KR20190121346A - Peptide compound and method for producing same, composition for screening and selection method of peptide compound - Google Patents

Abstract

An object of the present invention is to provide a novel cyclic peptide compound excellent in cell membrane permeability, a method for producing the same, a composition for screening, and a method for selecting a cyclic peptide compound that binds to a target substance. According to this invention, the peptide compound or its salt represented by following formula (1) is provided. In the formula, each symbol has the meaning described in this specification.

Description

Peptide compound and method for producing same, composition for screening and selection method of peptide compound

The present invention relates to a peptide compound, a method for producing the same, and a composition for screening. The present invention also relates to a method of selecting a peptide compound that binds to a target substance.

Peptides containing a cyclic structure or an unnatural amino acid are attracting attention as new drug seeds because of their excellent membrane permeability, target binding ability, and in vivo stability. For example, Patent Document 1 and Non-Patent Document 1 describe a method for producing a cyclic peptide compound including a thioether cyclization method or a triazole cyclization method, and a drug search method using the cyclic peptide compound.

The drug search method is based on determining a peptide structure by forming a complex in which a translated peptide and a gene derived from the peptide are linked, and deciphering a gene of a peptide complex bound to a target substance. As a method of forming the complex, Patent Literature 2 includes a step of crosslinking an RNA (ribo nucleic acid) molecule to a peptide acceptor; Translating the RNA to produce a peptide product; And generating a DNA (deoxyribonucleic acid) peptide peptide by reverse transcription of RNA. In addition, Patent Document 3, providing an RNA molecule; And chemically linking the peptide acceptor to form a covalent bond to the 3 'end of the RNA molecule.

On the other hand, some methods are known as methods for synthesizing cyclic compounds. For example, Patent Document 4 describes a method of forming a thiazolin ring, which involves reduction of disulfide and hydrolysis of an amide bond.

Patent Document 1: Japanese Unexamined Patent Publication No. 2012-058092 Patent Document 2: International Publication No. 2000/032823 Patent Document 3: Japanese Unexamined Patent Publication No. 2010-284172 Patent Document 4: US Patent Publication No. 2015/0056137

Non-Patent Document 1: Development of Translation Synthesis of Special Cyclic Peptides and Drug Discovery, Biochemistry Vol. 82, No. 6, pp 505-514, 2010

An object of the present invention is to provide a novel peptide compound excellent in cell membrane permeability, a method for producing the same, and a composition for screening. Another object of the present invention is to provide a method for selecting a peptide compound that binds to a target substance.

MEANS TO SOLVE THE PROBLEM As a result of earnestly examining the said subject, the present inventors discovered that the compound represented by General formula (1) described in this specification, or its salt has the outstanding cell membrane permeability. Furthermore, the present inventors found that the compound represented by General formula (1) or its salt is a compound useful as a cyclic peptide library. Moreover, the present inventors discovered that in a cell-free translation system, the cyclic peptide can be manufactured by making the amino acid which has a cyano group, and the amino acid (amino acid which has reactive groups, such as cysteine) represented by General formula (2) react. . Furthermore, the present inventors found that a method for producing a cyclic peptide by reaction with an amino acid having a cyano group and an amino acid represented by General Formula (2) is useful in constructing a cyclic peptide library. The present invention has been completed based on these findings.

That is, according to this invention, the following invention is provided.

<1> Peptide compound or its salt represented by following formula (1).

[Formula 1]

In the formula,

X represents S, NH, or O,

A represents a divalent group represented by * -CR ⁰ = C (B)-which becomes one with a carbon atom to which a C1 or 2 straight-chain alkylene group which may have a single bond, a substituent, or B couple | bonds, and R ⁰ represents a hydrogen atom or a substituent, * represents a position to bond with X,

B represents a C1-C2 linear alkylene group which may have a single bond or a substituent, provided that A and B are not a single bond at the same time,

Z represents a hydroxyl group or an amino group,

p piece R may be same or different, and may represent the hetero arylene group which may have a substituent, or the C6-C10 arylene group which may have a substituent,

G represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms that may have a substituent when the carbon to which G is bonded is one with A and does not represent a divalent group represented by * -CR ⁰ = C (B)-. Indicate,

t ¹ W ¹ may be the same or different and is a single bond, -CH ₂ (C ₆ H ₅ NH)-, -CH ₂ (C ₆ H ₅ O)-, an amino acid residue which may have a substituent, or a substituent. The heteroarylene group which may have, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown,

t ² W ² may be the same or different and is a single bond, -CO-, -COO-, -NHCO-, -NHCONH-, -CONHCO-,-(CH ₂ CH ₂ O)-,-(CH ₂ CH ₂ CH ₂ O)-, the amino acid residue which may have a substituent, the heteroarylene group which may have a substituent, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkyl which may have a substituent Represents a Lengi,

J represents a hydrogen atom or a C1-C6 alkyl group which may have a substituent,

each of n Xaa independently represents any amino acid residue or any amino acid flexible residue,

m Xbbs each independently represent any amino acid residue or any amino acid flexible residue,

p represents the integer of 0-4,

t ¹ is an integer of 0-6,

t ² represents an integer of 0 to 6,

m represents an integer of 0 to 20,

n represents the integer of 1-20.

The peptide compound as described in <1> or its salt whose peptide compound represented by said <2> above formula (1) is a peptide compound represented by following formula (1A).

[Formula 2]

In the formula,

A <^1> represents the bivalent group represented by * -CH = C (N)-and becomes one with the C1-C2 linear alkylene group which may have a substituent, or the carbon atom which N couple | bonds, and * is S Indicates the position to join with,

p ¹ R ¹ may be the same or different and represents a heteroarylene group which may have a substituent, or an arylene group having 6 to 10 carbon atoms, which may have a substituent;

t ¹¹ W ¹¹ may be the same or different and are a single bond, -CH ₂ (C ₆ H ₅ NH)-, -CH ₂ (C ₆ H ₅ O)-, an amino acid residue which may have a substituent, or a substituent The heteroarylene group which may have, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown,

t ²¹ W ²¹ may be the same or different and are a single bond, -CO-, -COO-, -NHCO-, -NHCONH-, -CONHCO-,-(CH ₂ CH ₂ O)-,-(CH ₂ CH ₂ CH ₂ O)-, the amino acid residue which may have a substituent, the heteroarylene group which may have a substituent, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkyl which may have a substituent Represents a Len group,

G ¹ is a C 1-6 carbon that may have a hydrogen atom or a substituent when the carbon to which G ¹ is bonded is ^one with A ¹ and does not represent a divalent group represented by * —CH═C (N)-. Represents an alkyl group,

J ¹ represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms which may have a substituent,

p ¹ represents the integer of 0-4,

t ¹¹ represents an integer of 0 to 6,

²¹ t is an integer of 0-6,

Z, Xaa, Xbb, m, and n represent the same meaning as the definition in <1>.

The peptide compound or its salt as described in <1> whose peptide compound represented by <3> above-mentioned formula (1) is a peptide compound represented by following formula (1B).

[Formula 3]

In the formula,

A <^2> represents the bivalent group represented by * -CH = C (N)-which becomes one with the C1-C2 linear alkylene group which may have a substituent, or the carbon atom which N couple | bonds, and * is S Indicates the position to join with,

G ² is a C 1-6 carbon having a hydrogen atom or a substituent when the carbon to which G ² is bonded is one with A ² and does not represent a divalent group represented by * -CH = C (N)-. Represents an alkyl group,

p <^2> R <^2> may be same or different and represents the heteroarylene group which may have a substituent, or the C6-C10 arylene group which may have a substituent,

J ² represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms which may have a substituent,

p ² represents an integer of 0 to 4,

q ² represents the integer of 0-6,

However, p ² and q ² do not become 0 at the same time.

Z, Xaa, Xbb, m, and n represent the same meaning as the definition in <1>.

<4> wherein R, R ¹ or R ² is, benz which may have a benzoxazolyl group, a substituent group which may optionally have a benzo thiazolyl group, a substituent which may have a substituent group imidazolyl, which may have a substituent May have a benzothiophenylene group, a benzofuranylene group which may have a substituent, an isobenzofuranylene group which may have a substituent, an indolylene group which may have a substituent, a quinolineylene group which may have a substituent, and a substituent Isoquinolinylene group, the quinazolylene group which may have a substituent, the cinnoylene group which may have a substituent, the indazole ylene group which may have a substituent, the benzothiadiazole ylene group which may have a substituent, and may have a substituent Pyridinylene group which may have a pyridinylene group and a substituent, and may have a substituent Limidinylene group, the pyrazinylene group which may have a substituent, the thiazole ylene group which may have a substituent, the imidazole ylene group which may have a substituent, the oxazolylene group which may have a substituent, and the oxadiazoleyl which may have a substituent Imide group which may have a ethylene group, the thiadiazole ylene group which may have a substituent, the pyrazole ylene group which may have a substituent, the isoxazole zylene group which may have a substituent, the triazole ylene group which may have a substituent, and a substituent Thiazolylene group, imidazopyridinylene group which may have a substituent, imidazopyridazine ylene group which may have a substituent, imidazopyrimidine ylene group which may have a substituent, and imidazopyrazine ylene group which may have a substituent And pyrazolopyrimidinylene groups which may have a substituent , A pyrrolopyridinylene group which may have a substituent, a thiophenylene group which may have a substituent, a furanylene group which may have a substituent, a pyrrolene group which may have a substituent, a phenylene group which may have a substituent, and a substituent The peptide compound in any one of <1>-<3> or its salt which is at least 1 structure chosen from the naphthylene group which may have.

<5> wherein R or R ¹ or R ² is, indazolyl which may have a quinolinyl group, a substituent which may have a indolyl group, a substituent group which may optionally have a benzo thiophenyl group, a substituent which may have a substituent jolil group , Pyrrolopyridinylene group which may have a substituent, imidazopyrazinylene group which may have a substituent, pyridinylene group which may have a substituent, pyridazineylene group which may have a substituent, pyrazineylene group which may have a substituent Selected from a thiazole ylene group which may have a substituent, an oxazolylene group which may have a substituent, a triazole ylene group which may have a substituent, a thiophenylene group which may have a substituent, and a phenylene group which may have a substituent The peptide compound according to any one of <1> to <4>, which is at least one structure It is a salt.

<6> The peptide compound according to any one of <1> to <5>, or a salt thereof, wherein the total number of amino acid residues and amino acid flexible bodies constituting the annular portion of the peptide compound is 3 to 20.

<7> The peptide compound according to any one of <1> to <6>, or a salt thereof, wherein the total number of amino acid residues and amino acid flexible bodies constituting the peptide compound is 3 to 20.

<8> The composition for screening containing the peptide compound in any one of <1>-<7>, or its salt.

<9> comprising contacting a target material with a peptide library comprising the peptide compound or salt thereof according to any one of <1> to <7>, and selecting the peptide compound or salt thereof that binds to the target material, A method of selecting a peptide compound or salt thereof that binds to a target substance.

<10> A step of producing a peptide chain having an amino acid residue or amino acid flexible residue having a cyano group in the side chain at the C-terminus or at the C-terminus, and having the structure of Formula (2) at the N-terminus; And,

The manufacturing method of the peptide compound or its salt containing the process of reacting said cyano group with the structure of following formula (2), and forming the annular part which has a bond represented by following formula (3).

[Formula 4]

In the formula, X represents S, NH, or O,

A represents a C1-C2 linear alkylene group which may have a single bond or a substituent,

B represents a C1-C2 linear alkylene group which may have a single bond or a substituent,

G represents a hydrogen atom or a C1-C6 alkyl group which may have a substituent,

* Represents a binding site to the peptide chain,

A and B are not single bonds at the same time:

[Formula 5]

In formula, X, A, G, and B are synonymous with the definition in Formula (2).

<11> Process of manufacturing the peptide compound which has an annular part by the method as described in <10>; And

A method of selecting a peptide compound that binds to a target material, the method comprising contacting a peptide library comprising the peptide compound or a salt thereof with a target material and selecting a peptide compound or a salt thereof that binds to the target material.

<12> The selection method as described in <11> containing the following process.

(i) preparing a library containing a peptide compound prepared by preparing a nucleic acid library, translating by a cell-free translation system containing a renal tRNA acylated with a non-natural amino acid, wherein the non-natural amino acid is randomly introduced into a peptide sequence. Process of doing;

(ii) contacting the peptide library with the target material;

(iii) selecting a peptide compound that binds to the target substance,

In the step (i), each peptide compound constituting the library is translated from a nucleic acid sequence encoding each peptide compound constituting the library, and the nucleic acid sequence and the peptide which is a translation product thereof are linked to provide an in vitro display library. Is built,

The process of (iii) includes determining a nucleic acid sequence encoding a peptide compound that binds a target substance, determining a peptide sequence from the nucleic acid sequence, and selecting a peptide compound.

<13> The method according to any one of <10> to <12>, wherein the amino acid residue and / or the amino acid flexible residue having the cyano group in a side chain is a structure represented by the following Formula (4).

[Formula 6]

In the formula,

m <^1> Q <^1> may be same or different and is at least among the heteroarylene group which may have a substituent, the C6-C10 arylene group which may have a substituent, and the C1-C6 alkylene group which may have a substituent. 1 type,

T ¹ represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms which may have a substituent,

n ¹ is an integer of 0 ~ 6, m ¹ represents an integer of 1 to 4;

* Indicates a binding position with amino acid residues and / or amino acid flexible residues constituting the peptide chain.

<14> The method according to any one of <10> to <12>, wherein the amino acid residue and / or the amino acid flexible residue having the cyano group in a side chain is a structure represented by the following Formula (5).

[Formula 7]

In the formula,

l and ² Q ² are, the same or different, each represent a single _{bond, -CH 2 (C 6 H 5} NH) -, -CH 2 (C 6 H 5 O) -, the amino acid residues, the substituent which may have a substituent The heteroarylene group which may have, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown,

n ² Q ³ may be the same or different and are a single bond, -CO-, -COO-, -NHCO-, -NHCONH-, -CONHCO-,-(CH ₂ CH ₂ O)-,-(CH ₂ CH ₂ CH ₂ O)-, the amino acid residue which may have a substituent, the heteroarylene group which may have a substituent, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkyl which may have a substituent Represents a Len group,

m <^2> Q <^4> may be same or different and is at least among the heteroarylene group which may have a substituent, the C6-C10 arylene group which may have a substituent, and the C1-C6 alkylene group which may have a substituent. 1 type,

T ² represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms which may have a substituent,

l ² represents the integer of 0-6,

n ² represents an integer of 0 to 6,

m ² represents the integer of 1-4,

* Indicates a binding position with amino acid residues and / or amino acid flexible residues constituting the peptide chain.

<15> wherein Q ¹ or Q ⁴ is, benz that jolil benzoxazolyl which may optionally have a benzo thiazolyl group, a substituent which may have a substituent group, which may have a substituent group already jolil, which may have a substituent benzothiazol Ophenylene group, the benzofuranylene group which may have a substituent, the isobenzofuranylene group which may have a substituent, the indolylene group which may have a substituent, the quinolineylene group which may have a substituent, and the isoquinoline which may have a substituent The ylene group, the quinazolylene group which may have a substituent, the cinnanoylene group which may have a substituent, the indazole ylene group which may have a substituent, the benzothiadiazolylene group which may have a substituent, and the pyridinyl which may have a substituent The pyridazine-ylene group which may have a rene group and a substituent, and the blood which may have a substituent Midinylene group, the pyrazinylene group which may have a substituent, the thiazole ylene group which may have a substituent, the imidazole ylene group which may have a substituent, the oxazolylene group which may have a substituent, and the oxadiazolyl which may have a substituent Imide group which may have a ethylene group, the thiadiazole ylene group which may have a substituent, the pyrazole ylene group which may have a substituent, the isoxazole zylene group which may have a substituent, the triazole ylene group which may have a substituent, and a substituent Thiazolylene group, imidazopyridinylene group which may have a substituent, imidazopyridazine ylene group which may have a substituent, imidazopyrimidine ylene group which may have a substituent, and imidazopyrazine ylene group which may have a substituent A pyrazolopyrimidinylene group which may have a substituent, A pyrrolopyridinylene group which may have a substituent, a thiophenylene group which may have a substituent, a furanylene group which may have a substituent, a pyrrolene group which may have a substituent, a phenylene group which may have a substituent, and a substituent The method as described in <13> or <14> which is at least 1 structure chosen from the naphthylene group which may have.

<16> The Q ¹ or Q ⁴ may have a substituent, a benzothiophenylene group which may have a substituent, an indolylene group which may have a substituent, a quinolineylene group which may have a substituent, an indazole ylene group which may have a substituent, or a substituent. Pyrrolopyridinylene group which may have, the imidazopyrazine ylene group which may have a substituent, the pyridinylene group which may have a substituent, the pyridazine ylene group which may have a substituent, the pyrazine ylene group which may have a substituent, and a substituent At least one selected from a thiazole ylene group which may have a substituent, an oxazolylene group which may have a substituent, a triazole ylene group which may have a substituent, a thiophenylene group which may have a substituent, and a phenylene group which may have a substituent The method in any one of <13>-<15> which is one structure.

<17> The method according to any one of <10> to <16>, wherein the formula (2) is a structure represented by the following formula (2A).

[Formula 8]

In formula, A <^1> represents the C1-C2 linear alkylene group which may have a substituent. G represents a hydrogen atom or a C1-C6 alkyl group which may have a substituent.

<18> The method according to any one of <10> to <17>, wherein the formula (2) is at least one structure selected from the following formula.

[Formula 9]

<19> The method according to any one of <10> to <18>, wherein the reaction solvent in the step of reacting the cyano group with the structure of the formula (2) to form a bond represented by the formula (3) is water. .

<20> In <10> to <19>, wherein the pH of the reaction solution of the step of reacting the cyano group with the structure of the formula (2) to form a bond represented by the formula (3) is 6.0 to 8.5. The method as described in any one.

<21> The method according to any one of <10> to <20>, wherein the total number of amino acid residues and amino acid flexible bodies constituting the annular portion of the peptide compound having the annular portion is 3 to 20.

<22> The method according to any one of <10> to <21>, wherein the total number of amino acid residues and amino acid flexible bodies constituting the peptide compound having the annular portion is 3 to 20.

The amino acid residue or amino acid flexible residue which has a heteroarylene group which has the said cyano group, the arylene group which has a cyano group, or the alkylene group which has a cyano group in a side chain is assigned with respect to the codon assigned in translation of a natural amino acid. The method according to any one of <10> to <22>, which is introduced into the peptide chain by using a codon, an end codon, or a tetrabasic codon, which is empty by excluding a natural amino acid.

<24> A peptide compound having a toroid or a salt thereof

The said annular part is a screening composition containing the peptide compound which has a structure represented by following formula (6), or its salt.

[Formula 10]

In the formula,

X represents S, NH, or O,

A represents a divalent group represented by * -CR ⁰ = C (B)-which becomes one with a carbon atom to which a C1 or 2 straight-chain alkylene group which may have a single bond, a substituent, or B couple | bonds, and R ⁰ represents a hydrogen atom or a substituent, * represents a position to bond with X,

B represents a C1-C2 linear alkylene group which may have a single bond or a substituent, provided that A and B are not a single bond at the same time,

p piece R may be same or different, and may represent the hetero arylene group which may have a substituent, or the C6-C10 arylene group which may have a substituent,

G represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms that may have a substituent when the carbon to which G is bonded is one with A and does not represent a divalent group represented by * -CR ⁰ = C (B)-. Indicates,

p represents the integer of 0-4.

The peptide compound of the present invention is excellent in cell membrane permeability. According to the method for producing a peptide compound of the present invention, a cyclic peptide compound excellent in cell membrane permeability can be produced. The peptide compound and the screening composition of the present invention are useful in a method for selecting a cyclic peptide compound that binds to a target substance.

EMBODIMENT OF THE INVENTION Hereinafter, this invention is demonstrated in detail.

In this invention,% is mass% unless there is particular notice.

In the present invention, unless otherwise described, each term has the following meaning.

In this invention, "-" is used by the meaning which includes the numerical value described before and after that as a lower limit and an upper limit.

A halogen atom means a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

C _1-6 alkyl group is methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, pentyl, isopentyl, 2-methylbutyl, 2-pentyl, 3-pentyl and hex It means a linear or branched C _1-6 alkyl group such as a practical group.

C _3-8 cycloalkyl group means a C _3-8 cycloalkyl group such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptane group.

The C _1-6 alkoxy C _1-6 alkyl group means a C _1-6 alkyloxy C _1-6 alkyl group such as methoxymethyl and 1-ethoxyethyl group.

C _6-20 aryl C _1-6 alkyl group is benzyl, diphenyl methyl, trityl, phenethyl, 2-phenylpropyl, C _6-20 aryl C _1-6 alkyl groups such as 3-phenylpropyl and naphthylmethyl group ( Aralkyl group wherein the alkyl moiety is C _1-6 alkyl).

C _1-6 alkoxy groups are methoxy, ethoxy, propoxy, isopropoxy, cyclopropoxy, butoxy, isobutoxy, sec-butoxy, tert-butoxy, cyclobutoxy, pentyloxy and hexyl jade It means a linear, cyclic or branched C _1-6 alkyloxy group such as period.

The C _6-20 aryloxy group means a C _6-20 aryloxy group such as a phenoxy and naphthyloxy group.

C _1-6 alkylthio is methylthio, ethylthio, propylthio, isopropylthio, butylthio, sec-butylthio, isobutylthio, tert-butylthio, pentylthio Or a linear or branched C _1-6 alkylthio group such as isopentylthio, 2-methylbutylthio, 2-pentylthio, 3-pentylthio and hexylthio groups.

C _6-20 arylthio groups mean C _6-20 arylthio groups such as phenylthio and 2-naphthylthio groups.

C _1-6 alkylamino group is a linear or branched C _1- such as methylamino, ethylamino, propylamino, isopropylamino, butylamino, sec-butylamino, tert-butylamino, pentylamino and hexylamino groups. _It means a ₆ alkylamino group.

C _6-20 arylamino group is, phenylamino, means an amino-p- tolyl and 2-naphthyl group and the like of a C _6-20 arylamino group.

C _2-6 alkenyl group is linear or branched C ₂ such as vinyl, allyl, propenyl, isopropenyl, butenyl, isobutenyl, 1,3-butadienyl, pentenyl and hexenyl groups _-6 means alkenyl group.

The C _3-8 cycloalkenyl group means a C _3-8 cycloalkenyl group such as cyclopropenyl, cyclobutenyl, cyclopentenyl, and cyclohexenyl groups.

The C _2-6 alkynyl group means a straight or branched C _2-6 alkynyl group such as ethynyl, propynyl, butynyl, pentanyl and hexenyl groups.

The C _1-6 alkylcarbonyl group means a C _1-6 alkylcarbonyl group such as acetyl, propionyl, butyryl, isobutyryl and pivaloyl groups.

The C _1-30 alkylcarbonyl group means a C _1-30 alkylcarbonyl group such as acetyl, propionyl, butyryl, isobutyryl, pivaloyl and palmitoyl group.

A C _6-20 arylcarbonyl group means an arylcarbonyl group having 6 to 20 carbon atoms such as benzoyl.

A heterocyclic carbonyl group means a heterocyclic carbonyl group, such as nicotinoyl, tenoyl, pyrrolidinocarbonyl, or furoyl group.

The C _1-6 alkylsulfonyl group means a C _1-6 alkylsulfonyl group such as methylsulfonyl, ethylsulfonyl and propylsulfonyl group.

The C _6-20 arylsulfonyl group means a C _6-20 arylsulfonyl group such as benzenesulfonyl, p-toluenesulfonyl or naphthalenesulfonyl group.

C _1-6 alkyl group seolpin means a methyl sulfinyl, ethyl sulfinyl group, and propyl seolpin such as C _1-6 alkyl group seolpin.

C _6-20 arylsulfinyl group means a C _6-20 arylsulfinyl group such as benzenesulfinyl, p-toluenesulfinyl or naphthalenesulfinyl group.

The C _6-20 aryl group means an aryl group having 6 to 20 carbon atoms such as a phenyl or naphthyl group.

Monocyclic nitrogen-containing heterocyclic group is aziridinyl, azetidinyl, pyrrolidinyl, pyrrolinyl, pyrrolyl, piperidyl, tetrahydropyridyl, dihydropyridyl, pyridyl, homopiperidinyl, octahydro Azosinyl, imidazolidinyl, imidazolinyl, imidazolyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, piperazinyl, diazepanyl, pyrazinyl, pyridazinyl, pyrimidinyl, homopipe It means the monocyclic nitrogen-containing heterocyclic group which contains the binomial atom which forms the said ring, such as a razinyl, triazolyl, and tetrazolyl group, and also contains monocyclic nitrogen-containing heteroaryl.

Monocyclic oxygen-containing heterocyclic group is a binomial which forms the above-mentioned ring such as oxetanyl, tetrahydrofuranyl, furanyl, tetrahydropyranyl, pyranyl, 1,3-dioxanyl and 1,4-dioxanyl group It means the monocyclic oxygen-containing heterocyclic group containing only an oxygen atom as an atom.

The monocyclic sulfur-containing heterocyclic group means thienyl, tetrahydrothiopyranyl, 1,1-dioxide tetrahydrothiopyranyl and the like.

The monocyclic nitrogen-oxygen heterocyclic group is a monocyclic ring containing a nitrogen atom and an oxygen atom as a binary atom for forming the ring, such as oxazolyl, isooxazolyl, oxadiazolyl, morpholinyl and oxazpanyl group. Nitrogen-containing oxygen heterocyclic group means.

Monocyclic nitrogen-sulfur heterocyclic group includes the above-mentioned groups such as thiazolyl, isothiazolyl, thiadiazoleyl, thiomorpholinyl, 1-oxide thiomorpholinyl, and 1,1-dioxide thiomorpholinyl group. The monocyclic nitrogen-sulfur heterocyclic group containing only a nitrogen atom and a sulfur atom as a binary atom which forms a ring is meant.

Monocyclic heterocyclic group means a monocyclic nitrogen-containing heterocyclic group, a monocyclic oxygen-containing heterocyclic group, a monocyclic sulfur-containing heterocyclic group, a monocyclic nitrogen-oxygen heterocyclic group or a monocyclic nitrogen-sulfur heterocyclic group it means.

Bicyclic nitrogen-containing heterocyclic group is indolinyl, indolyl, isoindolinyl, isoindoleyl, benzimidazolyl, indazolyl, benzotriazolyl, pyrazolopyridinyl, quinolyl, tetrahydroquinolinyl, Tetrahydroisoquinolinyl, isoquinolinyl, quinolidinyl, cinnolinyl, phthalazinyl, quinazolinyl, dihydroquinoxalinyl, quinoxalinyl, naphthyridinyl, purinyl, pteridylyl and quinuclidin It means the bicyclic nitrogen-containing heterocyclic group containing only a nitrogen atom as a binary atom which forms the said ring, such as a diary.

With bicyclic oxygen-containing heterocyclic group, 2,3-dihydrobenzofuranyl, benzofuranyl, isobenzofuranyl, chromanyl, chromanyl, isochromenyl, 1,3-benzodioxolyl, 1,3- The bicyclic oxygen-containing heterocyclic group containing only an oxygen atom is meant as a binary atom which forms the said ring, such as a benzodioxanyl and a 1, 4- benzodioxanyl group.

The bicyclic sulfur-containing heterocyclic group means a bicyclic sulfur-containing heterocyclic group containing only a sulfur atom as a binary atom forming the above-mentioned ring such as 2,3-dihydrobenzothienyl and benzothienyl group.

With bicyclic nitrogen-containing oxygen heterocyclic group, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzomorpholinyl, dihydropyranopyridyl, dioxolopyridyl, propyridinyl, dihydrodioxo The bicyclic nitrogen-oxygen heterocyclic group which contains only a nitrogen atom and an oxygen atom as a binary atom which forms said ring, such as a cynopyridyl and a dihydropyridooxadinyl group.

A bicyclic nitrogen-containing sulfur heterocyclic group is a bicyclic nitrogen containing a nitrogen atom and a sulfur atom as a binary atom for forming the ring such as benzothiazolyl, benzisothiazolyl and benzothiazolyl group. Sulfur heterocyclic group.

A bicyclic heterocyclic group is a bicyclic nitrogen-containing heterocyclic group, a bicyclic oxygen-containing heterocyclic group, a bicyclic sulfur-containing heterocyclic group, a bicyclic nitrogen-containing oxygen heterocyclic group, or a bicyclic nitrogen-containing sulfur heterocyclic group it means.

A spiro-type heterocyclic group is 2,6-diazaspiro [3.3] heptyl, 2,7-diazaspiro [3.5] nonyl, 2-oxa-6-azaspiro [3.3] heptyl, 1, As a binary atom which forms the said ring, such as 4-dioxa spiro [4.5] decyl, 1-oxa-8-azaspiro [4.5] decyl, and 1-thia-8- azaspiro [4.5] decyl group, etc. By spiro heterocyclic group comprising at least one nitrogen atom, oxygen atom or sulfur atom.

A crosslinked heterocyclic group is used to form the above-mentioned ring such as 3-oxa-8-azabicyclo [3.2.1] octyl, 8-oxa-3-azabicyclo [3.2.1] octyl and quinucridinyl groups. It means the crosslinked heterocyclic group which contains one or more nitrogen atoms as a binary atom, and may also contain one or more oxygen atoms or a sulfur atom.

A heterocyclic group means a monocyclic heterocyclic group, a bicyclic heterocyclic group, a spiro heterocyclic group, and a crosslinked heterocyclic group.

An alkylene group having 1 to 6 carbon atoms is linear or cyclic C _1-6 alkyl such as methylene, ethylene, propylene, isopropylene, n-butylene, n-pentylene, n-hexylene group, and cyclohexylene It means Rengi.

An arylene group having 6 to 10 carbon atoms means an arylene group having 6 to 20 carbon atoms such as a phenylene or naphthylene group.

Here, the carbon number of a C1-C6 alkylene group and a C6-C10 arylene group does not contain the carbon number of a substituent. Heteroarylene group means a bivalent heterocyclic group.

Peptide compounds are generic terms of compounds formed by amide bonds or ester bonds of amino acids or amino acid flexibles. In addition, the peptide compound (also called a cyclic peptide compound) which has a cyclic | annular part is a general term of the compound in which a peptide compound was cyclized through the covalent bond in the same molecule. The compound obtained by chemically modifying the said compound is also contained in the peptide compound of this invention. The peptide compound of the present invention may have a straight chain portion.

The amino acid and amino acid flexible body which comprise a peptide compound may be called an amino acid residue and an amino acid flexible body residue, respectively. Amino acid residues and amino acid flexible residues mean monovalent or divalent groups derived from amino acids and amino acid flexible residues.

The amino acids in the present invention are α, β and γ-amino acids, and natural amino acids (natural amino acids refer to 20 kinds of amino acids included in proteins. Specifically, Gly, Ala, Ser, Thr, Val, Leu, Ile, Phe, Tyr, Trp, His, Glu, Asp, Gln, Asn, Cys, Met, Lys, Arg, Pro)), and may be a non-natural amino acid. Non-natural amino acid refers to amino acids other than the said natural amino acid. Natural amino acids existing in nature other than the 20 kinds of amino acids contained in proteins are called non-natural amino acids. In the case of the α-amino acid, an L-type amino acid may be used, or may be a D-type amino acid, or an α, α-dialkylamino acid may be used. The amino acid side chain may have, for example, a C _1-6 alkyl group which may have a substituent, a C _3-8 cycloalkyl group which may have a substituent, a C _2-6 alkenyl group which may have a substituent, or a substituent in addition to a hydrogen atom. A C _2-6 alkynyl group, a C _6-20 aryl group which may have a substituent, a heterocyclic group which may have a substituent, a C _6-20 aryl C _1-6 alkyl group which may have a substituent, or the like. It may be substituted.

The amino acid softener is preferably α-hydroxycarboxylic acid and α-mercaptocarboxylic acid. The side chain of (alpha)-hydroxy carboxylic acid and (alpha)-mercaptocarboxylic acid may have various substituents other than an amino acid and the same hydrogen atom (it may have a free substituent). The three-dimensional structure of the α-hydroxycarboxylic acid and the α-mercaptocarboxylic acid may correspond to any of L-type or D-type of the amino acid, and the side chain may be, for example, a C _1-6 alkyl group or substituent which may have a substituent. C _3-8 cycloalkyl group which may have a substituent, C _2-6 alkenyl group which may have a substituent, C _2-6 alkynyl group which may have a substituent, C _6-20 aryl group which may have a substituent, a substituent It may be substituted by the group selected from the heterocyclic group which may have, the _C6-20 aryl C _1-6 alkyl group which may have a substituent, etc. The number of substituents is not limited to one, You may have two or more. For example, it may have an S atom and may further have functional groups, such as an amino group and a halogen atom.

<Peptide compound of the present invention or salt thereof>

The peptide compound or its salt of this invention is a peptide compound or its salt represented by following formula (1). The peptide compound of the present invention or a salt thereof is excellent in cell membrane permeability, and preferably also excellent in metabolic stability.

[Formula 11]

X represents S, NH, or O. X preferably represents S.

A represents a divalent group represented by * -CR ⁰ = C (B)-which becomes one with a carbon atom to which a C1 or 2 straight-chain alkylene group which may have a single bond, a substituent, or B couple | bonds, and R ⁰ represents a hydrogen atom or a substituent, and * represents a position bonded to X.

A preferably represents a divalent group represented by * -CR ⁰ = C (B)-which becomes one with a C1-C2 linear alkylene group which may have a substituent, or one with the carbon atom to which B is couple | bonded. , R ⁰ represents a hydrogen atom or a substituent.

A more preferably represents a C1-C2 linear alkylene group which may have a substituent.

A more preferably represents an ethylene group or a methylene group which may have a substituent.

A particularly preferably represents a methylene group.

R ⁰ preferably represents a hydrogen atom.

B represents a C1-C2 linear alkylene group which may have a single bond or a substituent, A and B are not a single bond at the same time.

B, Preferably, represents a single bond.

In the definition of A and B, as a substituent in "the C1-C2 linear alkylene group which may have a substituent", a C _1-6 alkyl group, a C _3-8 cycloalkyl group, a C _2-6 alkenyl group, C _2-6 alkynyl group, C _6-20 aryl group, heterocyclic group, C _6-20 aryl C _1-6 alkyl group.

Substituents in the definition of R ⁰ include C _1-6 alkyl group, C _3-8 cycloalkyl group, C _2-6 alkenyl group, C _2-6 alkynyl group, C _6-20 aryl group, heterocyclic group, C _{And 6-20} aryl C _1-6 alkyl groups.

G is a C 1-6 alkyl group which may have a hydrogen atom or a substituent when the carbon to which G is bonded becomes one with A and does not represent a divalent group represented by * -CR ⁰ = C (B)-. Indicates.

G is preferably a methyl group, an ethyl group, or a hydrogen atom, and more preferably a hydrogen atom.

Z represents a hydroxyl group or an amino group. Z preferably represents an amino group.

R represents the heteroarylene group which may have a substituent, or the C6-C10 arylene group which may have a substituent.

As a C6-C10 arylene group which may have a substituent which is R, the phenylene group which may have a substituent, and the naphthylene group which may have a substituent are preferable, and the phenylene group which may have a substituent is more preferable.

As a preferable example of R, the benzothiazolylene group which may have a substituent, the benzoxazolylene group which may have a substituent, the benzimidazolylene group which may have a substituent, the benzothiophenylene group which may have a substituent, and a substituent Has a benzofuranylene group which may have, an isobenzofuranylene group which may have a substituent, an indolylene group which may have a substituent, a quinolineylene group which may have a substituent, an isoquinolinylene group which may have a substituent, and a substituent It may have a quinazolylene group which may have, a cinnanoylene group which may have a substituent, an indazole ylene group which may have a substituent, the benzothiadiazolylene group which may have a substituent, the pyridinylene group which may have a substituent, and a substituent The pyridazine ylene group which becomes, and the blood which may have a substituent Midinylene group, the pyrazinylene group which may have a substituent, the thiazole ylene group which may have a substituent, the imidazole ylene group which may have a substituent, the oxazolylene group which may have a substituent, and the oxadiazolyl which may have a substituent Imide group which may have a ethylene group, the thiadiazole ylene group which may have a substituent, the pyrazolylene group which may have a substituent, the isooxazolylene group which may have a substituent, the triazole ylene group which may have a substituent, and a substituent Thiazolylene group, imidazopyridinylene group which may have a substituent, imidazopyridazine ylene group which may have a substituent, imidazopyrimidinylene group which may have a substituent, and imidapyrazine ylene group which may have a substituent , Pyrazolopyrimidinylene groups which may have substituents, A pyrrolopyridinylene group which may have ventilation, a thiophenylene group which may have a substituent, a furanylene group which may have a substituent, a pyrrolene group which may have a substituent, a phenylene group which may have a substituent, and a substituent At least one structure chosen from the naphthylene group which may have is mentioned.

As a more preferable example of R, the benzothiophenylene group which may have a substituent, the indolylene group which may have a substituent, the quinolineylene group which may have a substituent, the indazole ylene group which may have a substituent, and the blood which may have a substituent Pyrozinylene group which may have a rolopyridinylene group, the imidazopyrazine ylene group which may have a substituent, the pyridinylene group which may have a substituent, the pyridazineylene group which may have a substituent, and the substituent which may have a substituent At least one structure selected from an azole ylene group, an oxazolylene group which may have a substituent, a triazole ylene group which may have a substituent, a thiophenylene group which may have a substituent, and a phenylene group which may have a substituent Can be.

W ¹ may be the same or different and may have a single bond, -CH ₂ (C ₆ H ₅ NH)-, -CH ₂ (C ₆ H ₅ O)-, an amino acid residue which may have a substituent, or a substituent. The heteroarylene group, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown. Preferably, a single bond, -CH ₂ (C ₆ H ₅ NH)-, or -CH ₂ (C ₆ H ₅ O)-is represented.

W ² may be the same or different and is a single bond, -CO-, -COO-, -NHCO-, -NHCONH-, -CONHCO-,-(CH ₂ CH ₂ O)-,-(CH ₂ CH ₂ CH ₂ O) -, it represents an alkylene group having 1 to 6 carbon atoms which optionally have a substituent of amino acid residues, which may have a hetero-aryl group, a substituent which may have a substituent which may have an aryl group, or a substituent having from 6 to 20 carbon atoms . Preferably, a single _{bond, -NHCO-, - (CH 2 CH} 2 O) -, amino acid residue which may have a substituent, represents a heteroarylene which may have a substituent.

Examples of R, W ^1, and the substituent in the definition of W ^2, substituents of the exemplified structure, as a more preferable example of the preferable examples of R and R, there may be mentioned the substituents described in the Substituent Group A _1.

Substituent group A ₁ :

Halogen atom,

Cyanogi,

Nitrogen,

Form Diary,

Carboxyl,

Sulfur,

Hydroxyl group,

Amino Group,

Mercapto Group,

A C _1-6 alkyl group which may have one or more substituents selected from substituent group A ₂ ,

A C _3-8 cycloalkyl group which may have one or more substituents selected from substituent group A ₂ ,

A C _1-6 alkoxy C _1-6 alkyl group which may have one or more substituents selected from substituent group A ₂ ,

A C _6-20 aryl C _1-6 alkyl group which may have one or more substituents selected from substituent group A ₂ ,

C _1-6 alkoxy group which may have one or more substituents selected from substituent group A ₂ ,

C _6-20 aryloxy group which may have one or more substituents selected from substituent group A ₂ ,

C _1-6 alkylamino group which may have one or more substituents selected from substituent group A ₂ ,

C _6-20 arylamino group which may have one or more substituents selected from substituent group A ₂ ,

C _1-6 alkylthio group which may have one or more substituents selected from substituent group A ₂ ,

C _6-20 arylthio group, which may have one or more substituents selected from substituent group A ₂ ,

C _2-6 alkenyl group which may have one or more substituents selected from substituent group A ₂ ,

C _3-8 cycloalkenyl group which may have one or more substituents selected from substituent group A ₂ ,

A C _2-6 alkynyl group which may have one or more substituents selected from substituent group A ₂ ,

C _6-20 aryl group which may have one or more substituents selected from substituent group A ₂ ,

A heterocyclic group which may have one or more substituents selected from substituent group A ₂ ,

C _1-30 alkylcarbonyl group which may have one or more substituents selected from substituent group A ₂ ,

C _6-20 arylcarbonyl group which may have one or more substituents selected from substituent group A ₂ ,

C _1-6 alkylsulfonyl group which may have one or more substituents selected from substituent group A ₂ ,

C _6-20 arylsulfonyl group which may have one or more substituents selected from substituent group A ₂ ,

A C _1-6 alkylsulfinyl group which may have one or more substituents selected from substituent group A ₂ , and

C _6-20 arylsulfinyl group which may have one or more substituents selected from substituent group A ₂ .

Substituent group A ₂ :

Halogen atom,

Hydroxyl group,

Cyanogi,

A C _1-6 alkyl group which may have one or more substituents selected from substituent group A ₃ ,

A C _3-8 cycloalkyl group which may have one or more substituents selected from substituent group A ₃ ,

C _1-6 alkoxy group which may have one or more substituents selected from substituent group A ₃ ,

A C _1-6 alkoxy C _1-6 alkyl group which may have one or more substituents selected from substituent group A ₃ ,

C _1-6 alkylcarbonyl group which may have one or more substituents selected from substituent group A ₃ ,

C _1-6 alkylsulfonyl group which may have one or more substituents selected from substituent group A ₃ ,

A heterocyclic group which may have one or more substituents selected from substituent group A ₃ ,

NR ¹² R ¹³ (R ¹² and R ¹³ are each independently a hydrogen atom, a C _1-6 alkyl group.)

A heterocyclic carbonyl group which may have one or more substituents selected from substituent group A ₃ .

Substituent group A ₃ :

Halogen atom,

Hydroxyl group,

Cyanogi,

C _1-6 alkyl group,

A C _1-6 alkoxy group,

J represents a hydrogen atom or a C1-C6 alkyl group which may have a substituent, Preferably it is a methyl group or a hydrogen atom, More preferably, it is a hydrogen atom.

Each n Xaa independently represents any amino acid residue or any amino acid flexible residue.

m Xbbs each independently represent any amino acid residue or any amino acid flexible residue.

p represents the integer of 0-4, Preferably it represents 0-2, More preferably, it represents 0-1.

t ¹ is an integer of 0 to 6, preferably an integer of 0-2.

t ² is an integer of 0 to 6, preferably an integer of 0-2.

m represents the integer of 0-20. m becomes like this. Preferably it is 0-10, More preferably, the integer of 0-5 is represented.

n represents the integer of 1-20. n becomes like this. Preferably, it is 1-18, More preferably, the integer of 3-13 is shown.

It is preferable that it is 3-20, and, as for the total number of the amino acid residue and amino acid flexible body residue which comprise the annular part of a peptide compound, it is more preferable that it is 5-15.

It is preferable that it is 3-20, and, as for the total number of the amino acid residue and amino acid flexible body residue which comprise a peptide compound, it is more preferable that it is 5-20.

Preferably, the peptide compound represented by Formula (1) is a peptide compound represented by following formula (1A).

[Formula 12]

A ¹ represents a linear alkylene group having 1 or 2 carbon atoms which may have a substituent, or a divalent group represented by * -CH = C (N)-in combination with a carbon atom to which N is bonded, * Indicates a position to bond with S.

A ¹ preferably represents a linear alkylene group having 1 or 2 carbon atoms which may have a substituent.

A ¹ more preferably represents an ethylene group or a methylene group which may have a substituent.

A ¹ more preferably represents a methylene group.

Substituents in the definition of A ¹ is the same described above with respect to the definition of A in formula (1).

G ¹ is a C 1-6 carbon group which may have a hydrogen atom or a substituent when the carbon to which G ¹ is bonded is ^one with A ¹ and does not represent a divalent group represented by * —CH═C (N) —. An alkyl group is shown. G ¹ preferably represents an ethyl group, a methyl group, or a hydrogen atom, and more preferably represents a hydrogen atom.

R <^1> represents the heteroarylene group which may have a substituent, or the C6-C10 aryl group which may have a substituent.

R ¹ preferably represents a heteroarylene group which may have a substituent or a phenylene group which may have a substituent.

Preferred and more preferred examples of R ¹ in R ¹ are the same as more preferred examples of the preferable examples of R and R.

Substituents in the definition of R ¹ are the same described above with respect to the definition of R in the formula (1).

W ¹¹ is a single bond, -CH ₂ (C ₆ H ₅ NH)-, -CH ₂ (C ₆ H ₅ O)-, an amino acid residue which may have a substituent, a heteroarylene group which may have a substituent, or a substituent The C6-C20 arylene group which may have, or the C1-C6 alkylene group which may have a substituent is shown. Preferably, a single bond, -CH ₂ (C ₆ H ₅ NH)-, -CH ₂ (C ₆ H ₅ O)-is represented.

W ²¹ is a single bond, -CO-, -COO-, -NHCO-, -NHCONH-, -CONHCO-,-(CH ₂ CH ₂ O)-,-(CH ₂ CH ₂ CH ₂ O)-, a substituent The amino acid residue which may have, the heteroarylene group which may have a substituent, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown. Preferably, a single _{bond, -NHCO-, - (CH 2 CH} 2 O) -, amino acid residue which may have a substituent, represents a heteroarylene which may have a substituent.

J <^1> represents a hydrogen atom or the C1-C6 alkyl group which may have a substituent, Preferably it is a methyl group and a hydrogen atom.

p ¹ represents the integer of 0-4, Preferably it represents 0 or 1.

¹¹ t is an integer of 0 to 6, preferably an integer of 0-2.

²¹ t is an integer of 0 to 6, preferably an integer of 0-2.

Z, Xaa, Xbb, m, and n represent the same meaning as the definition in (1).

Preferably, the peptide compound represented by Formula (1) is a peptide compound represented by following formula (1B).

[Formula 13]

A <^2> represents the bivalent group represented by * -CH = C (N)-which becomes one with the C1-C2 linear alkylene group which may have a substituent, or the carbon atom which N couple | bonds, and * is S Indicates the position to join with.

A ² preferably represents a linear alkylene group having 1 or 2 carbon atoms which may have a substituent.

A ² more preferably represents an ethylene group or a methylene group which may have a substituent.

A ² more preferably represents a methylene group.

The substituent in the definition of A ² is the same as described above with respect to the definition of A in Formula (1).

G ² is a C 1-6 carbon having a hydrogen atom or a substituent when the carbon to which G ² is bonded is one with A ² and does not represent a divalent group represented by * -CH = C (N)-. An alkyl group is shown. G ² preferably represents an ethyl group, a methyl group, and a hydrogen atom.

R <^2> represents the heteroarylene group which may have a substituent, or the C6-C10 arylene group which may have a substituent.

R ² preferably represents a heteroarylene group which may have a substituent or a phenylene group which may have a substituent.

More preferable examples of R ^2, and preferred examples of R ² are the same as more preferred examples of the preferable examples of R and R.

The substituent in the definition of R ² is the same as described above with respect to the definition of R in the formula (1).

J <^2> represents the hydrogen atom or the C1-C6 alkyl group which may have a substituent, Preferably it is a methyl group and a hydrogen atom.

p ² represents the integer of 0-4, Preferably it represents the integer of 0-2, More preferably, it represents 0 or 1.

q ² is an integer of 0 to 6, preferably an integer of 0 to 4, and more preferably represents an integer of 0 to 2, particularly preferably represents a zero or one.

However, p ² and q ² do not become 0 at the same time.

Z, Xaa, Xbb, m, and n represent the same meaning as the definition in (1).

As a peptide compound or its salt, salts in basic groups, such as a known amino group, acidic groups, such as a carboxyl group, and a hydroxyl group, are mentioned normally.

In addition, when referred to simply as a peptide compound in this specification, the salt of a peptide compound is also included.

As a salt in a basic group, For example, salt with mineral acid, such as hydrochloric acid, hydrobromic acid, nitric acid, and sulfuric acid; Salts with organic carboxylic acids such as formic acid, acetic acid, citric acid, oxalic acid, fumaric acid, maleic acid, succinic acid, malic acid, tartaric acid, aspartic acid, trichloroacetic acid and trifluoroacetic acid; And salts with sulfonic acids such as methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, mesitylenesulfone and naphthalenesulfonic acid.

As a salt in an acidic group, For example, salt with alkali metals, such as sodium and potassium; Salts with Group 2 metals such as calcium and magnesium; Ammonium salts; And trimethylamine, triethylamine, tributylamine, pyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, diethylamine, dicyclohexylamine, procaine, dibenzyl And salts with nitrogen-containing organic bases such as amines, N-benzyl-β-phenethylamine, 1-ephenamine, and N, N'-dibenzylethylenediamine.

When an isomer (for example, an optical isomer, a geometric isomer, etc.) exists in a peptide compound or its salt, this invention contains these isomers, and also includes solvates, hydrates, and crystals of various shapes.

<Composition for screening>

According to this invention, the composition for screening containing the above-mentioned peptide compound of this invention or its salt is provided.

According to the present invention, there is also provided a peptide compound having a cyclic moiety or a salt thereof, and the composition for screening comprising a peptide compound having the structure represented by the following formula (6) or a salt thereof.

[Formula 14]

In the formula,

X represents S, NH, or O,

A represents a divalent group represented by * -CR ⁰ = C (B)-which becomes one with a carbon atom to which a C1 or 2 straight-chain alkylene group which may have a single bond, a substituent, or B couple | bonds, and R ⁰ represents a hydrogen atom or a substituent, * represents a position to bond with X,

B represents a C1-C2 linear alkylene group which may have a single bond or a substituent, provided that A and B are not a single bond at the same time,

p piece R may be same or different, and may represent the hetero arylene group which may have a substituent, or the C6-C10 arylene group which may have a substituent,

G represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms that may have a substituent when the carbon to which G is bonded is one with A and does not represent a divalent group represented by * -CR ⁰ = C (B)-. Indicates,

p represents the integer of 0-4.

The meaning and preferable range of the symbol in Formula (6) are the same as that mentioned above about Formula (1).

The target substance and screening of the screening are as follows in this specification.

<Method for Producing Peptide Compound>

The manufacturing method of the peptide compound of this invention is not specifically limited, You may manufacture by the method of using a cell-free translation system, and you may manufacture by chemical synthesis of a peptide.

For example, a peptide chain (chain peptide) having an amino acid residue or amino acid flexible residue having a cyano group in the side chain at the C-terminus or at the C-terminus, and having the structure of Formula (2) at the N-terminus, By reacting the ano group with the structure of formula (2) to form a cyclic moiety having a bond represented by the following formula (3), a peptide compound having a cyclic moiety can be prepared from an acyclic peptide compound containing natural and non-natural amino acids. have.

The peptide compound of the present invention can also be produced by chemical synthesis. The synthesis of the peptide compound may be solid phase synthesis or liquid phase synthesis, but is preferably solid phase synthesis. Solid phase synthesis of a peptide compound is known to those skilled in the art, for example, a method of synthesizing a Fmoc group using a Fmoc group (Fluorenyl-Methoxy-Carbonyl group) as the protection of an amino group, and a Boc group (tert-Butyl Oxy Carbonyl group) as a protection of an amino group. Boc group synthesis | combining method etc. which are used) are mentioned. Chemical synthesis of a peptide compound can generally be performed by the automatic peptide synthesis | combination apparatus.

[Formula 15]

In Formula (2), X represents S, NH, or O. X preferably represents S.

A represents a C1-C2 linear alkylene group which may have a single bond or a substituent.

A preferably represents a C1-C2 linear alkylene group which may have a substituent.

A more preferably represents an ethylene group or a methylene group which may have a substituent.

A more preferably represents a methylene group.

B represents a C1-C2 linear alkylene group which may have a single bond or a substituent. Provided that A and B are not single bonds at the same time.

B preferably represents a single bond.

G represents a hydrogen atom or a C1-C6 alkyl group which may have a substituent. G preferably represents a hydrogen atom.

* Represents a binding site to the peptide chain.

[Formula 16]

In formula, X, A, G, and B are synonymous with the definition in Formula (2).

In the definition of A and B, as a substituent in "the C1-C2 linear alkylene group which may have a substituent", a C _1-6 alkyl group, a C _3-8 cycloalkyl group, a C _2-6 alkenyl group, C _2-6 alkynyl group, C _6-20 aryl group, heterocyclic group, C _6-20 aryl C _1-6 alkyl group.

The amino acid residue or amino acid flexible residue having the cyano group in the side chain is preferably a structure represented by the following formula (4).

[Formula 17]

In Formula (4), Q <^1> of m <^1> may be same or different, and may be a heteroarylene group which may have a substituent, a C6-C10 arylene group which may have a substituent, and C1-C1 which may have a substituent At least 1 sort (s) of the alkylene group of 6 is shown.

Q ¹ preferably represents a heteroarylene group which may have a substituent or an arylene group having 6 to 20 carbon atoms which may have a substituent.

Q ¹ more preferably represents a heteroarylene group which may have a substituent or a phenylene group which may have a substituent.

T <^1> represents a hydrogen atom or the C1-C6 alkyl group which may have a substituent, Preferably it is a methyl group and a hydrogen atom.

n ¹ represents an integer of 0 to 6, preferably an integer of 0 to 3, and more preferably represents 1 or 2 and represents the more preferably one.

m ¹ represents the integer of 1-4, Preferably 1 or 2 is represented, More preferably, 1 is represented.

* Indicates a binding position with amino acid residues and / or amino acid flexible residues constituting the peptide chain.

The amino acid residue or amino acid flexible residue having the cyano group in the side chain is preferably a structure represented by the following formula (5).

[Formula 18]

In formula (5), Q ² may have a single bond, -CH ₂ (C ₆ H ₅ NH)-, -CH ₂ (C ₆ H ₅ O)-, an amino acid residue which may have a substituent, or a substituent. The heteroarylene group, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown. Q ² is preferably a single bond, -CH ₂ (C ₆ H ₅ NH)-, -CH ₂ (C ₆ H ₅ O)-, an amino acid residue which may have a substituent, or a heteroaryl which may have a substituent Represents a Ren group.

Q ³ is a single bond, -CO-, -COO-, -NHCO-, -NHCONH-, -CONHCO-,-(CH ₂ CH ₂ O)-,-(CH ₂ CH ₂ CH ₂ O)-, a substituent The amino acid residue which may have, the heteroarylene group which may have a substituent, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown. Q ³ preferably represents a single bond, -NHCO-,-(CH ₂ CH ₂ O)-, an amino acid residue which may have a substituent, or a heteroarylene group which may have a substituent.

Q ⁴ represents at least one of a heteroarylene group which may have a substituent, an arylene group having 6 to 10 carbon atoms which may have a substituent, and an alkylene group having 1 to 6 carbon atoms which may have a substituent. Q ⁴ preferably represents a heteroarylene group which may have a substituent or an arylene group having 6 to 10 carbon atoms which may have a substituent.

T <^2> represents a hydrogen atom or the C1-C6 alkyl group which may have a substituent, Preferably it is a methyl group and a hydrogen atom.

l ² is an integer of 0 to 6, preferably an integer of 0-2.

n <^2> represents the integer of 0-6, Preferably it represents the integer of 0-2.

m ² represents the integer of 1-4, Preferably 1 or 2 is represented.

* Indicates a binding position with amino acid residues and / or amino acid flexible residues constituting the peptide chain.

As a preferable example of Q <^1> and Q <^4> , the benzothiazole ylene group which may have a substituent, the benzoxazole ylene group which may have a substituent, the benzimidazole ylene group which may have a substituent, and the benzothiophenyl which may have a substituent An benzofuranylene group which may have a ene group, a substituent, an isobenzofuranylene group which may have a substituent, an indolylene group which may have a substituent, a quinolineylene group which may have a substituent, and an isoquinolineylene group which may have a substituent , A quinazolylene group which may have a substituent, a cinnanoylene group which may have a substituent, an indazole ylene group which may have a substituent, a benzothiadiazole ylene group which may have a substituent, a pyridinylene group which may have a substituent, Even if it has a pyridazine ylene group which may have a substituent, and a substituent The pyrimidine ylene group which may have a substituent, the pyrazine ylene group which may have a substituent, the thiazole ylene group which may have a substituent, the imidazole ylene group which may have a substituent, the oxazolylene group which may have a substituent, and the oxa which may have a substituent May be having a diazole ylene group, a thiazole azole group which may have a substituent, a pyrazol ylene group which may have a substituent, an isoxoxazole ylene group which may have a substituent, the triazole ylene group which may have a substituent, and a substituent The imidazothiazole ylene group, the imidazopyridinylene group which may have a substituent, the imidazopyridazine ylene group which may have a substituent, the imidazopyrimidine ylene group which may have a substituent, and the imidazopyrazine which may have a substituent Pyrazolopyrimidine which may have an ylene group and a substituent An ylene group, a pyrrolopyridinylene group which may have a substituent, a thiophenylene group which may have a substituent, a furanylene group which may have a substituent, a pyrrolene group which may have a substituent, a phenylene group which may have a substituent, And at least one structure selected from naphthylene groups which may have a substituent.

As a more preferable example of Q <^1> and Q <^4> , the benzothio phenylene group which may have a substituent, the indolylene group which may have a substituent, the quinolinylene group which may have a substituent, the indazole ylene group which may have a substituent, and a substituent Pyrrolopyridinylene group which may have, Imidazopyrazine ylene group which may have a substituent, Pyridinylene group which may have a substituent, Pyridazineylene group which may have a substituent, Pyrazinylene group which may have a substituent, and a substituent At least one selected from a thiazole ylene group which may have, an oxazole ylene group which may have a substituent, a triazole ylene group which may have a substituent, a thiophenylene group which may have a substituent, and a phenylene group which may have a substituent The structure of can be mentioned.

The structure represented by Formula (2) is preferably a structure represented by the following Formula (2A).

[Formula 19]

In formula (2A), A <^1> represents the C1-C2 linear alkylene group which may have a substituent. A ¹ preferably represents an ethylene group or a methylene group which may have a substituent. A ¹ more preferably represents a methylene group.

G represents a hydrogen atom or a C1-C6 alkyl group which may have a substituent. G preferably represents an ethyl group, a methyl group, or a hydrogen atom.

Formula (2), More preferably, it is at least 1 structure chosen from the following formula.

[Formula 20]

Preferably, the reaction solvent of the process of making a cyano group and the structure of Formula (2) react, and forming the bond represented by Formula (3) is water or an organic solvent. When the synthesis by a cell-free translation system is used as the method for producing the acyclic peptide and the cyclic peptide, water is preferable as the reaction solvent.

The water may further contain an organic solvent and / or a surfactant in pure distilled water, an aqueous solution of a buffer and a salt (such as NaCl), or in the distilled water or the aqueous solution. When synthesize | combined by a cell-free translation system, it is preferable to use water as a reaction solvent in this way. As a buffer solution, the appropriate buffer solution which has buffering ability, such as HEPES (2- [4- (2-hydroxyethyl) -1- piperazinyl] ethanesulfonic acid) buffer, a phosphate buffer, etc. is mentioned. As an organic solvent, the organic solvent which can be mixed with water or a buffer solution is preferable, For example, methanol, dimethyl sulfoxide, polyethylene glycol, etc. are mentioned. As surfactant, Triton X (brand name), Brij (brand name), Tween (brand name), etc. are mentioned. The range of preferable organic solvent content is 20% or less, More preferably, it is 15% or less, and a more preferable range is 10% or less. When the organic solvent is included, the organic solvent content is greater than 0%.

Moreover, when chemical synthesis is used as a manufacturing method of acyclic peptide and a cyclic peptide, an organic solvent is preferable as a reaction solvent. Examples of the organic solvent include dimethylacetamide, N-methyl-2-pyrrolidone, N, N-dimethylformamide, methanol, ethanol, isopropanol, tetrahydrofuran, dioxane and acetonitrile. In this case, you may mix and use with water. When mixing and using an organic solvent and water, it is preferable to contain 20% or more of an organic solvent, More preferably, they are 20% or more and 70% or less, More preferably, they are 30% or more and 60% or less.

Preferably, pH of the process of reacting a cyano group and the structure of Formula (2), and forming the bond represented by Formula (3) is 6.0-8.5. By adjusting the pH within the above range, a cyclic peptide can be obtained in good yield.

The step of producing a peptide chain having an amino acid residue and / or an amino acid flexible residue having a cyano group at the side chain at the C chain or at the C terminus and having the structure of Formula (2) at the N terminus is preferably unprotected. It is a process of synthesizing non-cyclic peptides. By synthesizing an unprotected acyclic peptide, it is possible to simplify the purification of the cyclic peptide of interest in a subsequent step (synthesis step of the cyclic peptide). Moreover, when using the synthesized peptide as a peptide library, it can be evaluated as it is, without going through a deprotection process after synthesis. As amino acid residue and / or amino acid flexible body residue which has a cyano group in a side chain, the amino acid residue and / or amino acid flexible body which have a heteroarylene group which has a cyano group, an arylene group which has a cyano group, or an alkylene group which has a cyano group in a side chain Residues are preferred.

The process of reacting a cyano group and the structure of said Formula (2), and forming the bond represented by Formula (3), Preferably, it is a process performed under no catalyst. It is preferable from the viewpoint of simplicity that the above step can be performed without a catalyst.

From the standpoint of both binding (pharmacological activity) to the target and membrane permeability, the total number of amino acid residues and amino acid flexible residues constituting the annular portion of the peptide compound having the annular portion is preferably 3 to 20, more preferably It is five to fifteen.

Preferably, the total number of amino acid residues and amino acid flexible residues constituting the peptide compound having a cyclic portion is 3 to 20, and more preferably 5 to 20.

When synthesizing a peptide by a cell-free translation system, amino acid residues or amino acid flexible residues having a cyano group in the side chain exclude natural amino acids with respect to codons assigned in translation of end codons, tetrabasic codons, and natural amino acids. It can introduce | transduce using the codon empty by making it empty. Preferably, it introduce | transduces using a stop codon and a tetrabasic codon.

<Selection method of peptide compound>

According to the present invention, a peptide compound which binds to a target substance, comprising contacting the target library with a peptide library comprising the peptide compound of the present invention or a salt thereof, and selecting the peptide compound or salt thereof to bind to the target substance A method of selection is provided.

According to the present invention, there is further provided a process for preparing a peptide compound having an annular portion by the above-described method of the present invention; And selecting a peptide compound or a salt thereof by contacting the target material with a peptide library comprising the peptide compound or a salt thereof, thereby providing a method for selecting a peptide compound that binds to the target material. .

Peptide libraries are aggregates composed of many kinds of peptides. Selection is an act of selecting a peptide having a desired function from an aggregate, and may be called screening.

The peptide library may contain an acyclic peptide compound composed of natural amino acids or may contain a cyclic peptide compound composed of natural amino acids with respect to the peptide compound of the present invention.

The peptide compound of the present invention preferably includes an acyclic peptide compound composed of natural amino acids or a cyclic peptide compound composed of natural amino acids.

The method for selecting a peptide compound that binds to a target substance according to the present invention preferably includes the following steps.

(i) preparing a nucleic acid library, translating by a cell-free translation system containing a renal tRNA acylated with a non-natural amino acid, and preparing a library containing a peptide in which the non-natural amino acid is randomly introduced into a peptide sequence. fair;

(ii) contacting the peptide library with the target material;

(iii) selecting a peptide that binds to the target substance

In the step (i), each peptide constituting the library may be translated from a nucleic acid sequence encoding the peptide, the nucleic acid sequence and the peptide which is a translation product thereof may be linked, and an in vitro display library may be constructed.

In the nucleic acid sequence, the region encoding the peptide may include a random sequence consisting of repetition of a plurality of other triplets, or at least a part of the triplets in the random sequence is an array corresponding to a codon that designates an unnatural amino acid, The non-natural amino acid may be introduced into the peptide sequence by conjugation of the anti-codon of the kidney tRNA acylated with the non-natural amino acid and the codon designating the non-natural amino acid.

The step (iii) may include determining a nucleic acid sequence encoding a peptide that binds a target substance, determining a peptide sequence from the nucleic acid sequence, and selecting a peptide compound.

The "nucleic acid" in the present invention may also include a deoxyribonucleic acid (DNA), ribo nucleic acid (RNA), or a nucleotide derivative having an artificial base. It may also contain a peptide nucleic acid (PNA). The nucleic acid in the present invention may be any of these nucleic acids or hybridized as long as the desired genetic information is maintained. That is, the chimeric nucleic acid in which the hybrid nucleotide of DNA-RNA and other nucleic acids, such as DNA and RNA, were connected to one strand is also included in the nucleic acid in this invention.

In the present invention, nucleic acid libraries such as display libraries containing these nucleic acids as templates can be suitably used.

In vitro display refers to peptides synthesized using a cell-free translation system (also called in vitro translation system) in association with genetic information. Ribosome display, mRNA display, DNA display and the like are known. Any display has a mechanism of associating the genetic information recorded in the mRNA or DNA with the peptide encoded by the genetic information so as to correspond as a complex of [genetic information]-[translation product]. In ribosomal display, a complex of mRNA-ribosome-peptide is formed. In mRNA display, a complex of mRNA-peptides is formed. In DNA display, a complex of DNA-peptide is formed. In the present invention, any in vitro display library can be used.

The library can be contacted with a desired immobilized target to wash away molecules that do not bind to the target, thereby concentrating the binding peptides (panning method). Through this process, by analyzing the genetic information associated with the selected peptide, it is possible to clarify the arrangement of the protein bound to the target. For example, a method in which the antibiotic substance puromycin, which is an analog of an aminoacyl tRNA, is nonspecifically linked to mRNA translating proteins by ribosomes is described by mRNA display (Proc Natl Acad Sci USA. 1997; 94: 12297-302. RNA. -peptide fusions for the in vitro selection of peptides and proteins.Roberts RW, Szostak JW.) or in vitro virus (FEBS Lett. 1997; 414: 405-8.In vitro virus: bonding of mRNA bearing puromycin at the 3'- terminal end to the C-terminal end of its encoded protein on the ribosome in vitro.Nemoto N, Miyamoto-Sato E, Husimi Y, Yanagawa H.).

When a spacer such as puromycin is bound to the 3 'end of a library of mRNA obtained by transcription from a DNA library including a promoter such as a T7 promoter, and the mRNA is translated into a protein by a cell-free translation system, puromycin is purified by ribosomes. It is misidentified as an amino acid, introduced into a protein, and the mRNA and the protein encoded therein are linked to form a library to which the mRNA and its products are associated. This process does not include transformation of Escherichia coli, so that high efficiency is realized and a large-scale display library (10 ⁹ to ^{14 14} types) can be constructed. By panning, cDNA can be synthesized from mRNA, which is a tag containing genetic information attached to a selected molecule, PCR amplified, and the nucleotide sequence is analyzed to clarify the sequence of bound proteins. The part which does not fix the amino acid residue of the DNA library used as the template of a library can be obtained by mixing and synthesize | combining a base. A repeat of three multiples of a mixture (N) of four bases of A, T, G, C, or the first character of the codon, the second character of N, the third character of the two bases of W, M, K, S, etc. It synthesize | combines as a mixture. If the type of the amino acid to be introduced is suppressed to 16 or less, there is also a method of using the third letter as one type of base. In addition, the frequency of appearance of amino acid residues can be freely adjusted by preparing codon units corresponding to the three letters of the codon, mixing them in arbitrary ratios and using them for synthesis.

In addition to mRNA display, a display library using a cell-free translation system includes cDNA display (Nucleic Acids Res. 2009; 37 (16): e108. CDNA), which is a library consisting of cDNA encoding a peptide to which a peptide-puromycin complex binds. display: a novel screening method for functional disulfide-rich peptides by solid-phase synthesis and stabilization of mRNA-protein fusions.Yamaguchi J, Naimuddin M, Biyani M, Sasaki T, Machida M, Kubo T, Funatsu T, Husimi Y, Nemoto N.), Proc Natl Acad Sci US A. 1994; 91: 9022-6.An in vitro polysome display system for identifying ligands from very large peptide libraries Mattheakis LC, Bhatt RR, Dower WJ.), Covalent display using bacteriophage endonuclease P2A to form covalent bonds with DNA (Nucleic Acids Res. 2005; 33: e10. Cova. lent antibody display-an in vitro antibody-DNA library selection system.Reiersen H, Lobersli I, Loset GA, Hvattum E, Simonsen B, Stacy JE, McGregor D, Fitzgerald K, Welschof M, Brekke OH, Marvik OJ.), microorganisms CIS display using the replication initiation protein RepA of the plasmid of plasmid at the replication initiation point ori (Proc Natl Acad Sci US A. 2004; 101: 2806-10. CIS display: In vitro selection of peptides from libraries of protein-DNA complexes. Odegrip R, Coomber D, Eldridge B, Hederer R, Kuhlman PA, Ullman C, FitzGerald K, McGregor D.). In vitro compartmentalization (Nat Biotechnol. 1998; 16: 652-6. Man-made) in which a transcriptional translation system is encapsulated in a water-in-oil emulsion or liposome for each molecule of the DNA constituting the DNA library, and a translation reaction is performed. Cell-like compartments for molecular evolution.Tawfik DS, Griffiths AD.) are also known. As appropriate, the method can be used using a known method.

In the present invention, these nucleic acid libraries can be translated using the cell-free translation system described below. In the case of using a cell-free translation system, it is preferable to include an arrangement encoding a spacer downstream of the nucleic acid of interest. Examples of the spacer arrangement include, but are not limited to, an arrangement containing glycine or serine. Also, between the compound introduced into the peptide during translation by ribosomes such as puromycin and its derivatives, and the nucleic acid library, it is formed of a polymer of RNA, DNA, hexaethylene glycol (spc18) (for example, five polymers), or the like. It is preferable to include a linker which becomes

Cell-free translation

In the manufacturing method of the peptide compound of this invention, it is preferable to use protein production systems, such as a cell-free translation system. A cell-free translation system is a combination of an energy source such as a protein factor group, tRNA, amino acids, ATP (adenosine triphosphate), a regenerative system other than ribosomes extracted from cells, and mRNA can be translated into a protein. In addition to these, the cell-free translation system of the present invention may include initiation factor, elongation factor, dissociation factor, aminoacyl tRNA synthetase (ARS), methionyl tRNA transformase, and the like. These factors can be obtained by purifying from extracts of various cells. Cells for purifying the factor include, for example, prokaryotic or eukaryotic cells. Examples of prokaryotic cells include Escherichia coli cells, highly thermophilic cells, and Bacillus subtilis cells. As eukaryotic cells, those using yeast cells, wheat embryos, rabbit reticulocytes, plant cells, insect cells, or animal cells are known.

In the cell-free translation system, tRNA, amino acid, ATP, and the like are added to an extract prepared by crushing cells of a material and preparing by centrifugation, dialysis, or the like. For example, Escherichia coli (Methods Enzymol. 1983; 101: 674-90. Prokaryotic coupled transcription-translation. ChenHz, Zubay G.), yeast (J. Biol. Chem. 1979 254: 3965-3969. The preparation and characterization of a cell-free system from Saccharomyces cerevisiae that translates natural messenger ribonucleic acid.E Gasior, F Herrera, I Sadnik, CS McLaughlin, and K Moldave, Wheats Enzymol. 1983; 96: 38-50. of messenger RNA in a wheat germ system.Erickson AH, Blobel G.), Methods Enzymol. 1983; 96: 50-74. Preparation and use of nuclease-treated rabbit reticulocyte lysates for the translation of eukaryotic messenger RNA. Jackson RJ, Hunt T.), Hela cells (Methods Enzymol. 1996; 275: 35-57. Assays for poliovirus polymerase, 3D (Pol), and authentic RNA replication in HeLa S10 extracts.Barton DJ, Morasco BJ, Flanegan JB. ), Insect cells (Comp Biochem Physiol B. 1989; 93: 803-6. Cell-free translation in lysates from Spodoptera frugiperd a material (Lepidoptera: Noctuidae) cells.Swerdel MR, Fallon AM.) may be used. By adding RNA polymerases such as T7 RNA polymerase, transcription and translation from DNA can be conjugated. On the other hand, PUREfrex (registered trademark) is a reconstituted cell-free translation system that extracts and purified each of the protein factors, energy regeneration enzymes, and ribosomes necessary for the translation of E. coli, and is mixed with tRNA, amino acids, ATP, and GTP (guanosine triphosphate). to be. Since the content of impurities is not only small, but a reconstitution system, a system containing no protein factor or amino acid to be excluded can be easily manufactured ((i) Nat Biotechnol. 2001; 19: 751-5. Cell-free translation reconstituted with purified components.Shimizu Y, Inoue A, Tomari Y, Suzuki T, Yokogawa T, Nishikawa K, Ueda T. (ii) Methods Mol Biol. 2010; 607: 11-21.PURE technology.Shimizu Y, Ueda T.). In this invention, the said method can be used using a well-known method suitably.

Various factors included in the cell-free translation system, such as ribosomes and tRNAs, can be purified from E. coli cells and yeast cells by methods well known to those skilled in the art. In addition to the tRNA and aminoacyl tRNA synthetase present in nature, an artificial aminoacyl tRNA synthetase which recognizes an artificial tRNA or an unnatural amino acid can also be used. By using an artificial tRNA or an artificial aminoacyl tRNA synthetase, a peptide having a site-specific non-natural amino acid introduced therein can be synthesized.

Translational introduction of non-natural amino acids into peptides includes orthogonal and efficiently introduced into ribosomes ((i) Biochemistry. 2003; 42: 9598-608. Adaptation of an orthogonal archaeal leucyl-tRNA and synthetase Pair for four-base, amber, and opal suppression.Anderson JC, Schultz PG., (ii) Chem Biol. 2003; 10: 1077-84.Using a solid-phase ribozyme aminoacylation system to reprogram the genetic code.Murakami H, Kourouklis D, Suga H. (iii) aminoacylation of Japanese Patent Publication No. 4917044) is necessary. The following five methods can be used as a method of aminoacylating a tRNA.

(1) In the cell, aminoacyl tRNA synthetase is prepared for each amino acid that binds tRNA in the process of aminoacylation of tRNA. A method of using a specific species of aminoacyl tRNA synthetase to allow non-natural amino acids such as N-Me His, that is, a method of preparing a variant aminoacyl tRNA synthetase to allow non-natural amino acids and using the same ((i)). Proc Natl Acad Sci US A. 2002; 99: 9715-20.An engineered Escherichia coli tyrosyl-tRNA synthetase for site-specific incorporation of an unnatural amino acid into proteins in eukaryotic translation and its application in a wheat germ cell-free system. Kiga D, Sakamoto K, Kodama K, Kigawa T, Matsuda T, Yabuki T, Shirouzu M, Harada Y, Nakayama H, Takio K, Hasegawa Y, Endo Y, Hirao I, Yokoyama S. (ii) Science. 2003; 301 An expanded eukaryotic genetic code.Chin JW, Cropp TA, Anderson JC, Mukherji M, Zhang Z, Schultz PG. Chin, JW. (Iii) Proc Natl Acad Sci US A. 2006; 103: 4356-61 Enzymatic aminoacylation of tRNA with unnatural amino acids.Hartman MC, Josephson K, Szostak JW.).

(2) A method of aminoacylating tRNA and then chemically modifying the amino acid in vitro may also be used (J Am Chem Soc. 2008; 130: 6131-6. Ribosomal synthesis of N-methyl peptides.Subtelny AO, Hartman MC, Szostak JW.).

(3) Aminoacyl tRNA can be obtained by combining an aminoacylated pdCpA (dinucleotide consisting of deoxycytidine and adenosine) separately prepared with the exception of CA from the CCA sequence of the 3 'end of tRNA with RNA ligase ( Biochemistry. 1984; 23: 1468-73. T4 RNA ligase mediated preparation of novel “chemically misacylated” tRNA Phe S. Heckler TG, Chang LH, Zama Y, Naka T, Chorghade MS, Hecht SM.).

(4) There is also aminoacylation by flexizyme, a ribozyme that supports active esters of various non-natural amino acids on tRNA (J Am Chem Soc. 2002; 124: 6834-5.Aminoacyl-tRNA synthesis by a resin-immobilized ribozyme Murakami H, Bonzagni NJ, Suga H.). Ultrasonic mixing of tRNA and amino acid active esters in cationic micelles is also available (Chem Commun (Camb). 2005; (34): 4321-3. Simple and quick chemical aminoacylation of tRNA in cationic micellar solution under ultrasonic agitation. Hashimoto N, Ninomiya K, Endo T, Sisido M.).

(5) Aminoacylation is also possible by adding to the tRNA a combination of amino acid active esters to PNA complementary to the 3 'end of the tRNA (J Am Chem Soc. 2004; 126: 15984-9. In situ chemical aminoacylation with amino acid thioesters linked to a peptide nucleic acid.Ninomiya K, Minohata T, Nishimura M, Sisido M.).

Although there have been many reports of using codons for introducing non-natural amino acids, since PUREfrex (registered trademark) can be used to construct a synthetic system excluding natural amino acids and ARS, the codons encoding amino acids are excluded. Non-natural amino acids can be introduced using codons vacant by introducing non-natural amino acids instead of natural amino acids, ie by excluding natural amino acids from codons allocated in translation of natural amino acids (J Am Chem Soc. 127: 11727-35.Ribosomal synthesis of unnatural peptides. Josephson K, Hartman MC, Szostak JW.). Also, non-natural amino acids can be added without excluding natural amino acids by decoupling codons and expanding codons by tetrabasic codons (Kwon I, et al. Breaking the degeneracy of the genetic code.J Am Chem Soc. 2003, 125, 7512-3.T, Hohsaka et al. J Am Chem Soc. 1996, 118, 9778.). That is, as an amino acid residue or amino acid flexible body residue which has a heteroarylene group which has a cyano group, an arylene group which has a cyano group, or an alkylene group which has a cyano group in a side chain, it is a natural amino acid with respect to the codon assigned in translation of a natural amino acid. You may use any of the codon, the stop codon, or the tetrabasic codon which are empty by excluding.

In natural translation, 20 types of proteinaceous amino acids and translation ends (stops) are assigned to each of 64 types of codons according to the universal genetic code table shown below.

TABLE 1

In the present invention, in addition to the codons used in the peptide chain extension reaction, the start codon can also be changed. The start codon is a codon that designates the start of translation, and encodes a start amino acid that becomes the N terminus of the peptide on the mRNA. Initiation of translation of mRNA requires a specific tRNA called an initiation tRNA. To begin translation, the aminoacylated initiation tRNA binds to a small subunit of the ribosome along with the initiation factor (IF), and the small subunit of the ribosome binds to the initiation codon on the mRNA. The initiating tRNA has an anti codon corresponding to the initiation codon and recognizes the initiation codon. In the universal code table, since the start codon, AUG, which is generally a codon of methionine, is used, the initiating tRNA has an anticodon corresponding to methionine, and the initiating tRNA necessarily forms a methionine (a form in prokaryotic cells). Transports ilmethionine).

By using initiation read-through (greater than translation of the initiation codon), the N-terminal introduction of amino acids, amino acid flexibles or N-terminal carboxylic acid flexibles other than the above-mentioned methionine may be used to There is a method that does not require preparation of plural kinds of aminoacyl translation initiation tRNAs in the synthesis method. Initiation read through means that a protein or peptide is generally translated from methionine, a translation initiating amino acid encoded as an AUG codon, but does not include translation initiation methionyl tRNA in a cell-free translation system. It means a phenomenon in which a translation product from an amino acid encoded by a second or later codon occurs when a non-natural amino acid having a low translation efficiency is attempted to start translation from being added to a translation start tRNA.

As a method of using the initiation read-through, any natural amino acid other than methionine is encoded in the second codon after the start codon of the mRNA encoding the peptide to include a methionine or a translation initiation methionine tRNA. By translating by a non-translational system, a method of preparing a peptide or peptide library having the N-terminus as any natural amino acid other than methionine can be used. As a separate method, a method of removing mesionine at the N-terminus of a peptide is known by applying an enzyme such as peptide deformylase and Methionine aminopeptidase. (Meinnel, T , et al. Biochimie (1993) 75, 1061-1075, Methionine as translation start signal: A review of the enzymes of the Pathway in Escherichia coli.).

Moreover, the method of translating an N terminal as a desired amino acid can also be used by translating using another translation start tRNA which carried out aminoacylation. In the N terminal introduction of non-natural amino acids, it is known to use amino acids and amino acid flexible bodies that have a higher degree of amino acid tolerance than elongation and have a structure significantly different from natural amino acids (J Am Chem Soc. 2009 Apr 15; 131 (14)). : Translational initiation with initiator tRNA charged with exotic peptides.Goto Y, Suga H.).

(Peptide illusion)

In the present invention, the peptide can be cyclicized by using an intramolecular specific reaction of a non-cyclic peptide synthesized by translation.

Cyclization of a peptide is performed by the following process (i) and (ii).

(i) synthesizing, by translational synthesis, a non-cyclic peptide compound having functional groups 1 and 2, which are a set of functional groups capable of a bond formation reaction, in a molecule; And

(ii) cyclicizing the acyclic peptide compound by a bond formation reaction of the functional group 1 and the functional group 2;

With one set of functional groups capable of a bond formation reaction, a bond formation reaction is possible between one set of functional groups, that is, between functional group 1 and functional group 2, and as a result of the reaction, a non-cyclic peptide compound is used as a cyclic peptide compound. It is a set of functional groups.

In this invention, a combination of a cyano group and the structure of said Formula (2) is used as said one set of functional groups.

That is, in this invention, the peptide chain which has the amino acid residue or amino acid flexible body residue which has a cyano group in a side chain in the peptide chain or C terminal, and has the structure of said Formula (2) at the N terminal is produced, A cyclic peptide compound can be manufactured by making an ano group react with the structure of said Formula (2), and forming the bond represented by Formula (3) described in this specification.

Since the ring is formed by the bond formation between the above-described set of functional groups present in the acyclic peptide compound, the elements constituting the acyclic peptide compound (typically, amino acids) are used as one unit, and The same set of functional groups need to exist on the units of different components. Such a component is called an amino acid compound, and a unit of the component is called an amino acid compound unit. That is, a non-cyclic peptide compound is a compound which has one set of functional groups on another amino acid compound unit. In the non-cyclic peptide compound, it is preferable that an amino acid compound unit of 1 to 18 is present between the amino acid compound unit having one functional group and the amino acid compound unit having the other functional group, and the amino acid compound unit of 1 to 15 is It is more preferable to exist, and it is still more preferable that the amino acid compound unit of 3-13 exists.

Examples of the amino acid having functional group 2 include cysteine, serine, and threonine as natural amino acids. Examples of non-natural amino acids include non-natural amino acids having -SH groups (e.g., penicylamine, homocysteine, mercaptonovaline, etc.), non-natural amino acids having -NH ₂ group (e.g., α, β-diaminopropionic acid, (alpha), (gamma)-diamino butyric acid etc.), or non-natural amino acid (for example, homoserine etc.) which has OH group can also be used.

As an amino acid which has functional group 2, cysteine, a-methyl-cysteine, penicylamine, and homocysteine are preferable. The amino acid having functional group 2 is introduced in the peptide chain extension reaction by a reconstructed translation system including at least this amino acid and the corresponding tRNA.

The cyclic peptide compound is synthesize | combined by circulating the acyclic peptide compound synthesize | combined as mentioned above. The conditions of the bond formation reaction of the functional group 1 and the functional group 2 are set according to the kind of the functional group.

The annularization of the acyclic peptide compound can be performed by isolating the acyclic peptide compound and then exposing it to appropriate reaction conditions. Alternatively, the cyclic can be performed by adjusting the cell-free translation system to appropriate reaction conditions without isolating the acyclic peptide compound. Moreover, depending on the kind of one functional group, it may be cyclicized under the conditions of the cell-free translation system for synthesizing a non-cyclic peptide compound, and in this case, the cyclic is carried out without adjusting special reaction conditions. Peptide compounds can be obtained.

Preferred reaction conditions for the annularization of the acyclic peptide compound are as described above in the present specification.

(Template nucleic acid encoding a peptide)

In the present invention, in a cell-free translation system, a peptide library having a random amino acid sequence may be synthesized by performing a translation synthesis from a template nucleic acid (mRNA or a corresponding DNA) having a random sequence in a region encoding the peptide. . In addition, by combining the translation system with in vitro display technology, the peptides constituting the library can be screened with a nucleic acid sequence encoding the peptides. In this case, the peptide aptamer is selected from the display library in which the genetic information is presented (displayed) as the peptide as the translation product. Thereby, the tag which can amplify and read by the molecular biological method is added to each random peptide molecule in a library.

In the present invention, the RNA or DNA sequence that is a template corresponding to the amino acid sequence of the peptide may be designed to code a random library of peptides. Specifically, the region encoding the peptide in the nucleotide sequence includes a random sequence consisting of repetition of a plurality of other triplets, and at least a part of the triplets in the random sequence is an array corresponding to a codon that designates an unnatural amino acid. .

In the region encoding the peptide, at least a part of the tetrabasic (quatet) codons in the random sequence may be an array corresponding to the codon specifying the non-natural amino acid.

In this invention, you may design so that RNA or DNA sequence may code a cyclic peptide. Specifically, the region encoding the peptide in the nucleotide sequence includes the nucleotide sequence corresponding to the following (a) to (c) in the direction of 5 'to 3' of the mRNA sequence:

(a) a codon designating an amino acid having functional group 1;

(b) a random arrangement of repetitions of a plurality of other triplets, and

(c) a codon that designates an amino acid having functional group 2.

The random mRNA sequence is designed so that non-natural amino acids appear in a certain probability in a random amino acid sequence that is a translation product. That is, at least a part of the triplet in the random sequence of (b) is a codon that designates a non-natural amino acid, whereby the non-natural amino acid is introduced into a part of the amino acid sequence of the random peptide as a translation product. Introduction of the non-natural amino acid is achieved by confronting the anti-codon of the tRNA for elongation reaction in which the non-natural amino acid is linked with the codon specifying the non-natural amino acid in the peptide chain extension reaction on the ribosome. Moreover, the peptide which is a translation product is cyclicized by the bond formation reaction between the functional group 1 and the functional group 2 which is a set of functional groups which can perform a bond formation reaction. As described above, the tRNA used for the introduction of the non-natural amino acid is preferably an artificial tRNA prepared by an in vitro transcriptional reaction.

In the present invention, a DNA or RNA molecule corresponding to the nucleotide sequence serving as a template for translation is used in a cell-free translation system composed of components optimized for the purpose. In addition to the region encoding the target amino acid sequence, the nucleic acid sequence may additionally include a base sequence that is advantageous for translation, in addition to the region encoding the target amino acid sequence. For example, in the case of a system using an E. coli-derived ribosome, the efficiency of the translation reaction increases by including a Shine-Dalgarno (SD) sequence, an epsilon sequence, and the like upstream of the start codon.

At the N terminus of the region encoding the peptide, the start codon is disposed. The start codon is usually a triplet arrangement AUG.

On the C-terminal side, an array for linking the nucleic acid molecule with its translational product peptide is included for in vitro display. For example, in the case of using an mRNA display method using a puromycin linker, a complex library of mRNA-peptides is formed by adding a pre-linked puromycin linker to an mRNA library to a translation system. In order to efficiently introduce puromycin to the A site of ribosomes, a linker is usually inserted between the 3 'terminal side of the mRNA and the puromycin. Puromycin functions as a substrate (aminoacyl tRNA analog) of peptide transfer reactions on ribosomes and connects mRNA and peptide by binding to the C terminus of the renal peptide. The mRNA display method is a technique for integrating genotype and phenotype by linking mRNA and peptide through an appropriate linker by an in vitro translation system, and, as long as this object is achieved, includes a substance having another identical function instead of puromycin. It is also within the scope of recognition of those skilled in the art that a linker can be used.

The random arrangement consists of repetition of codons consisting of triplets of any arrangement, and is designed so that some of them are codons specifying non-natural amino acids such as amino acids having a cyano group in the side chain. In addition, tetrabasic (quated) codons may be included in the random sequence, and non-natural amino acids such as amino acids having a cyano group in the side chain may be specified in the tetrabasic codon.

The triplets constituting the random array are represented by N ¹ N ² N ³ codons, and possible arrangements will be described. N ¹ and N ² may each independently be any one of A, U, C or G. N ³ may also be any one of A, U, C or G. Alternatively, N ³ may be any one selected from any three of four bases of A, U, C, and G. Alternatively, N ³ may be any one selected from any two kinds of four bases of A, U, C, and G. Alternatively, N ³ can be defined as one of A, U, C or G.

For example, as an example of a triplet on an mRNA sequence constituting a random sequence, NNU codon or NNK codon {N is a ribonucleotide of any one of A, U, C or G, and K is either C or G. It is a ribonucleotide of}}.

(in vitro selection (selection))

In the present invention, since the peptide library constructed by the cell-free translation system is perfectly compatible with in vitro display techniques including mRNA display, peptide molecules that bind to the target from peptide libraries consisting of more than 10 ⁹ types of high diversity Can be created.

In vitro display technology is used as a tool for evolutionary molecular engineering. In evolutionary molecular engineering, for the purpose of creating a protein or peptide having a desired function or property, a potential gene is prepared on a large scale, and a clone having a target phenotype is selected among them. Basically, first, a DNA population (DNA library) is prepared to obtain an RNA population (RNA library) as an in vitro transcription product, and a peptide population (peptide library) as an in vitro translation product. From this peptide library, one having a desired function or property is selected in any screening system. For example, in the case of obtaining a peptide molecule that binds to a specific protein, a peptide group can be introduced into a column in which the target protein is solidified to recover a mixture of peptide molecules bound to the column. At this time, by in vitro display technology, the nucleic acid molecule as a template is added to each peptide molecule like a tag. In the case of mRNA display libraries, mRNA is added to each peptide molecule. Therefore, the DNA was recovered from the recovered population of peptide-mRNA complexes by reverse transcriptase and amplified by PCR (polymerase chain reaction) to obtain a biased library containing a large number of clones having the desired phenotype. A selection experiment is conducted. Alternatively, in order to avoid the possibility of recovering RNA aptamers, it is also possible to perform reverse transcription reactions prior to selection, in order to make the nucleic acid moiety a double strand (DNA / RNA hybrid). By repeating this operation, clones having the desired phenotype with the passage of generations are concentrated in the population.

When identifying the peptide aptamers, the in vitro display library is mixed with the target material, the corresponding molecule (active species) presenting the peptide bound to the target material is selected, and the nucleic acid by PCR from the nucleic acid portion of the selected matching molecule. By repeating the process for preparing the library, the gene of the peptide aptamer binding to the target substance can be cloned.

As a target substance, generally, a lipid containing a protein, a nucleic acid, a complex lipid, a sugar containing a sugar chain, other biological molecules, and the like, and metals and pigments.

Examples of the target substance include intracellular proteins, nucleic acids, and membranes which are inaccessible to molecules in vivo for the treatment of diseases, in particular molecules that do not have a space for inheriting low molecular weight compounds having a molecular weight of less than 500, or high molecular compounds such as antibodies. Preferred are intracellular regions of proteins or membrane transmembrane domains of membrane proteins.

Target substances include, for example, G Protein-Coupled Receptors (GPCRs), intranuclear receptors, protein kinases, proteases, esterases, ion channels, metabolic enzymes, unstructured proteins, RNA, DNA, fatty acids, phosphorus lipids. And sterols.

As a specific example of a target substance,

transcription factors such as c-Myc, STAT, AP1, CREB, SREBP, G protein conjugated receptors such as GPR143, GRM1, ADORA1, muscarinic acetylcholine receptor, cannabinoid receptor, GLP-1 receptor, PTH receptor Protein-coupled receptors (GPCR), cytokines such as TNF, TNFR, IL-6, IL-6R, ion channel receptors such as receptors, P2X receptors, nicotinic acetylcholine receptors, tyrosine kinase types such as EGFR, PDGFR DNAs such as microRNAs such as receptors, p53, XIAP, Mcl-1, Bcl-2, MDM2, MLL, BRD4, USP7, and YAP, microRNAs such as miR-21 and miR206, cfDNA and mitochondrial DNA.

In addition, a metal such as gold, silver, copper, platinum, palladium, or a metal salt thereof may be a target substance, and may be titanium oxide, barium sulfate, carbon black, silica, iron oxide, azo dye, phthalocyanine, anthraquinone, or the like. The pigment may be a target substance.

To select an active species, a [genetic information]-[peptide] complex is contacted with a target substance to separate the complex presenting the peptide bound to the target substance from a number of other complexes not bound to the target substance in an appropriate manner. It is necessary to recover. Many techniques are known as a method of such recovery.

For example, it is convenient to give the target substance a formula which can be recovered by binding to a solid phase. For example, the target substance may be modified by biotin, and recovered using specific binding to the solidified biotin-binding protein. As such specific binding, in addition to the combination of biotin binding protein (avidin, streptoavidin, etc.) / biotin, maltose binding protein / maltose, polyhistidine peptide / metal ion (nickel, cobalt, etc.), glutathione-S -Transferases / glutathiones, antibodies / antigens (epitopes), and the like can be used, but are not limited to these.

According to the present invention, a peptide library is contacted with a target substance to select an active species presenting a peptide bound to the target substance, thereby amplifying the nucleic acid sequence of the selected active species, and using the amplified nucleic acid sequence as a template. Repeating the in vitro selection of the active species from the library of peptides synthesized again, thereby creating a peptide that binds to the target substance.

The creation of a peptide compound that binds to a target substance is achieved by recovering the active species presenting the peptide bound to the target substance, interpreting the nucleic acid sequence, determining the peptide sequence from the nucleic acid sequence, and selecting an appropriate peptide based on the obtained peptide sequence. And obtaining an amino acid sequence and a nucleic acid sequence of the peptide that bind to the target substance. Further, based on the obtained sequence information, it is possible to synthesize, purify and isolate the peptide using any method. Using the obtained peptides, peptides with high activity can be obtained by assessing the binding activity of the target protein and confirming the inhibitory activity.

Example

The present invention will be described with reference to the following Examples, but the present invention is not limited thereto.

When there is no description in particular, the purification by column chromatography used the automatic refiner ISOLERA (Biotage company) or the medium pressure liquid chromatography YFLC W-prep 2XY (Yamazen Corporation).

When there is no description in particular, the support | carrier in silica gel column chromatography used SNAP KP-Sil Cartridge (Biotage), high flash column W001, W002, W003, W004, or W005 (Yamazen Corporation).

NH silica used SNAP KP-NH Cartridge (Biotage).

The mixing ratio in the eluent is a capacity ratio.

For example, "chloroform / methanol = 90/10 → 50/50" means that the eluent of "chloroform / methanol = 90/10" was changed into the eluent of "chloroform / methanol = 50/50". do.

The mass spectrum (MS) is ACQUITY SQD LC / MS System (Waters, ionization method: ESI (Electro Spray Ionization), or LCMS-2010 EV (Shimazu Seisakusho, ionization method: ESI and APCI (Atmospheric) Pressure chemical ionization and atmospheric chemical ionization) were measured using the ionization method which performs simultaneously.

Unless otherwise specified, MS in the table means MS (ESI m / z): (M + H).

The microwave reaction apparatus used InitiatorTM (Biotage). H-Cube (ThalesNano) was used for the flow hydrogenation reactor.

The nuclear magnetic resonance (NMR) spectrum was measured using tetramethylsilane as an internal reference, and Bruker AV300 (Bruker), and the total δ value was expressed in ppm.

The holding time (RT) was measured using SQD (Waters, Inc.) and expressed in minutes.

Column: BEHC 18 1.7μm, 2.1x30mm from Waters

Solvent: Liquid A: 0.1% formic acid-water

Liquid B: 0.1% formic acid acetonitrile

Gradient Cycles: 0.00min (Liquid A / B = 95/5), 2.00min (Liquid A / B = 5/95), 3.00min (Liquid A / B = 5/95)

Flow rate: 0.5mL / min

Column temperature: room temperature

Detecting Wavelength: 254nm

Matrix Assisted Laser Desorption Ionization- time of flight mass spectrum (MALDI-TOF MS) used ultrafleXtreme MALDI-TOF / TOF MS (manufactured by Bruker Daltonics). As the matrix, α-cyano-4-hydroxycinnamic acid was used.

Synthesis of 4-bromo-2-cyanothiazole

[Formula 21]

To 5 mL of methanol (MeOH) solution of 4-bromo-1,3-thiazole-2-carboaldehyde (500 mg) is added 430 μL of N-methylmorpholine (NMM) and hydroxylamine hydrochloride (200 mg) and at room temperature. It stirred for 12 hours. After the solvent was distilled off under reduced pressure, distilled water and ethyl acetate were added, and the extraction operation was performed. The organic layer was washed with distilled water and saturated brine, and dried over magnesium sulfate. 10 mL of dichloromethane and 430 mg of 1,1'-carbonyldiimidazole (CDI) were added to the obtained residue, and it stirred at room temperature for 2 hours. The solvent was distilled off and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 10/90) to give the title compound (450 mg) as a yellow solid.

MS (ESI m / z): 190.9 (M + H)

RT (min): 1.06

Synthesis of 4-bromo-2-cyanofuran

[Formula 22]

It carried out similarly to the synthesis | combination of 4-bromo-2-cyanothiazole.

MS (ESI m / z): 172.0 (M + H)

RT (min): 1.18

Synthesis of 3-bromo-4-nitrobenzonitrile

[Formula 23]

(1) Synthesis of 3-bromo-4-nitrobenzamide

To acetonitrile solution (20 mL) of 3-bromo-4-nitrobenzoic acid (2.35 g) 4- (4,6-dimethoxy-1,3,5-triazin-2-yl) -4- Methylmorpholinium chloride (DMT-MM) (3.95 g) and the methanol solution (7 mol / L, 8 mL) of ammonia were added, and it stirred at room temperature for 3.5 hours. Saturated sodium hydrogen carbonate aqueous solution was added to the reaction solution, and extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water, saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure to obtain the title compound (2.26 g) as a pale yellow solid.

MS (ESI m / z): 246.9 (M + H)

RT (min): 0.96

(2) Synthesis of 3-bromo-4-nitrobenzonitrile

To 2.0 g of 3-bromo-4-nitrobenzamide, 10 mL of tetrahydrofuran (THF) and 4 mL of triethylamine (TEA) were added. 1.8 mL of trifluoroacetic anhydride (TFAA) was dripped under the ice bath, and it stirred for 2 hours. After the solvent was distilled off, distilled water and ethyl acetate were added to the obtained residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 15/85) to obtain 1.45 g of the title compound as a pale yellow solid.

MS (ESI m / z): 228.1 (M + H)

RT (min): 1.31

Synthesis of 6-bromobenzo [b] thiophen-2-carbonitrile

[Formula 24]

6-bromobenzo [b] thiophene-2-carboxylic acid was used as a starting material, and it carried out similarly to the synthesis | combination of 3-bromo-4- nitrobenzonitrile.

¹ H-NMR (CDCl ₃ ) δ: 8.03 (1H, s), 7.86 (1H, s), 7.75 (1H, d, J = 8.6 Hz), 7.59 (1H, dd, J = 8.6, 2.0 Hz).

MS (ESI m / z): 239.0 (M + H)

RT (min): 1.69

Synthesis of 6-bromobenzofuran-2-carbonitrile

[Formula 25]

(1) Synthesis of 2- (5-bromo-2-formylphenoxy) acetonitrile

To 4-bromo-2-hydroxybenzaldehyde (1.1 g) was added N, N-dimethylformamide (DMF) (5 mL), potassium carbonate (1.2 g) and bromoacetonitrile (460 μL), It stirred at room temperature for 15 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 10/90 → 30/70) to obtain the title compound (1.1 g) as a pale yellow oil.

MS (ESI m / z): 241.0 (M + H)

RT (min): 1.25

(2) Synthesis of 6-bromobenzofuran-2-carbonitrile

DMF (10 mL) and potassium carbonate (0.95 g) were added to 2- (5-bromo-2-formylphenoxy) acetonitrile (1.1 g), and it stirred at 100 degreeC for 1 hour. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 10/90) to obtain the title compound (1.1 g) as a pale yellow solid.

¹ H-NMR (CDCl ₃ ) δ: 7.76 (1H, s), 7.59-7.47 (2H, m), 7.44 (1H, s).

MS (ESI m / z): 223.0 (M + H)

RT (min): 1.64

Synthesis of 4-bromo-1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazole-3-carbonitrile

[Formula 26]

To a THF solution (14 mL) of 4-bromo-1H-pyrazole-3-carbonitrile (1.06 g) was added 3,4-dihydropyran (0.98 mL) and trifluoroacetic acid (47 μL), followed by 60 ° C. It stirred at 18 hours. The solvent was distilled off under reduced pressure, and the obtained residue was dissolved in dichloromethane. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 13/87 to 25/75) to obtain the title compound (1.30 g) as a white solid.

MS (ESI m / z): 256.8 (M + H)

RT (min): 1.44

Synthesis of tert-Butyl (R) -2-((tert-butoxycarbonyl) amino) -3-iodopropanoate

[Formula 27]

After adding iodine (7.29 g) to a dichloromethane solution (50 mL) of triphenylphosphine (PPh ₃ ) (7.35 g) and imidazole (1.96 g) under an ice bath, the temperature of the solution was raised to room temperature. And it stirred for 1 hour. Thereafter, a dichloromethane solution (10 mL) of tert-butyl (tert-butoxycarbonyl) -L-serinate (Boc-Ser-OtBu) (5.0 g) was added dropwise under an ice bath. Boc represents tert-butoxycarbonyl group and tBu represents t-butyl. After completion of the dropwise addition, the temperature of the solution was raised to room temperature and stirred for 16 hours. The insolubles were filtered off, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 5/95) to give the title compound (5.35 g) as a pale yellow solid. )

MS (ESI m / z): 372.1 (M + H)

RT (min): 1.83

Synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate

[Formula 28]

DMF (2 mL) and iodine (25 mg) were added to zinc powder (116 mg), and it stirred for 5 minutes in nitrogen atmosphere. Then, tert-butyl (R) -2-((tert-butoxycarbonyl) amino) -3-iodopropanoate (226 mg) and iodine (25 mg) were added and room temperature for 30 minutes under nitrogen atmosphere. Further stirred. The solution contained 6-bromoquinoline-2-carbonitrile (185 mg), tris (dibenzylideneacetone) dipalladium (0) (also referred to as Pd ₂ (dba) ₃ ) (13 mg) and 2-dicyclohexyl Phosino-2 ', 6'- dimethoxybiphenyl (Sphos) (12 mg) was added, and it stirred for 4 hours in 60 degreeC nitrogen atmosphere. The insolubles were removed by Celite filtration, the solvent of the filtrate was distilled off, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 15/85) to obtain a pale yellow oily phase ( Iii) the title compound (90 mg).

MS (ESI m / z): 398.2 (M + H)

RT (min): 1.72

The synthesis | combination of the compound shown in following Table 2 is the synthesis | combination of tert- butyl (S) -2-((tert- butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate Was carried out in the same manner.

TABLE 2-1

Table 2-2

TABLE 2-3

Synthesis of tert-Butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanobenzo [d] thiazol-6-yl) propanoate

[Formula 29]

(1) Synthesis of tert-Butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-nitrophenyl) propanoate

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-nitrophenyl) propanoic acid (Boc-Phe (pNO ₂ ) -OH) (318 mg) was dissolved in toluene (10 mL). And it heated at 80 degreeC. N, N-dimethylformamide-di-tert-butylacetal (1.0 mL) was added dropwise to the solution. After dripping, it stirred at 80 degreeC for 1 hour. Disappearance of the raw material was confirmed by liquid chromatography mass spectrometry (LC-MS), and cooled to room temperature. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 15/85) to obtain 349 mg of the title compound as a clear liquid.

MS (ESI m / z): 367.9 (M + H)

RT (min): 1.75

(2) Synthesis of tert-Butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-aminophenyl) propanoate

1.0 g of reduced iron and ammonium chloride (300 mg) were dissolved in ethanol (EtOH) (15 mL) and distilled water (15 mL), and heated at 80 ° C. for 20 minutes. To the solution was added an ethanol solution (5 mL) of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-nitrophenyl) propanoate (349 mg), and 80 It stirred at 1.5 degreeC. Insoluble matter was removed by Celite filtration, and the filtrate was distilled off under reduced pressure. Distilled water and ethyl acetate were added to the obtained residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, and the solvent was distilled off under reduced pressure to obtain 327 mg of the brown oily title compound.

MS (ESI m / z): 337.0 (M + H)

RT (min): 1.20

(3) Synthesis of tert-Butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-amino-3-bromophenyl) propanoate

N-bromosuccinimide (10 mL) in DMF solution (10 mL) of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-aminophenyl) propanoate (300 mg) 173 mg of NBS) was added, and it stirred at room temperature for 1 hour. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 15/85 → 20/80) to obtain the title compound (280 mg) as a clear liquid.

MS (ESI m / z): 416.9 (M + H)

RT (min): 1.72

(4) tert-butyl (S, E) -3- (3-bromo-4-((4-chloro-5H-1,2,3-dithiazol-5-ylidene) amino) phenyl)- Synthesis of 2-((tert-butoxycarbonyl) amino) propanoate

To a dichloromethane solution (10 mL) of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-amino-3-bromophenyl) propanoate (280 mg) 170 mg of Appel's salt (4,5-Dichloro-1,2,3-dithiazolium chloride) was added, and it stirred at room temperature for 3.5 hours. 110 microliters of pyridine (Py) was added to this solution, and it stirred at room temperature for 1 hour further. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 10/90 → 15/85) to give 280 mg of the title compound as a yellow oil.

MS (ESI m / z): 551.7 (M + H)

RT (min): 2.09

(5) Synthesis of tert-Butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanobenzo [d] thiazol-6-yl) propanoate

tert-butyl (S, E) -3- (3-bromo-4-((4-chloro-5H-1,2,3-dithiazol-5-ylidene) amino) phenyl) -2- ( To a pyridine solution (5 mL) of (tert-butoxycarbonyl) amino) propanoate (280 mg) was added 110 mg of copper iodide (I), followed by microwave irradiation (InitiatorTM, 100 ° C., 1.0 hour, 2.45 GHz, 0-240W). Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 15/85) to obtain 159 mg of the pale yellow oily title compound.

MS (ESI m / z): 403.9 (M + H)

RT (min): 1.82

Synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-6-methoxybenzo [d] thiazol-5-yl) propanoate

[Formula 30]

(1) Synthesis of tert-Butyl (S) -3- (5-amino-4-bromo-2-methoxyphenyl) -2-((tert-butoxycarbonyl) amino) propanoate

The synthesis was carried out in the same manner as in the synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-amino-3-bromophenyl) propanoate.

MS (ESI m / z): 446.0 (M + H)

RT (min): 1.73

(2) tert-butyl (S, Z) -3- (4-bromo-5-((4-chloro-5H-1,2,3-dithiazol-5-ylidene) amino) -2- Synthesis of Methoxyphenyl) -2-((tert-butoxycarbonyl) amino) propanoate

tert-butyl (S, E) -3- (3-bromo-4-((4-chloro-5H-1,2,3-dithiazol-5-ylidene) amino) phenyl) -2- ( It carried out similarly to the synthesis | combination of (tert-butoxycarbonyl) amino) propanoate.

MS (ESI m / z): 581.8 (M + H)

RT (min): 2.13

(3) tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-6-methoxybenzo [d] thiazol-5-yl) propanoate Synthesis of

The synthesis was carried out in the same manner as in the synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanobenzo [d] thiazol-6-yl) propanoate.

MS (ESI m / z): 434.0 (M + H)

RT (min): 1.84

Synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1-methyl-1H-indol-5-yl) propanoate

[Formula 31]

179 mg of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1H-indol-5-yl) propanoate 5 mL DMF, potassium carbonate (180 mg) And methane sulfonate (MeOMs) (50 microliters) was added, and it stirred at room temperature for 3 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 20/80) to obtain a colorless oily title compound (163 mg).

MS (ESI m / z): 400.1 (M + H)

RT (min): 1.85

tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1-methyl-1H-benzo [d] imidazol-6-yl) propanoate and tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1-methyl-1H-benzo [d] imidazol-5-yl) propanoate Synthesis of the mixture

[Formula 32]

(1) Synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (3,4-diaminophenyl) propanoate

10 mL of ethanol and 10 mL of distilled water were added to 110 mg of reduced iron and 210 mg of ammonium chloride, and it heated and refluxed for 20 minutes. Then ethanol solution (5 mL) of 150 mg tert-butyl (S) -3- (4-amino-3-nitrophenyl) -2-((tert-butoxycarbonyl) amino) propanoate was added , And refluxed for 2 hours. The reaction solution was cooled to room temperature, filtered through celite, and the resulting filtrate was distilled off under reduced pressure. Distilled water and ethyl acetate were added to the obtained residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with saturated brine, dried over magnesium sulfate, the solvent was distilled off under reduced pressure, and purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 30/70 → 60/40). This gave 81.2 mg of the title compound as a brown oil.

MS (ESI m / z): 352.1 (M + H)

RT (min): 1.10

(2) Synthesis of tert-Butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1H-benzo [d] imidazol-6-yl) propanoate

To 81 mg of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (3,4-diaminophenyl) propanoate, 5 mL of pyridine and 58 mg of Appel's salt are added, and at room temperature 30 After stirring for a while, microwave was irradiated (InitiatorTM, 150 degreeC, 30 minutes, 2.45 GHz, 0-240 W). The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 30/70 to 60/40) to give 25.2 mg of a brown oily title compound.

MS (ESI m / z): 387.1 (M + H)

RT (min): 1.51

(3) tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1-methyl-1H-benzo [d] imidazol-6-yl) pro Phanoate and tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1-methyl-1H-benzo [d] imidazol-5-yl) pro Synthesis of Mixtures of Panoates

Similarly to the synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1-methyl-1H-indol-5-yl) propanoate did.

The process proceeded with the positional isomer mixture.

MS (ESI m / z): 401.1 (M + H)

RT (min): 1.62

Synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanobenzo [d] oxazol-6-yl) propanoate

[Formula 33]

(1) Synthesis of tert-Butyl (S) -3- (4-amino-3-hydroxyphenyl) -2-((tert-butoxycarbonyl) amino) propanoate

It carried out similarly to the synthesis | combination of tert- butyl (S) -2-((tert- butoxycarbonyl) amino) -3- (3, 4- diaminophenyl) propanoate.

MS (ESI m / z): 353.3 (M + H)

RT (min): 1.11

(2) tert-butyl (S, Z) -2-((tert-butoxycarbonyl) amino) -3- (4-((4-chloro-5H-1,2,3-dithiazol-5 Synthesis of -ylidene) amino) -3-hydroxyphenyl) propanoate

tert-butyl (S, E) -3- (3-bromo-4-((4-chloro-5H-1,2,3-dithiazol-5-ylidene) amino) phenyl) -2- ( It carried out similarly to the synthesis | combination of (tert-butoxycarbonyl) amino) propanoate.

MS (ESI m / z): 488.3 (M + H)

RT (min): 1.97

(3) Synthesis of tert-Butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanobenzo [d] oxazol-6-yl) propanoate

tert-butyl (S, Z) -2-((tert-butoxycarbonyl) amino) -3- (4-((4-chloro-5H-1,2,3-dithiazol-5-ylidene To 51 mg of) amino) -3-hydroxyphenyl) propanoate were added 4 mL of toluene and 0.5 mL of pyridine, and microwaves were irradiated (InitiatorTM, 150 ° C, 30 minutes, 2.45 GHz, 0-240 W). The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 5/95 to 10/90) to give 22.2 mg of the title compound as a yellow oil.

MS (ESI m / z): 388.1 (M + H)

RT (min): 1.18

tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (6-cyano-1-methyl-1H-benzo [d] imidazol-2-yl) propanoate and tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (5-cyano-1-methyl-1H-benzo [d] imidazol-2-yl) propanoate Synthesis of the mixture

[Formula 34]

(1) Synthesis of tert-Butyl N ^4- (2-amino-5-cyanophenyl) -N ^2- (tert-butoxycarbonyl) -L-asparazinate

To 300 mg of (S) -4- (tert-butoxy) -3-((tert-butoxycarbonyl) amino) -4-oxobutanoic acid was added 5 mL of DMF and 120 μL of N-methylmorpholine. 135 µL of chloroform acid isobutyl was added under an ice bath, followed by stirring for 30 minutes. Thereafter, 138 mg of 3,4-diaminobenzonitrile was added and stirred at room temperature for 18 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 50/50) to obtain 321 mg of the brown oily title compound.

MS (ESI m / z): 405.1 (M + H)

RT (min): 1.39

(2) Synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (6-cyano-1H-benzo [d] imidazol-2-yl) propanoate

5 mL of acetic acid (AcOH) is added to 321 mg of tert-butyl N ^4- (2-amino-5-cyanophenyl) -N ^2- (tert-butoxycarbonyl) -L-asparazineate, and 24 at 60 ° C. It stirred for hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 35/65) to obtain 321 mg of the title compound as a red oil.

MS (ESI m / z): 387.1 (M + H)

RT (min): 1.36

(3) tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (6-cyano-1-methyl-1H-benzo [d] imidazol-2-yl) prop Phanoate and tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (5-cyano-1-methyl-1H-benzo [d] imidazol-2-yl) pro Synthesis of Mixtures of Panoates

Similarly to the synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1-methyl-1H-indol-5-yl) propanoate did. The brown oily title compound was obtained.

The process proceeded to the next step with a mixture of positional isomers.

MS (ESI m / z): 401.1 (M + H)

RT (min): 1.49

Synthesis of cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate

[Formula 35]

To a dichloromethane solution (1 mL) of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate (90 mg) 5 mL of trifluoroacetic acid (TFA) was added, and it stirred at room temperature for 4 hours. The solvent was distilled off, 80 mL of 5 mL of N, N- diisopropylethylamine (DIEA), and di-tert- butyl dicarbonate (Boc ₂ O) were added to DMF, and it stirred at room temperature for 2 hours. After confirming disappearance of the raw materials, 30 µL of bromoacetonitrile was added, and further stirred at room temperature for 5 hours. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 20/80 to 40/60) to obtain 20.4 mg of the title compound as a white amorphous state.

¹ H-NMR (CDCl ₃ ) δ: 8.29 (1H, d, J = 8.6 Hz), 8.15 (1H, d, J = 8.6 Hz), 7.77-7.63 (3H, m), 5.04-4.93 (1H, m ), 4.89-4.64 (3H, m), 3.47-3.21 (2H, m), 1.41 (9H, s).

MS (ESI m / z): 381.1 (M + H)

RT (min): 1.41

The synthesis | combination of the compound shown in following Table 3 is the synthesis | combination of cyanomethyl (S) -2-((tert- butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate The same was done.

Table 3-1

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

Table 3-7

Table 3-8

Table 3-9

Synthesis of Cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanophenyl) propanoate

[Formula 36]

0.9 mL of N, N'-diisopropylethylamine and bromoacetonitrile in a DMF solution (10 mL) of 0.5 g of Boc-4-cyano-L-phenylalanine (Boc-Phe (4-CN) -OH) 0.18 mL was added and stirred at room temperature for 2 hours. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 40/60) to give 599 mg of a white solid.

¹ H-NMR (CDCl ₃ ) δ: 7.63 (2H, d, J = 7.9 Hz), 7.30 (2H, d, J = 7.9 Hz), 4.99-4.89 (1H, m), 4.89-4.61 (3H, m ), 3.24 (1H, doublet of doublets, J = 13.9, 5.9 Hz), 3.13-3.08 (1H, m), 1.42 (9H, s).

MS (ESI m / z): 330.0 (M + H)

RT (min): 1.39

Synthesis of Cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3-cyanopropanoate

[Formula 37]

It carried out similarly to the synthesis | combination of cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanophenyl) propanoate.

TABLE 4

Synthesis of tert-butyl (tert-butoxycarbonyl) -L-asparazinate

[Formula 38]

815 µL of triethylamine and 1.34 mL of di-tert-butyl dicarbonate (Boc ₂ O) were added to an ethyl acetate solution (20 mL) of 1.0 g of L-asparagine-t-butyl ester, and the mixture was stirred at room temperature for 15 hours. The organic layer was washed with distilled water and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure to obtain 1.41 g of the title compound as a white solid.

MS (ESI m / z): 289.0

RT (min): 1.10

Synthesis of (S) -4-amino-2-((tert-butoxycarbonyl) amino) -4-thioxobutanoic acid tert-butyl

[Formula 39]

To 20 mL of a THF solution of tert-butyl (tert-butoxycarbonyl) -L-asparazineate (1.41 g), Laweson reagent (2,4-bis (4-methoxyphenyl) -1,3-dicy 1.03 g of a-2,4-diphosphane 2,4-disulfide) was added, and it stirred at room temperature for 3 hours. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 30/70 → 40/60) to obtain 1.39 g of the title compound as a white solid.

MS (ESI m / z): 305.0

RT (min): 1.31

Synthesis of (S) -2- (3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl) thiazole-4-carboxylic acid ethyl

[Formula 40]

1.1 mL of pyridine and bromopyruvic acid in an ethanol solution (20 mL) of (S) -4-amino-2-((tert-butoxycarbonyl) amino) -4-thioxobutanoic acid tert-butyl (1.39 g) 635 µL of ethyl was added and heated to reflux for 3.5 hours. 310 microliters of bromopyruvic acid was further added, and it heated and refluxed for 2 hours. The solvent was distilled off under reduced pressure, distilled water and ethyl acetate were added to the residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 20/80) to obtain the title compound (680 mg) as a brown oil.

MS (ESI m / z): 401.0

RT (min): 1.62

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl

[Formula 41]

Methanol solution (5 mL) of (S) -2- (3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl) thiazole-4-carboxylic acid ethyl (680 mg) 6.5 mL of 25% ammonia water was added to the reaction vessel, and the mixture was stirred at room temperature for 24 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 30/70 → 40/60 → 80/20) to give 473 mg of the title compound as a transparent oil.

MS (ESI m / z): 372.0

RT (min): 1.30

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid tert-butyl

[Formula 42]

To dichloromethane solution (5 mL) of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl (312 mg) 240 microliters of triethylamines were added. 130 microliters of trifluoroacetic anhydrides were dripped on the ice bath, and it stirred at room temperature for 14 hours. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 10/90 to 20/80) to give 193 mg of the title compound as a transparent oil.

MS (ESI m / z): 354.0

RT (min): 1.58

Synthesis of 4-bromo-1-methyl-1H-pyrrole-2-carbonitrile

[Formula 43]

1.02 g of NBS was added to the DMF solution (5 mL) of 1-methyl-1H-pyrrole-2-carbonitrile, and stirred for 5 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and purified by (silica gel, ethyl acetate / hexane = 0/100 → 5/95) to obtain 405 mg of the title compound as a white solid.

MS (ESI m / z): 186.0 (M + H)

RT (min): 1.26

Synthesis of Methyl (4-bromobenzoyl) -L-serinate

[Formula 44]

20 mL of dichloromethane and 1.51 mL of triethylamine were added to 0.84 g of methyl-L-serinate hydrochloride. 1.19 g of 4-bromobenzoyl chlorides were dripped under the ice bath. After dripping, it stirred at room temperature for 2 hours. The solvent was distilled off under reduced pressure, distilled water and ethyl acetate were added to the residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 50/50 to 100/0) to obtain 1.49 g of a colorless oily title compound.

MS (ESI m / z): 303.8 (M + H)

RT (min): 0.98

Synthesis of 2- (4-bromophenyl) oxazole-4-carboxylic acid methyl

[Formula 45]

THF 15 mL and Burgess reagent (methyl N- (triethylammoniosulfonyl) carbamic acid) 1.41g were added to methyl (4-bromobenzoyl) -L-serinate, and it stirred at 80 degreeC for 2 hours. Then, the solvent was distilled off under reduced pressure, distilled water and ethyl acetate were added to the residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, 15 mL of dichloromethane, 1.51 mL of bromotrichloromethane, and 2.29 mL of diazabicycloundecene were added, followed by stirring at room temperature for 2 hours. The solvent was distilled off under reduced pressure, ethyl acetate was added to the residue, and extraction was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 10/90 → 30/70) to give 775 mg of the title compound as a white solid.

MS (ESI m / z): 283.8 (M + H)

RT (min): 1.45

Synthesis of 1- (4-nitrophenyl) -1H-imidazole-4-carboxylic acid ethyl

[Formula 46]

1.3 g of 1-fluoro-4-nitrobenzene and 1.5 g of potassium carbonate were added to a solution of 15 g of acetonitrile of 1.2 g of 1H-imidazole-4-carboxylic acid ethyl, and stirred at 60 ° C for 17 hours. Distilled water and ethyl acetate were added to the residue, and an extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, 5 mL of ethyl acetate and 30 mL of hexane were added thereto, and the solid was filtered off. The obtained solid was washed with hexane to give 977 mg of the title compound as a white solid.

MS (ESI m / z): 262.9 (M + H)

RT (min): 1.10

Synthesis of 1- (4-aminophenyl) -1H-imidazole-4-carboxylic acid ethyl

[Formula 47]

18 mL of ethanol and 2 mL of distilled water were added to 1.05 g of reduced iron and 200 mg of ammonium chloride, and heated to reflux for 20 minutes. Thereafter, 970 mg of 1- (4-nitrophenyl) -1H-imidazole-4-carboxylic acid ethyl was added and heated to reflux for 1 hour. The reaction solution was cooled to room temperature, filtered through celite, and the resulting filtrate was distilled off under reduced pressure. Purified by column chromatography (silica gel, ethyl acetate / methanol = 100/0 → 95/5) to give 819 mg of the title compound as a yellow oil.

MS (ESI m / z): 232.0 (M + H)

RT (min): 0.72

Synthesis of 1- (4-bromophenyl) -1H-imidazole-4-carboxylic acid ethyl

[Formula 48]

To 819 mg of ethyl 1- (4-aminophenyl) -1H-imidazole-4-carboxylic acid, 10 mL of acetonitrile and 875 mg of brominated copper were added. 1.1 mL of nitrous acid t-butyl was dripped at this solution at room temperature, and it stirred at room temperature after dripping for 4 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, 5 mL of ethyl acetate and 30 mL of hexane were added thereto, and the solid was filtered off. The obtained solid was washed with hexane to give 746 mg of the title compound as a yellow solid.

MS (ESI m / z): 296.8 (M + H)

RT (min): 1.29

Synthesis of 6-bromoimidazo [1,2-a] pyrimidine-2-carboxylic acid ethyl

[Formula 49]

To 2.0 g of 2-amino-5-bromopyrimidine, 30 mL of ethanol and 2.9 mL of 3-bromopyruvate were added, followed by heating to reflux for 6 hours. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 15/85 → 30/70) to give 804 mg of the title compound as a yellow solid.

MS (ESI m / z): 271.9 (M + H)

RT (min): 1.06

Synthesis of 6-bromoimidazo [1,2-a] pyrazine-2-carboxylic acid ethyl

[Formula 50]

It carried out similarly to the synthesis | combination of 6-bromoimidazo [1,2-a] pyrimidine-2-carboxylic acid ethyl.

MS (ESI m / z): 271.9 (M + H)

RT (min): 0.92

Synthesis of 6-bromoimidazo [1,2-b] pyridazine-2-carboxylic acid ethyl

[Formula 51]

It carried out similarly to the synthesis | combination of 6-bromoimidazo [1,2-a] pyrimidine-2-carboxylic acid ethyl.

MS (ESI m / z): 271.9 (M + H)

RT (min): 1.09

Synthesis of 5-bromo-1-methyl-1H-indazole-3-carbonitrile

[Formula 52]

Similarly to the synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1-methyl-1H-indol-5-yl) propanoate did.

MS (ESI m / z): 237.9 (M + H)

RT (min): 1.48

Synthesis of 4-bromo-1-methyl-1H-pyrazole-3-carbonitrile

[Formula 53]

Similarly to the synthesis of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyano-1-methyl-1H-indol-5-yl) propanoate did.

MS (ESI m / z): 187.0 (M + H)

RT (min): 1.10

Synthesis of 6- (3-bromophenyl) pyrazolo [1,5-a] pyrimidine-2-carboxylic acid ethyl

[Formula 54]

To 600 mg of 6-bromopyrazolo [1,5-a] pyrimidine-2-carboxylic acid, 495 mg of (3-bromophenyl) boronic acid, 20 mL of THF, and 5.9 mL of an aqueous sodium carbonate solution (1.0 mol / L) were added. And nitrogen substitution were performed. 81.4 mg of tetrakis (triphenylphosphine) palladium (0) was added to this solution, and it stirred at 80 degreeC for 9 hours. The solvent was distilled off under reduced pressure, ethyl acetate was added to the residue, and extraction was performed with ethyl acetate. The organic layer was washed with distilled water and brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 10/90 → 30/70) to give 622 mg of the title compound as a yellow solid.

MS (ESI m / z): 347.8 (M + H)

RT (min): 1.57

Synthesis of 6- (3-bromophenyl) pyrazolo [1,5-a] pyrimidine-2-carboxamide

[Formula 55]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 318.9 (M + H)

RT (min): 1.17

Synthesis of 6- (3-bromophenyl) pyrazolo [1,5-a] pyrimidine-2-carbonitrile

[Formula 56]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 300.0 (M + H)

RT (min): 1.55

The synthesis | combination of the compound shown in following Table 5 uses tert-butyl (R) -2-((tert- butoxycarbonyl) amino) -3- iodopropanoate as a raw material, and tert-butyl (S ) -2-((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3-yl) propanoate .

Table 5-1

Table 5-2

The synthesis | combination of the compound shown in following Table 6 is synthesis of cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate The same was done.

Table 6-1

Table 6-2

Table 6-3

Synthesis of 6- (2-bromoacetyl) picolinate ethyl

[Formula 57]

3.1 mL of hydrogen bromide (30% acetic acid solution) was added to 990 mg of 6-acetylpicolinate ethyl. Then, 300 microliters of bromine was dripped, and it stirred at room temperature for 9 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 20/80) to obtain 1.49 g of a colorless oily title compound.

MS (ESI m / z): 273.8 (M + H)

RT (min): 1.29

Synthesis of 2- (2-bromoacetyl) thiazole-4-carboxylic acid methyl

[Formula 58]

It carried out similarly to the synthesis | combination of ethyl 6- (2-bromoacetyl) picolinate.

MS (ESI m / z): 265.8 (M + H)

RT (min): 1.08

Synthesis of 2- (2-bromoacetyl) nicotinate ethyl

[Formula 59]

It carried out similarly to the synthesis | combination of ethyl 6- (2-bromoacetyl) picolinate.

MS (ESI m / z): 273.9 (M + H)

RT (min): 1.24

Synthesis of 6-acetylnicotinate

[Formula 60]

20 mL of toluene was added to 1.5 g of methyl 6-chloronicotinates, and nitrogen substitution was performed. 3.65 mL of tributyl (1-ethoxyvinyl) tin and 308 mg of dichlorobis (triphenylphosphine) palladium (II) were added to this solution, and it stirred at 105 degreeC for 5 hours and 40 minutes in nitrogen atmosphere. The solvent was distilled off under reduced pressure, 10 mL of methanol and 5 mL of concentrated hydrochloric acid were added, and the mixture was stirred at room temperature for 16 hours. The solvent was distilled off under reduced pressure, 5 mL of distilled water was added to the residue, and the neutralization treatment was performed with a saturated aqueous sodium hydrogen carbonate solution. Ethyl acetate was added, and extraction operation was performed with ethyl acetate. The organic layer was washed with saturated brine and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 40/60) to obtain 927 mg of the title compound as a white solid.

MS (ESI m / z): 180.0 (M + H)

RT (min): 0.97

Synthesis of 6- (2-bromoacetyl) nicotinate methyl

[Formula 61]

It carried out similarly to the synthesis | combination of ethyl 6- (2-bromoacetyl) picolinate.

MS (ESI m / z): 259.0 (M + H)

RT (min): 1.26

Synthesis of 6-acetylpyrazolo [1,5-a] pyrimidine-2-carboxylic acid ethyl

[Formula 62]

It carried out similarly to the synthesis | combination of methyl 6-acetylnicotinate.

MS (ESI m / z): 234.0 (M + H)

RT (min): 0.95

Synthesis of 6- (2-bromoacetyl) pyrazolo [1,5-a] pyrimidine-2-carboxylic acid ethyl

[Formula 63]

It carried out similarly to the synthesis | combination of ethyl 6- (2-bromoacetyl) picolinate.

MS (ESI m / z): 313.9 (M + H)

RT (min): 1.13

Synthesis of 3-bromo-2,2-dimethoxypropanoic acid

[Formula 64]

10 mL of ortho formic acid trimethyl and 400 µL of sulfuric acid were added to 5.0 g of 3-bromopyruvic acid, and the mixture was stirred at room temperature for 9 hours. Dichloromethane 100mL was added to the reaction solution, and it wash | cleaned with 100mL of 10% hydrochloric acid aqueous solution. Ethyl acetate was added to the aqueous layer, and extraction operation was performed with ethyl acetate. The organic layer was washed with saturated brine and dried over magnesium sulfate. The solvent was distilled off under reduced pressure to obtain 3.43 g of the title compound as a white solid.

¹ H-NMR (CDCl ₃ ) δ: 3.62 (2H, s), 3.38 (6H, s).

Synthesis of Methyl O-benzyl-N- (3-bromo-2,2-dimethoxypropanoyl) -L-serinate

[Formula 65]

To 3.43 g of 3-bromo-2,2-dimethoxypropanoic acid, 50 mL of dichloromethane, 17 mL of diisopropylethylamine, HATU (1- [bis (dimethylamino) methylene] -1H-1,2, 7.35 g of 3-triazolo [4,5-b] pyridinium 3-oxide hexafluoro phosphate) and 4.35 g of O-methyl O-benzyl-L-serinate hydrochloride were added and stirred at room temperature for 7 hours. The solvent was distilled off under reduced pressure, an aqueous hydrochloric acid solution (1 mol / L) and ethyl acetate were added to the residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with aqueous hydrochloric acid solution (1 mol / L), saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 40/60) to obtain 5.77 g of a colorless oily title compound.

MS (ESI m / z): 405.9 (M + H)

RT (min): 1.46

Synthesis of Methyl (3-bromo-2,2-dimethoxypropaneyl) -L-serinate

[Formula 66]

To 5.77 g of methyl O-benzyl-N- (3-bromo-2,2-dimethoxypropaneoyl) -L-serinate, 30 mL of methanol was added, and a hydro-hydrogenation apparatus (H-Cube (ThalesNano)) Reaction was performed (10% palladium hydroxide / carbon, 40 bar, 60 ° C., 2.0 mL / mL). After the reaction, the solvent was distilled off under reduced pressure to obtain 4.41 g of a yellow oily title compound.

MS (ESI m / z): 315.9 (M + H)

RT (min): 0.75

Synthesis of 2- (2-bromo-1,1-dimethoxyethyl) oxazole-4-carboxylic acid methyl

[Formula 67]

50 mL of dichloromethane was added to 4.41 g of methyl (3-bromo-2,2-dimethoxypropane oil) -L-serinate and cooled to -78 ° C. 2.05 mL of (diethylamino) sulfur trifluoride was added dropwise to the solution, and the mixture was stirred at -78 ° C for 1 hour. Then, 3.75 g of potassium carbonate was added, and it stirred at -78 degree | times for 1 hour and room temperature for 2 hours. The insoluble matter was filtered off, and the filtrate was distilled off under reduced pressure, and 50 mL of dichloromethane and 4.2 mL of diazabicycloundecene were added. 3.72 mL of bromo trichloromethane was dripped on the ice bath, and it stirred at room temperature for 4 hours and 30 minutes after dripping. The solvent was distilled off under reduced pressure, distilled water and ethyl acetate were added to the residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with aqueous hydrochloric acid solution (1 mol / L), saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 12/88 → 100/0) to obtain 2.57 g of the title compound as a yellow oil.

MS (ESI m / z): 295.9 (M + H)

RT (min): 1.05

Synthesis of 2- (2-bromoacetyl) oxazole-4-carboxylic acid methyl

[Formula 68]

Formic acid 15mL was added to 2.57 g of 2- (2-bromo-1,1-dimethoxyethyl) oxazole-4-carboxylic acid methyl, and it stirred at 60 degreeC for 3 hours and 30 minutes. Saturated sodium hydrogen carbonate aqueous solution was added to the reaction solution, and extraction operation was performed with ethyl acetate. The organic layer was washed with saturated brine and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 20/80 to 40/60) to obtain 1.46 g of the title compound as a white solid.

MS (ESI m / z): 249.9 (M + H)

RT (min): 0.93

Synthesis of Methyl N- (2- (benzyloxy) propanoyl) -O- (tert-butyl) -L-allothrooninate

[Formula 69]

It carried out similarly to the synthesis | combination of methyl O-benzyl-N- (3-bromo-2,2-dimethoxypropaneoyl) -L-serinate.

MS (ESI m / z): 352.2 (M + H)

RT (min): 1.66

Synthesis of Methyl (2- (benzyloxy) propaneyl) -L-allothroonate

[Formula 70]

10 mL of TFA was added to 3.91 g of methyl N- (2- (benzyloxy) propaneyl) -O- (tert-butyl) -L-allothrooninate, and it stirred at room temperature for 2 hours. The solvent was distilled off under reduced pressure, saturated aqueous sodium hydrogen carbonate solution and ethyl acetate were added to the residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 50/50 to 100/0) to obtain 2.30 g of a colorless oily title compound.

MS (ESI m / z): 296.1 (M + H)

RT (min): 1.06

Synthesis of (2S) -2- (2- (benzyloxy) propaneamide) -3-oxobutanoic acid methyl

[Formula 71]

15 mL of dichloromethane was added to 2.30 g of methyl (2- (benzyloxy) propaneyl) -L-allothroonate. 4.29 g of des-Martin periodinan was added on an ice bath, and it stirred at room temperature for 1 hour. After filtering off the insoluble matter, the solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 20/80 → 40/60) to give the title compound as a colorless oil. 2.18 g was obtained.

MS (ESI m / z): 294.1 (M + H)

RT (min): 1.26

Synthesis of 2- (1- (benzyloxy) ethyl) -5-methyloxazole-4-carboxylic acid methyl (DL01721-040)

[Formula 72]

20 mL of dichloromethane and 4.14 mL of triethylamine were added to 2.18 g of (2S) -2- (2- (benzyloxy) propaneamide) -3-oxobutanoic acid. Triphenylphosphine 3.9g and 3.77g of iodine were added on an ice bath, and it stirred at room temperature for 3 hours. The solvent was distilled off under reduced pressure, distilled water and ethyl acetate were added to the residue, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water, aqueous sodium thiosulfate solution (10%) and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 10/90 to 20/80) to obtain 1.55 g of the title compound as a yellow oil.

MS (ESI m / z): 276.1 (M + H)

RT (min): 1.42

Synthesis of 2- (1- (benzyloxy) ethyl) -5-methyloxazole-4-carboxamide

[Formula 73]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 261.1 (M + H)

RT (min): 1.21

Synthesis of 2- (1- (benzyloxy) ethyl) -5-methyloxazole-4-carbothioamide

[Formula 74]

(S) -4-amino-2-((tert-butoxycarbonyl) amino) -4-thioxobutanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 277.1 (M + H)

RT (min): 1.49

Synthesis of 2- (2- (1- (benzyloxy) ethyl) -5-methyloxazol-4-yl) thiazole-4-carboxylic acid ethyl

[Formula 75]

10 mL of ethanol and 335 µL of ethyl bromopyruvate were added to 2- (1- (benzyloxy) ethyl) -5-methyloxazole-4-carbothioamide, and the mixture was heated to reflux for 2 hours. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 15/85) to obtain 650 mg of the brown oily title compound.

MS (ESI m / z): 373.1 (M + H)

RT (min): 1.79

Synthesis of 2- (2- (1-hydroxyethyl) -5-methyloxazol-4-yl) thiazole-4-carboxylic acid ethyl

[Formula 76]

5 mL of dichloromethane was added to 650 mg of 2- (2- (1- (benzyloxy) ethyl) -5-methyloxazol-4-yl) thiazole-4-carboxylic acid ethyl. 1.65 mL of dichloromethane solution (1 mol / L) of boron tribromide was dripped at -78 degreeC, and it stirred at -78 degreeC for 1 hour. Then, 1.65 mL of dichloromethane solutions (1 mol / L) of boron tribromide were further dripped, and it stirred at -78 degreeC for 1 hour. Distilled water was added on the ice bath, and the extraction operation was performed by dichloromethane. The organic layer was washed with saturated brine and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 25/75 to 50/50) to obtain 372 mg of the title compound as a pale yellow solid.

MS (ESI m / z): 283.0 (M + H)

RT (min): 1.09

Synthesis of 2- (2-acetyl-5-methyloxazol-4-yl) thiazole-4-carboxylic acid ethyl

[Formula 77]

It carried out similarly to the synthesis | combination of (2S) -2- (2- (benzyloxy) propaneamide) -3-oxobutanoic acid methyl.

MS (ESI m / z): 281.0 (M + H)

RT (min): 1.32

Synthesis of 2- (2- (2-bromoacetyl) -5-methyloxazol-4-yl) thiazole-4-carboxylic acid ethyl

[Formula 78]

It carried out similarly to the synthesis | combination of ethyl 6- (2-bromoacetyl) picolinate.

MS (ESI m / z): 360.9 (M + H)

RT (min): 1.50

Synthesis of 2- (1-hydroxyethyl) -5-methyloxazole-4-carboxylic acid methyl

[Formula 79]

It carried out similarly to the synthesis | combination of 2- (2- (1-hydroxyethyl) -5-methyloxazol-4-yl) thiazole-4-carboxylic acid ethyl.

MS (ESI m / z): 186.1 (M + H)

RT (min): 0.69

Synthesis of 2-acetyl-5-methyloxazole-4-carboxylic acid methyl

[Formula 80]

It carried out similarly to the synthesis | combination of (2S) -2- (2- (benzyloxy) propaneamide) -3-oxobutanoic acid methyl.

MS (ESI m / z): 184.1 (M + H)

RT (min): 0.81

Synthesis of 2- (2-bromoacetyl) -5-methyloxazole-4-carboxylic acid methyl

[Formula 81]

It carried out similarly to the synthesis | combination of ethyl 6- (2-bromoacetyl) picolinate.

MS (ESI m / z): 263.0 (M + H)

RT (min): 1.08

Synthesis of 6-chloropyridine-3-carbothioamide

[Formula 82]

(S) -4-amino-2-((tert-butoxycarbonyl) amino) -4-thioxobutanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 173.0 (M + H)

RT (min): 0.85

Synthesis of 2- (6-chloropyridin-3-yl) thiazole-4-carboxylic acid ethyl

[Formula 83]

It carried out similarly to the synthesis | combination of 2- (2- (1- (benzyloxy) ethyl) -5-methyloxazol-4-yl) thiazole-4-carboxylic acid ethyl.

MS (ESI m / z): 269.0 (M + H)

RT (min): 1.31

Synthesis of 2- (6-acetylpyridin-3-yl) thiazole-4-carboxylic acid ethyl

[Formula 84]

It carried out similarly to the synthesis | combination of methyl 6-acetylnicotinate.

MS (ESI m / z): 277.0 (M + H)

RT (min): 1.23

Synthesis of 2- (6- (2-bromoacetyl) pyridin-3-yl) thiazole-4-carboxylic acid ethyl

[Formula 85]

It carried out similarly to the synthesis | combination of ethyl 6- (2-bromoacetyl) picolinate.

MS (ESI m / z): 356.9 (M + H)

RT (min): 1.45

Synthesis of 6-chloropyridine-2-carbothioamide

[Formula 86]

(S) -4-amino-2-((tert-butoxycarbonyl) amino) -4-thioxobutanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 173.0 (M + H)

RT (min): 1.08

Synthesis of 2- (6-chloropyridin-2-yl) thiazole-4-carboxylic acid ethyl

[Formula 87]

It carried out similarly to the synthesis | combination of 2- (2- (1- (benzyloxy) ethyl) -5-methyloxazol-4-yl) thiazole-4-carboxylic acid ethyl.

MS (ESI m / z): 269.0 (M + H)

RT (min): 1.51

Synthesis of 2- (6-acetylpyridin-2-yl) thiazole-4-carboxylic acid ethyl

[Formula 88]

It carried out similarly to the synthesis | combination of methyl 6-acetylnicotinate.

MS (ESI m / z): 277.0 (M + H)

RT (min): 1.41

Synthesis of 2- (6- (2-bromoacetyl) pyridin-2-yl) thiazole-4-carboxylic acid ethyl

[Formula 89]

It carried out similarly to the synthesis | combination of ethyl 6- (2-bromoacetyl) picolinate.

MS (ESI m / z): 356.9 (M + H)

RT (min): 1.54

(S) -2 '-(3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl)-[2,4'-bithiazole] -4- Synthesis of Methyl Carboxylate

[Formula 90]

(S) -4-amino-2-((tert-butoxycarbonyl) amino) -4-thioxobutanoic acid tert-butyl 395mg 10mL, 2- (2-bromoacetyl) thiazole-4- 342 mg of methyl carboxylic acid was added, and it heated and refluxed for 1 hour. The solvent was distilled off under reduced pressure, 10 mL of dimethylformamide, 1 mL of diisopropylethylamine, and 360 µL of Boc ₂ O were added, and the mixture was stirred at room temperature for 5 hours. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 20/80 to 40/60) to obtain 489 mg of the pale yellow oily title compound.

MS (ESI m / z): 470.0 (M + H)

RT (min): 1.66

The synthesis | combination of the compound shown in following Table 7 is (S) -2 '-(3- (tert-butoxy) -2-((tert- butoxycarbonyl) amino) -3-oxopropyl)-[2 It carried out similarly to the synthesis | combination of methyl, 4'- bithiazole] -4-carboxylic acid.

Table 7-1

Table 7-2

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamothioylthiazol-2-yl) propanoic acid tert-butyl

[Formula 91]

(S) -4-amino-2-((tert-butoxycarbonyl) amino) -4-thioxobutanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 388.0 (M + H)

RT (min): 1.52

The synthesis | combination of the compound shown in following Table 8 is (S) -2-((tert- butoxycarbonyl) amino) -3- (4-carbamo thiothiazol-2-yl) propanoic acid tert as a raw material. With -butyl, (S) -2 '-(3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl)-[2,4'-bi It carried out similarly to the synthesis | combination of thiazole] -4-carboxylic acid methyl.

TABLE 8

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoyl- [2,4'-bithiazol] -2'-yl) propanoic acid tert-butyl

[Formula 92]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 455.9 (M + H)

RT (min): 1.46

The synthesis | combination of the compound shown in following Table 9 is the synthesis | combination of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl Was carried out in the same manner.

Table 9-1

Table 9-2

Table 9-3

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2-cyanopyrazolo [1,5-a] pyrimidin-6-yl) thiazol-2-yl Synthesis of propanoic acid tert-butyl

[Formula 93]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 471.1 (M + H)

RT (min): 1.74

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2-cyanopyrazolo [1,5-a] pyrimidin-6-yl) thiazol-2-yl Synthesis of Cyanomethyl Propanoate

[Formula 94]

It carried out similarly to the synthesis of cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate.

MS (ESI m / z): 454.2 (M + H)

RT (min): 1.44

¹ H-NMR (CDCl ₃ ) δ: 9.21 (1H, s), 9.05 (1H, s), 7.63 (1H, s), 7.16 (1H, s), 5.59 (1H, d, J = 8.6 Hz), 4.97-4.68 (3H, m), 3.78-3.57 (2H, m), 1.46 (9H, s).

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamothioyl [2,4'-bithiazol] -2'-yl) propanoic acid tert-butyl

[Formula 95]

(S) -4-amino-2-((tert-butoxycarbonyl) amino) -4-thioxobutanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 471.1 (M + H)

RT (min): 1.68

(S) -2 '' '-(3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl)-[2,4': 2 ', 4' ': 2' ', 4' ''-quaterthiazole] -4-carboxylic acid methyl

[Formula 96]

(S) -2 '-(3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl)-[2,4'-bithiazole] -4- It carried out similarly to the synthesis | combination of methyl carboxylic acid.

MS (ESI m / z): 636.7 (M + H)

RT (min): 1.99

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (4-carbamothioyloxazol-2-yl) thiazol-2-yl) propanoic acid tert-butyl synthesis

[Formula 97]

(S) -4-amino-2-((tert-butoxycarbonyl) amino) -4-thioxobutanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 455.0 (M + H)

RT (min): 1.52

(S) -2- (2- (2- (3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl) thiazol-4-yl) oxazole Synthesis of -4-yl) thiazole-4-carboxylic acid ethyl

[Formula 98]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (4-carbamothioyloxazol-2-yl) thiazol-2-yl) propanoic acid tert-butyl 76 mg 10 mL of ethanol and 25 µL of ethyl bromopyruvate were added to the mixture, and the mixture was stirred for 4 hours under reflux. The solvent was distilled off under reduced pressure, 10 mL of THF, 40 µL of Boc ₂ O, and 1 mL of diisopropylethylamine were added, and the mixture was stirred at room temperature for 18 hours. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 20/80 to 40/60) to obtain 43.8 mg of the pale yellow oily title compound.

MS (ESI m / z): 551.0 (M + H)

RT (min): 1.75

(S) -2- (2- (2- (2- (3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl) thiazol-4-yl Synthesis of (oxazol-4-yl) thiazol-4-yl) oxazole-4-carboxylic acid methyl

[Formula 99]

(S) -2 '-(3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl)-[2,4'-bithiazole] -4- It carried out similarly to the synthesis | combination of methyl carboxylic acid.

MS (ESI m / z): 604.0 (M + H)

RT (min): 1.69

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (4- (4-carbamoylthiazol-2-yl) oxazol-2-yl) thiazol-2- (1) Synthesis of propanoic acid tert-butyl

[Formula 100]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 522.1 (M + H)

RT (min): 1.47

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoyl [2,4 ': 2', 4 '': 2 '', 4 '' '-quaterazole ] -2 '' '-yl) propanoic acid tert-butyl

[Formula 101]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 621.9 (M + H)

RT (min): 1.76

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (4- (4- (4-carbamoyloxazol-2-yl) thiazol-2-yl) oxazole Synthesis of -2-yl) thiazol-2-yl) propanoic acid tert-butyl

[Formula 102]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 589.0 (M + H)

RT (min): 1.49

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoyl [2,4'-bithiazol] -2'-yl) propanoic acid cyanomethyl

[Formula 103]

It carried out similarly to the synthesis of cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate.

MS (ESI m / z): 438.0 (M + H)

RT (min): 1.21

The synthesis | combination of the compound shown in following Table 10 is synthesis of cyanomethyl (S) -2-((tert- butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate Was carried out in the same manner.

Table 10-1

Table 10-2

Table 10-3

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyano [2,4'-bithiazol] -2'-yl) propanoic acid cyanomethyl

[Formula 104]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 420.0 (M + H)

RT (min): 1.51

¹ H-NMR (CDCl ₃ ) δ: 8.01 (1H, s), 7.99 (1H, s), 5.59-5.48 (1H, m), 4.93-4.75 (3H, m), 3.72-3.55 (2H, m) , 1.45 (9H, s).

The synthesis | combination of the compound shown in following Table 11 is the synthesis | combination of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid tert-butyl Was carried out in the same manner.

Table 11-1

Table 11-2

Table 11-3

Table 11-4

Table 11-5

Table 11-6

(S) -3- (4- (2-((((9H-fluoren-9-yl) methoxy) carbonyl) amino) acetamide) phenyl) -2-((tert-butoxycarbonyl) Synthesis of Amino) propanoic acid tert-butyl

[Formula 105]

To 100 mg of tert-butyl (S) -2-((tert-butoxycarbonyl) amino) -3- (4-aminophenyl) propanoate, 5 mL of DMF, ((((9H-fluoren-9-yl) meth) Methoxy) carbonyl) glycine 97.3 mg, diisopropylethylamine 100 μL, HATU (1- [bis (dimethylamino) methylene] -1H-1,2,3-triazolo [4,5-b] pyridinium 170 mg of 3-oxide hexafluoro phosphate) was added, and it stirred at room temperature for 2 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 30/70 → 60/40) to give 183 mg of the pale yellow oily title compound.

MS (ESI m / z): 616.0 (M + H)

RT (min): 1.91

The synthesis of the compound shown in Table 12 below is (S) -3- (4- (2-((((9H-fluoren-9-yl) methoxy) carbonyl) amino) acetamide) phenyl)- It carried out similarly to the synthesis | combination of 2-((tert-butoxycarbonyl) amino) propanoic acid tert-butyl.

TABLE 12

Synthesis of (S) -3- (4- (2-aminoacetamide) phenyl) -2-((tert-butoxycarbonyl) amino) propanoic acid tert-butyl

[Formula 106]

(S) -3- (4- (2-((((9H-fluoren-9-yl) methoxy) carbonyl) amino) acetamide) phenyl) -2-((tert-butoxycarbonyl) Dichloromethane 6mL and piperidine 1.2mL were added to 183 mg of amino) propanoic acid tert-butyl, and it stirred at room temperature for 1 hour 30 minutes. The solvent was distilled off under reduced pressure, purified by column chromatography (NH silica gel, methanol / ethyl acetate / hexane / = 0/50/50 → 0/100/0 → 20/80/0) to obtain a pale yellow oily phase. 117 mg of the title compound were obtained.

MS (ESI m / z): 394.0 (M + H)

RT (min): 1.08

The synthesis | combination of the compound shown in following Table 13 is synthesis of (S) -3- (4- (2-aminoacetamide) phenyl) -2-((tert-butoxycarbonyl) amino) propanoic acid tert-butyl The same was done.

TABLE 13

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (5-cyanothiophen-2-carboxamide) acetamide) phenyl) propanoic acid tert-butyl Synthesis of

[Formula 107]

To 117 mg of (S) -3- (4- (2-aminoacetamide) phenyl) -2-((tert-butoxycarbonyl) amino) propanoic acid tert-butyl 5 mL of DMF, 300 μL of diisopropylethylamine, 5 -Cyanothiophene-2-carboxylic acid 50 mg, HATU (1- [bis (dimethylamino) methylene] -1H-1,2,3-triazolo [4,5-b] pyridinium 3-oxide hexafluor Phosphate) 170 mg was added, and it stirred at room temperature for 12 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 30/70 to 60/40) to obtain 120 mg of a pale yellow oily title compound.

MS (ESI m / z): 529.2 (M + H)

RT (min): 1.58

The synthesis | combination of the compound shown in following Table 14 is (S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (5-cyanothiophene-2-carboxamide) (Acetamide) phenyl) propanoic acid tert-butyl in the same manner as in the synthesis.

TABLE 14

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (5-cyanothiophen-2-carboxamide) acetamide) phenyl) cyanomethyl propanoic acid Synthesis of

[Formula 108]

It carried out similarly to the synthesis of cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate.

MS (ESI m / z): 512.2 (M + H)

RT (min): 1.34

¹ H-NMR (DMSO-D ₆ ) δ: 10.10 (1H, s), 9.39-9.29 (1H, m), 8.02 (1H, d, J = 4.0 Hz), 7.93 (1H, d, J = 4.0 Hz ), 7.54-7.44 (3H, m), 7.18 (2H, d, J = 8.6 Hz), 5.00 (2H, s), 4.27-4.15 (1H, m), 4.15-4.02 (2H, m), 3.02- 2.78 (2H, m), 1.33 (9H, s).

The synthesis | combination of the compound shown in following Table 15 is (S) -2-((tert- butoxycarbonyl) amino) -3- (4- (2- (5-cyanothiophene-2-carboxamide) In the same manner as in the synthesis of acetamide) phenyl) propanoic acid cyanomethyl.

TABLE 15

Synthesis of 5-cyano-N- (2- (2- (2-hydroxyethoxy) ethoxy) ethyl) thiophene-2-carboxamide

[Formula 109]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (5-cyanothiophen-2-carboxamide) acetamide) phenyl) propanoic acid tert-butyl The synthesis was carried out in the same manner.

MS (ESI m / z): 285.0 (M + H)

RT (min): 0.78

Synthesis of 5-cyano-N- (2- (2- (2- (2-hydroxyethoxy) ethoxy) ethoxy) ethyl) thiophen-2-carboxamide

[Formula 110]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (5-cyanothiophen-2-carboxamide) acetamide) phenyl) propanoic acid tert-butyl The synthesis was carried out in the same manner.

MS (ESI m / z): 329.0 (M + H)

RT (min): 0.82

Synthesis of 5-cyano-N- (12-hydroxydodecyl) thiophene-2-carboxamide

[Formula 111]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (5-cyanothiophen-2-carboxamide) acetamide) phenyl) propanoic acid tert-butyl The synthesis was carried out in the same manner.

MS (ESI m / z): 337.1 (M + H)

RT (min): 1.54

Synthesis of 4-methylbenzenesulfonic acid 12- (5-cyanothiophene-2-carboxamide) dodecyl

[Formula 112]

380 µL of triethylamine was added to a chloroform solution (10 mL) of 230 mg of 5-cyano-N- (12-hydroxydodecyl) thiophen-2-carboxamide. 195 mg of paratoluene sulfonyl chloride was added on an ice bath, and it stirred for 2 hours under an ice bath. 380 µL of triethylamine and 195 mg of paratoluene sulfonyl chloride were further added, followed by stirring under an ice bath for 3 hours. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 5/95 → 15/85 → 30/70) to give 267 mg of the title compound as a yellow oil.

MS (ESI m / z): 491.2 (M + H)

RT (min): 2.01

Synthesis of 4-methylbenzenesulfonic acid 2- (2- (2- (2-hydroxyethoxy) ethoxy) ethoxy) ethyl

[Formula 113]

To 11 g of 2,2 '-((oxybis (ethane-2,1-diyl)) bis (oxy)) bis (ethan-1-ol), 5 mL of THF and an aqueous solution of sodium hydroxide 1.92 g (5 mL) were added. . On an ice bath, 4.32 g of THF solution (10 mL) of paratoluenesulfonyl chloride was added dropwise. After dripping, it stirred at room temperature for 2 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 50/50 to 100/0) to obtain 1.30 g of a colorless oily title compound.

MS (ESI m / z): 349.0 (M + H)

RT (min): 1.08

Synthesis of 5- (2- (2- (2- (2-hydroxyethoxy) ethoxy) ethoxy) ethoxy) picolinonitrile

[Formula 114]

231 mg of 4-methylbenzenesulfonic acid 2- (2- (2- (2-hydroxyethoxy) ethoxy) ethoxy) ethyl 10 ml of acetonitrile, cesium carbonate 371 mg, 5-hydroxy picolino nitrile 82 mg Was added, and it stirred at 60 degreeC for 5 hours and 90 degreeC for 3 hours. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (NH silica gel, ethyl acetate / hexane = 60/40 → 100/0) to obtain 116 mg of a colorless oily title compound.

MS (ESI m / z): 297.1 (M + H)

RT (min): 0.80

Synthesis of N- (2- (2- (2-bromoethoxy) ethoxy) ethyl) -5-cyanothiophene-2-carboxamide

[Formula 115]

Triphenylmethane solution (10 mL) of 5-cyano-N- (2- (2- (2-hydroxyethoxy) ethoxy) ethyl) thiophene-2-carboxamide 233 mg triphenyl on an ice bath 312 mg of phosphine and 396 mg of carbon tetrabromide were added. Then, it stirred at room temperature for 24 hours. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 35/65 → 70/30) to obtain 141 mg of a colorless oily title compound.

MS (ESI m / z): 348.9 (M + H)

RT (min): 1.14

The synthesis of the compound shown in Table 16 below was carried out in the same manner as the synthesis of N- (2- (2- (2-bromoethoxy) ethoxy) ethyl) -5-cyanothiophen-2-carboxamide did.

TABLE 16

Synthesis of tert-butyl (tert-butoxycarbonyl) -L-tyrosinate

[Formula 116]

50 mL of dichloromethane, 6.2 mL of triethylamine, and 6.1 mL of Boc ₂ O were added to 5.19 g of tert-butyl L-tyrosinate, and it stirred at room temperature for 1 hour 30 minutes. The solvent was distilled off under reduced pressure, an aqueous hydrochloric acid solution (1 mol / L) and ethyl acetate were added to the residue, and an extraction operation was performed with ethyl acetate. The organic layer was washed with aqueous hydrochloric acid solution (1 mol / L), saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 30/70) to give 6.52 g of a colorless oily title compound.

MS (ESI m / z): 338.1 (M + H)

RT (min): 1.51

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (2- (2- (5-cyanothiophen-2-carboxamide) ethoxy) Synthesis of Toxy) ethoxy) phenyl) propanoic acid tert-butyl

Formula 117

123 mg of tert-butyl (tert-butoxycarbonyl) -L-tyrosinate, 10 mL of DMF, 151 mg of potassium carbonate, N- (2- (2- (2-bromoethoxy) ethoxy) ethyl) -5- 141 mg of cyanothiophene-2-carboxamide was added, and it stirred at room temperature for 24 hours. Distilled water and ethyl acetate were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was washed with distilled water and saturated brine, and dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 30/70 to 60/40) to obtain 178 mg of a colorless oily title compound.

MS (ESI m / z): 604.1 (M + H)

RT (min): 1.72

The compound shown in following Table 17 is (S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (2- (2- (5-cyanothiophen-2) Carboxamide) ethoxy) ethoxy) ethoxy) phenyl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

TABLE 17

(S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (2- (2- (5-cyanothiophen-2-carboxamide) ethoxy) Synthesis of methoxy) ethoxy) phenyl) propanoic acid cyanomethyl

[Formula 118]

It carried out similarly to the synthesis of cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanoquinolin-6-yl) propanoate.

MS (ESI m / z): 587.0 (M + H)

RT (min): 1.47

¹ H-NMR: (CDCl ₃ ) δ: 7.46-7.42 (2H, m), 7.06 (2H, d, J = 8.6 Hz), 6.82 (2H, d, J = 8.6 Hz), 4.98-4.54 (4H, m), 4.13-4.08 (2H, m), 3.89-3.84 (2H, m), 3.76-3.61 (9H, m), 3.06 (2H, d, J = 5.9 Hz), 1.43 (9H, s).

The compound shown in following Table 18 is (S) -2-((tert-butoxycarbonyl) amino) -3- (4- (2- (2- (2- (5-cyanothiophen-2) Carboxamide) ethoxy) ethoxy) ethoxy) phenyl) propanoic acid cyanomethyl was carried out in the same manner as in the synthesis.

Table 18-1

Table 18-2

Synthesis of tert-butyl (R) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3-iodopropanoate

Formula 119

It carried out similarly to the synthesis | combination of tert- butyl (R) -2-((tert- butoxycarbonyl) amino) -3- iodopropanoate. In the present specification, Fmoc represents a 9-fluorenylmethyloxycarbonyl group.

MS (ESI m / z): 494.0 (M + H)

RT (min): 2.02

Synthesis of Allyl 2- (6-iodopyridin-2-yl) thiazole-4-carboxylate

(1) Synthesis of Allyl (R) -2- (6-iodopyridin-2-yl) -4,5-dihydrothiazole-4-carboxylate

[Formula 120]

To 2-cyano-6-bromopyridine (5.0 g), sodium iodide (12.3 g), trimethylsilyl chloride (TMSCl) (3.5 mL) and propionitrile (30 mL) were added and 2 at 90 ° C It stirred for hours. An aqueous sodium hydroxide solution and ethyl acetate were added to the reaction solution, and an extraction operation was performed. The organic layer was washed with an aqueous thiosulfate solution, dried over anhydrous magnesium sulfate, and the solvent was concentrated under reduced pressure. 3.63 g of L-cysteine, methanol (20 mL) and distilled water (10 mL) were added to the obtained residue, and it stirred at 80 degreeC for 3.5 hours. The solvent was distilled off under reduced pressure, a methanol / ethyl acetate mixed solvent was added to the obtained residue, and the solids were separated by filtration. THF (100 mL) and oxalyl chloride (2.4 mL) were added to the obtained solid, and the mixture was stirred for 45 minutes. Thereafter, allyl alcohol (3.4 mL) was added to the reaction solution, and the mixture was stirred for 4 hours. Saturated sodium hydrogen carbonate aqueous solution and ethyl acetate were added to the reaction solution, and the extraction operation was performed. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure to obtain the title compound (3.2 g) as a yellow solid.

MS (ESI m / z): 335.8 (M + H)

RT (min): 1.56

(2) Synthesis of Allyl 2- (6-iodopyridin-2-yl) thiazole-4-carboxylate

[Formula 121]

Allyl (R) -2- (6-iodopyridin-2-yl) -4,5-dihydrothiazole-4-carboxylate (0.5 g) to bromotrichloromethane (5 mL), diazabicyclo Undecene (DBU) (0.3 mL) was added and stirred at room temperature for 10 minutes. Aqueous citric acid solution and ethyl acetate were added to the reaction solution, and the extraction operation was performed. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure to obtain the title compound (0.31 g) as a white solid.

MS (ESI m / z): 372.4 (M + H)

RT (min): 1.67

Synthesis of tert-butyl (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3-yl) propanoate

[Formula 122]

Iodine (46 mg) was added to the DMF (2.6 mL) solution of zinc powder (2.4 g), and it stirred for 5 minutes at room temperature in nitrogen atmosphere. DMF (1.4 mL) of tert-butyl (R) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3-iodopropanoate (600 mg) to the reaction mixture The solution and iodine (46 mg) were added at room temperature, and it stirred for 2 hours and 40 minutes. To the reaction mixture 4-bromo-2-cyanothiophene (298 mg), 2-dicyclohexylphosphino-2 ', 4', 6'-triisopropyl-1,1'-biphenyl (29 mg) and Tris (dibenzylideneacetone) dipalladium (28 mg) was added at room temperature, and the mixture was stirred at room temperature under nitrogen atmosphere for 3 hours, and then the mixture was filtered through Celite. Ethyl acetate was added to the filtrate, and the mixture was washed with an aqueous sodium thiosulfate solution. The organic layer was dried over anhydrous magnesium sulfate, and then concentrated under reduced pressure. The obtained residue was purified by silica gel chromatography (n-hexane: ethyl acetate = 90:10-&gt; 30:70) to obtain tert-butyl (S) -2-((((9H-fluorene-9- I) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3-yl) propanoate (127 mg) was obtained.

MS (ESI m / z): 475.1 (M + H)

RT (min): 1.95

Synthesis | combination of the compound shown in following Table 19 is tert- butyl (S) -2-((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanosoxy It carried out similarly to the synthesis | combination of open-3-yl) propanoate.

Table 19-1

Table 19-2

Table 19-3

Table 19-4

Synthesis of (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3-yl) propanoic acid

Formula 123]

tert-butyl (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3-yl) propanoate (127 mg TFA (1.0 mL) was added, and after stirring at room temperature for 30 minutes, the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel chromatography (n-hexane: ethyl acetate = 70:30-&gt; 0: 100) to obtain 63 mg of the title compound as a white solid.

¹ H-NMR (MeOD) δ: 7.78 (2H, d, J = 7.3 Hz), 7.59 (2H, d, J = 7.3 Hz), 7.53-7.24 (6H, m), 4.53-4.43 (1H, m) , 4.36-4.11 (3H, m), 3.25-2.93 (2H, m).

MS (ESI m / z): 419.0 (M + H)

RT (min): 1.55

Synthesis of the compound shown in Table 20 below is (S) -2-((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3 It carried out similarly to the synthesis | combination of -yl) propanoic acid.

Table 20-1

Table 20-2

Table 20-3

Table 20-4

Table 20-5

[Table 20 ~ 6]

Table 20-7

Table 20-8

Synthesis of (S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid

[Formula 124]

To dichloromethane solution (2 mL) of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid tert-butyl (193 mg) 10 mL of TFA was added and it stirred at room temperature for 3 hours. The solvent was distilled off under reduced pressure, 10 mL of NMF, 0.48 mL of N, N-diisopropylethylamine and 204 mg of 9-fluorenylmethyl N-succinimidyl carbonate (Fmoc-OSu) were added, followed by stirring at room temperature for 15 hours. did. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 30/70 → 100/0) to obtain 121 mg of the title compound as a pale yellow amorphous.

¹ H-NMR (CDCl ₃ ) δ: 7.78 (2H, d, J = 7.3 Hz), 7.68-7.63 (1H, m), 7.60-7.49 (2H, m), 7.45-7.28 (4H, m), 5.34 -5.24 (1H, m), 4.80-4.67 (1H, m), 4.55-4.35 (2H, m), 4.18 (1H, t, J = 6.9 Hz), 3.42-3.21 (2H, m).

MS (ESI m / z): 454.9 (M + H)

RT (min): 1.62

Synthesis of tert-butyl (((9H-fluoren-9-yl) methoxy) carbonyl) -L-homoserineate

[Formula 125]

THF solution of (S) -3-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -4- (tert-butoxy) -4-oxobutanoic acid (5.02 g) Triethylamine (2.80 mL) was added to 30 mL), and THF solution (10 mL) of ethyl chloroformate (1.43 mL) was added dropwise onto an ice bath, followed by stirring at room temperature for 35 minutes. The insolubles were separated by filtration, and a small amount of 1.36 g of sodium borohydride was added to the filtrate, followed by stirring at room temperature for 1 hour. After 5 mL of distilled water was added to the reaction solution, an aqueous hydrochloric acid solution (1 mol / L) and ethyl acetate were added, followed by extraction with ethyl acetate. The organic layer was washed with saturated brine and dried over magnesium sulfate. The solvent was distilled off under reduced pressure to obtain a colorless oily title compound (1.62 g).

MS (ESI m / z): 398.0 (M + H)

RT (min): 1.61

Synthesis of (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -4-iodobutanoic acid tert-butyl

[Formula 126]

It carried out similarly to the synthesis | combination of tert-butyl (R) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3-iodopropanoate.

MS (ESI m / z): 507.8 (M + H)

RT (min): 1.99

(S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-cyano-1H-1,2,3-triazol-1-yl Synthesis of Propionic Acid

Formula 127]

(S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3-azidopropanoic acid (230 mg) water / acetonitrile mixed solvent (= 5/2 2-chloroacrylonitrile (0.11 mL) was added to (7 mL) at room temperature, and it stirred at 80 degreeC for 21 hours. Ethyl acetate and saturated brine were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. To the obtained residue was added hexane / acetone mixed solvent (15: 1) and recrystallized at 50 ° C. to obtain the title compound (145 mg) as a white solid.

MS (ESI m / z): 403.9 (M + H)

RT (min): 1.41

¹ H-NMR (CDCl ₃ ) δ: 7.87-7.78 (2H, m), 7.65-7.55 (2H, m), 7.49-7.41 (3H, m), 7.40-7.31 (2H, m), 5.44-5.38 ( 1H, m), 5.03-4.62 (3H, m), 4.56-4.50 (1H, m), 4.23-4.19 (2H, m).

Synthesis of (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-nitrophenyl) propanoic acid tert-butyl

[Formula 128]

To THF solution (100 mL) of (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-nitrophenyl) propanoic acid (2.5 g) 4.5 mL of 2,2,2-trichloroacetimide acid tert-butyl was added at room temperature, and it stirred at 70 degreeC for 24 hours. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 10/90 → 20/80) to give the title compound (3.65 g) as a yellow oil.

MS (ESI m / z): 489.1 (M + H)

RT (min): 1.96

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) penta-4-phosphate tert-butyl

[Formula 129]

(S) -2-((tert-butoxycarbonyl) amino) penta-4-phosphate (1.5 g) in ethyl acetate solution (5.0 mL) tert-butyl 2,2,2-trichloroacetimidade ( 4.6 g) was added dropwise and stirred at room temperature for 22 hours. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 → 30/70) to obtain a colorless oily title compound (1.66 g).

MS (ESI m / z): 270.1 (M + H)

RT (min): 1.59

Synthesis of (S) -5- (3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl) isoxazole-3-carboxylic acid ethyl

[Formula 130]

DMF solution of (S) -2-((tert-butoxycarbonyl) amino) penta-4-phosphate tert-butyl (1660 mg) and 2-chloro-2- (hydroxyimino) acetic acid ethyl (2.8 g) 21 mL) was added triethylamine (640 L) at 90 DEG C and stirred for 15 minutes. Triethylamine (640 µL) was added to the reaction solution at 90 ° C, and stirred for 15 minutes. Triethylamine (1278 μL) was added at 90 ° C. and stirred for 30 minutes. Ethyl acetate and saturated brine were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 25/75) to obtain the title compound (818 mg) as a yellow oil.

MS (ESI m / z): 385.0 (M + H)

RT (min): 1.36

Synthesis of 5-bromo-1-methyl-1H-pyrrolo [2,3-b] pyridine-6-carbonitrile

[Formula 131]

Cesium carbonate (919 mg), methanesulfonic acid in THF / acetonitrile solution (= 2/1, 6 mL) of 5-bromo-1H-pyrrolo [2,3-b] pyridine-6-carbonitrile (250 mg) Methyl (115 µL) was added and stirred at room temperature for 16 hours. Ethyl acetate and an ammonium chloride aqueous solution were added to the reaction solution, and the extraction operation was performed with ethyl acetate. The organic layer was dried over magnesium sulfate. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 50/50) to obtain the title compound (151 mg) as a white solid.

MS (ESI m / z): 235.6 (M + H)

RT (min): 1.58

Synthesis of 6- (3-bromophenyl) imidazo [1,2-a] pyrimidine-2-carboxylic acid ethyl

[Formula 132]

It carried out similarly to the synthesis | combination of 6- (3-bromophenyl) pyrazolo [1,5-a] pyrimidine-2-carboxylic acid ethyl.

MS (ESI m / z): 347.0 (M + H)

RT (min): 1.45

The compound shown in Table 21 below was carried out in the same manner as in the synthesis of 6- (3-bromophenyl) pyrazolo [1,5-a] pyrimidine-2-carboxylic acid ethyl.

TABLE 21

Synthesis of 1- (4-bromophenyl) -1H-imidazole-4-carboxamide

[Formula 133]

To 1- (4-bromophenyl) -1H-imidazole-4-carboxylic acid ethyl (746 mg) was added methanol solution of ammonia (7 mol / L, 10 mL) and irradiated with microwave (InitiatorTM, 110 ° C, 1.0 hour, 2.45GHz, 0-240W). Furthermore, microwave was irradiated to the reaction solution (InitiatorTM, 120 degreeC, 4.0 hours, 2.45 GHz, 0-240 W). The solvent was distilled off under reduced pressure to obtain the title compound (660 mg) as a white solid.

MS (ESI m / z): 268.0 (M + H)

RT (min): 0.98

Synthesis of 6- (3-bromophenyl) imidazo [1,2-a] pyrimidine-2-carboxamide

[Formula 134]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 318.9 (M + H)

RT (min): 1.00

The compound shown in Table 22 below is the same as the synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl Carried out.

Table 22

Synthesis of 6- (3-bromophenyl) imidazo [1,2-a] pyrimidine-2-carbonitrile

[Formula 135]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 300.0 (M + H)

RT (min): 1.24

The compound shown in Table 23 below is the same as the synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid tert-butyl Carried out.

TABLE 23

The compound shown in Table 24 below is tert-butyl (S) -2-((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3 It carried out similarly to the synthesis | combination of -yl) propanoate.

TABLE 24-1

TABLE 24-2

Synthesis of (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-aminophenyl) propanoic acid tert-butyl

[Formula 136]

It carried out similarly to the synthesis | combination of tert- butyl (S) -2-((tert- butoxycarbonyl) amino) -3- (3, 4- diaminophenyl) propanoate.

MS (ESI m / z): 459.1 (M + H)

RT (min): 1.55

(S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-(((allyloxy) carbonyl) amino) phenyl) propanoic acid tert- Synthesis of Butyl

[Formula 137]

Dichloromethane of (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-aminophenyl) propanoic acid tert-butyl (2.83 g) Diisopropylethylamine (3 mL) and chloroformate allyl (722 µL) were added to the solution (50 mL), and the mixture was stirred at room temperature for 2 hours. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 20/80) to obtain the title compound (2.52 g) as a yellow oil.

MS (ESI m / z): 543.1 (M + H)

RT (min): 1.93

The compound shown in the following Table 25 is (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3-yl) It carried out similarly to the synthesis of propanoic acid.

Table 25-1

Table 25-2

Table 25-3

Table 25-4

Table 25-5

Table 25-6

(S) -5- (2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (tert-butoxy) -3-oxopropyl) imidazo [1, 2-a] Synthesis of pyridine-2-carboxylic acid ethyl

[Formula 138]

It carried out similarly to the synthesis | combination of 6-bromoimidazo [1,2-a] pyrimidine-2-carboxylic acid ethyl.

MS (ESI m / z): 556.4 (M + H)

RT (min): 1.70

(S) -5- (3- (tert-butoxy) -2-((tert-butoxycarbonyl) amino) -3-oxopropyl) imidazo [1,2-a] pyridine-2-carboxylic acid ethyl Synthesis of

[Formula 139]

(S) -5- (2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (tert-butoxy) -3-oxopropyl) imidazo [1, DMF (10 mL) and piperidine (635 µL) were added to 2-a] pyridine-2-carboxylic acid ethyl (357 mg), and it stirred at room temperature for 1 hour. After confirming the disappearance of the raw materials, diisopropylethylamine (4 mL) and Boc ₂ O (3 mL) were added, and the mixture was stirred at room temperature for 3 hours. The solvent was distilled off under reduced pressure and the residue was purified by column chromatography (silica gel, ethyl acetate / hexane = 0/100 to 50/50 to 100/0) to obtain the title compound (176 mg) as a brown oil.

MS (ESI m / z): 434.4 (M + H)

RT (min): 1.41

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (2-carbamoylimidazo [1,2-a] pyridin-5-yl) propanoic acid tert-butyl

[Formula 140]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-carbamoylthiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 405.9 (M + H)

RT (min): 1.19

Synthesis of (S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyano [2,4'-bithiazol] -2'-yl) propanoic acid tert-butyl

Formula 141

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyanothiazol-2-yl) propanoic acid tert-butyl was carried out in the same manner as in the synthesis.

MS (ESI m / z): 437.9 (M + H)

RT (min): 1.74

The compound shown in Table 26 below is (S) -2-((tert-butoxycarbonyl) amino) -3- (4-cyano [2,4'-bithiazol] -2'-yl) propane It carried out similarly to the synthesis | combination of an acid tert- butyl.

TABLE 26

(S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-((1- (5-cyanothiophen-2-yl)- Synthesis of 1-oxo-5,8,11-trioxa-2-azatridecan-13-yl) oxy) phenyl) propanoic acid

[Formula 142]

(S) -2-((tert-butoxycarbonyl) amino) -3- (4-((1- (5-cyanothiophen-2-yl) -1-oxo-5,8,11- Trifluoroacetic acid (25 mL) was added to a dichloromethane solution (5 mL) of trioxa-2-azatridecan-13-yl) oxy) phenyl) propanoic acid tert-butyl (891 mg), and 3 hours at room temperature. Stirred. The solvent was distilled off under reduced pressure, and the residue was diluted with dichloromethane (10 mL), diisopropylethylamine (3 mL), and N-[(9H-fluorene-9-ylmethoxy) carbonyloxy] succinimide (464 mg). Was added and stirred at room temperature for 2 hours. The solvent was distilled off under reduced pressure, and the residue was purified by column chromatography (silica gel, methanol / ethyl acetate = 0/100 → 30/70) to obtain the title compound (921 mg) as light yellow oil.

MS (ESI m / z): 714.4 (M + H)

RT (min): 1.53

(S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (4- (2- (2- (2- (2-((6-between) Synthesis of Anopyridin-3-yl) oxy) ethoxy) ethoxy) ethoxy) ethoxy) phenyl) propanoic acid

[Formula 143]

The compound shown in the following table is (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-((1- (5-cyanothiophene) 2-yl) -1-oxo-5,8,11-trioxa-2-azatridecan-13-yl) oxy) phenyl) propanoic acid was carried out in the same manner as in the synthesis.

MS (ESI m / z): 682.2 (M + H)

RT (min): 1.58

The compound shown in Table 27 below is (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-((1- (5-cyano) It carried out similarly to the synthesis | combination of thiophen-2-yl) -1-oxo-5,8,11-trioxa-2-azatridecane-13-yl) oxy) phenyl) propanoic acid.

Table 27-1

Table 27-2

Table 27-3

Table 27-4

Table 27-5

Synthesis of pdCpA Amino Acid-1

[Formula 144]

PdCpA (Gene) in cyanomethyl (S) -2-((tert-butoxycarbonyl) amino) -3- (2-cyanobenzo [d] thiazol-6-yl) propanoate (1.15 mg) 13.7 µL of a DMF solution (1.0OD / µL) of Act Corporation) (dinucleotide composed of deoxycytidine and adenosine) was added, and the mixture was shaken with a vortex for 1 hour. OD stands for optical density. After the reaction, the mixture was diluted with 0.38% aqueous formic acid solution / acetonitrile (1/1), and subjected to high performance liquid chromatography (HPLC) (1260 Infinity Binary LC system from Agilent, column: ZORBAX SB-C18 (9.4x50 mm) from Agilent) Column temperature: 40 ° C., gradient conditions: H ₂ O (0.1% TFA) / acetonitrile (0.1% TFA) = 90/10 → 0/100, flow rate: 4.0 mL / min, detection wavelength: 254 nm) Purified by. The solvent of the obtained target solution was distilled off under reduced pressure, and 100 µL of TFA was added to the obtained residue. After shaking for 1 hour at room temperature, the solvent was distilled off under reduced pressure to obtain pdCpA amino acid-1. Identification was carried out by MALDI-TOF MS (manufactured by Bruker Daltonics, ultrafleXtreme MALDI-TOF / TOF MS, matrix: α-cyano-4-hydroxycinnamic acid).

MS (MALDI-TOF, m / z): 864.5 (M-H)

Synthesis | combination of pdCpA amino acid-2-29 shown in following Table 28 was synthesize | combined by operation similar to the synthesis of pdCpA amino acid-1.

Table 28-1

Table 28-2

Table 28-3

Table 28-4

Table 28-5

Table 28-6

Table 28-7

Table 28-8

Table 28-9

Synthesis | combination of the pdCpA amino acid shown in following Table 29 was synthesize | combined by operation similar to the synthesis | combination of pdCpA amino acid-1.

TABLE 29-1

Table 29-2

Table 29-3

TABLE 29-4

Table 29-5

Table 29-6

Table 29-7

Table 29-8

Table 29-9

Table 29-10

TABLE 29-11

Table 29-12

Table 29-13

TABLE 29-14

The water used in subsequent experiments using DNA and RNA is Nuclease-Free Water manufactured by QIAGEN.

mRNA synthesis

All mRNA-1 to mRNA-13 used for the cell-free translation synthesis were synthesized according to the following method.

Two-stranded DNA having a nucleotide sequence to which the T7 promoter and the ribosome binds upstream of the open reading frame was amplified by PCR to prepare a template DNA gene of mRNA (template DNA-1 to 13, table below). Purification was performed using a QIAquick PCR Purification Kit (manufactured by QIAGEN).

Next, mRNA was synthesized by transcriptional reaction. The solution of following solution composition 1 was prepared and reacted at 37 degreeC for 6 hours. 100 µL of 5M ammonium acetate was added, mixed lightly, and left on ice for 20 minutes. The mixture was centrifuged at 13200 rpm at 4 ° C. for 20 minutes, the supernatant was removed, and 200 μL of 1 × TE buffer (10 mmol / L Tris-HCl (pH 8.0) and 1 mmol / L EDTA (pH 8.0)) was added. By dissolving the precipitate. In addition, Tris represents trishydroxymethylaminomethane and EDTA represents ethylenediamine tetraacetic acid. Equivalent amount of phenol / chloroform = 1/1 (saturated with 1 × TE) was added, stirred, and centrifuged. The upper layer was recovered, an equivalent amount of chloroform was added, stirred and centrifuged. The upper layer was collected, 20 µL of 3 mol / L potassium acetate pH4.5 and 600 µL of ethanol were added, mixed lightly, and left at -80 ° C for 30 minutes. After centrifugation at 13200 rpm and 4 degreeC for 30 minutes, supernatant was removed, 200 microliters of 70% cold ethanol preserve | saved at -30 degreeC were added, and it centrifuged at 13200 rpm and 4 degreeC for 5 second. The supernatant was removed and dried under reduced pressure. The concentration was determined by spectrophotometer and dissolved in water to 16 μmol / L.

Solution composition 1

10 x Buffer (400 mmol / L Tris-HCl (pH 8.0), 500 mmol / L NaCl, 80 mmol / L MgCl ₂ , 50 mmol / L DTT): 10 μL

25 mmol / L NTPs (nucleotide triphosphate mixture): 16 μL

100 mmol / L Spermidine: 2 μL

0.1% BSA (bovine serum albumin): 1 μL

ribonuclease inhibitor (40 units / μL, manufactured by Takara Bio Co., Ltd.): 1 μL

inorganic pyrophosphatase (0.5 unit / μL, manufactured by Sigma Aldrich): 1 μL

Thermo T7 RNA Polymerase (50unit / μL; manufactured by Toyobo Corporation): 4μL

Template DNA gene of mRNA (100ng / μL): 20μL

Water: 45μL

"Array table"

TABLE 30

The whole sequence of template DNA-1-template DNA-13 is described in sequence numbers 1-13 of a "sequence table", respectively.

MRNA synthesized from template DNA-1 was designated as mRNA-1, and mRNA-2 to 13 were then regulated in the same manner.

Synthesis of Amber Suppressor tRNA (-CA)

Using a mycoplasma capri column-derived tryptophan tRNA variant described in International Publication WO07 / 055429, the tRNA lacking the CA dinucleotide at the 3 'end was amplified by PCR, a tRNA (-CA) gene was prepared, and a MinElute PCR Purification Kit ( Purified using QIAGEN Co., Ltd.).

Next, tRNA (-CA) was synthesized by transcriptional reaction. The solution of the following solution composition 2 was prepared and reacted at 37 degreeC for 12 hours. The tRNA (-CA) was purified by RNeasy MinElute Cleanup Kit (manufactured by QIAGEN), and dissolved in water to 200 µmol / L.

Solution composition 2

10 x Transcription Buffer (400 mmol / L Tris-HCl (pH 8.0), 200 mmol / L MgCl ₂ , 50 mmol / L DTT): 10 μL

25mmol / L NTPs: 16μL

100mmol / L GMP: 20μL

100 mmol / L Spermidine: 2 μL

0.1% BSA: 1 μL

ribonuclease inhibitor (40 units / μL, manufactured by Takara Bio Co., Ltd.): 1 μL

inorganic pyrophosphatase (0.5 unit / μL, manufactured by Sigma Aldrich): 1 μL

T7 RNA Polymerase (50 units / μL; manufactured by New England BioLabs): 8 μL

tRNA (-CA) gene (100ng / μL): 41μL

Synthesis of aminoacyl tRNA-1 (nucleotide sequence of RNA moiety is shown in SEQ ID NO: 14 of the "SEQ ID NO")

[Formula 145]

The solution of following solution composition 3 was prepared to the 1.5 mL sample tube, and it left still at 4 degreeC for 2 hours. Thereafter, 26.7 µL and 160 µL of 0.6 mol / L potassium acetate aqueous solution (pH4.5) were added to the reaction solution, and the mixture was allowed to stand at -80 ° C for 30 minutes. Then, centrifugation (4 degreeC, 13200 rpm) was performed for 30 minutes, and supernatant liquid was removed. 200 µL of a 70% aqueous ethanol solution was added silently, and centrifugation (4 ° C, 13200 rpm) was performed for 1 minute. The supernatant was removed again and dried under reduced pressure to obtain aminoacyl tRNA-1. The resulting aminoacyl tRNA was dissolved in 1 mmol / L potassium acetate aqueous solution immediately before addition to the translation mixture.

Solution composition 3

Water: 14μL

5xLigation Buffer (275mmol / L HEPES-Na pH7.5, 75mmol / L MgCl ₂ , 16.5mmol / L DTT, 5mmol / L ATP): 5.34μL

0.1% BSA: 0.54 μL

DMSO solution of pdCpA amino acid-1 (0.73 mmol / L): 2.66 μL

Amber suppressor tRNA (-CA) aqueous solution (200μmol / L): 3.34μL

T4 RNA Ligase Solution (manufactured by Takara Bio Co., 40 U / μL): 0.80 μL

In addition, HEPES represents 2- [4- (2-hydroxyethyl) piperazin-1-yl] ethanesulfonic acid, and DMSO represents dimethyl sulfoxide.

The aminoacyl tRNA-2-68 shown to the following Tables 31 and 32 was performed similarly to the synthesis of the aminoacyl tRNA-1.

Table 31-1

Table 31-2

Table 31-3

Table 32-1

Table 32-2

Table 32-3

Table 32-4

Cell-free translation synthesis of non-natural amino acid chain peptides and synthesis of cyclic peptides represented by formula (1)

As the MALDI-TOF MS in this section, ultrafleXtreme MALDI-TOF / TOF MS (manufactured by Bruker Daltonics) was used. As the matrix, α-cyano-4-hydroxycinnamic acid was used.

Synthesis of Cyclic Peptides 1-1

Formula 146

The solution of following solution composition 4 was prepared in the 1.5 mL sample tube, and incubated at 37 degreeC for 1.5 hours. 31 μL of wash buffer (composition: 20 mmol / L phosphate buffer (pH7.5), 500 mmol / L NaCl, 5 mM imidazole) and magnetic bead solution (MBL Life Sciences, Anti-DDDDK-tag mAb-Magnetic Agarose) 10 μL was added and shaken with vortex at room temperature for 30 minutes. Thereafter, centrifugation was performed to remove the supernatant solution. The washing operation of the obtained magnetic beads (addition of 200 μL of washing buffer → shaking with vortex → centrifugation → removal of supernatant) was repeated three times. 10 µL of a 2% aqueous formic acid solution was added to the obtained magnetic beads, followed by shaking using a vortex at room temperature for 1 hour. Thereafter, magnetic beads were precipitated by centrifugation, the supernatant was collected, and cyclic peptide 1-1 was obtained. The obtained peptide was identified by MALDI-TOF MS.

MS (MALDI-TOF, m / z): 2382.0 (M + H)

Solution composition 4

Water: 2μL

mRNA-1 aqueous solution (0.02OD / μL): 1μL

Aminoacyl tRNA-1 aqueous solution (0.2OD / μL): 1μL

Amino acid solution (19 amino acids other than Met, each 0.3 mmol / L mixture): 1.5 μL

PUREfrex (registered trademark) custom ver2 (product made in jean frontier company, PFC-Z1802)

SolutionI: 4 μL

SolutionII: 0.5 μL

SolutionIII: 1 μL

The synthesis of cyclic peptides 1-2 to 27 shown in Table 33 below was carried out by the same operation as the synthesis of cyclic peptide 1-1 using the combination of mRNA and aminoacyl tRNA shown in Table 33.

Table 33-1

Table 33-2

Table 33-3

The synthesis of the cyclic peptide shown in Table 34 below was carried out by the same operation as the synthesis of the cyclic peptide 1-1 using the combination of mRNA and aminoacyl tRNA shown in Table 34.

TABLE 34-1

Table 34-2

Table 34-3

Table 34-4

Table 34-5

Table 34-6

Synthesis of Cyclic Peptides 1-28

[Formula 147]

The solution of the said solution composition 4 was prepared in the 1.5 mL sample tube, and incubated at 37 degreeC for 30 minutes. 70 microliters of 0.1 mol / L phosphate buffer (pH6.4) was added to the reaction solution, and it was incubated at 37 degreeC for 4 hours. 20 µL of 0.1 mol / L sodium hydroxide aqueous solution and 10 µL of magnetic beads solution (manufactured by MBL Life Sciences, Anti-DDDDK-tag mAb-Magnetic Agarose) were added to the reaction solution, followed by shaking using a vortex at room temperature for 30 minutes. Thereafter, centrifugation was performed to remove the supernatant solution. The washing operation of the obtained magnetic beads (addition of 200 μL of washing buffer → shaking with vortex → centrifugation → removal of supernatant) was repeated three times. 10 µL of a 2% aqueous formic acid solution was added to the obtained magnetic beads, followed by shaking using a vortex at room temperature for 1 hour. Thereafter, magnetic beads were precipitated by centrifugation, the supernatant was collected, and cyclic peptide 1-28 was obtained. The obtained peptide was identified by MALDI-TOF MS.

MS (MALDI-TOF, m / z): 2325.1 (M + H)

Synthesis of Cyclic Peptides 1-29

The aminoacyl tRNA-28 in the synthesis of the cyclic peptide 1-28 was changed to the aminoacyl tRNA-29, and the incubation time after the addition of the buffer was 24 hours, whereby the cyclic peptide 1-29 shown in Table 35 was obtained.

Table 35

Synthesis of Cyclic Peptides 1-30-38

The synthesis of cyclic peptides 1-30 to 38 shown in Table 36 below was performed by the same operation as the synthesis of cyclic peptide 1-1 using the combination of mRNA and aminoacyl tRNA shown in Table 36.

TABLE 36-1

Table 36-2

Synthesis of Cyclic Peptides 1-39 ~ 47

The synthesis of cyclic peptides 1-39 to 47 shown in Table 37 below was carried out by the same operation as the synthesis of cyclic peptide 1-1 using the combination of mRNA and aminoacyl tRNA shown in Table 37.

Table 37-1

Table 37-2

Synthesis of Cyclic Peptides 1-48

[Formula 148]

Synthesis of cyclic peptide 1-48 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-4 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 2159.9 (M + H)

Synthesis of Cyclic Peptides 1-49

[Formula 149]

Synthesis of cyclic peptide 1-49 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-5 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 2217.6 (M + H)

Synthesis of Cyclic Peptides 1-50

[Formula 150]

Synthesis of cyclic peptide 1-50 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-6 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 2088.9 (M + H)

Synthesis of Cyclic Peptides 1-51

[Formula 151]

Synthesis of cyclic peptide 1-51 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-7 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 2001.8 (M + H)

Synthesis of Cyclic Peptides 1-52

[Formula 152]

Synthesis of cyclic peptide 1-52 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-8 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 1845.7 (M + H)

Synthesis of Cyclic Peptides 1-53

[Formula 153]

Synthesis of cyclic peptide 1-53 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-9 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 1748.7 (M + H)

Synthesis of Cyclic Peptides 1-54

Formula 154

Synthesis of cyclic peptide 1-54 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-10 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 3001.3 (M + H)

Synthesis of Cyclic Peptides 1-55

[Formula 155]

Synthesis of cyclic peptide 1-55 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-11 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 3614.6 (M + H)

Synthesis of Cyclic Peptides 1-56

[Formula 156]

Synthesis of cyclic peptide 1-56 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-12 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 2327.0 (M + H)

Synthesis of Cyclic Peptides 1-57

[Formula 157]

Synthesis of cyclic peptide 1-57 was performed by the same operation as the synthesis of cyclic peptide 1-1 using a combination of mRNA-13 and aminoacyl tRNA-10.

MS (MALDI-TOF, m / z): 2090.9 (M + H)

General Method of Peptide Solid Phase Synthesis by Peptide Automated Synthesis

Peptide solid phase synthesis was performed using a peptide automatic synthesis apparatus (SiroI manufactured by biotage). Rink Amide-ChemMatrix (registered trademark) (manufactured by Biotaji Co., Ltd.), N-methyl-2-pyrrolidone (NMP) solution of Fmoc amino acid (0.5 mol / L), cyano-hydroxyimino-acetic acid ethyl ester NMP solution of (1.0 mol / L) and diisopropylethylamine (0.1 mol / L), NMP solution of diisopropylcarbodiimide (1.0 mol / L), NMP of piperidine (20% v / v) A solution and an NMP solution of acetic anhydride (20% v / v) were set and synthesized according to the manual. The peptide chain was extended by Fcycle deprotection (20 minutes), washing with NMP, condensation of Fmoc amino acids (1 hour), washing with NMP as one cycle and repeating this cycle. The HPLC of this section used the 1260 Infinity Binary LC system (made by Agilent) or LC system (made by Waters).

Column: X Select CSH130 C18 (10x250mm) from Waters or X Select CSH130 C18 (19x250mm) from Waters

Column temperature: 40 ℃

Flow rate: 4.0 mL / min (manufactured by Agilent), 20 mL / min (manufactured by Waters)

Detection wavelength: 220nm, 254nm

Synthesis of Cyclic Peptides 2-1

[Formula 158]

Peptide solid phase synthesis was performed using Rink Amide-ChemMatrix (0.5 mmol / g, 40 mg) as a starting material. (S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (2-cyanobenzo [b] thiophen-4-yl) propionic acid, N- α- (9-fluorenylmethoxycarbonyl) -N-ω- (2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulfonyl) -L-arginine (Fmoc-Arg ( Pbf) -OH), N-α- (9-fluorenylmethoxycarbonyl) -1- (t-butoxycarbonyl) -L-tryptophan (Fmoc-Trp (Boc) -OH), N-α- (9-Fluorenylmethoxycarbonyl) -β-cyclohexyl-D-alanine (Fmoc-D-Cha-OH), N- (9-fluorenylmethoxycarbonyl) -L-proline (Fmoc-Pro- OH) and N-α- (t-butoxycarbonyl) -S-trityl-L-cysteine (Boc-Cys (Trt) -OH) in the order of condensation. After the extension was completed, the resin was washed with dichloromethane, and then the solvent was distilled off under reduced pressure. TFA: triisopropylsilane: water (= 95: 2.5: 2.5, 2.0 mL) was added, and the peptide was extruded and deprotected. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. HEPES buffer (pH7.3, 2.5 mL) and methanol (0.5 mL) were added to the obtained solid, and reaction was performed for 2 hours. Peptides were adsorbed onto the carrier using Sep-pak C18 (waters), washed with water, eluted with acetonitrile and methanol to remove salts. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution), and then hydrogen triethylammonium carbonate solution (1.0 mol / L, pH8.5) was added. Neutralization, and the solvent was distilled off under reduced pressure to obtain cyclic peptide 2-1 (0.91 mg) as a white solid.

MS (ESI m / z): 923.9 (M + H)

RT (min): 1.19

In the same manner as the cyclic peptide 2-1, the compound shown in Table 38 below was obtained.

Table 38-1

Table 38-2

Table 38-3

Synthesis of Cyclic Peptides 3-1

[Formula 159]

Peptide solid phase synthesis was performed using 100 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. (S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (6-cyanopyridin-3-yl) propionic acid, Fmoc-Arg (Pbf)- Condensation was performed in the order of OH, Fmoc-Trp (Boc) -OH, Fmoc-D-Cha-OH, Fmoc-Pro-OH, and Boc-Cys (Trt) -OH. After the extension was completed, the resin was washed with dichloromethane, and then the solvent was distilled off under reduced pressure. TFA: triisopropylsilane: water (= 95: 2.5: 2.5, 3.0 mL) was added, and the peptide was removed and deprotected. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. Phosphoric acid buffer (pH6.4, 5.0 mL) and acetonitrile (1.0 mL) were added to the obtained solid, and reaction was performed for 2 hours. Peptides were adsorbed onto the carrier using Sep-pak C18 (waters), washed with water, eluted with acetonitrile and methanol to remove salts. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% aqueous formic acid solution / 0.1% formic acid acetonitrile solution), and then triethylammonium carbonate solution (1 mol / L, pH8.5) was added to the mixture. It neutralized and the solvent was distilled off under reduced pressure and the colorless oily cyclic peptide 3-1 (0.93 mg) was obtained.

MS (ESI m / z): 869.2 (M + H)

RT (min): 1.09

In the same manner as the cyclic peptide 3-1, the compound shown in Table 39 below was obtained.

TABLE 39

Synthesis of Cyclic Peptides 4-1

[Formula 160]

Peptide solid phase synthesis was performed using 100 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. (S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (6-cyanopyridin-2-yl) propionic acid, N-α- (9- Fluorenylmethoxycarbonyl) -D-phenylalanine (Fmoc-D-Phe-OH), N-α- (9-fluorenylmethoxycarbonyl) glycine (Fmoc-Gly-OH), Fmoc-Gly-OH, N-α- (9-fluorenylmethoxycarbonyl) -O- (t-butyl) -D-tyrosine (Fmoc-D-Tyr (tBu) -OH), Boc-Cys (Trt) -OH Condensation was carried out. After the extension was completed, the resin was washed with dichloromethane, and then the solvent was distilled off under reduced pressure. TFA: triisopropylsilane: water (= 95: 2.5: 2.5, 3.0 mL) was added to the reaction solution, and the peptide was removed and deprotected. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. An aqueous solution of HEPES buffer (pH7.3, 5.0 mL), acetonitrile (1.0 mL), and tris (2-carboxyethyl) phosphine (0.5 mol / L, 0.1 mL) was added to the obtained solid, followed by stirring at room temperature for 2 hours. After that, it stood for 13 hours. The solution was concentrated under reduced pressure, and the obtained residue was purified by HPLC (0.1% formic acid aqueous solution: 0.1% formic acid acetonitrile solution), and then neutralized by adding hydrogen triethylammonium carbonate solution (1.0 m, pH8.5), The solvent was distilled off under reduced pressure to obtain a colorless oily cyclic peptide 4-1 (2.61 mg).

MS (ESI m / z): 701.0 (M + H)

RT (min): 0.97

By the same method as cyclic peptide 4-1, the cyclic peptide 4-2-7 shown to the following Table 40, 41, and 42, the cyclic peptide 4-8, and the cyclic peptide 4-9 were obtained.

TABLE 40

Table 41

Table 42

Cyclic Peptides 4-8

[Formula 161]

MS (ESI m / z): 1135.2

RT (min): 1.15

Cyclic Peptides 4-9

[Formula 162]

MS (ESI m / z): 1151.2

RT (min): 1.12

Synthesis of Cyclic Peptides 5-1

[Formula 163]

Peptide solid phase synthesis was performed using 50 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. N-α- (9-fluorenylmethoxycarbonyl) -3-cyano-L-phenylalanine (Fmoc-Phe (3-CN) -OH), N-α- (9-fluorenylmethoxycarbonyl) -D-glutamic acid γ-t-butyl ester (Fmoc-D-Glu (OtBu) -OH), N-α- (9-fluorenylmethoxycarbonyl) -D-tryptophan (Fmoc-D-Trp-OH) , N-α- (9-fluorenylmethoxycarbonyl) -L-leucine (Fmoc-Leu-OH), N-α- (9-fluorenylmethoxycarbonyl) -D-valine (Fmoc-D- Condensation was carried out in the order of Val-OH) and Boc-Cys (Trt) -OH. After the extension was completed, the resin was washed with dichloromethane, and then the solvent was distilled off under reduced pressure. TFA: triisopropylsilane: water (= 95: 2.5: 2.5, 3.0 mL) was added to the reaction solution, and the peptide was removed and deprotected. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. Phosphoric acid buffer (pH6.4, 2.5 mL), methanol (1.0 mL) and tris (2-carboxyethyl) phosphine (0.5 mol / L, 0.025 mL) aqueous solution were added to the obtained solid, and the mixture was stirred at room temperature for 42 hours. Peptides were adsorbed onto the carrier using Sep-pak C18 (waters), washed with water, eluted with acetonitrile and methanol to remove salts. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% formic acid aqueous solution: 0.1% formic acid acetonitrile solution), and then neutralized by adding hydrogen triethylammonium carbonate solution (1.0M, pH8.5). Then, the solvent was distilled off under reduced pressure to obtain a colorless oily cyclic peptide 5-1 (0.67 mg).

MS (ESI m / z): 802.9 (M + H)

RT (min): 1.21

Synthesis of Cyclic Peptide 6-1

Formula 164

Peptide solid phase synthesis was performed using 50 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. (S) -2-(((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (6- (4-((allyloxy) carbonyl) thiazol-2-yl Condensation was carried out in the order of pyridin-2-yl) propanoic acid, Fmoc-Arg (Pbf) -OH, Fmoc-Trp (Boc) -OH, Fmoc-D-Cha-OH, and Fmoc-Pro-OH. After peptide extension, tetrakis (triphenylphosphine) palladium (0) (Pd (PPh ₃ ) ₄ ) (29 mg), chloroform: acetic acid: N-methylmorpholine (= 37/2/1, 1.5 mL) The mixture was added and reacted for 1 hour to remove the allyl group. NMP solution of piperidine (20% v / v) was added and reacted for 20 minutes to remove the Fmoc group, followed by O- (7-azabenzotriazol-1-yl) -N, N, N The peptide was cyclized by adding ', N'-tetramethyluronium hexafluorophosphate (19 mg), diisopropylethylamine (17 μL) and 1-methyl-2-pyrrolidone (1.5 mL) and reacting for 2 hours. I was. After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. TFA: triisopropylsilane: water (= 92.5: 2.5: 2.5, 2.0 mL) was added to the reaction solution, and the peptide was removed and deprotected. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. The obtained residue was purified by HPLC (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain cyclic peptide 6-1 (0.91 mg) as a white solid.

MS (ESI m / z): 867.0 (M + H)

RT (min): 1.11

Synthesis of Cyclic Peptides a-1-1

Formula 165

Peptide solid phase synthesis was performed using 104 mg of Rink Amide-ChemMatrix (0.48 mmol / g) as a starting material. (S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3-yl) propanoic acid, Fmoc-Arg (Pbf ) -OH, Fmoc-Trp (Boc) -OH, Fmoc-D-Cha-OH, Fmoc-Pro-OH, N-((((9H-fluoren-9-yl) methoxy) carbonyl) -S- Condensation was carried out in the order of ((4-methoxyphenyl) diphenylmethyl) -L-cysteine. After completion of the extension, an NMP solution of piperidine (20% v / v) was added and reacted for 20 minutes to remove the Fmoc group. After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. TFA: 3,6-dioxa-1,8-octanedithiol: triisopropylsilane: water (= 92.5: 2.5: 2.5: 2.5, 3.0 mL) was added to prevent cleavage and deprotection of the peptide. Done. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. To the obtained solid, phosphate buffer (pH 7.0, 5.0 mL), methanol (5.0 mL) and tris (2-carboxyethyl) phosphine (0.5 mol / L, 0.1 mL) were added, and the mixture was stirred for 1 hour. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% aqueous formic acid solution / 0.1% formic acid acetonitrile solution), and then triethylammonium carbonate solution (1 mol / L, pH8.5) was added to the mixture. It neutralized and the solvent was distilled off under reduced pressure and the white solid cyclic peptide a-1-1 (2.63 mg) was obtained.

MS (ESI m / z): 888.2 (M + H)

RT (min): 1.12

By the same method as the synthesis of the cyclic peptide a-1-1, the cyclic peptides a-1-2 to 18 shown in Table 43 below were obtained.

TABLE 43-1

Table 43-2

Table 43-3

Cyclic Peptides a-1-19

Formula 166

The synthesis of the cyclic peptide a-1-19 was carried out in the same manner as the cyclic peptide a-1-1.

MS (ESI m / z): 854.1 (M + H)

RT (min): 1.14

Synthesis of Cyclic Peptide a-2-1

Formula 167

Peptide solid phase synthesis was performed using Rink Amide-ChemMatrix (0.54 mmol / g, 104 mg) as a starting material. (S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (4-((allyloxy) carbonyl) amino) phenyl) propanoic acid, Fmoc- Condensation was performed in the order of Arg (Pbf) -OH, Fmoc-Trp (Boc) -OH, Fmoc-D-Cha-OH, Fmoc-Pro-OH, and Boc-Cys (Trt) -OH. After peptide extension, Pd (PPh ₃ ) ₄ (58 mg) and chloroform: acetic acid: N-methylmorpholine (= 37: 2: 1, 2.0 mL) were added and stirred for 1 hour to remove the Alloc group. Condensation was performed in the order of Fmoc-Gly-OH, Fmoc-Gly-OH, and Fmoc-Phe (3-CN) -OH. By adding an NMP solution of piperidine (20% v / v) and reacting for 20 minutes, the Fmoc group is deprotected, and an NMP solution of acetic anhydride (20% v / v) is added and reacted for 10 minutes, The N terminal amino group was acetylated. After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. TFA: triisopropylsilane: water (= 95: 2.5: 2.5, 3.0 mL) was added to extrude and deprotect the peptide. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. Phosphoric acid buffer (pH7.0, 5 mL), methanol (5 mL), and tris (2-carboxyethyl) phosphine (0.5 mol / L, 0.1 mL) aqueous solution were added to the obtained solid, and reaction was performed for 30 hours. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution), and then hydrogen triethylammonium carbonate solution (1.0 mol / L, pH8.5) was added. Neutralization, and the solvent was distilled off under reduced pressure to obtain a white solid cyclic peptide a-2-1 (7.96 mg).

MS (ESI m / z): 1184.2 (M-H)

RT (min): 1.11

Cyclic peptide a-2-2

Formula 168

The synthesis of the cyclic peptide a-2-2 was carried out in the same manner as the cyclic peptide a-2-1.

MS (ESI m / z): 1107.3 (M + H)

RT (min): 1.17

Cyclic peptide a-3-1

[Formula 169]

Peptide solid phase synthesis was performed using Rink Amide-ChemMatrix (0.54 mmol / g, 104 mg) as a starting material. Fmoc-Phe (3-CN) -OH, N- (9-fluorenylmethoxycarbonyl) -L-leucine (Fmoc-Leu-OH), N- (9-fluorenylmethoxycarbonyl) -L- Alanine (Fmoc-Ala-OH), N- (9-fluorenylmethoxycarbonyl) -L-phenylalanine (Fmoc-Phe-OH), Fmoc-Ala-OH, Fmoc-Pro-OH, Fmoc-Ala-OH , Fmoc-Leu-OH, Fmoc-Leu-OH, Fmoc-Pro-OH, Fmoc-Leu-OH, Fmoc-Arg (Pbf) -OH, Fmoc-Leu-OH, Fmoc-Leu-OH, Boc-Cys ( Condensation was carried out in the order of Trt) -OH. After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. TFA: 3,6-dioxa-1,8-octanedithiol: triisopropylsilane: water (= 92.5: 2.5: 2.5: 2.5, 3.0 mL) was added to prevent cleavage and deprotection of the peptide. Done. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. To the obtained solid, an aqueous solution of phosphate buffer (pH 7.0, 14 mL), methanol (15 mL), acetonitrile (4 mL), tris (2-carboxyethyl) phosphine (0.5 mol / L, 0.1 mL) was added, and 38 hours. Reaction was performed. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution), and then hydrogen triethylammonium carbonate solution (1.0 mol / L, pH8.5) was added. Neutralization, and the solvent was distilled off under reduced pressure to obtain a white solid cyclic peptide a-3-1 (8.05 mg).

MS (ESI m / z): 1664.6 (M + H)

RT (min): 1.53

Cyclic peptide a-3-2

[Formula 170]

The cyclic peptide a-3-2 was obtained similarly to the cyclic peptide a-3-1.

MS (ESI m / z): 1129.5 (M + H)

RT (min): 1.21

Cyclic peptide a-4-1

[Formula 171]

Peptide solid phase synthesis was performed using Rink Amide-ChemMatrix (0.54 mmol / g, 104 mg) as a starting material. Fmoc-Phe (3-CN) -OH, Fmoc-Ala-OH, Fmoc-Leu-OH, Fmoc-Lys (Boc) -OH, Fmoc-Leu-OH, Fmoc-Ala-OH, Fmoc-Leu-OH, Condensation was performed in the order of N-α- (9-fluorenylmethoxycarbonyl) -N-ε-allyloxycarbonyl-L-lysine. By adding an NMP solution of piperidine (20% v / v) and reacting for 20 minutes, the Fmoc group is deprotected, and an NMP solution of acetic anhydride (20% v / v) is added and reacted for 10 minutes, The N terminal amino group was acetylated. Pd (PPh ₃ ) ₄ (58 mg) and chloroform: acetic acid: N-methylmorpholine (= 37: 2: 1, 2.0 mL) were added and stirred for 1 hour to remove the Alloc group. After condensation of Boc-Cys (Trt) -OH, the resin was washed with dichloromethane and the solvent was distilled off under reduced pressure. TFA: 3,6-dioxa-1,8-octanedithiol: triisopropylsilane: water (= 92.5: 2.5: 2.5: 2.5, 3.0 mL) was added to prevent cleavage and deprotection of the peptide. Done. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. Phosphoric acid buffer (pH7.0, 5 mL), methanol (5 mL), and tris (2-carboxyethyl) phosphine (0.5 mol / L, 0.1 mL) aqueous solution were added to the obtained solid, and reaction was performed for 30 hours. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution), and then hydrogen triethylammonium carbonate solution (1.0 mol / L, pH8.5) was added. Neutralization, and the solvent was distilled off under reduced pressure to obtain a white solid cyclic peptide a-4-1 (0.24 mg).

MS (ESI m / z): 1011.5 (M-H)

RT (min): 0.98

Cyclic Peptides 7-1

[Formula 172]

Peptide solid phase synthesis was performed using 100 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. N-α- (9-fluorenylmethoxycarbonyl) -S-trityl-L-cysteine (Fmoc-Cys (Trt) -OH), Fmoc-Arg (Pbf) -OH, Fmoc-Trp (Boc)- Condensation was carried out in the order of OH, Fmoc-D-Cha-OH, Fmoc-Pro-OH, Fmoc-Ala-OH, and after peptide extension, deprotection of the Fmoc group was carried out, and chloroacetic acid was condensed in the same manner as amino acids. . After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. TFA: triisopropylsilane: water (= 95: 2.5: 2.5, 3.0 mL) was added to the reaction solution, and the peptide was removed and deprotected. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. HEPES buffer (pH7.3, 5.0 mL) and acetonitrile (1.0 mL) were added to the obtained solid, and it stirred at room temperature for 4 hours. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% aqueous TFA solution: 0.1% TFA acetonitrile solution) to obtain cyclic peptide 7-1 (1.4 mg) as a white solid.

MS (ESI m / z): 824.4 (M + H)

RT (min): 1.09

By the same method as the synthesis of cyclic peptide 7-1, the cyclic peptide shown in Table 44 below was obtained.

TABLE 44-1

Table 44-2

Cyclic Peptides 8-1

[Formula 173]

Peptide solid phase synthesis was performed using 100 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. N-α- (9-fluorenylmethoxycarbonyl) -L-glutamic acid γ-allyl ester (Fmoc-Glu (OAl) -OH), Fmoc-Arg (Pbf) -OH, Fmoc-Trp (Boc) -OH , Fmoc-D-Cha-OH, Fmoc-Pro-OH, and Fmoc-Ala-OH were condensed in this order. After peptide extension, Pd (PPh ₃ ) ₄ (58 mg) and chloroform: acetic acid: N-methylmorpholine (= 37: 2: 1, 2.0 mL) were added and stirred for 1 hour to remove allyl groups in the side chain. The Fmoc group was removed by adding an NMP solution of piperidine (20% v / v) and reacting for 20 minutes. O- (7-azabenzotriazol-1-yl) -N, N, N ', N'-tetramethyluronium hexafluoro phosphoric acid (57 mg), diisopropylethylamine (52 μL), NMP (3.0 mL ) And reacted for 2 hours at room temperature to cyclize the peptide. After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. TFA: triisopropylsilane: water (= 95: 2.5: 2.5, 3.0 mL) was added to the reaction solution at room temperature to remove and deprotect the peptide. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. The obtained residue was purified by HPLC (0.1% TFA aqueous solution / 0.1% TFA acetonitrile solution) to obtain a white solid cyclic peptide 8-1 (7.1 mg).

MS (ESI m / z): 792.4 (M + H)

RT (min): 1.02

By the same method as the synthesis of cyclic peptide 8-1, the cyclic peptide shown in Table 45 below was obtained.

TABLE 45

Cyclic Peptides 9-1

[Formula 174]

Peptide solid phase synthesis was performed using 100 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. Fmoc-Cys (Trt) -OH, Fmoc-Arg (Pbf) -OH, Fmoc-Trp (Boc) -OH, Fmoc-D-Cha-OH, Fmoc-Pro-OH, Fmoc-Cys (Trt) -OH In order, the peptide chain was elongated, followed by adding NMP solution of piperidine (20% v / v) and reacting for 20 minutes, thereby deprotecting the Fmoc group, followed by NMP of acetic anhydride (20% v / v). By adding a solution and reacting for 10 minutes, the N terminal amino group was acetylated. After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. To the reaction solution was added TFA: 3,6-dioxa-1,8-octanedithiol: triisopropylsilane: water (= 92.5: 2.5: 2.5: 2.5, 3.0 mL) to remove the peptide and Deprotection was performed. After 2 hours, the resin was separated by filtration and methyl-t-butylether (12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. After adding acetonitrile (20 mL) and water (20 mL), hydrogen triethylammonium carbonate solution (1.0 mol / L, pH8.5) was added in small portions to adjust the pH to 8.0. Subsequently, an acetonitrile solution of iodine (0.1 mol / L) was added until the color of iodine disappeared at room temperature to form a disulfide bond. After 30 minutes, sodium ascorbate was added until the color of iodine disappeared, and the solvent was distilled off under reduced pressure. The residue was purified by HPLC (0.1% TFA aqueous solution / 0.1% TFA acetonitrile solution) to obtain white solid cyclic peptide 9-1 (7.0 mg).

MS (ESI m / z): 856.4 (M + H)

RT (min): 1.15

In the same manner as in the synthesis of cyclic peptide 9-1, the cyclic peptide shown in Table 46 below was obtained.

TABLE 46

Cyclic Peptides 10-1

[Formula 175]

Peptide solid phase synthesis was performed using 80 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. N-α- (9-fluorenylmethoxycarbonyl) -L-propargylglycine (Fmoc-Pra-OH), Fmoc-Arg (Pbf) -OH, Fmoc-Trp (Boc) -OH, Fmoc-D- In the order of Cha-OH, Fmoc-Pro-OH, Fmoc-Ala-OH, after peptide elongation, NMP solution of piperidine (20% v / v) was added and reacted for 20 minutes, whereby the N-terminal Fmoc group Deprotection was performed. Azidoacetic acid was condensed in the same manner as amino acids. Copper iodide (7.6 mg), diisopropylethylamine (34.4 μL), tris [(1-benzyl-1H-1,2,3-triazol-4-yl) methyl] amine (6.4 mg), NMP (2.0 mL) was added and the peptide was cyclized by stirring at room temperature for 1 hour. After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. TFA: triisopropylsilane: water (= 95: 2.5: 2.5, 2.4 mL) was added to the reaction solution, and the peptide was removed and deprotected. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. The obtained residue was purified by HPLC (0.1% TFA aqueous solution: 0.1% TFA acetonitrile solution) to obtain white solid cyclic peptide 10-1 (1.26 mg).

MS (ESI m / z): 859.0 (M + H)

RT (min): 1.05

The cyclic peptide shown in Table 47 below was obtained by the same method as the synthesis of cyclic peptide 10-1.

TABLE 47

Evaluation of Membrane Permeability of Synthetic Cyclic Peptides by PAMPA Method

In order to compare and examine the membrane permeability of the synthesized cyclic peptide, PAMPA (Parallel Artificial Membrane Permeability Assay) was performed.

In filter plate (Merck Millipore, Cat. MAIPN4550), L-α-phosphatidylcholine (Avanti, Cat. 840051P, 1.67%), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (Avanti, Cat. 840035P, 0.33%), n-dodecane express (WAKO, 047-21612) / 1-octanol reagent express (Kanto chemical, Cat. 31013-08) = 10: 1 addition of 5 μL phosphorus lipid organic solvent solution Thus, artificial phosphorus lipid membrane was produced.

Measurement method-A

475 μL of 50 mmol / L KPB (potassium phosphate buffer, pH 7.4 or pH 6.5) was added to 25 μL of a DMSO solution containing the compound at a concentration of 20 μmol / L, and diluted to a final concentration of 1 μmol / L. The compound solution was added to the lower side (donor side) by 300 microliters by the artificial phosphorus lipid membrane of PAMPA96 well plate (Filter Plate (Merck Millipore, Cat. MAIPN4550)). 5% DMSO KPB (pH7.4) was added to the upper side (acceptor side) with an artificial phospholipid membrane between them (200 μL). The permeation test through the artificial phospholipid membrane was performed at 25 degreeC for 4 hours. The compound concentration in the solution in the donor plate and the acceptor plate was measured by LC / MS / MS, and the membrane permeation rate _Pe of the compound was calculated from the following formula.

However, C ₀ is the initial concentration of the compound in the donor liquid, t is the test time, A is the membrane filter area = 0.3 cm ² , V _D is the donor liquid amount = 300 μL, and V _A is the acceptor liquid amount = 200 μL, C _D (t) Compound concentration in donor liquid at time t, C _A (t), Compound concentration in acceptor liquid at time t, C _equilibrium = [C _D (t) * V _D + C _A (t) * V _A ] / (V _D + V _A ).

Measurement method-B

475 μL of 50 mmol / L KPB (potassium phosphate buffer, pH7.4 or pH6.5) was added to 25 μL of a DMSO solution containing the compound at a concentration of 200 μmol / L, and diluted to a final concentration of 10 μmol / L. The compound solution was added to the lower side (donor side) by 300 microliters by the artificial phosphorus lipid membrane of PAMPA96 well plate (Filter Plate (Merck Millipore, Cat. MAIPN4550)). 5% DMSO KPB (pH7.4) was added to the upper side (acceptor side) with an artificial phospholipid membrane between them (200 μL). The permeation test through the artificial phospholipid membrane was performed at 25 degreeC for 4 hours. The compound concentration in the solution in the donor plate and the acceptor plate was measured by LC / MS / MS, and the membrane permeation rate _Pe of the compound was calculated from the following formula.

However, C ₀ is the initial concentration of the compound in the donor liquid, t is the test time, A is the membrane filter area = 0.3 cm ² , V _D is the donor liquid amount = 300 μL, and V _A is the acceptor liquid amount = 200 μL, C _D (t) Compound concentration in donor liquid at time t, C _A (t), Compound concentration in acceptor liquid at time t, C _equilibrium = [C _D (t) * V _D + C _A (t) * V _A ] / (V _D + V _A ).

[Equation 1]

The membrane permeability (P _e (10 ^-6 cm / s)) obtained by this method is described in the following table.

Evaluation criteria are as follows.

+++ 0.5 <P _e (10 ^-6 cm / s)

++ 0.2 <P _e (10 ^-6 cm / s) ≤0.5

+ 0.01 < _Pe (10 ^-6 cm / s)

0.01≤P _e (10 ^-6 cm / s)

TABLE 48-1

TABLE 48-2

Table 48-3

The amino acid sequence constituting the cyclic peptide is aligned in the same manner as for the cyclic moiety, and the cyclic peptide is prepared by using the preparation methods of the cyclic peptide of the present invention, the thioether cyclization method, and the triazole cyclization method, and the disulfide cyclization method. Synthesized. For each peptide, cell membrane permeability was evaluated and compared by PAMPA method.

As a result, the cyclic peptide synthesized according to the present invention was able to show that the cell membrane permeability was excellent as compared with the cyclic peptide synthesized by other production methods.

Metabolic Stability Test of Human Hepatic Microsomes of Cyclic Peptides

For the purpose of comparing and examining the metabolic stability of the synthesized cyclic peptide, an experiment using human liver microsomes (HLM) was performed.

In a human liver microsome (BD Cat # 452117) prepared to have a final concentration of 0.5 mg protein / mL using 100 mmol / L phosphate buffer (pH7.4), a compound having a final concentration of 1 μmol / L was reduced nicotinamide adenine. Incubation was carried out at 37 ° C. for 20 minutes in the presence of dinucleotide phosphoric acid (NADPH) and uridine 5′-diphosphate-α-D-glucuronic acid (UDPGA). The protein removal process by acetonitrile was performed, the remaining unchanged body weight was quantified using LC / MS / MS, and the residual ratio (%) in 20 minutes was computed. The HLM residual rate (%) obtained by this method is described in the following table.

Evaluation criteria are as follows.

+++ 60% <HLM survival rate (%)

++ 40% <HLM Retention Percentage (%) ≤60%

+ HLM residual rate (%) ≤ 40%

Table 49

The amino acid sequence constituting the cyclic peptide was aligned in the same manner as for the cyclic moiety, and the cyclic peptide was synthesized using the production method of the cyclic peptide of the present invention and the thioether cyclization method. Each peptide was evaluated and compared by metabolic stability test in human liver microsomes.

As a result, the cyclic peptide synthesized by the present invention was able to show that the metabolic stability was superior to that of the cyclic peptide synthesized by other production methods.

<cDNA display>

Preparation of DNA Library for Display Library

The extension reaction was performed by KOD-plus- (Toyobo Co., Ltd.) using synthetic oligo DNA (SEQ ID NO: 15) and synthetic oligo DNA (SEQ ID NO: 16). After denaturing at 94 ° C for 3 minutes, the cycle of 1 minute at 55 ° C and 2 minutes at 72 ° C was repeated five times. Subsequently, this extension reaction product was subjected to PCR by KOD-plus- (Toyobo Co., Ltd.) using synthetic oligo DNA (SEQ ID NO: 16) and synthetic oligo DNA (SEQ ID NO: 17) as a template. After denaturation at 94 ° C for 2 minutes, a cycle of 1 minute at 94 ° C, 1 minute at 50 ° C, and 1 minute at 68 ° C was repeated five times to construct a DNA library (SEQ ID NO: 18).

The location indicated by N in the array indicates that A, T, G, and C appear randomly, and the point indicated by K means that T and G appear randomly.

Array number 15

AAGAAGGAGATATACATATGTGCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKTAGGGCGGTTCTGGCGGTAGC

Array number 16

ATACTCAAGCTTATTTATTTACCCCCCGCCGCCCCCCGTCCTGCTACCGCCAGAACCGCC

Array number 17

GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATG

Array number 18

GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTGCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKTAGGGCGGTTCTGGCGGTAGCAGGACGGGGGGCGGCGGGGGGCGAGAATAATA

Preparation of mRNA-Puromycin Linker Complex

A DNA library (SEQ ID NO: 18) prepared by PCR was prepared in a template, and mRNA (SEQ ID NO: 19) was prepared using Thermo T7 RNA Polymerase (Toyobo Co., Ltd.), and purified by ethanol precipitation. To 2.8 μmol / L mRNA, 5 μmol / L of the following puromycin linker A (manufactured by Tsukuba Oligo Service) and TBS (25 mmol / L Tris, 500 mmol / L NaCl, pH7.5) were added and reacted at 90 ° C. for 1 minute. After making it, it lowered to 25 degreeC by 0.5 degreeC every 1 minute. Subsequently, after irradiating with 365 nm UV for 30 minutes, it refine | purified by ethanol precipitation and set it as the mRNA- puromycin linker complex.

In the arrangement, "N" indicates that A, U, G, and C appear randomly, and "K" means that U and G appear randomly.

Array number 19

GGGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUUUAACUUUAAGAAGGAGAUAUACAUAUGUGCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKUAGGGCGGUUCUGGCGGUAGCAGGACGGGGGGCGGGUGGGGGGUAAAUAAAUAAGCUUGA

Formula 176

The above is puromycin linker A (made by Tsukuba Oligo Service).

[Formula 177]

The above represents (Sp18).

Preparation of Target Protein

Into the plasmid of pET28a, a gene containing amino acids 1-172 of MCL-1 was introduced, and a plasmid of a construct to which a His6 tag, MBP, HRV3C protease recognition sequence, and 3 x FLAG tag was attached to the N-terminal side was prepared. did. This plasmid was transformed into BL21 (DE3) RIPL strain and cultured at 30 ° C. When O.D. reached 0.8, 0.5 μmol / L of IPTG was added and induction of mass expression was followed by incubation with 16 ° C over night. The recovered cells were suspended in Lysis Buffer B (25 mmol / L Tris (pH 7.5), 300 mmol / L NaCl), and then disrupted by ultrasonication. Centrifugation was performed at 15 krpm and 15 minutes, and the supernatant after centrifugation was refine | purified using Ni-NTA resin (made by QIAGEN). The sample adsorbed on the Ni-NTA resin was washed by lysis Buffer B containing 20 mmol / L imidazole, and then eluted by lysis Buffer B containing 200 mmol / L imidazole. PreScission Protease (manufactured by GE lifescience) was added to the sample, and His6 tag and MBP were cut, and replaced by over night by Dialysis Buffer (25 mmol / L Tris (pH 7.5), 150 mmol / L NaCl) by dialysis. did. After confirming the cleavage of the tag, it was added to amylose resin (New England Bio Labs) substituted by Dialysis Buffer, and the flow-through fraction was fractionated. The obtained sample was concentrated by Amicon Ultra (manufactured by Millipore), and then purified by HiLoad Superdex75 (manufactured by GE lifescience). The obtained sample was concentrated by Amicon Ultra and stored at -80 degreeC.

Fabrication of Protein Immobilized Beads

100 μL of ANTI-FLAG M2 Magnetic Beads (manufactured by Sigma) was washed with TBS (20 mmol / L Tris, 150 mmol / L NaCl, pH7.4), 33 μg of target protein was added, and rotationally mixed for 10 minutes. The protein was bound to the beads. The beads were recovered and washed with TBS to obtain target protein immobilized beads.

Synthesis of Amber Suppressor tRNA (-CA)

Amber suppressor tRNA was synthesized in the same manner as described above.

Synthesis of aminoacyl tRNA-15 (Table 31)

In the same manner as described above, aminoacyl tRNA-15 was obtained.

Translation amount used for panning

Using PUREfrex (registered trademark) custom ver2 (manufactured by Gene Frontier, PFC-Z1802), the following was added to a 10 µL reaction solution.

mRNA-puromycin linker complex: 0.6 μmol / L final concentration

Aminoacyl tRNA-15 aqueous solution (0.2OD / μL): 1μL

Amino acid solution (19 amino acids other than Met, each 0.3 mmol / L mixture): 1.5 μL

Translation, Reverse Transcription, Panning, and PCR for Panning Round 1

The above-mentioned translation liquid was prepared and reacted at 37 degreeC for 30 minutes. To 4 µL of this translation solution, 2 µL of 60 mmol / L EDTA solution was added and left to stand at room temperature for several minutes. Subsequently, ReverTra Ace (manufactured by Toyobo Co., Ltd.), 5 × RT buffer (manufactured by Toyobo Co., Ltd.), 1 mmol / L dNTPs were added to the solution, and the mixture was kept at 30 ° C. for 10 minutes and at 42 ° C. for 30 minutes. Peptide-mRNA complex solution was obtained.

10 microliters of target protein immobilization beads and TBS were added to the above solution, and rotational mixing was performed at room temperature for 45 minutes. The supernatant was removed and washed four times with TBS + 0.05% tween-20, once with TBS, and once with pure water.

1 μL of the beads was added to a PCR solution containing 1 μmol / L primer (SEQ ID NO: 20), 1 μmol / L primer (SEQ ID NO: 21), and KOD-plus- (manufactured by Toyobo Co.) And DNA were purified by a QIAquick PCR purification kit (produced by QIAGEN). The purified DNA was subjected to PCR again using 0.3 μmol / L primer (SEQ ID NO: 22), 0.3 μmol / L primer (SEQ ID NO: 23), and KOD-plus- (manufactured by Toyobo Co., Ltd.), and the QIAquick PCR purification kit. DNA was purified by (QIAGEN).

Array number 20

GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTC

Array number 21

ATACTCAAGCTTATTTATTTACCCCCCGCCGCCCCCCGTCC

Array number 22

GAAATTAATACGACTCACTA

Array number 23

ATACTCAAGCTTATTTATTT

Transcription, mRNA-puromycin linker complex preparation for round 2 panning, translation, reverse transcription reaction, panning, PCR

From cDNA amplified in round 1, mRNA was synthesized using Thermo T7 RNA Polymerase (manufactured by Toyobo Co., Ltd.) and purified by ethanol precipitation. Next, puromycin linker A (the structure is shown in the above formula (176)) was added to the mRNA, and reacted at 90 ° C for 1 minute, and then decreased to 25 ° C by 0.5 ° C every minute. Subsequently, after irradiating with 365 nm UV for 30 minutes, it refine | purified by ethanol precipitation and set it as the mRNA- puromycin linker complex. The 4 μL translation solution containing the 0.6 μmol / L mRNA-puromycin linker complex was prepared, kept at 37 ° C. for 30 minutes, and then 2 μL of 60 mmol / L EDTA solution was added and left at room temperature for several minutes. Subsequently, ReverTra Ace (manufactured by Toyobo Co., Ltd.), 5 × RT buffer (manufactured by Toyobo Co., Ltd.), 1 mmol / L dNTPs were added to the solution, and the mixture was kept at 30 ° C. for 10 minutes and at 42 ° C. for 30 minutes. Peptide-mRNA complex solution was obtained.

10 microliters of target protein immobilization beads and TBS were added to the above solution, and rotational mixing was performed at room temperature for 45 minutes. The supernatant was removed and washed four times with TBS + 0.05% tween-20, once with TBS, and once with pure water.

After adding 1 μL of the beads to the PCR solution containing 1 μmol / L primer (SEQ ID NO: 20), 1 μmol / L primer (SEQ ID NO: 21), and KOD-plus- (manufactured by Toyobo Co., Ltd.), amplifying the cDNA by PCR And DNA were purified by a QIAquick PCR purification kit (produced by QIAGEN). The purified DNA was subjected to PCR again using 0.3 μmol / L primer (SEQ ID NO: 22), 0.3 μmol / L primer (SEQ ID NO: 23), and KOD-plus- (manufactured by Toyobo Co., Ltd.), and the QIAquick PCR purification kit. DNA was purified by (QIAGEN).

Also in round 3, the same operation as in round 2 was repeated to concentrate cDNA showing a target protein specific binding. Nucleotide sequence analysis of the concentrated DNA pool was performed to identify the concentrated peptide sequence.

Chemical Synthesis of Concentrated Peptide Sequence Synthesis of Cyclic Peptides a-5-1

[Formula 178]

Peptide solid phase synthesis was performed using 100 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. (S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (6-cyanopyridin-2-yl) propionic acid, N-α- (9- Fluorenylmethoxycarbonyl) -O- (t-butyl) -L-tyrosine (Fmoc-Tyr (tBu) -OH), Fmoc-Trp (Boc) -OH, Fmoc-L-Leu-OH, Fmoc-Phe -OH, Fmoc-Ala-OH, Fmoc-Pro-OH, Fmoc-Trp (Boc) -OH, Fmoc-Leu-OH, N-α- (9-fluorenylmethoxycarbonyl) -S-trityl- L-cysteine (Fmoc-Cys (Trt) -OH), Fmoc-Ala-OH, Fmoc-Trp (Boc) -OH, N-α- (9-fluorenylmethoxycarbonyl) -Ot-butyl-L- Condensation was performed in the order of serine (Fmoc-Ser (OtBu) -OH), Fmoc-Arg (Pbf) -OH, and Fmoc-Cys (Trt) -OH. After completion of the extension, an NMP solution of piperidine (20% v / v) was added and reacted for 20 minutes to deprotect the Fmoc group. After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. To the reaction solution was added TFA: 3,6-dioxa-1,8-octanedithiol: triisopropylsilane: water (= 92.5: 2.5: 2.5: 2.5, 3.0 mL) to remove the peptide and Deprotection was performed. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. Phosphoric acid buffer (pH7.0, 2.5 mL), methanol (2.5 mL) and tris (2-carboxyethyl) phosphine (0.5 mol / L, 0.025 mL) aqueous solution were added to the obtained solid, and the mixture was stirred at 45 ° C for 40 minutes. . The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% formic acid aqueous solution: 0.1% formic acid acetonitrile solution), and then neutralized by adding hydrogen triethylammonium carbonate solution (1.0 m, pH8.5). The solvent was distilled off under reduced pressure to thereby give a colorless oily cyclic peptide a-5-1 (21.7 mg).

MS (ESI m / z): 1957.6 (M + H)

RT (min): 1.40

Synthesis of Cyclic Peptides a-5-2

[Formula 179]

It carried out similarly to cyclic peptide a-5-1.

MS (ESI m / z): 1979.4 (M + H)

RT (min): 1.67

Synthesis of Cyclic Peptides a-5-3

[Formula 180]

Peptide solid phase synthesis was performed using 100 mg of Rink Amide-ChemMatrix (0.5 mmol / g) as a starting material. (S) -2-(((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (6-cyanopyridin-2-yl) propionic acid, Fmoc-Phe-OH, Fmoc -Ala-OH, Fmoc-Leu-OH, Fmoc-Pro-OH, Fmoc-Leu-OH, Fmoc-Phe-OH, N-α- (9-fluorenylmethoxycarbonyl) -N5-trityl-L Glutamine (Fmoc-L-Gln (Trt) -OH), Fmoc-Pro-OH, Fmoc-L-Trp (Boc) -OH, Fmoc-Leu-OH, Fmoc-Leu-OH, Fmoc-Ala-OH, Condensation was performed in the order of Fmoc-Phe-OH and Fmoc-Cys (Trt) -OH. After the extension was completed, the resin was washed with dichloromethane, and then the solvent was distilled off under reduced pressure. To the reaction solution was added TFA: 3,6-dioxa-1,8-octanedithiol: triisopropylsilane: water (= 92.5: 2.5: 2.5: 2.5, 3.0 mL) to remove the peptide and Deprotection was performed. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. Phosphoric acid buffer (pH7.0, 2.5 mL), methanol (2.5 mL), and tris (2-carboxyethyl) phosphine (0.5 mol / L, 0.025 mL) aqueous solution were added to the obtained solid, and it stirred at room temperature for 2 hours. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% formic acid aqueous solution: 0.1% formic acid acetonitrile solution), and then neutralized by adding hydrogen triethylammonium carbonate solution (1.0 m, pH8.5). The solvent was distilled off under reduced pressure to obtain a colorless oily cyclic peptide a-5-3 (13.4 mg).

MS (ESI m / z): 1821.3 (M + H)

RT (min): 1.56

In the same manner as the cyclic peptide a-5-3, the compound shown in Table 50 below was obtained.

TABLE 50-1

Table 50-2

Preparation of Target Protein

The gene containing the amino acid 1-172 part of MCL-1 was introduce | transduced into the plasmid of pET28a, and the plasmid of the construct to which the His6 tag, MBP, and TEV protease recognition sequence was provided at the N terminal side was prepared. This plasmid was transformed with BL21 (DE3) RIPL strains and incubated at 30 ° C. When O.D. reached 0.8, 0.5 mmol / L of IPTG was added and induction of mass expression was followed by incubation with 16 ° C. over night. The recovered cells were suspended in Lysis Buffer A (25 mmol / L Tris (pH 7.5), 150 mmol / L NaCl), and then disrupted by ultrasonication. Centrifugation was performed at 15 krpm and 15 minutes, and the supernatant after centrifugation was refine | purified using Ni-NTA resin (made by QIAGEN). Samples adsorbed onto the Ni-NTA resin were washed by lysis Buffer A containing 15 mmol / L imidazole, and then eluted by lysis Buffer A containing 200 mmol / L imidazole. Samples were stored at -80 ° C after replacement with Lysis Buffer by dialysis.

Evaluation of binding of synthetic peptides to target proteins using surface plasmon resonance (SPR)

SPR experiment of the interaction analysis of the synthetic peptide and Mcl-1 was performed at 25 ° C using Biacore T200 (GE healthcare). For the immobilized protein, synthetic peptide was added and the interaction was evaluated.

As a running buffer, what added dimethyl formamide (DMF) or dimethyl sulfoxide (DMSO) to HBS-EP + (made by GE healthcare company) so that the final concentration might be 1 vol% was used. Using Amine Coupling Kit (manufactured by GE healthcare), Mcl-1 was immobilized on the sensor chip Series S Sensor Chip CM5 (manufactured by GE healthcare) for buyer core. In order to measure the dissociation constant (KD), each synthetic peptide was added at a plurality of concentrations, and a sensor gram of binding to immobilized Mcl-1 was obtained.

The obtained sensorgram was analyzed using T200 evaluation software (manufactured by GE healthcare). Solvent correction for DMF or DMSO was performed, and then KD was determined by equilibrium analysis using a sensorgram obtained by subtracting the sensorgram to a flow cell in which Mcl-1 was not immobilized. The result obtained by analyzing as mentioned above is shown to the following table | surface.

What was K and less than 50 micromol / L, and what was more than 50 micromol / L are described as B.

Table 51

mRNA display

Preparation of DNA Library for Display Library

DNA library was prepared similarly to the method mentioned above.

Preparation of mRNA-Puromycin Linker Complex

A DNA library (SEQ ID NO: 18) prepared by PCR was prepared in a template, and mRNA (SEQ ID NO: 19) was prepared using Thermo T7 RNA Polymerase (Toyobo Co., Ltd.), and purified by ethanol precipitation. To 2.8 μmol / L mRNA, 5 μmol / L of Puromycin Linker B (manufactured by Tsukuba Oligo Service) (structure is shown below in Formula 181), TBS (25 mmol / L Tris, 500 mmol / L NaCl, pH7.5) It added and made it react at 90 degreeC for 5 minutes, and it lowered to 25 degreeC. Subsequently, 365 nm UV was irradiated for 2 minutes, and it refine | purified by ethanol precipitation, and set it as the mRNA-puromycin linker complex.

[Formula 181]

The above is puromycin B (manufactured by Tsukuba Oligo Service).

[Formula 182]

Preparation of Target Protein

The target protein was prepared in the same manner as described above.

Fabrication of Protein Immobilized Beads

Protein immobilization beads were prepared in the same manner as described above.

Synthesis of Amber Suppressor tRNA (-CA)

Amber suppressor tRNA was synthesized in the same manner as described above.

Synthesis of aminoacyl tRNA-10 (Table 31)

In the same manner as described above, aminoacyl tRNA-10 was obtained.

Translation amount used for panning

The following was added with respect to 10 microliters of reaction liquids using PUREfrex (trademark) custom ver2 (made by Gene Frontier, PFC-Z1802).

mRNA-puromycin linker complex: 0.6 μmol / L final concentration

Amino acyl tRNA-10 aqueous solution (0.2OD / μL): 1μL

Amino acid solution (19 amino acids other than Met, each 0.3 mmol / L mixture): 1.5 μL

Translation, panning, reverse transcription reaction, PCR for panning round 1

The above-mentioned translation liquid was prepared and reacted at 37 degreeC for 30 minutes. To 4 µL of this translation solution, 10 µL of target protein immobilization beads and TBS (20 mmol / L Tris, 150 mmol / L NaCl, pH7.4) were added, followed by rotational mixing at room temperature for 45 minutes. The supernatant was removed and washed four times with TBS + 0.05% tween-20, once with TBS, and once with pure water. Subsequently, ReverTra Ace (manufactured by Toyobo Co., Ltd.), 5 × RT buffer (manufactured by Toyobo Co., Ltd.), 1 mmol / L dNTPs were added to the beads solution, and kept at 30 ° C. for 10 minutes at 42 ° C. for 30 minutes, followed by reverse transcription. Peptide-mRNA complex solution was obtained.

1 μL of the beads was added to a PCR solution containing 1 μmol / L primer (SEQ ID NO: 20), 1 μmol / L primer (SEQ ID NO: 24), and KOD-Multi & Epi- (manufactured by Toyobo Co., Ltd.), and amplified cDNA by PCR. And DNA were purified by a QIAquick PCR purification kit (produced by QIAGEN).

Array number 24

ATACTCAAGCTTATTTATTTACCCCCCGCCGCCCCCCGTCCTGCTACCGCCAGAACCGCCCTA

Transcription, mRNA-puromycin linker complex preparation for round 2 panning, translation, panning, reverse transcription reaction, PCR

From cDNA amplified in round 1, mRNA was synthesized using Thermo T7 RNA Polymerase (manufactured by Toyobo Co., Ltd.) and purified by RNeady MinElute Cleanup Kit (manufactured by QIAGEN). Next, puromycin linker B (structure shown in the above formula (181)) was added to the mRNA, and reacted at 90 ° C for 5 minutes, and then lowered to 25 ° C. Subsequently, 365 nm UV was irradiated for 2 minutes, and it refine | purified by ethanol precipitation, and set it as the mRNA-puromycin linker complex. The 4 μL translation solution containing the 0.6 μmol / L mRNA-puromycin linker complex was prepared and kept at 37 ° C. for 30 minutes. To this solution, 10 µL of ANTI-FLAG M2 Magnetic Beads (manufactured by sigma) and TBS were added, conduction mixing was performed at room temperature for 10 minutes, and the supernatant was recovered three times. 10 µL of target protein immobilized beads and TBS were added to the supernatant, and rotational mixing was performed at room temperature for 45 minutes. The supernatant was removed and washed four times with TBS + 0.05% tween-20, once with TBS, and once with pure water. Subsequently, ReverTra Ace (manufactured by Toyobo Co., Ltd.), 5 × RT buffer (manufactured by Toyobo Co., Ltd.), 1 mmol / L dNTPs were added to the beads solution, and kept at 30 ° C. for 10 minutes at 42 ° C. for 30 minutes, followed by reverse transcription. Peptide-mRNA complex solution was obtained.

1 μL of the beads was added to a PCR solution containing 1 μmol / L primer (SEQ ID NO: 20), 1 μmol / L primer (SEQ ID NO: 24), and KOD-Multi & Epi- (manufactured by Toyobo Co., Ltd.), and amplified cDNA by PCR. And DNA were purified by a QIAquick PCR purification kit (produced by QIAGEN).

Also in round 3 and round 4, the same operation as in round 2 was repeated to concentrate cDNA showing a target protein specific binding. Nucleotide sequence analysis of the concentrated DNA pool was performed to identify the concentrated peptide sequence.

Chemical Synthesis of Concentrated Peptide Sequences

Synthesis of Cyclic Peptide a-6-1

[Formula 183]

Peptide solid phase synthesis was performed using Rink Amide-ChemMatrix (0.48 mmol / g, 104 mg) as a starting material. 2-((((9H-Fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3-yl) propanoic acid, Fmoc-Arg (Pbf) -OH, Fmoc-Arg (Pbf) -OH, Fmoc-Phe-OH, Fmoc-Leu-OH, Fmoc-Pro-OH, Fmoc-Trp (Boc) -OH, Fmoc-Phe-OH, N-α- (9-flu Orenylmethoxycarbonyl) -O- (t-butyl) -L-threonine (Fmoc-Thr (tBu) -OH), Fmoc-Pro-OH, N-α- (9-fluorenylmethoxycarbonyl)- L-aspartic acid β-t-butyl ester (Fmoc-Asp (OtBu) -OH), Fmoc-Cys (Trt) -OH, Fmoc-Tyr (tBu) -OH, N-α- (9-fluorenylme Condensation was carried out in the order of oxycarbonyl) -L-glutamic acid γ-t-butyl ester (Fmoc-Glu (tBu) -OH) and Boc-Cys (Trt) -OH. After the resin was washed with dichloromethane, the solvent was distilled off under reduced pressure. To the reaction solution was added TFA: 3,6-dioxa-1,8-octanedithiol: triisopropylsilane: water (= 92.5: 2.5: 2.5: 2.5, 3.0 mL) to remove the peptide and Deprotection was performed. After 2 hours, the resin was separated by filtration and n-hexane: methyl-t-butylether (= 1: 1, 12 mL) was added to the filtrate to generate a solid. After centrifugation to precipitate a solid, the supernatant was removed. The solid was washed with methyl t-butyl ether, and then the solvent was distilled off under reduced pressure. Phosphoric acid buffer (pH7.0, 5 mL), methanol (5 mL) and tris (2-carboxyethyl) phosphine (0.5 mol / L, 0.1 mL) aqueous solution were added to the obtained solid, and reaction was performed for 48 hours. The solvent was evaporated under reduced pressure, and the obtained residue was purified by HPLC (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution), and then hydrogen triethylammonium carbonate solution (1.0 mol / L, pH8.5) was added. And after adjusting pH to neutral, the solvent was distilled off under reduced pressure and the white solid cyclic peptide a-6-1 (7.6 mg) was obtained.

MS (ESI m / z): 1993.3 (M + H)

RT (min): 1.10

In the same manner as the cyclic peptide a-6-1, the cyclic peptide shown in Table 52 below was obtained.

Table 52-1

Table 52-2

Identification of the site of cyclization of a-6-7

Formula 184

a-6-7 represents 2-((((9H-fluoren-9-yl) methoxy) carbonyl) amino) -3- (5-cyanothiophen-3-yl) propanoic acid as a cyclization site Since it contained in two places, trypsin digestion was performed for structure determination. A solution of hydrogen triethylammonium carbonate (50 mmol / L, pH8.5, 95 μL) of trypsin (0.01 mg) (manufactured by Wako Junyaku Kogyo Co., Ltd.) was added to a DMSO solution (20 mm, 5 μL) of a-6-7, and 37 ° C. In 2 hours politics. When the reaction solution was analyzed by LC / MS, and two types of MS (1015.1 and 736.1) were observed, the cyclization site was confirmed to be the amino acid of the fifth residue from the N terminus.

Preparation of Target Protein

The target protein was prepared in the same manner as described above.

Evaluation of binding of synthetic peptides to target proteins using surface plasmon resonance (SPR)

The binding of the synthetic peptide to the target protein was evaluated in the same manner as described above. The obtained KD is shown in the following table | surfaces.

What was K and less than 50 micromol / L, and what was more than 50 micromol / L are described as B.

Table 53

Industrial availability

The cyclic peptide obtained by the manufacturing method of the present invention and the selection method is used as an active ingredient in medicines, pesticides, biochemical test reagents, cell culture additives, cosmetics, and functional foods, and is used as a filter or column chromatography. It can also be used as a separating agent. The cyclic peptide obtained by the manufacturing method of this invention and the selection method can also be used also as a catalyst which accelerate | stimulates a synthesis reaction, the dispersing agent of the pigment | dye and nanoparticle microfine solid, and the gelling agent of aqueous solution.

An array table

International Application 17F02646 Peptide Compound Based on International Accepted Patent Cooperation Treaty and Method for Manufacturing JP18011143 20180320 ---- 03370483151800582611 Normal 20180320163216201803071101443430_P1AP101__17_326.app

SEQUENCE LISTING <110> FUJIFILM Corporation <120> A cyclic peptide compound and a production method particular, and a method for selection of cyclic peptide compound <130>? 17F02646 <160> 24 <170> PatentIn version 3.5 <210> 1 <211> 169 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 1 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaacagaa accgcggagc aaaaactaga 120 gcgactacaa agacgatgac gacaaataag cttgagtatt ctatagtgt 169 <210> 2 <211> 169 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 2 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaatgcaa accgcggagc aaaaactaga 120 gcgactacaa agacgatgac gacaaataag cttgagtatt ctatagtgt 169 <210> 3 <211> 169 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 3 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaacagaa accgcggtgc aaaaactaga 120 gcgactacaa agacgatgac gacaaataag cttgagtatt ctatagtgt 169 <210> 4 <211> 169 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 4 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcgcgcaggc gccgcggagc gcgaactaga 120 gcgactacaa agacgatgac gacaaataag cttgagtatt ctatagtgt 169 <210> 5 <211> 166 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 5 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaacagaa accgcggagc aaatagagcg 120 actacaaaga cgatgacgac aaataagctt gagtattcta tagtgt 166 <210> 6 <211> 163 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 6 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaacagaa accgcggagc tagagcgact 120 acaaagacga tgacgacaaa taagcttgag tattctatag tgt 163 <210> 7 <211> 160 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 7 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaacagaa accgcggtag agcgactaca 120 aagacgatga cgacaaataa gcttgagtat tctatagtgt 160 <210> 8 <211> 157 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 8 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaacagaa accgtagagc gactacaaag 120 acgatgacga caaataagct tgagtattct atagtgt 157 <210> 9 <211> 154 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 9 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaacagaa atagagcgac tacaaagacg 120 atgacgacaa ataagcttga gtattctata gtgt 154 <210> 10 <211> 184 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 10 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaacagaa accgcggagc aaaaacccgt 120 tttggtgcca ttagagcgac tacaaagacg atgacgacaa ataagcttga gtattctata 180 gtgt 184 <210> 11 <211> 199 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 11 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcaaacagaa accgcggagc aaaaaccaga 120 aacggaacag cccgttttgg tgccattaga gcgactacaa agacgatgac gacaaataag 180 cttgagtatt ctatagtgt 199 <210> 12 <211> 169 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 12 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gccagaaact ggtgttcttt gcggaataga 120 gcgactacaa agacgatgac gacaaataag cttgagtatt ctatagtgt 169 <210> 13 <211> 169 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 13 cgaaattaat acgactcact atagggagac cacaacggtt tccctctaga aataattttg 60 tttaacttta agaaggagat atacatatgt gcgcgatcat tggcctgtgc gtgggctaga 120 gcgactacaa agacgatgac gacaaataag cttgagtatt ctatagtgt 169 <210> 14 <211> 75 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: tRNA gene <400> 14 gggagaguag uucaauggua gaacgucggu cucuaaaacc gagcguugag gguucgauuc 60 cuuucucucc cacca 75 <210> 15 <211> 83 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 15 aagaaggaga tatacatatg tgcnnknnkn nknnknnknn knnknnknnk nnknnknnkn 60 nktagggcgg ttctggcggt agc 83 <210> 16 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 16 atactcaagc ttatttattt accccccgcc gccccccgtc ctgctaccgc cagaaccgcc 60 <210> 17 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 17 gaaattaata cgactcacta tagggagacc acaacggttt ccctctagaa ataattttgt 60 ttaactttaa gaaggagata tacatatg 88 <210> 18 <211> 193 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA prepared by PCR <400> 18 gaaattaata cgactcacta tagggagacc acaacggttt ccctctagaa ataattttgt 60 ttaactttaa gaaggagata tacatatgtg cnnknnknnk nnknnknnkn nknnknnknn 120 knnknnknnk tagggcggtt ctggcggtag caggacgggg ggcggcgggg ggtaaataaa 180 taagcttgag tat 193 <210> 19 <211> 171 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: mRNA prepared by RNA polymerase <400> 19 gggagaccac aacgguuucc cucuagaaau aauuuuguuu aacuuuaaga aggagauaua 60 cauaugugcn nknnknnknn knnknnknnk nnknnknnkn nknnknnkua gggcgguucu 120 ggcgguagca ggacgggggg cggcgggggg uaaauaaaua agcuugagua u 171 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 20 gaaattaata cgactcacta tagggagacc acaacggttt ccctc 45 <210> 21 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 21 atactcaagc ttatttattt accccccgcc gccccccgtc c 41 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 22 gaaattaata cgactcacta 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 23 atactcaagc ttatttattt 20 <210> 24 <211> 63 <212> dna <213> artificial sequence <220> <223> description of artificial sequence: synthetic oligonucleotide <400> 24 atactcaagc ttatttattt accccccgcc gccccccgtc ctgctaccgc cagaaccgcc 60 cta 63

Claims (24)

Peptide compound or its salt represented by following formula (1).

In the formula,
X represents S, NH, or O,
A represents a divalent group represented by * -CR ⁰ = C (B)-which becomes one with a carbon atom to which a C1 or 2 straight-chain alkylene group which may have a single bond, a substituent, or B couple | bonds, and R ⁰ represents a hydrogen atom or a substituent, * represents a position to bond with X,
B represents a C1-C2 linear alkylene group which may have a single bond or a substituent, provided that A and B are not a single bond at the same time,
Z represents a hydroxyl group or an amino group,
p piece R may be same or different, and may represent the hetero arylene group which may have a substituent, or the C6-C10 arylene group which may have a substituent,
G represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms that may have a substituent when the carbon to which G is bonded is one with A and does not represent a divalent group represented by * -CR ⁰ = C (B)-. Indicate,
t ¹ W ¹ may be the same or different and is a single bond, -CH ₂ (C ₆ H ₅ NH)-, -CH ₂ (C ₆ H ₅ O)-, an amino acid residue which may have a substituent, or a substituent. The heteroarylene group which may have, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown,
t ² W ² may be the same or different and is a single bond, -CO-, -COO-, -NHCO-, -NHCONH-, -CONHCO-,-(CH ₂ CH ₂ O)-,-(CH ₂ CH ₂ CH ₂ O)-, the amino acid residue which may have a substituent, the heteroarylene group which may have a substituent, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkyl which may have a substituent Represents a Lengi,
J represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms which may have a substituent, each of n Xaa 's independently represents any amino acid residue or any amino acid flexible residue,
m Xbbs each independently represent any amino acid residue or any amino acid flexible residue,
p represents the integer of 0-4,
t ¹ is an integer of 0-6,
t ² represents an integer of 0 to 6,
m represents an integer of 0 to 20,
n represents the integer of 1-20. The method of claim 1,
Peptide compound or its salt whose peptide compound represented by said Formula (1) is a peptide compound represented by following formula (1A).

In the formula,
A <^1> represents the bivalent group represented by * -CH = C (N)-and becomes one with the C1-C2 linear alkylene group which may have a substituent, or the carbon atom which N couple | bonds, and * is S Indicates the position to join with,
p ¹ R ¹ may be the same or different and represents a heteroarylene group which may have a substituent, or an arylene group having 6 to 10 carbon atoms, which may have a substituent;
t ¹¹ W ¹¹ may be the same or different and are a single bond, -CH ₂ (C ₆ H ₅ NH)-, -CH ₂ (C ₆ H ₅ O)-, an amino acid residue which may have a substituent, or a substituent The heteroarylene group which may have, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown,
t ²¹ W ²¹ may be the same or different and are a single bond, -CO-, -COO-, -NHCO-, -NHCONH-, -CONHCO-,-(CH ₂ CH ₂ O)-,-(CH ₂ CH ₂ CH ₂ O)-, the amino acid residue which may have a substituent, the heteroarylene group which may have a substituent, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkyl which may have a substituent Represents a Len group,
G ¹ is a C 1-6 carbon that may have a hydrogen atom or a substituent when the carbon to which G ¹ is bonded is ^one with A ¹ and does not represent a divalent group represented by * —CH═C (N)-. Represents an alkyl group,
J ¹ represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms which may have a substituent,
p ¹ represents the integer of 0-4,
t ¹¹ represents an integer of 0 to 6,
²¹ t is an integer of 0-6,
Z, Xaa, Xbb, m, and n represent the same meaning as the definition in Claim 1. The method of claim 1,
Peptide compound or its salt whose peptide compound represented by said Formula (1) is a peptide compound represented by following formula (1B).

In the formula,
A <^2> represents the bivalent group represented by * -CH = C (N)-which becomes one with the C1-C2 linear alkylene group which may have a substituent, or the carbon atom which N couple | bonds, and * is S Indicates the position to join with,
G ² is a C 1-6 carbon having a hydrogen atom or a substituent when the carbon to which G ² is bonded is one with A ² and does not represent a divalent group represented by * -CH = C (N)-. Represents an alkyl group,
J ² represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms which may have a substituent,
p <^2> R <^2> may be same or different and represents the heteroarylene group which may have a substituent, or the C6-C10 arylene group which may have a substituent,
p ² represents an integer of 0 to 4,
q ² represents the integer of 0-6,
However, p ² and q ² do not become 0 at the same time.
Z, Xaa, Xbb, m, and n represent the same meaning as the definition in Claim 1. The method according to any one of claims 1 to 3,
The benzothiazole which the said R, R <^1> or R <^2> may have a substituent, the benzoxazolylene group which may have a substituent, the benzimidazolylene group which may have a substituent, and the benzothio which may have a substituent A phenylene group, the benzofuranylene group which may have a substituent, the isobenzofuranylene group which may have a substituent, the indolylene group which may have a substituent, the quinolineylene group which may have a substituent, and the isoquinolinyl which may have a substituent A benzene group, a quinazolylene group which may have a substituent, a cynolylene group which may have a substituent, an indazole ylene group which may have a substituent, a benzothiazole diene group which may have a substituent, and a pyridinylene group which may have a substituent The pyridazine ylene group which may have a substituent, the pyri may may have a substituent Midinylene group, the pyrazinylene group which may have a substituent, the thiazole ylene group which may have a substituent, the imidazole ylene group which may have a substituent, the oxazolylene group which may have a substituent, and the oxadiazolyl which may have a substituent Imide group which may have a ethylene group, the thiadiazole ylene group which may have a substituent, the pyrazole ylene group which may have a substituent, the isoxazole zylene group which may have a substituent, the triazole ylene group which may have a substituent, and a substituent Thiazolylene group, imidazopyridinylene group which may have a substituent, imidazopyridazine ylene group which may have a substituent, imidazopyrimidine ylene group which may have a substituent, and imidazopyrazine ylene group which may have a substituent A pyrazolopyrimidinylene group which may have a substituent, A pyrrolopyridinylene group which may have ventilation, a thiophenylene group which may have a substituent, a furanylene group which may have a substituent, a pyrrolene group which may have a substituent, a phenylene group which may have a substituent, and a substituent Peptide compound or its salt which is at least 1 structure chosen from the naphthylene group which may have. The method according to any one of claims 1 to 4,
R or R ¹ or R ² may be substituted with a benzothiophenylene group which may have a substituent, an indolylene group which may have a substituent, a quinolineylene group which may have a substituent, or an indazole ylene group which may have a substituent. Pyrrolopyridinylene group which may have, Imidazopyrazine ylene group which may have a substituent, Pyridinylene group which may have a substituent, Pyridazineylene group which may have a substituent, Pyrazinylene group which may have a substituent, and a substituent At least one selected from a thiazole ylene group which may have, an oxazole ylene group which may have a substituent, a triazole ylene group which may have a substituent, a thiophenylene group which may have a substituent, and a phenylene group which may have a substituent Peptide compound or a salt thereof which is a structure of. The method according to any one of claims 1 to 5,
A peptide compound or a salt thereof, wherein the total number of amino acid residues and amino acid flexible bodies constituting the annular portion of the peptide compound is 3 to 20. The method according to any one of claims 1 to 6,
Peptide compound or its salt whose total number of amino acid residue and amino acid flexible body residue which comprise the said peptide compound is 3-20. The composition for screening containing the peptide compound of any one of Claims 1-7, or its salt. A target material comprising contacting a target material with a peptide library comprising the peptide compound or salt thereof according to any one of claims 1 to 7, and selecting the peptide compound or salt thereof that binds to the target material. Method for selecting a peptide compound or salt thereof that binds to. Preparing a peptide chain having an amino acid residue or an amino acid flexible residue having a cyano group in the side chain at the C-terminus or at the C-terminus, and having the structure of Formula (2) at the N-terminus; And,
The manufacturing method of the peptide compound or its salt containing the process of reacting said cyano group with the structure of following formula (2), and forming the annular part which has a bond represented by following formula (3).

In the formula, X represents S, NH, or O,
A represents a C1-C2 linear alkylene group which may have a single bond or a substituent,
B represents a C1-C2 linear alkylene group which may have a single bond or a substituent,
G represents a hydrogen atom or a C1-C6 alkyl group which may have a substituent,
* Represents a binding site to the peptide chain,
A and B are not single bonds at the same time:

In formula, X, A, G, and B are synonymous with the definition in Formula (2). Producing a peptide compound having an annular portion by the method according to claim 10; And
A method of selecting a peptide compound that binds to a target material, the method comprising contacting a peptide library comprising the peptide compound or a salt thereof with a target material and selecting a peptide compound or a salt thereof that binds to the target material. The method of claim 11,
The selection method including the following process.
(i) preparing a library containing a peptide compound prepared by preparing a nucleic acid library, translating by a cell-free translation system containing a renal tRNA acylated with a non-natural amino acid, wherein the non-natural amino acid is randomly introduced into a peptide sequence. Process of doing;
(ii) contacting the peptide library with the target material;
(iii) selecting a peptide compound that binds to the target substance
In the step (i), each peptide compound constituting the library is translated from a nucleic acid sequence encoding each peptide compound constituting the library, and the nucleic acid sequence and the peptide as a translation product are linked to construct an in vitro display library. ,
The process of (iii) includes determining a nucleic acid sequence encoding a peptide compound that binds a target substance, determining a peptide sequence from the nucleic acid sequence, and selecting a peptide compound. The method according to any one of claims 10 to 12,
The said amino acid residue and / or the said amino acid flexible residue which have the said cyano group in a side chain are a structure represented by following formula (4).

In the formula,
m <^1> Q <^1> may be same or different and is at least among the heteroarylene group which may have a substituent, the C6-C10 arylene group which may have a substituent, and the C1-C6 alkylene group which may have a substituent. 1 type,
T ¹ represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms which may have a substituent,
n ¹ is an integer of 0 ~ 6, m ¹ represents an integer of 1 to 4;
* Indicates a binding position with amino acid residues and / or amino acid flexible residues constituting the peptide chain. The method according to any one of claims 10 to 12,
The said amino acid residue and / or the said amino acid flexible residue which have the said cyano group in a side chain are a structure represented by following formula (5).

In the formula,
l and ² Q ² are, the same or different, each represent a single _{bond, -CH 2 (C 6 H 5} NH) -, -CH 2 (C 6 H 5 O) -, the amino acid residues, the substituent which may have a substituent The heteroarylene group which may have, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkylene group which may have a substituent is shown,
n ² Q ³ may be the same or different and are a single bond, -CO-, -COO-, -NHCO-, -NHCONH-, -CONHCO-,-(CH ₂ CH ₂ O)-,-(CH ₂ CH ₂ CH ₂ O)-, the amino acid residue which may have a substituent, the heteroarylene group which may have a substituent, the C6-C20 arylene group which may have a substituent, or the C1-C6 alkyl which may have a substituent Represents a Len group,
m <^2> Q <^4> may be same or different and is at least among the heteroarylene group which may have a substituent, the C6-C10 arylene group which may have a substituent, and the C1-C6 alkylene group which may have a substituent. 1 type,
T ² represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms which may have a substituent,
l ² represents the integer of 0-6,
n ² represents an integer of 0 to 6,
m ² represents the integer of 1-4,
* Indicates a binding position with amino acid residues and / or amino acid flexible residues constituting the peptide chain. The method according to claim 13 or 14,
Q ¹ or Q ⁴ may be a benzothiazole ylene group which may have a substituent, a benzoxazole ylene group which may have a substituent, a benzimidazole ylene group which may have a substituent, or a benzothiophenylene group which may have a substituent. Benzofuranylene group which may have a substituent, isobenzofuranylene group which may have a substituent, indolylene group which may have a substituent, quinolineylene group which may have a substituent, isoquinolinylene group which may have a substituent, Quinazolylene group which may have a substituent, Cynolylene group which may have a substituent, Indazole ylene group which may have a substituent, Benzothiadiazolylene group which may have a substituent, Pyridinylene group which may have a substituent, A substituent The pyridazine ylene group which may have, and the pyrimi which may have a substituent Dynylene group, the pyrazinylene group which may have a substituent, the thiazole ylene group which may have a substituent, the imidazole ylene group which may have a substituent, the oxazolylene group which may have a substituent, and the oxadiazole ylene group which may have a substituent , The thiadiazole ylene group which may have a substituent, the pyrazol ylene group which may have a substituent, the isooxazolylene group which may have a substituent, the triazole ylene group which may have a substituent, and the imidazosy which may have a substituent Azole ylene group, the imidazopyridinylene group which may have a substituent, the imidazopyridazine ylene group which may have a substituent, the imidazopyrimidine ylene group which may have a substituent, the imidazopyrazine ylene group which may have a substituent, Pyrazolopyrimidinylene groups which may have a substituent, It has a pyrrolopyridinylene group which may have a group, the thiophenylene group which may have a substituent, the furanylene group which may have a substituent, the pyrrolene group which may have a substituent, the phenylene group which may have a substituent, and a substituent The method which is at least 1 structure chosen from the naphthylene group which may be present. The method according to any one of claims 13 to 15,
Q ¹ or Q ⁴ may have a benzothiophenylene group which may have a substituent, an indolylene group which may have a substituent, a quinolineylene group which may have a substituent, or an indazoleylene group which may have a substituent. It may have a pyrrolopyridinylene group, an imidazopyrazinylene group which may have a substituent, a pyridinylene group which may have a substituent, a pyridazineylene group which may have a substituent, a pyrazineylene group which may have a substituent, and a substituent At least one structure selected from the group consisting of a thiazolylene group, an oxazolylene group which may have a substituent, a triazoleylene group which may have a substituent, a thiophenylene group which may have a substituent, and a phenylene group which may have a substituent That's how. The method according to any one of claims 10 to 16,
The said formula (2) is a structure represented by following formula (2A).

In formula, A <^1> represents the C1-C2 linear alkylene group which may have a substituent. G represents a hydrogen atom or a C1-C6 alkyl group which may have a substituent. The method according to any one of claims 10 to 17,
The formula (2) is at least one structure selected from the following formula.

The method according to any one of claims 10 to 18,
The reaction solvent of the process of reacting the said cyano group and the structure of the said Formula (2), and forming the bond represented by the said Formula (3) is water. The method according to any one of claims 10 to 19,
The pH of the reaction liquid of the process of reacting the said cyano group and the structure of the said Formula (2), and forming the bond represented by the said Formula (3) is 6.0-8.5. The method according to any one of claims 10 to 20,
The total number of the amino acid residue and amino acid flexible body residue which comprise the annular part of the peptide compound which has the said annular part is 3-20. The method according to any one of claims 10 to 21,
And the total number of amino acid residues and amino acid flexible bodies constituting the peptide compound having the annular portion is 3 to 20. The method according to any one of claims 10 to 22,
The amino acid residue or amino acid flexible residue which has a heteroarylene group which has the said cyano group, the aryl group which has a cyano group, or the alkylene group which has a cyano group in a side chain is a natural amino acid with respect to the codon assigned in translation of a natural amino acid. Wherein the codon, terminator codon, or tetrabasic codon is emptied by exclusion and introduced into the peptide chain. A peptide compound having a toroid or a salt thereof,
The said annular part is a screening composition containing the peptide compound which has a structure represented by following formula (6), or its salt.

In the formula,
X represents S, NH, or O,
A represents a divalent group represented by * -CR ⁰ = C (B)-which becomes one with a carbon atom to which a C1 or 2 straight-chain alkylene group which may have a single bond, a substituent, or B couple | bonds, and R ⁰ represents a hydrogen atom or a substituent, * represents a position to bond with X,
B represents a C1-C2 linear alkylene group which may have a single bond or a substituent, provided that A and B are not a single bond at the same time,
p piece R may be same or different, and may represent the hetero arylene group which may have a substituent, or the C6-C10 arylene group which may have a substituent,
G represents a hydrogen atom or an alkyl group having 1 to 6 carbon atoms that may have a substituent when the carbon to which G is bonded is one with A and does not represent a divalent group represented by * -CR ⁰ = C (B)-. Indicates,
p represents the integer of 0-4.