KR20190116938A - Complete marker linked to the pepper ChiVMV-resistant Cvr1 gene and uses thereof - Google Patents

Abstract

The present invention relates to six molecular markers (CM941-13HRM1, ZL06N26HRM3, ZL06N25HRM1, CM941-6HRM1, ZL06N05HRM1, ZL06N08HRM1) located at the locus of Cvr1, monodominant ChiVMV-resistant gene of pepper chromosome 6; and uses thereof. The molecular markers developed through the present invention will be able to identify Cvr1 genes and at the same time be utilized as molecular markers for accurate selection when growing ChiVMV-resistant pepper varieties.

Description

Complete marker linked to the pepper ChiVMV-resistant Cvr1 gene and uses approximately

The present invention relates to pepper ChiVMV resistance gene Cvr1 completely associated markers and uses thereof.

Chilli veinal mottle viurs belong to the Potyviridae family and are known to interfere with pepper production by causing dark green vein banding, leaf mottling and shoe string lesions. ChiVMV is non-permanently mediated by aphids (aphid, Aulacorthum sp.), Which occurs very frequently in Asia and Africa.

Several studies have been conducted on ChiVMV resistance. ChiVMV resistance genes of pepper have been reported to exist as quantitative trait locus (QTL), single dominant gene through various genetic analysis. Most recently, single recessive ChiVMV resistance genes have also been found by assaying ChiVMV against a large number of gene sources. However, since the location of the current resistance gene is reported, the genes actually used for breeding are very limited. For example, pvr1 ² and pvr6 , which are present on pepper chromosomes 3 and 9, respectively, are most representative, and the CVM1 (ChiVMV resistance locus 1) locus on chromosome 6 has been reported. In contrast, the chromosomal location of the single recessive resistance gene has not been reported. In addition, Cvr1- associated markers, which are not gene-based molecular markers, have a genetic distance of about 2 cM from the Cvr1 locus, requiring the development and improvement of more accurate and completely related markers.

In order to solve this problem, the present invention increased the number of isolates to about 700 individuals using Capsicum annuum 'CV3', a ChiVMV resistant gene source. As the number of F ₂ individuals increased, microgenetic maps were used to develop more improved molecular markers. In addition, the candidate genes were identified through the mapping of microgenes, and the inoculation of various fortiviruses also confirmed that the Cvr1 gene specifically acted on ChiVMV.

Meanwhile, Korean Patent No. 0920369 discloses a primer set, method, and kit for screening ChiVMV resistant pepper varieties targeting pvr1 ² gene, but the pepper ChiVMV resistance gene Cvr1 complete association marker and its There is no description of the use.

The present invention is derived from the above requirements, and the present inventors use the two pepper standard dielectric maps CM334 and Zunla, and the SNP (single nucleotide polymorphism) of the ChiVMV resistance control group 'CV3' and the pathogenic control group 'Jeju' are included. Was extracted. Subsequently, six markers with a genetic distance of 0 cM between the molecular marker developed by applying this SNP to a recombinant entity of the 'CV3 × Jeju' F ₂ population and the ChiVMV monodominant Cvr1 locus of pepper chromosome 6 (CM941-13HRM1, ZL06N26HRM3, ZL06N25HRM1, CM941-6HRM1, ZL06N05HRM1, ZL06N08HRM1). In addition, the present invention was completed by inoculating PepMov and TEV to find out that the Cvr1 gene has ChiVMV-specific resistance.

In order to solve the above problems, the present invention is an oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Oligonucleotide primer sets of SEQ ID NO: 3 and SEQ ID NO: 4; Oligonucleotide primer sets of SEQ ID NO: 5 and SEQ ID NO: 6; Oligonucleotide primer sets of SEQ ID NO: 7 and SEQ ID NO: 8; Oligonucleotide primer sets of SEQ ID NO: 9 and SEQ ID NO: 10; And one or more primer sets selected from the group consisting of oligonucleotide primer sets of SEQ ID NO: 11 and SEQ ID NO: 12, provides a primer set for discriminating pepper varieties resistant to Chili veinal mottle virus ( ChivmV ). .

In addition, the present invention is a primer set; And it provides a kit for determining pepper varieties resistant to ChiVMV, including a reagent for performing an amplification reaction.

In addition, the present invention comprises the steps of separating genomic DNA from pepper samples; Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set of the present invention; And it provides a method for determining the pepper varieties resistant to ChiVMV, comprising the step of detecting the product of the amplification step.

The SNP markers developed through the present invention will be able to identify Cvr1 genes and at the same time be used as molecular markers for accurate selection when growing ChiVMV resistant pepper varieties.

1 is to verify the resistance or pathogenic response of pepper to ChiVMV, (A) is a photograph of ChiVMV symptoms observed in pepper. 'CV3' and 'CV8' have normal pepper-like phenotypes, but 'Jeju' showed abnormal leaf development with chlorosis. (B) is the degree of ChiVMV accumulation between individuals identified through quantitative experiments, each bar represents the average of three repeated samples, and error bars represent standard deviations. Duncan's test revealed that two groups, a and b, were significantly pathological and the other group, c, were significantly classified as ChiVMV resistance. If there are many ChiVMV envelope proteins, the absorbance at 405 nm appears to be high, indicating that the subject is ChiVMV pathogenic.
Figure 2 shows the physical and genetic location of the newly developed associative markers ZL06C10SNP1 and ZL06Z02SNP1 and the recombinant entity, the shaded red in the table refers to recombinant individuals that do not match the phenotype and the genotype inferred by the marker.
FIG. 3 shows the six physical locations of the fully associated markers and the candidate genes in the vicinity of the recombinant and fully associated marker regions, and the shaded red color in the table refers to the recombinant individuals having different marker genotypes and phenotypes.
Figure 4 is a 'CV3' (resistive homozygotes; Cvr1 / Cvr1 ), 'Jeju' ( biotic homozygotes; cvr1 / cvr1 ), 'CV3 × Jeju' F ₁ individuals (heterozygotes) using six developed fully associated markers ; Cvr1 / cvr1 ) is the result of analyzing the genotype. The red line represents the resistant homozygous entity, the blue line represents the pathogenic homozygous entity, and the pink line represents the heterozygous entity.
5 is a result of analyzing the accumulation of virus by inoculating two types of fortiviruses (TEV-HAT, PepMoV-GFP) in two gene sources 'CV3' and 'CV8'. Bars represent the mean of three replicate samples, with error bars representing standard deviation.

In order to achieve the object of the present invention, the present invention provides an oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Oligonucleotide primer sets of SEQ ID NO: 3 and SEQ ID NO: 4; Oligonucleotide primer sets of SEQ ID NO: 5 and SEQ ID NO: 6; Oligonucleotide primer sets of SEQ ID NO: 7 and SEQ ID NO: 8; Oligonucleotide primer sets of SEQ ID NO: 9 and SEQ ID NO: 10; And one or more primer sets selected from the group consisting of oligonucleotide primer sets of SEQ ID NO: 11 and SEQ ID NO: 12, provides a primer set for discriminating pepper varieties resistant to Chili veinal mottle virus ( ChivmV ). .

Primer set for discriminating pepper varieties resistant to ChiVMV of the present invention is preferably at least one, at least two, at least three, at least four, at least five selected from the group consisting of the six primer set A primer set for determining pepper varieties resistant to ChiVMV, most preferably the six sets of said primers, namely SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; SEQ ID NO: 9 and SEQ ID NO: 10; And oligonucleotide primer sets of SEQ ID NO: 11 and SEQ ID NO: 12.

Simultaneous use of the six primer sets enables more accurate determination of pepper varieties resistant to Chili veinal mottle virus ( ChivmV ).

The primers of the present invention are 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 in SEQ ID NO: 1 to SEQ ID NO: 12 depending on the sequence length of each primer Oligonucleotides consisting of segments of at least 23, at least 23, at least 24, at least 25, at least 26 consecutive nucleotides. For example, the primers of SEQ ID NO: 1 (23 oligonucleotides) may be at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, Oligonucleotides consisting of segments of 22 or more nucleotides. In addition, the primer may include a sequence of addition, deletion or substitution of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 12.

In the present invention, "primer" refers to a single strand of oligonucleotide sequence that is complementary to the nucleic acid strand to be replicated, and can serve as a starting point for the synthesis of primer extension products. The length and sequence of the primers should allow to start the synthesis of extension products. The specific length and sequence of the primer will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

As used herein, oligonucleotides used as primers may also include nucleotide analogues, such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

The invention also, the primer set; And it provides a kit for determining pepper varieties resistant to ChiVMV, including a reagent for performing an amplification reaction.

In the kit of the present invention, the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffers and the like. In addition, the kits of the present invention may further comprise a user guide describing the optimal reaction performance conditions. The guide is a printed document that explains how to use the kit, such as how to prepare a PCR buffer, and the reaction conditions presented. The instructions include brochures in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information that is disclosed or provided through electronic media such as the Internet.

The present invention also provides

Separating genomic DNA from pepper samples;

Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set of the present invention; And

It provides a method for determining pepper varieties resistant to ChiVMV, comprising detecting the product of the amplification step.

The method includes separating genomic DNA from pepper samples. As a method for separating genomic DNA from the sample, a method known in the art may be used. For example, the CTAB method may be used, or the Wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, one or more oligonucleotide primer sets according to one embodiment of the present invention may be used as a primer to amplify a target sequence. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification systems, There are any suitable methods for amplifying via strand displacement amplification or Qβ replication or for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a pair of primers specifically binding to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, detection of the amplification product may be performed through HRM analysis, DNA chip, fluorescence measurement, phosphorescence measurement or radioactivity measurement, but is not limited thereto.

High-resolution melting (HRM) analysis is a method of assaying genotypes without electrophoresis. PCR-based analysis using SNPs shows that the fluorescence sample decreases according to the SNP type as a melting curve. How to distinguish It analyzes and processes the data using specially designed software for HRM analysis for differences in the degree of dissociation with temperature of the double strand DNA (dsDNA) with the dye used in connection with the RT-PCR instrument. In addition, as one of methods for detecting amplification products, capillary electrophoresis may be performed. Capillary electrophoresis may be performed using, for example, an ABI sequencer. Fluorescence measuring method may also be performed by performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of a primer to detect a target sequence. Labeled fluorescence can be measured using a fluorimeter. In addition, radioactivity measuring method is to add a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product when performing PCR, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Materials and methods

Plant material and DNA extraction

The Cvr1 separation group was prepared and marker assay was performed using the pepper varieties ( Capsicum annuum 'CV3', 'CV8'), which were previously reported to contain the Cvr1 locus, and 'Jeju', which was in the laboratory. Pepper seeds were soaked in 10% trisodium phosphate buffer and 2% Lax solution for 15 minutes and then seeded. DNA extraction for the marker assay was performed by modifying the CTAB (Cetyl trimethylammonium bromide) DNA extraction method, and each DNA was adjusted to 50ng / μl to be used for further experiments such as PCR and high resolution melting (HRM). The 'CV3', 'CV8' and 'CV9' varieties used in the present invention are Clover Seed Ltd. It was purchased from (Hong Kong).

Inoculation and Observation

ChiVMV virus inoculum was stored at -80 ° C. ChiVMV retained the inoculum in tobacco ( Nicotiana benthamiana ) prior to use. At the time of ChiVMV inoculation, 0.1M potassium phosphate buffer was adjusted to pH 7.0, followed by spraying 400-grit carborundum on the leaves. After mixing with ChiVMV inoculum was inoculated on two tobacco leaves (ChiVMV inocula 2g of tobacco fresh leaves / 10ml of 0.1M potassium phosphate buffer). Pepper was inoculated into two cotyledons in the same way as above. After inoculation, symptoms were observed for 14 to 30 dpi (days post inoculation) in the growing room (16 hours daytime (23 ℃) and 8 hours nighttime (21 ℃)). Viral symptoms were observed by phenotypic examination once every 7 days after inoculation. In addition, DAS-ELISA (double-antibody sandwich enzyme-linked immunosorbent) analysis was performed to accurately determine the presence of virus. ELISA assay was performed between 20 and 30 dpi after inoculation, and ELISA was performed according to the instructions of the product (Agdia, Elkhart, IN, USA).

Cvr1  Association molecular marker development

Since it was confirmed that the previously reported Cvr1 resistance association marker exists on pepper chromosome 6, the positions of the two association markers (ZL06T16SNP1 and ZL06045) were confirmed on chromosome 6. Subsequently, nucleotide sequences between the associated markers were extracted from pepper standard dielectric CM334 and Zunla using bedtools program (https://bedtools.readthedocs.io/en/latest/). Based on the obtained nucleotide sequence, the primers were designed except for the section with the repetitive sequence. In order to confirm the amplified sequence, 100ng of DNA, 20mM of Tris-HCl (pH 8.0), 0.1mM EDTA, 100mM in 50µl total volume PCR was performed by making a PCR mixture containing KCl, 1 mM MgCl ₂ , 1 μM primers, 2.5 mM dNTPs, and 2.5 U Taq polymerase. PCR conditions were 95 ° C. 5 minutes; 35 repetitions at 95 ° C. 30 sec, annealing temperature 30 sec, 72 ° C. 1 min; It set to 72 degreeC 10 minutes and 4 degreeC 30 minutes. PCR products were purified using a Zymoclean PCR Purification Kit (Zymo Research, Irvine, CA, USA), and subjected to sequencing in Macrogen.

Example 1 ChiVMV Resistance Identification and Genetic Analysis

ChiVMV assays were performed using 'CV3', 'CV8' reported to include the Cvr1 locus, the ChiVMV resistant gene source 'CV9' without the Cvr1 locus, and the pathogenic control 'Jeju'. Abnormal development of leaves with chlorosis at 35 dpi was observed in 'Jeju'. On the other hand, ChiVMV symptom was not observed in 'CV3' and 'CV8' at the same time (FIG. 1A). In order to quantitatively measure the proliferation of ChiVMV, ChiVMV envelope protein levels were analyzed by ELISA as an antibody against ChiVMV. As a result of the phenotype, ChiVMV was not proliferated in 'CV3' and 'CV8'. (FIG. 1B). Therefore, as previously reported, 'CV3' and 'CV8' were found to be resistant to ChiVMV, and ELISA also confirmed that even the inoculation leaves did not accumulate ChiVMV.

In order to confirm the existence of a single gene through genetic analysis of CV3, the isolation ratio of ChiVMV resistance was confirmed in the F ₂ population that crossed the ChiVMV resistance gene source 'CV3' and the pathogenic gene source 'Jeju'. It was confirmed that the separation ratio of resistance and pathogenicity was 3: 1 in the F ₂ group, and the statistical significance was confirmed by the chi-square test (Table 1; P-value> 0.05). Thus, ChiVMV resistance in the 'CV3' gene source was confirmed to be controlled by a single dominant resistance gene.

Isolation Ratio and Chi-Square Test Results in Cvr1 Resistant Gene Isolates Population Total Resistant Susceptible Expected ratio P-value CV3 10 10 0 1: 0 Jeju 10 0 10 0: 1 CV3 × Jeju F ₁ 10 10 0 1: 0 CV3 × Jeju F ₂ 750 578 172 3: 1 0.1912

Example 2 Association Marker Development

Two previously reported ChiVMV resistance gene association markers (ZL06SEQT16SNP1, ZL06045; Lee et al., 2017, Molecular Breeding 37: 121) were applied to the 'CV3 × Jeju' F ₂ population, resulting in approximately 3 cM, It was confirmed that there is a genetic distance by 2cM. In order to improve this genetic distance, the SNP was searched using the pepper standard dielectric sequence Zunla reported to date, and the SNP was converted into an HRM marker.

Through this, two markers, ZL06C10SNP1 and ZL06Z02SNP1, which have improved genetic distance than the existing two markers (ZL06SEQT16SNP1 and ZL06045), could be developed. The distance between the markers was more than about 800 kb for the two markers, but the distance between the markers was reduced to about 300 kb for the two newly developed markers, and it was thought that there was a single dominant gene, Cvr1 , between them. 2). In the case of recombinant individuals that are indicative of genetic distance, five markers were originally compared with markers (CVMV2, CVMV3; Lee et al. 2013 Euphytica 193 (2): 197-205) that had 11 recombinants. By confirming that the genetic distance was also significantly reduced compared to the existing markers.

Example 3 Development of Completely Related Markers and Prediction of Candidate Genes

The base sequence between two markers, ZL06C10SNP1 and ZL06Z02SNP1, which are the closest markers to the Cvr1 locus, was extracted in CM334 and Zunla standard dielectric sequences, and additional marker production was performed using the sequences. In the nucleotide sequence, a total of six molecular markers (CM941-13HRM1, ZL06N26HRM3, ZL06N25HRM1, CM941-6HRM1, ZL06N05HRM1, ZL06N08HRM1) were developed. That is, six markers with a genetic distance of 0 cM were completely associated with the Cvr1 gene (Fig. 4; Table 2). As a result of checking the physical positions between the CM334 and the Zunla standard dielectric maps, respectively, the sequence was determined within each chromosome. It was found to be inconsistent and very entangled. In addition, 14 genes were predicted in the region including 6 molecular markers to find ChiVMV resistance genes, of which 12 were characteristic domains of disease resistance genes (NB-LRR, Kinase, NAC domain). It could be confirmed that it has (Fig. 3).

Information on primer sets that can identify six markers of the invention Marker Name Sequence information (5 '→ 3') SEQ ID NO: CM941-13HRM1 CGTCCCTAAAGTCTCACTTCTTG One GAGTGGTTTGGTTGTGGGGC 2 ZL06N26HRM3 CCTCAACTTCTAATCTTAATGAC 3 CTCTTTTAGGCCGCTACCATC 4 ZL06N25HRM1 CAAGATGCTCCCTTTTCTCAAC 5 AGGGGGTTTGTTGAAGGGAA 6 CM941-6HRM1 GCGGTCAAAATCACCAGTGA 7 GTATTGTATCGTTGGAGTTGTCG 8 ZL06N05HRM1 GCAAGAGGCAGAATAACCCA 9 CTCCTACTCGAAACGCCAAC 10 ZL06N08HRM1 ATGGTCCCCATAGATCCACG 11 CTGTGCTAAAGCATCTGAATAAGG 12

PCR and HRM Conditions of the Invention Step Function Temperature (℃) Time (sec.) Cycles Step 1 Pre-denaturation 94 240 One
Step 2 denaturation 95 20
55 Annealing Tm * 20 Extension 72 20 Step 3 Hold 60 60 One HRM 0.1 ° C increments from 60 ° C to 95 ° C in 2 second intervals * Tm by molecular marker
CM941-13HRM1: 60 ° C, CM941-6HRM1: 57 ° C, ZL06N25HRM1: 58 ° C, ZL06N26HRM3: 55 ° C, ZL06N05HRM1: 57.5 ° C, ZL06N08HRM1: 57.5 ° C.

Therefore, although the Cvr1 candidate gene is generally thought to be a gene including a Nucleotid binding-leucine rich repeat (NB-LRR) domain, which is a domain of the pathogenic dominant gene, the complexity of the sequence and the repetition of the gene are severe and BAC (Bacterial) is used for gene identification. Other methods such as artificial chromosome screening may be needed.

Example 4. Cvr1  Observing the Potyvirus Resistance of Genes

Finally, the two vaccines, PepMoV (Pepper mottle virus) and Tobacco etch virus-highly aphid-transmissible (TEV-HAT), were inoculated in a similar way to the ChiVMV assay to determine whether the Cvr1 gene is resistant to viruses in other fortiviruses. It was. The 'CV3' gene source was determined to have a very high amount of ChiVMV virus in both PepMoV and TEV-HAT (FIG. 5), thus confirming that the Cvr1 gene has a very narrow range of resistance to fortiviruses . However, based on the paper reported until now, the Pvr9 genes with resistance to PepMoV are thought to be very close and Cvr1 genes, thus Cvr1 as resistant to a variety of Poti virus evolutionary NB-LRR genes in gene belongs I think it will work.

<110> Seoul National University R & DB Foundation <120> Complete marker linked to the pepper ChiVMV-resistant Cvr1 gene          and uses <130> PN19108 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cgtccctaaa gtctcacttc ttg 23 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gagtggtttg gttgtggggc 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cctcaacttc taatcttaat gac 23 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ctcttttagg ccgctaccat c 21 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 caagatgctc ccttttctca ac 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agggggtttg ttgaagggaa 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gcggtcaaaa tcaccagtga 20 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gtattgtatc gttggagttg tcg 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gcaagaggca gaataaccca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ctcctactcg aaacgccaac 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 atggtcccca tagatccacg 20 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ctgtgctaaa gcatctgaat aagg 24

Claims (6)

Oligonucleotide primer sets of SEQ ID NO: 1 and SEQ ID NO: 2; Oligonucleotide primer sets of SEQ ID NO: 3 and SEQ ID NO: 4; Oligonucleotide primer sets of SEQ ID NO: 5 and SEQ ID NO: 6; Oligonucleotide primer sets of SEQ ID NO: 7 and SEQ ID NO: 8; Oligonucleotide primer sets of SEQ ID NO: 9 and SEQ ID NO: 10; And a set of oligonucleotide primers of SEQ ID NO: 11 and SEQ ID NO: 12. A primer set for determining a pepper variety that is resistant to Chili veinal mottle virus ( ChivmV ), comprising one or more primer sets selected from the group consisting of: The method of claim 1, wherein the oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Oligonucleotide primer sets of SEQ ID NO: 3 and SEQ ID NO: 4; Oligonucleotide primer sets of SEQ ID NO: 5 and SEQ ID NO: 6; Oligonucleotide primer sets of SEQ ID NO: 7 and SEQ ID NO: 8; Oligonucleotide primer sets of SEQ ID NO: 9 and SEQ ID NO: 10; And a set of oligonucleotide primers of SEQ ID NO: 11 and SEQ ID NO: 12; primer set for discriminating pepper varieties resistant to ChiVMV. A primer set according to claim 1 or 2; And a kit for determining pepper varieties resistant to Chili veinal mottle virus ( ChivmV ), comprising a reagent for performing an amplification reaction. The kit of claim 3, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs, and buffer. Separating genomic DNA from pepper samples;
Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set of claim 1; And
And detecting a product of the amplifying step, the pepper varieties having resistance to Chili veinal mottle virus ( ChivmV ). The method of claim 5, wherein the detection of the amplification product is carried out by HRM analysis, DNA chip, fluorescence measurement, phosphorescence measurement or radioactivity measurement.

Images