KR20190099183A - Nrf2 activating composition containing radish extract as an active ingredient and a method for producing the radish extract - Google Patents

Abstract

The present invention relates to a composition for inducing the activation and expression of Nrf2, comprising a radish extract as an effective component, and more particularly, the present invention has confirmed that the composition expresses, by activating a transcription factor, Nrf2, NADPH production regulatory gene, GSH production regulatory gene, quinone detoxification gene, iron regulatory gene, redox homeostasis regulatory gene, heme metabolism gene, and the like. By using liver cells, HepG2 cells, RAW264.7 cells used as an inflammation model, and 3T3L1 cells whose mechanism of adipocyte differentiation is extensively studied, the present invention has confirmed that Nrf2 activation due to the composition results in 1) the effect of suppressing the differentiation from liver cells to fat liver cells, 2) anti-inflammatory effect in inflammatory cells, and 3) the effect of suppressing the differentiation from preadipocytes to adipocytes.

Description

Activating composition containing radish extract as an active ingredient and a method for producing the radish extract}

The present invention relates to an Nrf2 activating composition comprising a radish extract as an active ingredient and a method for preparing the radish extract. More specifically, the radish extract is a transcription factor Nrf2 (NFE-2 (Nu-2). 2) to the expression and activation of the related factor 2), and a composition comprising a radish extract as an active ingredient and a method for producing the radish extract.

Radish is an edible crop belonging to the Brassicaceae family, which is distributed throughout the world such as Spain, China, Turkey, and Russia, and is widely used as a folk remedy in Spain, China, and Russia. come.

Glucosinolate is a secondary metabolite of cruciferous crops, and is produced in various ways by plant growth, protection from the environment, plant immunity, defense against microorganisms, and other physiological phenomena. Most glucosinolates are broken down into glucose, sulfur and aglucone by myrosinase, and are classified into isothiocyanate (ITCs), surforaphenen, thiocyanate, oxazolindine-2-thione and nitrile depending on the structure of the compound. And reportedly there are about 120 species of glucosinolate.

 Recent reports show that black radish has anti-cancer, vascular disease, pneumonia, and liver detoxification effects. Bleomycine (BLM) -induced pulmonary fibrosis In animal model diseases, administration of black radish extract significantly reduced TGF-b in blood and lung tissue (Asquhari et al 2015). Evans et al (2014) analyzed the detoxification effect of black radish extract in an animal model that induced liver toxicity with acetaminophen. The results showed that the glutamyl transferase level decreased significantly compared to the untreated group. Observed. These results reported that black radish extract activated the enzymes of phase I and phase II livers in the liver. In Mexico, Castro-Torres et al (2013) reported that black radish extract inhibited the formation of cholesterol gallstones when administered to experimental animals.

However, there is no report on the effect of radish extract on Nrf2, a transcription factor.

Nrf2 (NFE-2 (Nu-2) is a protective agent that protects cells from developmental processes such as inflammation, cardiovascular disease, pulmonary fibrosis, central nervous system disease, diabetes, aging and cancer. It is a transcription factor known to work. In the absence of oxidative stress, Nrf2 binds to Keap1 (Kelch-like ECH-associated protein1) in the cytoplasm and is degraded by ubiquitin-proteasome. However, when oxidative stress comes, Nrf2 is phosphorylated, separated from Keap1, transferred to the nucleus, and then coupled to the antioxidant response element (ARE) of the target genes (CYP1A2, HO-1, NQO1, etc.). By inducing the expression of antioxidant enzymes and anti-inflammatory enzymes plays an important role in human defense.

In the present invention, it was confirmed that the radish extract exhibits an excellent expression inducing effect and an activating effect on Nrf2 to complete the present invention.

IG Castro-Torres et al. Raphanus Sativus L. Var Niger as a Source of Phytochemicals for the Prevention of Cholesterol Gallstones, Phytother Res 28 (2), 167-171.

It is an object of the present invention to provide an Nrf2 activation and expression composition derived from natural products.

Still another object of the present invention is to provide a method for producing the natural product.

In order to achieve the above object, the present invention provides an Nrf2 activation and expression composition comprising a radish extract as an active ingredient.

The radish extract is Abcc1, Blvrb, Cat, Cxcl3, Ftl1, Gclm, Gsr, Ho-1, Plin2, Prdx1, Prr13, Slc48a1, Srxn1, Esd, Cyp1A1, Cyp1A2, NQO1, Sult2a1, ALDH3A1, NKAIN1 A2H It is characterized by controlling the expression of any one gene selected from the group consisting of.

The radish extract is any one selected from the group consisting of 3-hydroxymethyl-2-pyrrolidinethione, 3- [ethoxy- (methylthio) methyl] -2-pyrrolidinethione, 3- (E)-(methylthio) methylene-2-pyrrolidinethione It is characterized by including a compound.

The radish extract is characterized in that it comprises any one glucosinolate selected from the group consisting of glucoraphanin, glucoerucin, glucoraphasatin, 4-methoxylglucobrassicin.

Heat treating after cutting radish; Hot air drying; Extracting with 70% ethanol; It provides a method for producing the radish extract consisting of.

By treating the radish extract to cells provides a method of inhibiting differentiation into fatty liver cells induced by OA (oleic acid).

By treating the radish extract to cells provides a method for inhibiting the inflammatory response caused by lipopolysaccharide (LPS).

The present invention provides a method of inhibiting differentiation into adipocytes induced by MDI (3-Isobutyl-1-methylxanthine (IBMX) -Dexamethasone (DEX) -Insulin) by treating the extract.

The composition according to the invention induces and activates the expression of Nrf2.

The composition modulates the expression of the target gene of Nrf2.

The composition inhibits differentiation into adipocytes, inflammatory responses and differentiation into adipocytes.

1 is a result confirming the induction of Nrf2 expression of various radish extract samples.
Figure 2 shows the results confirming the Nrf2 activation effect of the three kinds of radish extract samples.
Figure 3 confirms the transcriptional induction of CYP1A1, HO-1 gene by radish extract using Quantitative PCR.
Figure 4 confirms the effect of inhibiting the differentiation of hepatocytes to adipocytes by radish extract.
5 is a result of component analysis by separating the radish extract.
Figure 6 is a result confirming the effect of Nrf2 activation and expression of the isolated radish extract single component.
7 is a result comparing the effect of the radish extract and milk thistle extract.
8 is a result confirming that the radish extract induces HO-1 expression in inflammatory model cells.
9 is a result confirming the anti-inflammatory effect of the radish extract in inflammatory model cells.
Figure 10 shows 14 genes induced transcription by radish extract in inflammatory model cells.
Figure 11 shows genes induced expression by radish extract in hepatocytes.
Figure 12 shows the effect of differentiation into adipocytes by radish extract in the adipocyte model.
Figure 13 shows the results of the expression of Nrf2 and HO-1 induced by radish extract in the adipocyte model.
Figure 14 shows the results of the transcription of HO-1 and NQO1 by radish extract in the adipocyte model.

Hereinafter, the present invention will be described in more detail with reference to Examples and Experimental Examples. However, these Examples and Experimental Examples are intended to illustrate the present invention in more detail, the scope of the present invention is not limited thereto.

< Example > Preparation of Radish Extract

To prepare an extract using radish under various conditions as shown in Table 1.

Sample Number part Pretreatment input Extraction condition Example 122 Black radish Heat treatment (70-80 ℃, 10 minutes)
Hot air drying (96 hours) 400 g 7 0% Ethanol Comparative Example 1 101 Outer Not dry 3.5 kg 80% spirit, 5L Comparative Example 2 102 Flesh Not dry 6.5kg 80% spirit, 10L Comparative Example 3 103 0.5-1cm slice Not dry 5 kg 80% spirit, 8L Comparative Example 4 104 0.5-1cm slice Not dry 5 kg Hydrothermal, 10L Comparative Example 5 105 0.5-1cm slice Heat treatment (70-80 ℃, 10 minutes)
Hot air drying (96 hours) 200 g 30% spirit, 2L Comparative Example 6 106 0.5-1cm slice Heat treatment (70-80 ℃, 10 minutes)
Hot air drying (96 hours) 200 g 50% spirit, 2L Comparative Example 7 107 0.5-1cm slice Heat treatment (70-80 ℃, 10 minutes)
Hot air drying (96 hours) 200 g 70% spirit, 2L Comparative Example 8 108 0.5-1cm slice Hot air drying (96 hours) 300 g Hydrothermal (4h), 3L Comparative Example 9 109 0.5-1cm slice Hot air drying (96 hours) 300 g 30% spirit, 3L Comparative Example 10 110 0.5-1cm slice Hot air drying (96 hours) 300 g 50% spirit, 3L Comparative Example 11 111 0.5-1cm slice Hot air drying (96 hours) 300 g 70% spirit, 3L Comparative Example 12 112 0.5-1cm slice Freeze drying (48 hours) 300 g Hydrothermal (4h), 3L Comparative Example 13 113 0.5-1cm slice Freeze drying (48 hours) 300 g 30% spirit, 3L Comparative Example 14 114 0.5-1cm slice Freeze drying (48 hours) 300 g 50% spirit, 3L Comparative Example 15 115 0.5-1cm slice Freeze drying (48 hours) 300 g 70% spirit, 3L Comparative Example 16 116 stem Hot air drying (48 hours) 705 g 70% ethanol, 10.6 L, 2 times Comparative Example 17 117 Outer Not dry 11 kg 80% ethanol Comparative Example 18 118 Black radish Freeze drying (48 hours) 500 g EA extract Comparative Example 19 119 White radish hot air dry 103 g 70% ethanol Comparative Example 20 120 Black radish Freeze drying (48 hours) 500 g 70% ethanol Comparative Example 21 121 Black radish hot air dry 400 g 70% ethanol Comparative Example 22 123 Black radish Not dried 9.5 kg 80% ethanol Comparative Example 23 124 Sample 117 HP-Column, 2nd fraction 150 g 50% ethanol, 4L Comparative Example 24 125 Sample 117 HP-Column, 1st fraction 150 g Distilled water, 2L Comparative Example 25 126 Black radish hot air dry 500 g 70% ethanol Comparative Example 26 127 Black Radish Stem hot air dry 500 g 70% ethanol Comparative Example 27 128 Jasai hot air dry 500 g 70% ethanol

Example (Sample No. 122) Wash the black radish flowing under running tap water, cut to a thickness of 5mm, boiled for 10 minutes at 80 ℃ water prepared in advance and hot air dried for 96 hours. Then, the mixture was concentrated under reduced pressure after extraction in 70% ethanol.

< Experimental Example >

In the present invention, hepG2 cells, hepatocytes, RAW264.7 cells used as an inflammatory model, and 3T3L1 cells, which are known for differentiation into adipocytes, are used as extracts.

1) Expression Induction and Activation Effect of Nrf2 in Each Cell

2) inhibitory effect of differentiation from hepatocytes to fatty liver cells,

3) anti-inflammatory effect on inflammatory cells

4) Inhibition of Differentiation of Preadipocytes into Adipocytes

It was confirmed.

Cell culture

HepG2 (human hepatocytes), RAW264.7 (mouse macrophages), and 3T3-L1 (mouse progenitor cells) were used from the American Type Culture Collection (ATCC). The cells were subjected to DMEM (Dulbecco's Minimal Essential Medium; Gibco, USA) containing 100 U / L penicillin, 100 μg / ml streptomycin, 10% Bovine calf serum (Gibco, USA), and 10% fetal calf serum (FCS). ) Or MEM culture was used to culture in an incubator maintained at 5% CO ₂ and 37 ℃, subculture was carried out every 3 to 4 days.

Electrophoresis and Western Blot Analysis

Protein separation from cultured cells was washed 2-3 times with PBS and homogenized for 30 minutes by treatment in RIPA lysis buffer. The supernatant was obtained by centrifugation of homogenized cells, and protein concentration was quantified using a Bio-Rad Protein Assay Kit by standardizing BSA (Bovine Serum Albumin). 30-50 μl of lysate was isolated from the total protein by 10% SDS-PAGE, which was transferred to polyvinylidene difluoride (PVDF; Millipore, USA) membrane. The PVDF membrane was treated with 5% non-milk and blocking buffer for 1 hour at room temperature and treated with primary antibodies (anti-Nrf2, anti-HO-1, anti-CYP1A2, anti-β-actin). After washing with TTBS, the secondary antibody was reacted at room temperature by diluting anti-mouse, anti-rabbit, and anti-goat IgG (Immunoglobulin G) conjugated with HRP. ) To the X-ray film after the reaction.

< Experimental Example  1> caused by radish extract Nrf2  Expression Induction Confirmation

Radish extract (BRE) samples extracted under various conditions of Table 1 were treated to HepG2 cells and analyzed for Nrf2 expression using western blot after 16 hours.

1, Nrf2 expression is very low in cells treated with DMSO as a control, but in samples treated with extract No. 101, 103, 115, 116, 117, 122 (example), 127 Nrf2 was expressed very strongly.

< Experimental Example  2> caused by radish extract Nrf2  Activation confirmation

Nrf2 present in the cytoplasm in combination with Keap1 was isolated from Keap1 by the extract-free treatment and moved inside the nucleus to express the target gene (CYP1A2) as a transcription factor. The results are shown in FIG.

HepG2 cells were maintained in MEM medium containing 10% FCS in 6 well plates at 1 × 10 ⁵ / ml cell number and incubated for 24 hours. After treatment with radish extract and 600uM OA (Oleic acid) was incubated for 16 hours and western blot. At this time, the radish extract sample No. 115, 116, 122 (Example) Radish extracts are 125, 250, 500 and 1000 ug / ml respectively.

2, it can be seen that Nrf2 and its target gene, CYP1A2, were expressed in a concentration-dependent manner. However, the target gene was not expressed in the untreated group and the OA-treated group but not the radish extract-treated group.

Hereinafter, In the experiment  The radish extract used Example  Sample No. 122 is radish extract.

< Experimental Example  3> caused by radish extract Of Nrf2 target  gene CYP1A1 , Confirm the transcription induction effect of HO-1

Using the quantitative PCR analysis of the CYP1A1, HO-1 gene transcription induction effect of the radish extract (sample No. 122) is shown in FIG.

HepG2 cells were treated with OA and radish extract (sample No. 122) at each concentration. After 8 hours, total RNA was isolated and cDNA was synthesized to perform quantitative PCR. After total RNA was isolated from the cultured HepG2 cells using NucleoSpin RNA reagent kit (Macherey-Nagel), cDNA synthesis was performed using ReverTra Ace-a synthesis kit (Japan). For quantitative PCR, 40 cycles were performed by mixing SYBR green master premix (Biorad), cDNA and primer. The primers used are as follows.

human-GAPDH-F: TCGACAGTCAGCCGCATCTTCTTT,

      GAPDH-R: ACCAAATCCGTTGACTCCGACCTT

human-CYP1A1-F; TCCGGGACATCACAGACAGC,

      CYP1A1-R; ACCCTGGGGTTCATCACCAA

human-HO-1-F; ACGCGTTGTAATTAAGCCTCGCAC,

      HO-1-R; TTCCGCTGGTCATTAAGGCTGAGT,

3 (A) CYP1A1 mRNA was transcribed 5 times more than the untreated or OA-only group in 200ug / ml of radish extract (sample 122), radish extract (sample 122) 25ug / ml treatment group Edo 1.8 times more than was killed.

Referring to FIG. 3 (B), HO-1 mRNA was transcribed 2 to 5 times more in the radish extract (No. 122) treated group than in the untreated group or only OA treated group.

Therefore, the radish extract (sample No. 122) not only strongly expresses Nrf2 but also activates Nrf2 and confirms that the target gene is strongly transcribed.

< Experimental Example  4> Reduction of fat accumulation by radish extract in fatty liver model

HepG2 cells, which are hepatocytes, were treated with radish extract and OA (oleic acid) to confirm that the differentiation into fat liver cells induced by OA was inhibited by radish extract.

First, Nrf2 expression and its target gene CYP1A2 (cytochrome P450 1A2) in cells treated with 600uM OA and radish extract (Sample No. 122) at various concentrations (125, 250, 500, 1000 ㎍ / mL), HO-1 (heme oxygenase-1) expression was analyzed by western blot. It is the same as the experimental method of Experimental Example 2 except that the type of radish extract treated is different.

Looking at Figure 4 (A), it can be seen that Nrf2, CYP1A2, HO-1 are all expressed in a concentration-dependent expression of radish extract (sample No. 122). Therefore, it was confirmed that the radish extract (sample No. 122) strongly induces Nrf2 expression and simultaneously activates Nrf2.

In addition, the amount of fat accumulated in hepatocytes was analyzed using Oil Red O staining. Cultured HepG2 cells were treated with radish extract (Sample No. 122) 1 hour before 600 uM OA treatment. After 24 hours of treatment with 600 uM OA, the cells were fixed with 10% formalin for 10 minutes and washed twice with PBS. And stained with Oil Red O for 20 minutes, washed again three times with PBS and observed under a microscope.

Referring to FIG. 4 (B), the stained cells were not observed in the control (untreated OA group), but it was confirmed that a lot of triglycerides were accumulated in the cytoplasm of OA (hepatocytes treated with 600uM OA only). However, fat accumulation was markedly reduced in OA + BRE250 (treated with 250 μg / ml OA and radish extract) or OA + BRE500 (treated with 500 μg / ml OA and radish extract). The results were quantified and shown in FIG. 4 (C).

< Experimental Example  5> Component Analysis of Radish Extract

Radish extract (Sample No. 122) was isolated using an HP-20 column, an organic solvent fraction, and a Sephadex LH-20 column. As a result, C4 (3-hydroxymethyl-2-pyrrolidinethione) and C5 (3- [ethoxy- (methylthio) 2-pyrrolidinethione compounds of methyl] -2-pyrrolidinethione), C6 (3- [ethoxy- (methylthio) methyl] -2-pyrrolidinethione), and C7 (3- (E)-(methylthio) methylene-2-pyrrolidinethione) Got it. This result is shown in FIG.

In addition, the radish extract (Sample No. 122) was analyzed by HPLC for the presence of 11 components of glucosinolate. As a result, four kinds (glucoraphanin, glucoerucin, glucoraphasatin, 4-methoxylglucobrassicin) were analyzed. This result is shown in FIG. Glucosinolate is reported to be present in more than 120 species as secondary metabolites of the Brassicaceae family crops.

< Experimental Example  6> Separated Radish Extract of Single Ingredient Nrf2  Activation and expression induction confirmation

Compounds C4, C5, C6, and C7 isolated in Experimental Example 5 were treated to HepG2 cells, respectively, and analyzed by Western blot for Nrf2 activation and expression.

As a result, the expression of Nrf2 was the strongest in C5 and C6 treated cells, and the target gene, CYP1A2, was concentration-dependently expressed by all four compounds. However, the target gene CYP1A2 was not expressed in cells that did not process both the compound and OA or only OA.

< Experimental Example  7> Radish Extract Milk Thistle  Comparison of the effects of extracts

Nrf2 expression and activation by milk thistle extract and the radish extract of the present invention, which are already used as a dietary supplement, are shown in FIG.

As a result, the expression of the target genes CYP1A2, HO-1 as well as Nrf2 was strongly induced by the radish extract (BRE). However, Nrf2 expression in milk thistle treated group (milk) was improved than the untreated group, but significantly lower than Nrf2 expression in the radish extract treated group. In addition, the expression of the target genes CYP1A2, HO-1 in the milk thistle treatment group is significantly lower than that of the radish extract treatment group.

As a result, radish may be used as a supplement for health functional foods better than milk thistle in improving disease caused by oxidative stress.

< Experimental Example  8> Confirmation of HO-1 Expression of Radish Extract in Inflammation Model Cells

Inflammatory cell model After treating LPS and radish extract (Sample No. 122) at various concentrations in RAW264.7 cells (mouse macrophages), HO-1 (Heme oxygenase-1) expression was confirmed by western blot and shown in FIG. 8. 8 (A) is an image of a western blot, (B) is a quantified image.

RAW 264.7 cells were maintained in DMEM medium containing 10% FBS and dispensed into 6 well plates at a cell count of 0.5 × 10 ⁵ / ml and treated with LPS (500 ng / ml) and radish extract (Sample No. 122) after 16 hours. And incubated for 12-16 hours.

Referring to FIG. 8, when the radish extract was treated to RAW264.7 cells, expression of HO-1 was increased depending on treatment concentration.

< Experimental Example  9> Anti-inflammatory Effect of Radish Extract in Inflammation Model Cells

Recently, when inflammatory cell model stimulates RAW264.7 cells with LPS (lipopolysaccharide), inflammatory factors have been reported to increase rapidly. On the other hand, Nrf2 is known to induce the transcription of HO-1 (Heme oxygenase-1) to inhibit inflammation and protect cells. In addition, HO-1 is known to help with anti-inflammatory and antioxidant activity by synthesizing iron (Fe) ions, carbon monoxide (CO), biliverdin.

LPS and radish extract (Sample No. 122) were treated on RAW264.7 cells to analyze the degree of secretion of inflammatory factor NO (nitric oxide) and are shown in FIG. 9. RAW 264.7 cells were maintained in DMEM medium containing 10% FBS and dispensed into 6 well plates with a cell count of 0.5 × 10 ⁵ / ml. After 16 hours, radish extract (Sample No. 122) and LPS were treated for 12-16 hours. Incubated for

As shown in the graph of Figure 9, when compared with the LPS-only group, it can be seen that the further treatment of radish extract to reduce the secretion of inflammatory factors NO. The degree of reduction also depends on the concentration of radish extract treated. This result is consistent with the result that the extract of Radish in Experimental Example 8 induces HO-1 expression, HO-1 is a result of inhibiting NO secretion, which is an inflammatory factor induced by LPS to protect cells or tissues. .

< Experimental Example  10> NGS  Screening of Active Genes by Radix Extracts in Inflammation Model Cells and Hepatocytes

Five treatment groups (control group, LPS treatment group, LPS + no extract 1000ug, LPS + no extract 500ug, LPS + no extract 250ug) samples were prepared in RAW264.7 cells three times. RNA preparation was performed using TruSeq Stranded mRNA sample preparation kit. RNA analysis was performed using Illumina NextSeq500 model and sequence reading was 76 paired-end read. As reference genome, mmu 10 (ver10) was used.

The number of genes that can be read using NGS (Next Generation Sequencing) is 26,665, and the number of genes with increased expression is about 8,000 and the number of genes with reduced expression is also 8,000. The dog is around. As a result of performing the P test, 2,627 genes protruded in the highly significant gene (P value ≤0.05) when comparing the control group with the LPS treatment group. However, compared to LPS-treated and LPS + non-extracts, the number of highly significant genes tended to decrease by less than half. The results are shown in Table 2 below.

compare Total number of genes expressed
(P value ≤0.05) Expression increase gene number
(P value ≤0.05) Expression decrease
(P value ≤0.05) Control / LPS treatment group 26,665
(2,627) 8,246
(1,157) 8,172
(1,470) LPS treatment group /
LPS + Radish Extract 1000ug 26,665
(986) 8,200
(404) 8,236
(582) LPS treatment group /
LPS + Radish Extract 500ug 26,665
(324) 8,066
(149) 8,311
(175) LPS treatment group /
250ug LPS + Radish Extract 26,665
(46) 8,146
(33) 8,117
(13)

In this experiment, 14 genes (Abcc1, Blvrb, Cat, Cxcl3, Ftl1, Gclm, Gsr, Ho-1, Plin2, Prdx1, Prr13, Slc48a1, Srxn1, Esd) were found to be induced by the radish extract. The results are shown in FIG. Nine of these genes (Blvrb, Cxcl3, Ftl1, Gsr, Plin2, Prr13, Slc48a1, Srxn1, Esd) are genes whose transcription is induced by a newly discovered radish extract.

Blvrb acts on oxidative stress as an isoform of flavin reductase. Cxcl3 is a C-X-C motif chemokine 3 precursor molecule that is involved in chemokine regulation. Ftl1 (ferritin light chain 1) is an iron molecule receptor and Gsr is glutathione reductase. Prr13 (proline-rich protein) inhibits the expression of Thrombospondin 1 (TSP1) at the transcriptional stage. Plin2 (Perilipin-2) is an adifferentiation related protein and Slc48a1 is a heme transporter. Srxn1 is sulfiredoxin and is involved in antioxidant metabolism. Esd is s-formylglutathione hydrolase.

Therefore, radish extract in inflammatory model cells can be seen to function not only to inhibit inflammatory stress but also to inhibit oxidative stress.

In addition, HepG2 cells were treated with 600 uM of FFA (oleic acid + palmitic acid) and radish extract (BRE), and the genes induced expression were analyzed by NGS technique and shown in FIG. 11. As a result, the mRNAs of the CYP1A1, SULT2A1, NKA1N1, AHRR, HO-1, ALDH3A1, GCLM, and OLFM2 genes in the FFA + BRE-treated group (FFA + BRE) were 2 ~ 8 times more expressed. These genes are genes induced through Nrf2 activation of radish extract, and can be seen to enhance hepatocyte function through cytoprotection, lipid accumulation inhibition, antioxidant, and the like.

< Experimental Example  11> Inhibition of Differentiation of Adipocytes into Adipocytes by Radish Extract

MDI (3-isobutyl-1-methylxanthine, Dexamethasone, Insulin) was treated to 3T3L1 cells (progenitor fat cells) to induce differentiation into adipocytes, and the extracts were treated by concentration to analyze the inhibitory effect on adipocyte differentiation. 12 is shown.

3T3-L1 cells were aliquoted into 12 well plates and incubated for 2 days. MDI (0.5 mM 3-isobutyl-1-methylxanthine (Sigma, USA), 1 uM dexamethasone (Sigma, USA), 10 µg / ml insulin (Sigma, USA)), which is a differentiation inducing substance, is contained in post-confluence state after 2 days Differentiated DMEM / 10% FBS (fetal bovine serum) culture to promote differentiation for 2 days. After 2 days, the existing medium was removed and exchanged with DMEM / 10% FBS culture containing 10 μg / ml insulin for 2 days, and then cultured with DMEM / 10% FBS culture. Total differentiation induction was carried out for 8 days, the radish extract was treated with differentiation inducer. Thereafter, the accumulated fat amount was analyzed using Oil Red O staining.

12 (A), it can be seen that differentiation into adipocytes was significantly suppressed in the group treated with 100 g / ml and 200 g / ml of the radish extract.

And the result of quantitatively measuring the fat amount after dissolving Oil Red O stained in adipocytes in isopropanol is shown in Figure 12 (B). In the same manner as in (A), the amount of fat decreased depending on the concentration of the extract.

< Experimental Example  12> by Radish Extract in Adipose Cell Model Nrf2  And expression of HO-1

13 shows the results of analyzing the expression levels of Nrf2 and HO-1 using western blot after protein extraction from the cells of Experimental Example 11. The higher the concentration of radish extract, the higher the expression of Nrf2 and target gene HO-1. These results suggest that radish extract induces the expression of Nrf2, activates Nrf2 and expresses its target gene, HO-1, which is involved in the inhibition of differentiation of progenitor cells into adipocytes.

< Experimental Example  13> HO-1 and Radish Extract in Adipose Cell Model Of NQO1  Warrior Induction

It was shown in Figure 14 by analyzing the HO-1, NQO1 mRNA transcription induction effect of the radish extract using quantitative PCR.

After 2 and 6 days, 3T3L1 cells were treated with MDI and various concentrations of radish extracts, and total RNA isolation and cDNA were synthesized to perform quantitative PCR. In the radish extract treatment, HO-1 was transcribed as high as 2 to 20 times in 2 days, and also 6 days as high as 2.5 to 15 times. It was confirmed that NQO1 mRNA was transcribed to a very low level in the untreated group and the MDI-only group compared with the non-extracted group.

In the group treated with radish extract for 2 days, both genes showed high concentration-dependent transcription, but the pattern in the group treated for 6 days was very different from that treated for 2 days.

In conclusion, Nrf2 is activated by radish extract in both undifferentiated adipocytes or differentiated adipocytes to express HO-1 and NQO1 genes to inhibit adipocyte differentiation.

Claims (4)

Contains black radish extract as an active ingredient,
The black radish extract is heat-treated 400 g of black radish at 70 to 80 ℃ and hot air dried and extracted from 70% ethanol,
The black radish extract is inducing and activating the expression of Nrf2 to regulate the target gene expression inhibiting the differentiation of progenitor cells from adipocytes to adipocytes. According to claim 1, wherein the target gene is Abcc1 (multidrug resistance-associated protein 1), Blvrb (flavin reductase (NADPH)), Cat (catalase), CxC3 (CXC motif chemokine 3 precursor), Ftl1 (ferritin light chain 1) , Gclm (glutamate--cysteine ligase regulatory subunit), Gsr (glutathione reductase, mitochondrial), Ho-1 (heme oxygenase 1), Plin2 (perilipin-2), Prdx1 (peroxiredoxin-1), Prr13 (proline-rich protein 13 ), Slc48a1 (heme transporter HRG1), Srxn1 (sulfiredoxin-1) and Esd (S-formylglutathione hydrolase) is any one selected from the group consisting of a pharmaceutical composition for treatment of fatty liver. The method of claim 1, wherein the black radish extract is 3-hydroxymethyl-2-pyrrolidinethione, 3- [ethoxy- (methylthio) methyl] -2-pyrrolidine Thion (3- [ethoxy- (methylthio) methyl] -2-pyrrolidinethione) and 3- (E)-(methylthio) methylene-2-pyrrolidinethione (3- (E)-(methylthio) methylene-2- pyrrolidinethione) pharmaceutical composition for treating fatty liver, characterized in that it comprises any one compound selected from the group consisting of. According to claim 1, wherein the black radish extract is any one selected from the group consisting of glucoraphanin (glucoraphanin), glycoerucin (glucoerucin), glucoraphasatin and 4-methoxylglucobrassicin Pharmaceutical composition for treating fatty liver, characterized in that it comprises one glucosinolate (glucosinolate).

Images