KR20190122596A - Gene Construct for Base Editing, Vector Comprising the Same and Method for Base Editing Using the Same - Google Patents

Abstract

The present invention relates to a gene construct for base editing, specifically, a gene construct encoding split-Cas9 and deaminase, a vector comprising the gene construct, and a method for base editing by introducing the vector.

Description

Gene Construct for Base Editing, Vector Comprising and Vector Comprising the Same and Method for Base Editing Using the Same}

The present invention relates to a gene construct for correcting a base, specifically, a split Cas9 (Split-Cas 9) and a gene construct encoding a diminase, a vector comprising the gene construct, a method for correcting a base by introducing the vector, and the vector And non-human animals in which the corrected bases are expressed.

Cytidine deaminase, such as apolipoprotein B editing complex 1 (APOBEC1) or activation-induced deaminase (AID), may be used to treat Cas9 nickase (nCas9) or catalytically-deficient Cas9 (dCas9). In conjunction with, it has been reported that at the target site C can be replaced by T (or G by A) without DSB production (Ma, Y. et al. Nat. Methods 13, 1029-1035 (2016) ).

Point mutations due to deamination of nucleic acid bases are a major cause of genetic disorders and diversity in humans. Unlike mutant agents that cause deamination of random nucleic acid bases, catalytically defective CRISPR-Cas9 variants such as nCas9 (D10A Cas9 nickase) from Streptococcus pyogenes or catalytically defective dCas9 (D10A / H840A Cas9) And deminase proteins from various sources allow guide RNA dependent single nucleotide conversion or base editing of cells and organisms. Such base editing systems can be classified into two categories: cytosine base editor (CBE), which converts C: G base pairs into T: A pairs, and adenine bases that convert A: T base pairs into G: C base pairs. Editor (ABE).

These RNA-guided programmable delaminations, unlike Cas9 nucleases, do not result in DNA double strand cleavage (DSB) and do not rely on endogenous DSB repair pathways, so that template donor DNA for homology-related repair in base editing is not available. It does not require and does not leave undesirable small insertions or deletions (indels) induced by error-prone non-homologous end joining (NHEJ) at the target site.

Since development, CBE has been rapidly adopted for inducing target mutations in plants and animals. nCas9 and TadA (tRNA adenosine diamines), a modified dianase derived from E. coli , have not yet been tested in higher eukaryotes.

Under this technical background, the inventors of the present application utilize an Adenine base editor (ABE) consisting of genetically engineered adenine deaminase and Streptococcus Pyogenes Cas9 kinase variants to achieve efficient adenine base editing in adult animals. It was confirmed that the present invention was completed.

It is an object of the present invention to provide a genetic construct for base correction.

Another object of the present invention is to provide a vector for base correction in which the gene construct is operably linked.

Another object of the present invention to provide a method for correcting a base comprising the step of introducing the gene construct or the vector.

Another object of the present invention is to provide a non-human animal in which the vector is introduced and the corrected base is expressed.

In order to achieve the above object, the present invention is (i) a gene encoding a first domain comprising the N-terminal of the Cas9 protein, a gene encoding a dominant is linked to the gene encoding the first domain; And (ii) a gene encoding a second domain comprising the C-terminus of the Cas9 protein, wherein the first domain and the second domain are fused and expressed to form a Cas9 protein. .

The present invention also provides a kit comprising: (i) a gene encoding a first domain comprising the N-terminus of a Cas9 protein, a first vector operably linked to a gene encoding a diminase; And (ii) a second vector operably linked to a gene encoding a second domain including the C-terminus of the Cas9 protein, wherein the first domain and the second domain are fused to express the Cas9 protein. A base correction vector is provided.

The present invention also provides a base calibration method comprising the step of introducing the vector.

The present invention further provides a non-human animal in which the vector is introduced and the corrected base is expressed.

According to the present invention, a trans-splicing adeno accessory viral vector was successfully transferred to a muscle cell of a mouse model of Duchenne muscular dystrophy, using a trans-splicing adeno-associated virus vector to correct nonsense mutations in the Dmd gene, and for the first time in adult animals. Demonstrated therapeutic base editing. In addition, the mutations that cause genetic diseases can be accurately corrected in adults. Accordingly, not only can adenine base correction be applied at the animal subject level, but also the gene of the animal subject in which the genetic disease is expressed can be corrected to normal.

According to the present invention, various transgenic animals can be produced effectively and accurately, and can be applied to actual gene therapy.

1 shows the results of therapeutic baseline editing of ABE in a mouse model of Duchenne muscular dystrophy.
(a) ABE target sequence in exon 20 of the Dmd gene comprising a nonsense mutation. PAM sequence is shown in blue. underline the proto-spacer sequence. Mutant nucleotides and guanine nucleotides corrected by ABE in Dmd knockout mice are shown in red and green, respectively.
(b) Schematic of a trans splicing AAV vector encoding recombinant E. coli TadA (ecTadA) bound to a first half Nikase Cas9 (nCas9-NT) and a second half Nikase Cas9 (nCas9 -CT). SD; splicing donor, SA; splicing acceptor.
(c) Base editing frequency of the Dmd target site was determined by deep sequencing. Error bars mean sem (n = 3).
(d) Histological analysis of tibialis anterior (TA) muscles in wild-type, Dmd knockout and ABE-treated (+ ABE) Dmd knockout mice 8 weeks after intramuscular delivery of tsAAV. As shown in the next section, dystrophin and neuronal nitric oxide synthase (nNOS) coexisted in the muscle cell membrane. (e) Quantification of dystrophin positive (dys +) fibers in the cross section of TA muscle. Error bars mean sem (n = 3).
2 shows a schematic diagram of a trans-splicing AAV vector encoding ABE. The first vector delivers a splice donor signal that is bound to the ecTadA and nCas9-NT cDNA fused to the 5 'end of the sgRNA, Spc512 promoter, and nCas9-NT cDNA induced by the U6 promoter. The second vector contains an NLS, HA tag and a bGH poly A signal following nCas9-CT adjacent to the splice acceptor at the 5 'end of nCas9-CT.
(a) Infect two target AAV-ABE vectors simultaneously.
(b) The two viral vectors recombine in ITR by recombination, leading to heterodimer formation in the form of ecTadA, nCas9-NT, SD, SA, nCas9-CT linked together.
(c) Construct Dmd target specific sgRNAs and ABE Pre-mRNAs.
(d) By splicing, SD and SA introns are removed together with ITR and ABE protein is translated. SD, splicing donor; SA, splicing acceptor; NLS, nuclear localization signal; ITR, inverted terminal repeat.
3 shows the results showing the base editing specificity of ABE in Dmd knockout mice. Targeting deep sequencing on genomic DNA isolated from muscle 8 weeks after tsAAV: ABE injection, base editing frequencies were measured at potential off-target sites identified by Cas-OFFinder. Mismatched nucleotides and PAM sequences are shown in red and blue, respectively. OT: off-target site. Error bars represent sem (n = 3).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The present invention, in one aspect, (i) a gene encoding a first domain comprising the N-terminal of the Cas9 protein, a gene encoding a diminase is linked to the gene encoding the first domain; And (ii) a gene encoding a second domain comprising the C-terminus of the Cas9 protein, wherein the first domain and the second domain are fused and expressed to form a Cas9 protein. It is about.

The diamines include adenosine diamines or cytidine diamines and can convert adenosine (A) to inosine (I) or cytidine (C) to uridine (U). The dianamin may be selected from the group consisting of, for example, apolipoprotein B editing complex 1 (APOBEC1), activation-induced deaminase (AID), and tRNA-specific adenosine deaminase (tadA).

In one embodiment, the dianamin may be adenosine deaminase, and in the present invention, the base correction reaction using the demiamine may be performed by changing a target RNA sequence and performing an editing reaction. The editorial reaction with adenosine deaminase is adenosine deamination and can convert adenosine to inosine. The editorial reaction with cytidine diminase is cytidine deamination and can convert cytidine to uridine.

The adenosine deaminase is an enzyme involved in converting adenosine (A) to inosine (I), and is a multi-domain protein comprising two to three double-stranded RNA recognition domains and a catalytically active domain depending on the enzyme. Recognition domains recognize specific double-stranded RNA (dsRNA) sequences and / or shapes, while catalytically active domains indenosine (I) bind adenosine (A) at nearby or pre-determined positions of the target RNA by deamine of nucleobases. Can be converted to Inosine is read into guanine by the translational process of the cell, which is capable of encoding protein sequences if the edited adenosine is present in the coding region of the mRNA or pre-mRNA.

The conversion of adenosine (A) to inosine (I) can also occur at the 5 'noncoding sequence of the target mRNA and be generated in a protein extending on the N terminus or in a noncoding site in the 3'UTR or other transcript. A new translation start site can be created upstream of the original starting position. This may affect the processing and / or stability of the RNA. In addition, the conversion of adenosine (A) to inosine (I) can occur in the splice configuration of introns or exons in the pre-mRNA, which can lead to changes in the splicing pattern. As a result, exons can be included or skipped. Adenosine deaminase is part of a family of enzymes called adenosine deaminase that act on RNA (ADAR), including the human deminase hADAR1, hADAR2, and hADAR3.

In one embodiment, the adenosine deaminase may be, for example, tadA (tRNA-specific adenosine deaminase). The adenosine deaminase is derived from, for example, E. coli TadA 7.10. The adenosine deminase may be linked to the 5 'direction of the gene encoding the first domain including the N-terminus of the Cas9 protein. The adenosine deaminase may be used in the form of a protein or DNA encoding the same, or an mRNA encoding the same. The gene encoding the diminase may include, for example, the sequence of SEQ ID NO: 6.

The Cas protein is a major protein component of the CRISPR / Cas system and is a protein capable of forming activated endonucleases or nickases.

Cas protein or genetic information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI). For example, the Cas protein,

Streptococcus sp. Streptococcus sp., Such as Cas proteins from Streptococcus pyogenes , such as Cas9 proteins (eg SwissProt Accession number Q99ZW2 (NP — 269215.1));

Campylobacter genus, for example, Campylobacter Jeju Needle (Campylobacter jejuni) derived from Cas proteins, e.g., protein Cas9;

Cas proteins, such as Cas9 proteins from the Streptococcus genus, such as Streptococcus thermophiles or Streptocuccus aureus ;

Cas proteins, such as Cas9 proteins from Neisseria meningitidis ;

Cas proteins, such as Cas9 proteins, from the genus Pasteurella , such as Pasteurella multocida ;

Fran when cellar (Francisella) in, for example, when Francisco Cellar Novi Let (Francisella novicida), but may be one or more selected from the group consisting of the origin of the Cas proteins, such as Cas9 protein or the like, without being limited thereto.

The Cas9 protein may be isolated from a microorganism or may be artificially or non-naturally occurring, such as in a recombinant or synthetic method. In one embodiment, the Cas9 protein may be a recombinant protein made by recombinant DNA. Recombinant DNA (rDNA) refers to a DNA molecule artificially produced by genetic recombination methods such as molecular cloning to include heterologous or homologous genetic material obtained from various organisms. For example, when recombinant DNA is expressed in an appropriate organism to produce target specific nucleases ( in vivo or in vitro ), the recombinant DNA is optimized for expression in the organism among codons encoding the protein to be prepared. It may have a nucleotide sequence reconstructed by selecting.

In the present invention, a vector capable of expressing a part of Cas9 was prepared to express Cas9 in a viral vector. That is, the Cas9 protein was divided into sizes that can be packaged in a viral vector and expressed in each vector. In the present invention, the first domain and the second domain of the Cas9 protein refer to a part of the Cas9 protein, and these are intended to be expressed by fusion after a separate vector is delivered into each cell. In the present invention, the Cas9 protein produced in the above manner was named "split-Cas9".

split-Cas9 divides Cas9 protein, which is large in size and has not been packaged through a viral vector, into a packageable size, and does not lose its function in cells even though each of them is expressed through the vector.

“First domain” refers to a domain comprising the N-terminal portion of the original Cas9 protein when expressing a portion of Cas9 cleaved for this purpose, and refers to a “second domain” C-terminal portion of the original Cas9 protein. Refers to the containing domain. Each of these domains is used interchangeably with the term "half (half) domain" in the present invention. Since each domain is intended to be expressed in a viral vector, each of the domains may be a size of 400 bp to 3.7 kbp that can be packaged in the viral vector. Specifically, in the present invention, since the first domain and the second domain are fused to constitute the entire original Cas9 protein, the size of one domain is obtained by subtracting the size of the other domain from the size of the entire Cas9 protein.

In a specific embodiment of the present invention, SG is cleaved by cleaving an intermediate region of a disordered linker (agcggccagggc; a sequence encoding an SGQG amino acid) present in an intermediate region of a wild-type (WT) Cas9 (CRISPR associated protein 9) protein. Two half domains were constructed in which the amino acid and the QG amino acid were linked to the first domain and the second domain, respectively.

The first domain was introduced into the plasmid vector and the viral vector with 2.1 kbp and the second domain as 1.9 kbp, and it was confirmed that split-Cas9 was able to induce Indel at the target position in the cells using the respective vectors. . The gene encoding the first domain may include the sequence of SEQ ID NO: 8, or the gene encoding the second domain may include the sequence of SEQ ID NO: 11.

The Cas9 protein may be in mutated form. It may mean that it has been mutated to lose endonuclease activity that cleaves DNA double strands, eg, to lose endonuclease activity and to have Nikase activity, or to target specific nucleases and endonucleases. It can be mutated to lose both first and Nikase activity. If it has Nikase activity, either the strand in which the base transformation takes place or the opposite strand (eg, base) simultaneously or sequentially with or without the base transformation by the diaminase (eg, cytidine to uradine) Nick may be introduced at the opposite strand of the strand where the transformation takes place (e.g., at the opposite strand of the strand where the PAM is located, nick at a position corresponding between the 3rd and 4th nucleotides in the 5 'end direction of the PAM sequence) Is introduced). Such mutations (eg, amino acid substitutions, etc.) may occur at least in the catalytic active domain of the nuclease (eg, the RuvC catalytic domain for Cas9).

In one embodiment, for the Streptococcus pyogenes derived Cas9 protein (SwissProt Accession number Q99ZW2 (NP_269215.1)), the mutation is catalytic aspartate residue (aspartic acid residue at position 10 (D10), etc.) ), Glutamic acid at position 762 (E762), histidine at position 840 (H840), asparagine at position 854 (N854), asparagine at position 863 (N863), aspartic acid at position 986 (D986), and the like. Mutations substituted with one or more of any other amino acid selected from the group. At this time, any other amino acid to be substituted may be alanine, but is not limited thereto.

In another example, the Cas9 protein may be mutated to recognize a different PAM sequence than the wild type Cas9 protein. For example, one or more of the aspartic acid at position 1135 (D1135), arginine at position 1335 (R1335), and threonine at position 1337 (T1337) of the Streptococcus pyogenes derived Cas9 protein, such as all three, may be And may be mutated to recognize an NGA (N is any base selected from A, T, G, and C) that is different from the PAM sequence (NGG) of wild type Cas9.

In one embodiment, the amino acid sequence of the Cas9 protein derived from Streptococcus pyogenes,

(1) D10, H840, or D10 + H840;

(2) D1135, R1335, T1337, or D1135 + R1335 + T1337; or

(3) Amino acid substitutions may have occurred at both (1) and (2) residues.

As used herein, the 'other amino acids' are alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, valine, aspartic acid, cysteine, glutamine, glycine, serine, threonine, tyrosine, aspartic acid, glutamic acid, Arginine, histidine, lysine, among all known variants of these amino acids, refers to an amino acid selected from among amino acids except for those that the wild type protein originally had at the mutation site. In one embodiment, the 'other amino acid' may be alanine, valine, glutamine, or arginine.

In one embodiment, to recognize a modified Cas9 protein that has lost endonuclease activity (eg, has Nikase activity, or has lost both endonuclease activity and Nikase activity), or a PAM sequence that is different from wild type Cas9. Can be. For example, the modified Cas9 protein, in the Cas9 protein derived from Streptococcus pyogenes ,

(1) a modified Cas9, or Cas9 protein from Streptococcus pyogenes , which has introduced a mutation (e.g., substitution with another amino acid) at the D10 or H840 position, resulting in loss of endonuclease activity and having Nikase activity A modified Cas9 protein wherein mutations (eg, substitution with other amino acids) were introduced at both the D10 and H840 positions, resulting in loss of both endonuclease activity and Nikase activity;

(2) a modified Cas9 protein that incorporates a mutation (eg, substitution with another amino acid) in one or more or all of D1135, R1335, and T1337 to recognize a PAM sequence that is different from the wild type; or

(3) Both mutations of (1) and (2) have been introduced to recognize PAM sequences that have Nikase activity and differ from the wild type, or lose both endonuclease activity and Nikase activity and recognize PAM sequences that differ from the wild type May be a modified Cas9 protein.

For example, the mutation at the D10 position of the CAs9 protein means a D10A mutation (mutation in which D, the tenth amino acid of the amino acids of the Cas9 protein, is replaced by A; hereinafter, a mutation introduced into Cas9 is represented by the same method). And the mutation at the H840 position may be an H840A mutation and the mutations at the D1135, R1335, and T1337 positions may be D1135V, R1335Q, and T1337R, respectively.

In one embodiment, a Cas9 protein derived from Streptococcus pyogenes (eg, SwissProt Accession number Q99ZW2 (NP_269215.1)) of the Cas9 protein used herein, (1) a mutation at the D10 position (eg, another Substitution with amino acids) results in the loss of endonuclease activity and modification Cas9 with Nikase activity, (2) a mutation at the H840 position (e.g., substitution with another amino acid) is introduced to result in an endonuclease activity Modified Cas9, (3) a mutation at the D10 position (e.g., substitution with another amino acid) and a mutation (e.g., substitution with another amino acid) at the H840 position are introduced, resulting in endonuclease activity And it may be one or more selected from the group consisting of modified Cas9 protein, etc. that lost all the Nikase activity. For example, the mutation at the D10 position of the CAs9 protein means a D10A mutation (mutation in which D, the tenth amino acid of the amino acids of the Cas9 protein, is replaced by A; hereinafter, a mutation introduced into Cas9 is represented by the same method). And the mutation at the H840 position may be a H840A mutation.

The nuclease may be isolated from a microorganism or artificially or non-naturally occurring, such as in a recombinant or synthetic method. In one embodiment, the nuclease may be a recombinant protein made by recombinant DNA. Recombinant DNA (rDNA) refers to a DNA molecule artificially produced by genetic recombination methods such as molecular cloning to include heterologous or homologous genetic material obtained from various organisms. For example, when recombinant DNA is expressed in an appropriate organism to produce a protein ( in vivo or in vitro ), the recombinant DNA is reconstituted by selecting a codon optimized for expression in the organism among the codons encoding the protein to be produced. It may have a nucleotide sequence.

The nuclease may be used in the form of a protein, a nucleic acid molecule (DNA or mRNA) encoding the same, a ribonucleic acid protein coupled with a guide RNA, a nucleic acid molecule encoding the ribonucleic acid protein, or a recombinant vector comprising the nucleic acid molecule. Can be.

The nuclease or nucleic acid molecule encoding the same may be in a form that can be delivered, acted, and / or expressed into the nucleus.

The nuclease may be in a form that is easy to introduce into the cell. In one example, the nuclease may be linked with a cell penetrating peptide and / or a protein transduction domain. The protein transfer domain may be, but is not limited to, poly-arginine or HIV derived TAT protein. Cell penetrating peptides or protein delivery domains are known in the art in addition to the examples described above, so those skilled in the art can apply various examples without being limited to these examples.

In addition, the nuclease or nucleic acid molecule encoding may further comprise a nuclear localization signal (NLS) sequence or a sequence encoding it. Thus, an expression cassette comprising a nucleic acid molecule encoding said nuclease may comprise a regulatory sequence, such as a promoter sequence for expressing said nuclease, or in addition, an NLS sequence. Such NLS sequences are well known in the art.

The nuclease or nucleic acid molecule encoding the same may be linked to a tag for isolation and / or purification or to a nucleic acid sequence encoding the tag. For example, the tag may be appropriately selected from the group consisting of small peptide tags such as His tag, Flag tag, S tag, GST (Glutathione S-transferase) tag, MBP (Maltose binding protein) tag, but not limited thereto. It doesn't work.

In one embodiment, the guide RNA may further comprise. "Guide RNA" refers to a target DNA specific RNA (eg, RNA hybridizable with a target site of DNA), and binds to and directs to a target DNA a nuclease such as a Cas protein.

The guide RNA may be appropriately selected depending on the type of nuclease and / or the microorganism derived from the nuclease. For example, the guide RNA

CRISPR RNA (crRNA) comprising a site that is hybridizable with a DNA target site;

Trans- activating crRNA (tracrRNA) comprising a site that interacts with an endonnucleotide such as Cas protein, Cpf1, etc .; And

The main site of the crRNA and tracrRNA (eg, hybridization site of the crRNA and the interaction site of the tracrRNA) may be one or more selected from the group consisting of a single guide RNA (sgRNA) in a fused form,

Specifically, it may be a dual RNA including CRISPR RNA (crRNA) and a trans- activating crRNA (tracrRNA), or a single guide RNA (sgRNA) comprising a major site of crRNA and tracrRNA.

The sgRNA may include a portion having a sequence complementary to a sequence in the target DNA (also referred to as a spacer region, a target DNA recognition sequence, a base pairing region, etc.) and a hairpin structure for Cas protein binding. More specifically, it may include a portion having a sequence complementary to the sequence in the target DNA, a hairpin structure and a Terminator sequence for Cas protein binding. The structure described above may be present in order from 5 'to 3', but is not limited thereto. Any form of guide RNA may be used in the present invention, provided that the guide RNA comprises a major portion of crRNA and tracrRNA and complementary portions of the target DNA.

For example, a Cas9 protein can be used to correct two target RNAs, ie, a CRISPR RNA (crRNA) having a nucleotide sequence that can hybridize with a target sequence site of a target gene, and a trans- activating crRNA (tracrRNA; And the crRNA and tracrRNA can be used in the form of a double stranded crRNA: tracrRNA complex bound to each other, or linked through a linker to form a single guide RNA (sgRNA). In one embodiment, when using a Cas9 protein derived from Streptococcus pyogenes , the sgRNA comprises at least a portion of all or part of the crRNA comprising the hybridizable nucleotide sequence of the crRNA of the Cas9 and a site that interacts with the Cas9 protein of the tracrRNA of the Cas9. Some or all of the tracrRNA may be to form a hairpin structure (stem-loop structure) through the nucleotide linker (the nucleotide linker may correspond to the loop structure).

The guide RNA, specifically crRNA or sgRNA, comprises a sequence complementary to the sequence in the target DNA, and at least one at the 5 'end of the upstream site of the crRNA or sgRNA, specifically the crRNA of the sgRNA or dual RNA, eg 1-10 Dogs, 1-5, or 1-3 additional nucleotides. The additional nucleotide may be guanine (G), but is not limited thereto.

The specific sequence of the guide RNA may be appropriately selected according to the type of nuclease (Cas9 protein) (ie, derived microorganism), which is easily understood by those skilled in the art. .

In one example, when using a Cas9 protein from Streptococcus pyogenes as a target specific nuclease, the crRNA can be expressed by the following general formula (1):

5 '-(N _cas9 ) _l- (GUUUUAGAGCUA)-(X _cas9 ) _m -3' (Formula 1)

In the general formula 1,

N _cas9 is a targeting sequence, i.e., a site determined according to the sequence of a target site of a target gene (ie, a sequence that is hybridizable with the sequence of the target site), and l is included in the targeting sequence. Indicative of the number of nucleotides, which may be an integer from 17 to 23 or 18 to 22, such as 20;

The site comprising 12 consecutive nucleotides (GUUUUAGAGCUA) located adjacent in the 3 'direction of the target sequence is an essential part of the crRNA,

X _cas9 is a site comprising m nucleotides located at the 3 'end of the crRNA (ie, located adjacent in the 3' direction of an essential part of the crRNA), where m is an integer from 8 to 12, such as 11 The m nucleotides may be the same as or different from each other, and may be independently selected from the group consisting of A, U, C, and G.

In one example, the X _cas9 may include but is not limited to UGCUGUUUUG.

In addition, the tracrRNA may be represented by the following general formula (2):

5 '-(Y _cas9 ) _p- (UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC) -3' (Formula 2)

In Formula 2, the site represented by 60 nucleotides (UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC) is an essential part of the tracrRNA,

Y _cas9 is a site comprising p nucleotides located adjacent to the 5 'end of the essential portion of the tracrRNA, p may be an integer of 6 to 20, such as an integer of 8 to 19, the p nucleotides are the same as each other Or may be independently selected from the group consisting of A, U, C and G.

In addition, the sgRNA is a crRNA moiety comprising the targeting sequence and the essential site of the crRNA and a tracrRNA moiety including the essential moiety (60 nucleotides) of the tracrRNA form a hairpin structure (stem-loop structure) through the oligonucleotide linker. Where the oligonucleotide linker corresponds to the loop structure. More specifically, the sgRNA is a double stranded RNA molecule in which a crRNA portion including a targeting sequence and an essential portion of the crRNA and a tracrRNA portion including an essential portion of the tracrRNA are bonded to each other, and the 3 'end of the crRNA region and 5 of the tracrRNA region ′ May have a hairpin structure linked via an oligonucleotide linker.

In one example, the sgRNA can be represented by the following general formula 3:

5 ′-(N _cas9 ) _l- (GUUUUAGAGCUA)-(oligonucleotide linker)-(UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC) -3 '(Formula 3) In Formula 3, (N _cas9 ) _l is the preceding targeting formula in Formula 1 As described.

The oligonucleotide linker included in the sgRNA may be one containing 3 to 5, such as 4 nucleotides, the nucleotides may be the same or different from each other, each independently selected from the group consisting of A, U, C and G Can be.

The crRNA or sgRNA may further comprise 1-3 guanine (G) at the 5 'end (ie, the 5' end of the targeting sequence region of the crRNA).

The tracrRNA or sgRNA may further comprise a termination region comprising 5 to 7 uracils (U) at the 3 'end of the essential portion (60nt) of the tracrRNA.

The target sequence of the guide RNA is adjacent to 5 'of PAM on the target DNA (5'-NGG-3' (N is A, T, G, or C) for Protospacer Adjacent Motif sequence ( S. pyogenes Cas9) And from about 17 to about 23 or from about 18 to about 22, such as 20 contiguous nucleic acid sequences.

The targeting sequence of the guide RNA that can hybridize with the target sequence of the guide RNA is a DNA strand (ie, PAM sequence (5'-NGG-3 '(N is A, T, G, or C)) in which the target sequence is located. Nucleotide sequence of the complementary strand of the DNA strand) located at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or at least 100% of the nucleotide sequence By sequence, complementary binding to the nucleotide sequence of the complementary strand is possible.

In this specification, the nucleic acid sequence of the target site is represented by the nucleic acid sequence of the strand where the PAM sequence is located among the two DNA strands of the corresponding gene site of the target gene. At this time, since the DNA strand to which the guide RNA actually binds is the complementary strand of the strand where the PAM sequence is located, the targeting sequence included in the guide RNA is a sequence of the target site, except that T is changed to U due to RNA characteristics. It will have the same nucleic acid sequence as. Thus, in this specification, the targeting sequence of the guide RNA and the sequence of the target site (or the sequence of the cleavage site) are represented by the same nucleic acid sequence except that T and U are mutually altered.

The guide RNA may be used in the form of RNA or in the form of a plasmid containing DNA encoding the same.

"Genome editing" is a technique that allows the introduction of targeted mutations in genomic sequences of animal and plant cells, including human cells, by knocking out or knocking out a specific gene, Refers to introducing a mutation into a non-coding DNA sequence that does not produce a protein. In addition, genome correction allows deletion, duplication, inversion, replacement or rearrangement of DNA on the genome.

"Deleted" means a mutation that results from a missing portion of a chromosome or a portion of a base on DNA. "Duplicate" means two or more of the same gene in the genome. "Inverted" means that a portion of the genome is placed upside down as compared to the original genome. In the present invention, "replacement" means that one nucleotide sequence is replaced with each other (i.e., replacement of informational sequences), and that only one polynucleotide is chemically or physically replaced with another polynucleotide. It does not mean. In the present invention, "rearrangement" means a structural change that causes a change in the position and sequence of genes on a chromosome, and includes translocation factors such as transposons or the like. In addition, it may include the conversion of genetic information by base rearrangement in the DNA molecule.

In the present invention, "on-target site" means a position to introduce a mutation (cutting, insertion, and / or deletion) using the Cas9 protein, which can be arbitrarily selected according to the purpose In addition to being present inside the coding sequence of a particular gene, it may be present in a non-coding DNA sequence that does not produce a protein.

Since the Cas9 protein has sequence specificity, the Cas9 protein acts at the target position, but side effects may occur at the off-target site depending on the target sequence.

In the present specification, the off-target site refers to a position having a sequence that is not identical to the target sequence of the Cas9 protein, but the Cas9 protein is active. That is, it refers to a position cleaved by the Cas9 protein other than the target position. In one example, the non-target position can be used as a concept that includes not only the actual non-target position for a particular Cas9 protein but also a position that is likely to be a non-target position. The non-target position may be any position other than the target position cleaved by the Cas9 protein in vitro , but not limited thereto.

Genetic shearing activity at a position other than the target position can be caused by a variety of causes. For example, it is possible that genetic scissors work for non-target sequences that have high sequence homology with the target position, which has a nucleotide mismatch with the target sequence designed for the target position. The non-target position may be a position having one or more nucleotide mismatches with a target sequence, but not limited thereto.

In another aspect, the present invention provides a kit comprising: (i) a first vector encoding a first domain comprising the N-terminus of a Cas9 protein, a first vector operably linked to a gene encoding a diminase; And (ii) a second vector operably linked to a gene encoding a second domain comprising the C-terminus of the Cas9 protein, wherein the first domain and the second domain are fused and expressed to form a Cas9 protein. The present invention relates to a base calibration vector.

"Operably linked" means a functional binding between a regulatory sequence associated with gene expression (eg, a promoter, signal sequence, or transcriptional regulator, etc.) and another gene, whereby the regulatory sequence is transcription of the other gene. And / or control detoxification.

As the vector used for overexpression of the gene, an expression vector known in the art may be used. "Vector" is used to refer to a DNA fragment (s), a nucleic acid molecule, that delivers into a cell. Vectors can replicate DNA and be reproduced independently in host cells. The term "carrier" is often used interchangeably with "vector". The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and a suitable nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism.

The expression vector may preferably comprise one or more selectable markers. The marker is a nucleic acid sequence having a characteristic that can be selected typically by a chemical method, may be any gene that can distinguish the transformed cells from non-transformed cells. For example, there are antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol, but are not limited thereto.

The vector further includes an inverted terminal repeat (IRT), a promoter, a nucleus localization protein sequence (NLS), and a splicing donor (SD) in the first vector; And / or the second vector may further include an ITR, a Splicing Acceptor (SA), an NLS, a hemagglutinin (HA) tag, and a polyA.

"Promoter" means a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. The promoter may include a promoter for expression in a mammal, and may include, for example, Spc512, U6, U3, H1, or 7SL, but is not limited thereto.

Each of the first vector and the second vector includes the same inverted terminal repeat (ITR) sequence at 5 'and 3', and may be heterodimerized through recombination of the same ITR sequence.

Both vectors may also comprise a splicing donor or acceptor signal, the splicing donor signal may be located at the 3 'end of the first vector, and the splicing acceptor signal may be located at the 5' end of the second vector. Full-length ABE proteins can be expressed after maturation and splicing of mRNA by splicing donor or receptor signals.

The vector may further comprise an NLS and may comprise an amino acid sequence having a strength sufficient to induce accumulation of the protein in a detectable amount in a mammal. The NLS may comprise short sequences (eg, 2-20 residues) comprising one or more of the basic, positively charged residues (eg, lysine and / or arginine) and are target specific. It may be operably linked to the N terminus or C terminus of the nuclease.

The vector may include a tag as a detectable label, and the tag may include 6xHis, FLAG ^ㄾ , HA, GST, Myc, and the like, but is not limited thereto.

The vector may include a plasmid vector, a cosmid vector or a viral vector, and specifically, may be a viral vector. Viral vectors are retroviruses such as Human immunodeficiency virus HIV (Murine leukemia virus) Avian sarcoma / leukosis (ASLV), Spleen necrosis virus (SNV), Rous sarcoma virus (RSV) and Mouse mammary (MMTV). tumor viruses, such as, but not limited to, vectors derived from Adenovirus, Adeno-associated virus, Herpes simplex virus, and the like.

Specifically, the first vector comprises the N-terminus of the ITR-promoter (U6) -guide RNA-promoter (Spc5-12) -NLS-deamiase coding gene-Cas9 protein in the 5 'to 3' direction. A second domain coding gene-NLS-tag comprising a domain coding gene-splicing donor-ITR and the second vector comprising the C-terminus of the ITR-splicing receptor-Cas9 protein in the 5 'to 3' direction (HA) -poly A-ITR.

In another aspect, the present invention relates to a base editing composition comprising the vector. The composition included in the composition is the same as described above, it can be applied equally to the composition.

In another aspect, the present invention relates to a base calibration method comprising the step of introducing said vector.

In a specific embodiment according to the present invention, in which the ABE7.10 Dmd a nonsense mutation in the target used (Fig. 1a) was to demonstrate the therapeutic nucleotide edited in a mouse model of Duchenne muscular dystrophy with a premature termination codon in the Dmd gene. Using the double trans-splicing adeno-associated virus (tsAAV) vector system, since the ABE7.10 gene and sgRNA (6.1kbp in size with promoter) cannot be packaged in a single AAV vector with a packing limit of about 4.7 kbp, The ABE gene was divided into two parts and delivered to skeletal muscle (FIGS. 1B and 2). Two AAV vectors encoding the N- or C-terminal half of ABE7.10, respectively, in cotransduced cells are efficiently heterodimerized by recombination of the same inverted terminal repeat (ITR) sequence in each vector. Since both vectors also contain a splicing donor or receptor signal, the full length ABE7.10 protein is expressed after maturation and splicing of the mRNA.

The introduction is carried out by various methods in the art such as microinjection, electroporation, DEAE-dextran treatment, lipofection, nanoparticle-mediated transfection, protein delivery domain mediated introduction, etc. Can be.

Gene constructs, vectors and methods according to the invention may be applied to eukaryotic organisms. The eukaryotic organisms are eukaryotic cells such as yeast, fungi, eukaryotic-derived cells such as embryonic cells, stem cells, somatic cells, germ cells, etc., or eukaryotic animals such as humans, monkeys, etc. , Pigs, cattle, sheep, goats, cows, rats, and the like. Gene constructs, vectors and methods according to the invention can be used to prepare transformed eukaryotic organisms by base correction.

In this respect, the present invention relates to a non-human animal in which the vector is introduced and the corrected base is expressed. Such animals may be advantageous for non-human mammals. In particular, it may be a mouse, rat or rabbit.

Example

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1 trans-splicing AAV vector plasmid and gRNA construction

Sequences encoding the N-terminal half (2,145 bp, 715 amino acids) of E. coli TadA and nCas9 were cloned into an AAV ITR (inverted terminal repeat) based vector plasmid (pAAV-ABE-NT). Dmd (Exon 20) Targeting sgRNA (gX20) sequences were inserted and transcribed under the control of the U6 promoter (pAAV-IRT-ABE-NT-sgRNA). ABE expression was controlled by the SpC5-12 muscle specific promoter. The sequence encoding the C-terminal half (1,959 bp, 653 amino acids) of nCas9 conjugated with the NLS, HA tag and bGH poly A signal was cloned into an AAV ITR based vector plasmid (pAAV-ABE-CT). The synthetic splicing donor sequence derived from the human β globin gene and the splicing receptor sequence derived from the human immunoglobulin heavy chain gene were introduced at the 3 'end of nCas9-NT and 5' end of nCas9-CT, respectively, in transduced cells. Assembly of the full length ABE7.10 protein was induced.

Table 1.

ABE7.10 targeting Dmd nonsense mutations (FIG. 1A) was used to demonstrate therapeutic baseline editing in a mouse model of Duchenne muscular dystrophy with early termination codons in the Dmd gene. Using the double trans-splicing adeno-associated virus (tsAAV) vector system, since the ABE7.10 gene and sgRNA (6.1kbp in size with promoter) cannot be packaged in a single AAV vector with a packing limit of about 4.7 kbp, The ABE gene was divided into two parts and delivered to skeletal muscle (FIGS. 1B and 2). Two AAV vectors encoding the N- or C-terminal half of ABE7.10, respectively, in cotransduced cells are efficiently heterodimerized by recombination of the same inverted terminal repeat (ITR) sequence in each vector. Since both vectors also contain a splicing donor or receptor signal, the full length ABE7.10 protein is expressed after maturation and splicing of the mRNA.

Intramuscular administration of two trans-splicing viral vectors tsAAV: ABE via intramuscular administration to tibialis anterior (TA ) muscles of Dmd knockout mice induced base substitutions from exact A to G and evaluated by targeted deep sequencing Early stop codons were converted to a frequency of 3.3 ± 0.4% for 8 weeks post-injection. Undesired indels at the target site were not induced by tsAAV: ABE treatment, demonstrating the advantage of base editing for the CRISPR-Cas9 mediated Dmd gene in mice. In addition, off target mutations were not induced to the extent of detection at homologous sites with up to three mismatches (FIG. 3).

Importantly, Dmd targeting tsAAV: ABE restored expression of dystrophin in 17 ± 1% of muscle fibers (FIGS. 1D and e). It should be noted that about 4% of general dystrophin expression is sufficient to improve muscle function. In addition, tsAAV: ABE treatment results in the localization of the sarcolemmal of the neuronal nitric oxide synthase (nNOS), an important regulator of skeletal muscle locomotor capacity, which is a dystrophin-associated protein complex produced from base-edited muscle cells. Suggests functional interaction with (FIG. 1D).

In summary, ABE can be used to construct disease models containing single base substitutions, and extend the in vitro and in vivo base editing windows through extended sgRNAs with several additional nucleotides at the 5 'end. Showed that there is. It is proposed that ABE delivered via trans-splicing AAV enables therapeutic base editing in vivo to correct for point mutations that cause genetic disorders.

As described above in detail a specific part of the content of the present invention, for those skilled in the art, such a specific description is only a preferred embodiment, which is not limited by the scope of the present invention Will be obvious. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Institute for Basic Science <120> Gene Construct for Base Editing, Vector Comprising the Same and          Method for Base Editing Using the Same <130> 078 <160> 13 <170> PatentIn version 3.5 <210> 1 <211> 130 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct 130 <210> 2 <211> 141 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 2 aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60 ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120 gagcgcgcag ctgcctgcag g 141 <210> 3 <211> 241 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 3 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 c 241 <210> 4 <211> 361 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 4 caccgcggtg gcggccgtcc gccctcggca ccatcctcac gacacccaaa tatggcgacg 60 ggtgaggaat ggtggggagt tatttttaga gcggtgagga aggtgggcag gcagcaggtg 120 ttggcgctct aaaaataact cccgggagtt atttttagag cggaggaatg gtggacaccc 180 aaatatggcg acggttcctc acccgtcgcc atatttgggt gtccgccctc ggccggggcc 240 gcattcctgg gggccgggcg gtgctcccgc ccgcctcgat aaaaggctcc ggggccggcg 300 gcggcccacg agctacccgg aggagcggga ggcgccaagc tctagaacta gtggatcccc 360 c 361 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 5 ccaaaaaaga agagaaaggt a 21 <210> 6 <211> 1095 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <220> <221> misc_feature <222> (1095) N is a, c, g, or t <400> 6 agtgaagtgg aattctccca cgagtattgg atgagacacg cattgacgct cgcaaaaaga 60 gcgtgggacg agagggaagt acccgtcgga gcagtcctcg tgcataacaa tcgggtgata 120 ggcgagggct ggaatcgacc tatcggccga catgacccga ccgcccatgc agaaattatg 180 gctctgcgac agggagggtt ggtgatgcag aactatcggc ttatcgatgc cacactctac 240 gttacgcttg aaccgtgcgt tatgtgtgcg ggggcgatga tacatagtag aatagggagg 300 gtcgtgttcg gggcgcgaga tgcgaaaacc ggggccgcag gctcattgat ggacgtcctg 360 caccaccccg gcatgaacca tcgggtcgag ataaccgaag gcatattggc agacgaatgt 420 gctgcgctcc tttccgattt ctttaggatg cgacgccagg agatcaaggc gcaaaaaaaa 480 gcccagtcta gtaccgactc cgggggcagc agtggggggt ctagtggcag tgagacgccc 540 ggtacgagcg agagcgccac gcctgaatca tcaggtggaa gcagtggtgg ctcttctgaa 600 gtcgaatttt cccacgagta ctggatgaga cacgcactta cgcttgccaa gagggcaaga 660 gatgaacgcg aggtcccggt cggagcagtg cttgtcctta ataatagagt gataggcgaa 720 ggctggaatc gagctatcgg cctccacgat cctaccgcgc atgctgagat catggcgctg 780 cgacaagggg ggctggtaat gcaaaactat agactcatcg atgcgacgct gtatgtgacc 840 tttgagccct gtgttatgtg tgctggggct atgatacata gcagaattgg cagggtagtc 900 ttcggcgtcc gcaatgccaa aaccggggca gctggatcct tgatggatgt tttgcattac 960 cctggaatga atcatagggt tgagattaca gaaggtatct tggcggatga atgcgccgca 1020 cttctctgtt atttttttcg gatgccgagg caagtcttca atgcccagaa aaaagcgcag 1080 tctagtacag acsdn 1095 <210> 7 <211> 96 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 7 agtggaggct caagtggggg cagctcagga agcgaaactc ctggtacctc agagtccgct 60 actcccgaat cctctggggg tagctcaggg ggcagt 96 <210> 8 <211> 2148 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <220> <221> misc_feature <222> (2148) N is a, c, g, or t <400> 8 atggacaaga agtacagcat cggcctggcc atcggtacca acagcgtggg ctgggccgtg 60 atcaccgacg agtacaaggt gcccagcaag aagttcaagg tgctgggcaa caccgaccgc 120 cacagcatca agaagaacct gatcggcgcc ctgctgttcg acagcggcga gaccgccgag 180 gccacccgcc tgaagcgcac cgcccgccgc cgctacaccc gccgcaagaa ccgcatctgc 240 tacctgcagg agatcttcag caacgagatg gccaaggtgg acgacagctt cttccaccgc 300 ctggaggaga gcttcctggt ggaggaggac aagaagcacg agcgccaccc catcttcggc 360 aacatcgtgg acgaggtggc ctaccacgag aagtacccca ccatctacca cctgcgcaag 420 aagctggtgg acagcaccga caaggccgac ctgcgcctga tctacctggc cctggcccac 480 atgatcaagt tccgcggcca cttcctgatc gagggcgacc tgaaccccga caacagcgac 540 gtggacaagc tgttcatcca gctggtgcag acctacaacc agctgttcga ggagaacccc 600 atcaacgcca gcggcgtgga cgccaaggcc atcctgagcg cccgcctgag caagagccgc 660 cgcctggaga acctgatcgc ccagctgccc ggcgagaaga agaacggcct gttcggcaac 720 ctgatcgccc tgagcctggg cctgaccccc aacttcaaga gcaacttcga cctggccgag 780 gacgccaagc tgcagctgag caaggacacc tacgacgacg acctggacaa cctgctggcc 840 cagatcggcg accagtacgc cgacctgttc ctggccgcca agaacctgag cgacgccatc 900 ctgctgagcg acatcctgcg cgtgaacacc gagatcacca aggcccccct gagcgccagc 960 atgatcaagc gctacgacga gcaccaccag gacctgaccc tgctgaaggc cctggtgcgc 1020 cagcagctgc ccgagaagta caaggagatc ttcttcgacc agagcaagaa cggctacgcc 1080 ggctacatcg acggcggcgc cagccaggag gagttctaca agttcatcaa gcccatcctg 1140 gagaagatgg acggcaccga ggagctgctg gtgaagctga accgcgagga cctgctgcgc 1200 aagcagcgca ccttcgacaa cggcagcatc ccccaccaga tccacctggg cgagctgcac 1260 gccatcctgc gccgccagga ggacttctac cccttcctga aggacaaccg cgagaagatc 1320 gagaagatcc tgaccttccg catcccctac tacgtgggcc ccctggcccg cggcaacagc 1380 cgcttcgcct ggatgacccg caagagcgag gagaccatca ccccctggaa cttcgaggag 1440 gtggtggaca agggcgccag cgcccagagc ttcatcgagc gcatgaccaa cttcgacaag 1500 aacctgccca acgagaaggt gctgcccaag cacagcctgc tgtacgagta cttcaccgtg 1560 tacaacgagc tgaccaaggt gaagtacgtg accgagggca tgcgcaagcc cgccttcctg 1620 agcggcgagc agaagaaggc catcgtggac ctgctgttca agaccaaccg caaggtgacc 1680 gtgaagcagc tgaaggagga ctacttcaag aagatcgagt gcttcgacag cgtggagatc 1740 agcggcgtgg aggaccgctt caacgccagc ctgggcacct accacgacct gctgaagatc 1800 atcaaggaca aggacttcct ggacaacgag gagaacgagg acatcctgga ggacatcgtg 1860 ctgaccctga ccctgttcga ggaccgcgag atgatcgagg agcgcctgaa gacctacgcc 1920 cacctgttcg acgacaaggt gatgaagcag ctgaagcgcc gccgctacac cggctggggc 1980 cgcctgagcc gcaagcttat caacggcatc cgcgacaagc agagcggcaa gaccatcctg 2040 gacttcctga agagcgacgg cttcgccaac cgcaacttca tgcagctgat ccacgacgac 2100 agcctgacct tcaaggagga catccagaag gcccaggtga gcggcsdn 2148 <210> 9 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 9 gtaagtatca aggttacaag acaggtttaa ggagaccaat agaaactggg 50 <210> 10 <211> 83 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 10 cttgtcgaga cagagaagac tcttgcgttt ctgataggca cctattggtc ttactgacat 60 ccactttgcc tttctctcca cag 83 <210> 11 <211> 1962 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <220> <221> misc_feature <222> (1962) N is a, c, g, or t <400> 11 cagggcgaca gcctgcacga gcacatcgcc aacctggccg gcagccccgc catcaagaag 60 ggcatcctgc agaccgtgaa ggtggtggac gagctggtga aggtgatggg ccgccacaag 120 cccgagaaca tcgtgatcga gatggcccgc gagaaccaga ccacccagaa gggccagaag 180 aacagccgcg agcgcatgaa gcgcatcgag gagggcatca aggagctggg cagccagatc 240 ctgaaggagc accccgtgga gaacacccag ctgcagaacg agaagctgta cctgtactac 300 ctgcagaacg gccgcgacat gtacgtggac caggagctgg acatcaaccg cctgagcgac 360 tacgacgtgg accacatcgt gccccagagc ttcctgaagg acgacagcat cgacaacaag 420 gtgctgaccc gcagcgacaa gaaccgcggc aagagcgaca acgtgcccag cgaggaggtg 480 gtgaagaaga tgaagaacta ctggcgccag ctgctgaacg ccaagctgat cacccagcgc 540 aagttcgaca acctgaccaa ggccgagcgc ggcggcctga gcgagctgga caaggccggc 600 ttcatcaagc gccagctggt ggagacccgc cagatcacca agcacgtggc ccagatcctg 660 gacagccgca tgaacaccaa gtacgacgag aacgacaagc tgatccgcga ggtgaaggtg 720 atcaccctga agagcaagct ggtgagcgac ttccgcaagg acttccagtt ctacaaggtg 780 cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt ggtgggcacc 840 gccctgatca agaagtaccc caagctggag agcgagttcg tgtacggcga ctacaaggtg 900 tacgacgtgc gcaagatgat cgccaagagc gagcaggaga tcggcaaggc caccgccaag 960 tacttcttct acagcaacat catgaacttc ttcaagaccg agatcaccct ggccaacggc 1020 gagatccgca agcgccccct gatcgagacc aacggcgaga ccggcgagat cgtgtgggac 1080 aagggccgcg acttcgccac cgtgcgcaag gtgctgagca tgccccaggt gaacatcgtg 1140 aagaagaccg aggtgcagac cggcggcttc agcaaggaga gcatcctgcc caagcgcaac 1200 agcgacaagc tgatcgcccg caagaaggac tgggacccca agaagtacgg cggcttcgac 1260 agccccaccg tggcctacag cgtgctggtg gtggccaagg tggagaaggg caagagcaag 1320 aagctgaaga gcgtgaagga gctgctgggc atcaccatca tggagcgcag cagcttcgag 1380 aagaacccca tcgacttcct ggaggccaag ggctacaagg aggtgaagaa ggacctgatc 1440 atcaagctgc ccaagtacag cctgttcgag ctggagaacg gccgcaagcg catgctggcc 1500 agcgccggcg agctgcagaa gggcaacgag ctggccctgc ccagcaagta cgtgaacttc 1560 ctgtacctgg ccagccacta cgagaagctg aagggcagcc ccgaggacaa cgagcagaag 1620 cagctgttcg tggagcagca caagcactac ctggacgaga tcatcgagca gatcagcgag 1680 ttcagcaagc gcgtgatcct ggccgacgcc aacctggaca aggtgctgag cgcctacaac 1740 aagcaccgcg acaagcccat ccgcgagcag gccgagaaca tcatccacct gttcaccctg 1800 accaacctgg gcgcccccgc cgccttcaag tacttcgaca ccaccatcga ccgcaagcgc 1860 tacaccagca ccaaggaggt gctggacgcc accctgatcc accagagcat caccggtctg 1920 tacgagaccc gcatcgacct gagccagctg ggcggcgacs dn 1962 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 12 ccaaaaaaga agagaaaggt a 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 13 ccaaagaaaa agagaaaagt a 21

Claims (18)

(i) a gene encoding a first domain comprising the N-terminus of a Cas9 protein, a gene encoding a dominase linked to a gene encoding the first domain; And
(ii) comprises a gene encoding a second domain comprising the C-terminus of the Cas9 protein,
The first and second domains are fusion-expressed to form a Cas9 protein.
The gene construct according to claim 1, wherein the dianamin is APOBEC1 (apolipoprotein B editing complex 1), activation-induced deaminase (AID) or tRNA-specific adenosine deaminase (tadA).
The gene construct according to claim 1, wherein the dianamin is adenosine deaminase.
The gene construct according to claim 3, wherein the adenosine deminase is tadA (tRNA-specific adenosine deaminase).
The gene construct according to claim 1, wherein the dianamin is TadA 7.10.
The gene construct according to claim 1, wherein the gene encoding the dianaminase comprises the sequence of SEQ ID NO.6.
The gene construct according to claim 1, wherein the Cas9 protein is wild type Cas9, inactivated Cas9 (dCas9), or Cas9 nickase.
The method of claim 1, wherein the Cas9 protein is (1) D10, H840, or D10 and H840 of the Cas9 protein derived from Streptococcus pyogenes ; (2) one or more selected from the group consisting of D1135, R1335, and T1337; Or (3) all of the amino acid residues of (1) and (2) are substituted with wild type and other amino acids.
The gene construct according to claim 1, wherein the gene encoding the first domain comprises the sequence of SEQ ID NO: 8.
The gene construct according to claim 1, wherein the gene encoding the second domain comprises the sequence of SEQ ID NO.
The gene construct of claim 1, further comprising a guide RNA.
The gene construct of claim 11, wherein the guide RNA is a double RNA, or a single guide RNA (sgRNA), including CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA).
(i) a gene encoding a first domain comprising the N-terminus of the Cas9 protein, a first vector operably linked to a gene encoding a diazase; And
(ii) a second vector operably linked to a gene encoding a second domain comprising the C-terminus of the Cas9 protein,
The first and second domains are fusion-expressed to form a Cas9 protein, characterized in that the vector.
The method of claim 13, further comprising an inverted terminal repeat (IRT), a promoter, a nucleus localization protein sequence (NLS), and a splicing donor (SD) in the first vector; And / or
The vector further comprises ITR, Splicing Acceptor (SA), NLS, hemagglutinin (HA) tag, and polyA.
The method of claim 14, wherein the vector is selected from the group consisting of a retrovirus vector, an adenovirus vector, an adeno-associated virus vector, and a herpes simplex virus vector. Vector, characterized in that.
A base editing composition comprising a vector according to any one of claims 13 to 15.
16. A base calibration method comprising the step of introducing a vector according to claim 13.
Non-human animal in which the vector according to any one of claims 13 to 15 is introduced to express the corrected base.

Images