Thr Ile Xaa Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser     450 455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Xaa Tyr Ile Pro 465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn                 485 490 495 Asn Asn Xaa Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Xaa             500 505 510 Gly Arg Xaa Ser Leu Xaa Asn Pro Gly Pro Ala Xaa Ala Ser His Lys         515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly     530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Xaa Ile 545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Xaa Asn Pro Val Ala Thr Glu Ser                 565 570 575 Tyr Gly Gln Val Ala Thr Asn His Gln Xaa Ala Gln Ala Gln Ala Gln             580 585 590 Thr Gly Trp Val Gln Asn Gln Gly Ile Leu Pro Gly Xaa Val Trp Gln         595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile Xaa Ala Lys Ile Pro His     610 615 620 Thr Asp Gly Xaa Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Xaa 625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Xaa Thr Pro Val Pro Ala                 645 650 655 Asp Pro Pro Thr Ala Phe Xaa Lys Asp Xaa Leu Asn Ser Phe Ile Thr             660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln         675 680 685 Xaa Glu Asn Ser Xaa Arg Xaa Asn Pro Glu Ile Gln Tyr Thr Ser Asn     690 695 700 Tyr Tyr Lys Ser Xaa Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Xaa Leu                 725 730 735

Claims (42)

As a recombinant adeno-associated virus (rAAV),
(A) an AAV68 capsid comprising at least one of the following (1) to (3):
(1) the vp1 protein produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2, the vp1 protein produced from SEQ ID NO: 1 or the predicted amino acid of 1 to 736 of SEQ ID NO: 2 Heterogeneous population of AAVhu68 vp1 proteins selected from vp1 proteins produced from nucleic acid sequences that are at least 70% identical to SEQ ID NO: 1 encoding the sequence,
Vp2 protein produced by expression from a nucleic acid sequence encoding a predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, a vp2 protein or sequence produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 1 Heterologous population of AAVhu68 vp2 proteins selected from vp2 proteins produced from nucleic acid sequences at least 70% identical to at least nucleotides 412-2211 of SEQ ID NO: 1 encoding a predicted amino acid sequence of at least about amino acids 138-736 of No. 2,
Vp3 protein produced by expression from a nucleic acid sequence encoding a predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 2, a vp3 protein produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 1 Heterogeneous population of AAVhu68 vp3 protein selected from vp3 protein produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607-2211 of SEQ ID NO: 1 encoding a predicted amino acid sequence of at least about amino acids 203-736 of 2
AAV hu68 capsid proteins, and / or
(2) an AAV capsid protein comprising a heterogeneous population of vp1 proteins, optionally a vp2 protein comprising a valine at position 157, and a heterogeneous population of vp3 proteins, wherein at least the subpopulations of vp1 protein and vp2 protein are The AAV capsid protein comprising valine at position 157 and optionally further comprising glutamic acid at position 67 based on the numbering of the vp1 capsid of SEQ ID NO: 2; And / or
(3) a heterogeneous population of vp1 proteins, the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins, a product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, and A heterogeneous population of vp3 proteins, the product of a nucleic acid sequence encoding at least amino acids 203-736 of SEQ ID NO: 2, wherein the vp1 protein, vp2 protein, and vp3 protein are at least two highly deamidated within the asparagine-glycine pair in SEQ ID NO: 2 A subpopulation containing an amino acid modification comprising deamidated asparagine (N), and optionally further comprising a different deamidated amino acid, wherein the deamidation results in an amino acid change. A heterogeneous population of vp1 protein, a heterogeneous population of vp2 protein and a heterogeneous population of vp3 protein; And
(B) a vector genome in the AAVhu68 capsid, wherein the vector genome is a non-AAV nucleic acid encoding a product operably linked to an AAV inverted terminal repeat sequence and a sequence directing expression of the product in a host cell Vector genome comprising a nucleic acid molecule comprising a sequence
Recombinant adeno-associated virus (rAAV), including The rAAV of claim 1, wherein the deamidated asparagine is deamidated with aspartic acid, isaspartic acid, interconverted aspartic acid / isoaspartic acid pairs, or a combination thereof. The deamidized according to claim 1 or 2, wherein the capsid is deamidated with (α) -glutamic acid, γ-glutamic acid, interconverted (α) -glutamic acid / γ-glutamic acid pairs or combinations thereof. RAAV, further comprising glutamine (s). The method according to any one of claims 1 to 3, wherein the AAVhu68 capsid is
(a) at least 65% of asparagine (N) in the asparagine-glycine pair located at position 57 of the vp1 protein, based on the numbering of SEQ ID NO: 2, is deamidated;
(b) at least 75% of N in the asparagine-glycine pair at position 329 of the vp1, v2 and vp3 proteins is deamidated based on the residue numbering of the amino acid sequence of SEQ ID NO: 2;
(c) at least 50% of N in the asparagine-glycine pair at position 452 of the vp1, v2 and vp3 proteins is deamidated based on the residue numbering of the amino acid sequence of SEQ ID NO: 2; And / or
(d) at least 75% of N in the asparagine-glycine pair at position 512 of the vp1, v2 and vp3 proteins is deamidated based on the residue numbering of the amino acid sequence of SEQ ID NO: 2
RAAV, comprising a subgroup having one or more of. 5. The method of claim 1, wherein the rAAVhu68 capsid is 75% to 100% of the N at position 57 of the vp1 protein when determined using mass spectrometry. RAAV, comprising a subgroup. 6. The method of claim 1, wherein the rAAVhu68 capsid is 75% to 100% of the N at position 329 based on the numbering of SEQ ID NO: 2 when determined using mass spectrometry. 7. RAAV, comprising a subpopulation of deamidated vp1 protein, vp2 protein, and / or vp3 protein. The method of claim 1, wherein the rAAVhu68 capsid is 75% to 100% of the N at position 452 based on the numbering of SEQ ID NO: 2 when determined using mass spectrometry. RAAV, comprising a subpopulation of deamidated vp1 protein, vp2 protein, and / or vp3 protein. 8. The vp1 protein of claim 1, wherein the rAAVhu68 capsid is deamidated from 75% to 100% of the N at position 512 based on the numbering of SEQ ID NO: 2 RAAV, comprising a subset of proteins and / or vp3 proteins. The method of claim 1, wherein the nucleic acid sequence encoding the protein is SEQ ID NO: 1 or at least 80% to at least 99% of SEQ ID NO: 1 encoding the amino acid sequence of SEQ ID NO: 2. 10. RAAV, identical sequence. The rAAV of claim 9, wherein the nucleic acid sequence is at least 80% to 97% identical to SEQ ID NO: 1. 11. The deAmid according to claim 1, wherein the rAAVhu68 capsid is at least about 50 to 100% deamidized at at least four positions selected from one or more of N57, 329, 452, 512 and combinations thereof. Further comprising a subpopulation of at least vp1, vp2 and / or vp3 proteins having amino acid modifications from SEQ ID NO: 2 comprising a. 12. The method of claim 1, wherein the rAAVhu68 capsid is N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, A subset of vp1, vp2 and / or vp3 proteins further comprising 1% to about 40% deamidation at positions N598, Q599, N628, N651, N663, N709, and at least one or more combinations thereof RAAV, which includes. The method of claim 1, wherein the rAAVhu68 capsid is acetylated lysine, phosphorylated serine and / or threonine, isomerized aspartic acid, oxidized tryptophan and / or methionine, or amide RAAV, comprising a subpopulation of vp1, vp2 and / or vp3 proteins, further comprising one or more modifications selected from one or more modifications in one or more of the amino acids. The rAAV of claim 1, wherein the rAAV comprises about 60 total capsid proteins in a ratio of vp1 of about 1 to vp2 of about 1 to 1.5 to vp3 protein of about 3 to 10. 15. The rAAV of claim 1, wherein the rAAV comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 vp2 to 3 to 9 vp3 protein. The rAAV of claim 1, wherein the AAV ITR sequence is a 5 ′ ITR and a 3 ′ ITR from an AAV source other than AAVhu68. A composition comprising a mixed population of recombinant adeno-associated virus hu68 (rAAVhu68), wherein each of the rAAVhu68 is independently selected from rAAV according to any one of claims 1-16. The composition of claim 17, wherein the average rAAVhu68 comprises about 60 total capsid proteins in a ratio of about 1 vp1 to vp2 of about 1 to 1.5 to vp3 protein of 3 to 10. 18. The composition of claim 17 or 18, wherein the average rAAV comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 vp2 to 3 to 6 vp3 protein. 20. The composition of any one of claims 17-19, wherein the AAV ITR sequence is 5 'ITR and 3' ITR from an AAV source other than AAVhu68. 21. The composition of any one of claims 17-20, wherein the composition is formulated for intrathecal delivery and the vector genome comprises a nucleic acid sequence encoding a product for delivery to the central nervous system. 21. The composition of any one of claims 17-20, wherein the composition is formulated for intravenous delivery. 23. The composition of any one of claims 17 to 22, wherein the vector genome comprises a nucleic acid sequence encoding an anti-HER2 antibody. The composition of claim 17, wherein the composition is formulated for intranasal or intramuscular delivery. The rAAV according to any one of claims 1 to 16 or the composition according to any one of claims 17 to 24 for delivering a desired gene product to a subject in need of delivery of the desired gene product. . The rAAV according to any one of claims 1 to 16 or the composition according to any one of claims 17 to 24 for delivering a desired gene product to a subject in need of delivery of the desired gene product. Use of A rAAV production system useful for the production of recombinant AAVhu68 according to any one of claims 1 to 16,
(a) an AAVhu68 capsid nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 2;
(b) a nucleic acid molecule suitable for packaging within the AAVhu68 capsid, wherein the non-AAV encodes a gene product operably linked to at least one AAV inverted terminal repeat (ITR) and a sequence directing expression of the product in a host cell Said nucleic acid molecule comprising a nucleic acid sequence; And
(c) sufficient AAV rep function and helper function to allow packaging of the nucleic acid molecule within the recombinant AAVhu68 capsid
Including, rAAV production system. The rAAV production system of claim 27, wherein the nucleic acid sequence of (a) comprises at least 70% to at least 99% identical sequence to SEQ ID NO: 1 encoding at least SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 . The system of claim 27 or 28, wherein the system optionally further comprises a nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 1 encoding the AAVhu68 vp3 of about aa 203 to about amino acid 736 of SEQ ID NO: 2. RAAV production system. 30. The rAAV production system of any of claims 27-29, wherein the cell culture comprises human embryonic kidney 293 cells. 32. The rAAV production system of any of claims 27-30, wherein the AAV rep is derived from a different AAV. The system of claim 31, wherein the AAV rep is derived from AAV2. 33. The rAAV production system of any of claims 27-32, wherein the AAV rep coding sequence and the cap gene are on the same nucleic acid molecule, with a spacer selectively between the rep sequence and the cap gene. 34. The rAAV production system of claim 33, wherein the spacer is atgacttaaaccaggt SEQ ID NO. 35. The rAAV production system of any of claims 27-30, 33 and 34, wherein the AAV rep is AAVhu68rep, characterized by the amino acid sequence of SEQ ID NO: 4 or a functional fragment thereof. The system of claim 35, wherein the AAV rep is encoded by the nucleic acid sequence of SEQ ID NO: 3. 37. A nucleic acid molecule comprising a nucleic acid sequence encoding an AAVhu68 rep protein or a functional fragment thereof under the control of an exogenous regulatory control sequence directing expression in a host cell, wherein the rep protein has the amino acid sequence of SEQ ID NO: 4. A method of reducing deamidation of an AAVhu68 capsid, the method comprising producing an AAVhu68 capsid from a nucleic acid sequence containing a modified AAVhu68 vp codon, wherein the nucleic acid sequence is 58, 330, 453 and / or 513 in SEQ ID NO: 2. A method of reducing deamidation of AAVhu68 capsids comprising glycine codons independently modified in one to three of the arginine-glycine pairs located at position one, wherein the modified codons encode amino acids other than glycine. A method of reducing deamidation of an AAVhu68 capsid, the method comprising producing an AAVhu68 capsid from a nucleic acid sequence containing a modified AAVhu68 vp codon, wherein the nucleic acid sequence is 57, 329, 452 and / or 512 in SEQ ID NO: 2. A method of reducing deamidation of an AAVhu68 capsid, comprising an arginine codon independently modified in one to three of the arginine-glycine pairs located at position one, wherein the modified codon encodes an amino acid other than arginine. 40. The method of any one of claims 38 or 39, wherein each modified codon encodes a different amino acid. 40. The method of claim 38 or 39, wherein two or more modified codons encode the same amino acid. Mutant rAAVhu68, comprising the hu68 capsid with reduced deamidation as compared to the unmodified hu68 capsid produced using the method according to any one of claims 38 to 41.

Images