KR20190011919A - Nrf2 activating composition containing radish extract as an active ingredient and a method for producing the radish extract - Google Patents

Abstract

The present invention relates to an Nrf2 activation and expression inducing composition containing a radish extract as an active ingredient. The composition activates Nrf2 which is a transcription factor to express NADPH production regulatory gene, GSH production regulatory gene, Quinone detox gene, iron regulatory gene, redox homeostasis regulatory gene, Heme metabolism gene, and the like. According to the present invention, due to an Nrf2 activation action induced by the composition, it is possible to confirm 1) an effect of inhibiting differentiation into fatty liver cells from liver cells, 2) an anti-inflammation effect for inflammatory cells, and 3) an effect of inhibiting differentiation into adipocytes of preadipocytes, by using HepG2 cells which are liver cells, RAW254.7 cells which are used for an inflammatory model, and 3T3L1 cells which are well known for a differentiation mechanism to adipocytes.

Description

The present invention relates to an Nrf2 activating composition comprising a radish extract as an active ingredient and a method for producing the Nrf2 activating composition containing an active ingredient and a method for producing the radish extract,

The present invention relates to an Nrf2 activating composition comprising a radish extract as an active ingredient and a method for preparing the Nrf2 extract. More particularly, the present invention relates to a Nrf2 activating composition comprising Nrf2 (Nuclear factor erythroid derived- 2) -related factor 2), and to a method for producing the extract without extract, which comprises the extract as an active ingredient.

Radish is an edible crop belonging to the Brassicaceae family, cultivated worldwide in Spain, China, Turkey and Russia. It is also known as a traditional medicinal plant in Spain, China and Russia. come.

Glucosinolate is a secondary metabolite of cruciferous crops and is produced in various ways by plant growth, protection from the environment, plant immunity, defense from microorganisms, and other physiological phenomena. Most glucosinolates are broken down into glucose, sulfate, and aglucone by myrosinase and are classified as isothiocyanate (ITCs), surforaphenen, thiocyanate, oxazolindine-2-thione and nitrile depending on the structure of the compound. And it has been reported that there are more than 120 kinds of glucosinolates.

 According to recent reports, black radish has anti-cancer, vascular disease improvement, pneumonia improvement, liver detoxification effect. Bleomycine (BLM) -induced pulmonary fibrosis (TGF-b) was significantly reduced in blood and lung tissues as a result of administration of the black fungus extract in animal model diseases (Asquhari et al 2015). Evans et al (2014) analyzed the detoxification effects of black fungus extract in an animal model that induced hepatotoxicity by administering acetaminophen. Glutamyl transferase levels in plasma were analyzed to show that glutamyl transferase levels were significantly decreased Respectively. These results indicate that the black wilt extract activates the liver enzyme phase I and phase II in liver. In Mexico, Castro-Torres et al (2013) reported that black wilt extract inhibited cholesterol gallstones formation in experimental animals.

However, there is no report on the effect of radish extract on Nrf2, the transcription factor.

(NFE-2) -related factor 2 (NFE-2) protects cells during inflammatory, cardiovascular, pulmonary fibrosis, central nervous system disease, diabetes, aging, and cancer caused by external stress Is a transcription factor that is known to play a role. In the absence of oxidative stress, Nrf2 binds to Keap1 (Kelch-like ECH-associated protein1) in the cytoplasm and is present in complex state and degraded by ubiquitin-proteasome. However, when oxidative stress occurs, Nrf2 phosphorylates and separates from Keap1 and moves to the nucleus, which then binds to the antioxidant response element (ARE) of target genes (CYP1A2, HO-1, NQO1, etc.) It plays an important role in human defense by inducing antioxidant enzyme and anti-inflammatory enzyme expression.

In the present invention, it was confirmed that the extract-free extract exhibits excellent induction and activation effect on Nrf2, thereby completing the present invention.

IG Castro-Torres et al. Raphanus sativus L. Var Niger as a Source of Phytochemicals for the Prevention of Cholesterol Gallstones, Phytother Res 28 (2), 167-171.

It is an object of the present invention to provide a composition for inducing Nrf2 activation and expression derived from a natural product.

Yet another object of the present invention is to provide a method for producing the natural product.

In order to achieve the above object, the present invention provides a composition for inducing Nrf2 activation and expression, which comprises a radish extract as an active ingredient.

The non-extract is selected from the group consisting of Abcc1, Blvrb, Cat, Cxcl3, Ftl1, Gclm, Gsr, Ho-1, Plin2, Prdx1, Prr13, Slc48a1, Srxn1, Esd, Cyp1A1, Cyp1A2, NQO1, Sult2a1, ALDH3A1, NKAIN1, AHRR and OLFM2 The expression of any one of the genes selected from the group consisting of SEQ ID NOs.

Wherein the extract is selected from the group consisting of 3-hydroxymethyl-2-pyrrolidinethione, 3- ethoxy- (methylthio) methyl] -2-pyrrolidinethione and 3- (E) - (methylthio) methylene-2-pyrrolidinethione Or a compound thereof.

Wherein the radish extract comprises any glucosinolate selected from the group consisting of glucoraphanin, glucoerucin, glucoraphasatin, and 4-methoxylglucobrassicin.

A step of heat-treating after cutting the radish; Hot air drying; Extracting with 70% ethanol; The present invention also provides a method of producing the radish extract.

The present invention provides a method for inhibiting the differentiation into fatty liver cells induced by OA (oleic acid) by treating the cells with the radish extract.

The present invention provides a method for inhibiting the inflammatory reaction induced by LPS (lipopolysaccharide) by treating the cell extract with the extract.

The present invention provides a method for inhibiting differentiation into adipocytes induced by MDI (3-Isobutyl-1-methylxanthine (IBMX) -Dexamethasone (DEX) -insulin) by treating the cells with the extract.

The composition according to the invention induces and activates the expression of Nrf2.

The composition regulates the expression of the target gene of Nrf2.

The composition inhibits differentiation into fatty liver cells, inflammatory reaction and differentiation into adipocytes.

FIG. 1 shows the results of confirming the induction of Nrf2 expression by various non-extractable samples.
Fig. 2 shows the results of confirming the Nrf2 activation effect of the three kinds of extract-free samples.
FIG. 3 shows the transcription induction of CYP1A1 and HO-1 genes by non-extract using quantitative PCR.
Fig. 4 shows the effect of suppressing the differentiation of hepatic cells into lipid hepatocytes by non-extract.
FIG. 5 shows the result of analyzing the components of the extract without extract.
FIG. 6 shows the results of confirming the Nrf2 activation and induction-inducing effects of a single extract of the extract-free extract.
Fig. 7 shows the results of comparing the effects of the extract without milk and the milk thistle extract.
Fig. 8 shows the results of confirming that the extract-free extract induces HO-1 expression in inflammatory model cells.
FIG. 9 shows the anti-inflammatory effect of the extract-free extract in inflammatory model cells.
FIG. 10 shows 14 genes that are transcriptionally induced by non-extract in inflammatory model cells.
Fig. 11 shows the gene whose expression is induced by non-extract in hepatocytes.
Fig. 12 shows the effect of suppressing the differentiation into adipocytes by the non-extract in the adipocyte model.
FIG. 13 shows the results of induction of expression of Nrf2 and HO-1 by an extract-free extract in an adipocyte model.
FIG. 14 shows the results of induction of transcription of HO-1 and NQO1 by non-extract in adipocyte model.

Hereinafter, the present invention will be described in more detail with reference to Examples and Experimental Examples. However, these examples and experimental examples are intended to further illustrate the present invention, and the scope of the present invention is not limited thereto.

EXAMPLES Preparation of Extracts without Extract

The extracts were prepared using radish under various conditions as shown in Table 1 below.

Sample number part Pretreatment input Extraction condition Example 122 Black Heat treatment (70-80 캜, 10 min)
Hot air drying (96 hours) 400g 7 0% ethanol Comparative Example 1 101 Sheath Non-drying 3.5kg 80% alcohol, 5L Comparative Example 2 102 Meat Non-drying 6.5kg 80% alcohol, 10L Comparative Example 3 103 0.5-1 cm slice Non-drying 5kg 80% alcohol, 8L Comparative Example 4 104 0.5-1 cm slice Non-drying 5kg Hot water, 10L Comparative Example 5 105 0.5-1 cm slice Heat treatment (70-80 캜, 10 min)
Hot air drying (96 hours) 200g 30% alcohol, 2L Comparative Example 6 106 0.5-1 cm slice Heat treatment (70-80 캜, 10 min)
Hot air drying (96 hours) 200g 50% alcohol, 2L Comparative Example 7 107 0.5-1 cm slice Heat treatment (70-80 캜, 10 min)
Hot air drying (96 hours) 200g 70% alcohol, 2L Comparative Example 8 108 0.5-1 cm slice Hot air drying (96 hours) 300g (4h), 3L Comparative Example 9 109 0.5-1 cm slice Hot air drying (96 hours) 300g 30% alcohol, 3L Comparative Example 10 110 0.5-1 cm slice Hot air drying (96 hours) 300g 50% alcohol, 3L Comparative Example 11 111 0.5-1 cm slice Hot air drying (96 hours) 300g 70% alcohol, 3L Comparative Example 12 112 0.5-1 cm slice Freeze-dried (48 hours) 300g (4h), 3L Comparative Example 13 113 0.5-1 cm slice Freeze-dried (48 hours) 300g 30% alcohol, 3L Comparative Example 14 114 0.5-1 cm slice Freeze-dried (48 hours) 300g 50% alcohol, 3L Comparative Example 15 115 0.5-1 cm slice Freeze-dried (48 hours) 300g 70% alcohol, 3L Comparative Example 16 116 stem Hot air drying (48 hours) 705 g 70% ethanol, 10.6 L, twice Comparative Example 17 117 Sheath Non-drying 11kg 80% ethanol Comparative Example 18 118 Black Freeze-dried (48 hours) 500g EA extract Comparative Example 19 119 Baekmu hot air dry 103g 70% ethanol Comparative Example 20 120 Black Freeze-dried (48 hours) 500g 70% ethanol Comparative Example 21 121 Black hot air dry 400g 70% ethanol Comparative Example 22 123 Black Dried pulp 9.5kg 80% ethanol Comparative Example 23 124 Sample No. 117 HP-Column, 2nd fraction 150g 50% ethanol, 4L Comparative Example 24 125 Sample No. 117 HP-Column, primary fraction 150g Distilled water, 2L Comparative Example 25 126 Black hot air dry 500g 70% ethanol Comparative Example 26 127 Black stalk hot air dry 500g 70% ethanol Comparative Example 27 128 Squeaky hot air dry 500g 70% ethanol

Example (Sample No. 122)

The black radish was washed thoroughly with running tap water, cut into a thickness of 5 mm, boiled in water prepared in advance at 80 ° C for 10 minutes, and hot-air dried for 96 hours. It was then extracted with 70% ethanol and concentrated under reduced pressure.

<Experimental Example>

In the present invention, hepatocyte HepG2 cells, RAW264.7 cells used as an inflammation model, and 3T3L1 cells known to differentiate into adipocytes were used.

1) induction and activation of Nrf2 in each cell

2) inhibition of differentiation from hepatocytes to fatty liver cells,

3) Anti-inflammatory effect in inflammatory cells

4) Inhibitory effect of adipocyte differentiation on adipocytes

Respectively.

Cell culture

HepG2 (human hepatocyte), RAW264.7 (mouse macrophage) and 3T3-L1 (mouse precursor adipocytes) were purchased from American Type Culture Collection (ATCC). The cells were cultured in DMEM (Dulbecco's Minimal Essential Medium, Gibco, USA) supplemented with 100 U / L penicillin, 100 μg / ml streptomycin, 10% calf serum (Gibco, USA) and 10% fetal calf serum ) Or MEM culture medium in an incubator maintained at 5% CO ₂ and 37 ° C, and subculture was performed every 3 to 4 days.

Electrophoresis and Western blot analysis

Protein separation from cultured cells was performed by washing the cells 2-3 times with PBS, treating with RIPA lysis buffer, and homogenizing for 30 minutes. The homogenized cells were centrifuged and the supernatant was obtained. Protein concentration was determined by standardizing BSA (Bovine Serum Albumin) using Bio-Rad Protein Assay Kit. Total protein was separated by 30% -50 μl of lysate by 10% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF; Millipore, USA) membrane. The PVDF membrane was treated with 5% non-milk and blocking buffer for 1 hour at room temperature and treated with primary antibodies (anti-Nrf2, anti-HO-1, anti-CYP1A2 and anti-β-actin). After washing with TTBS, the secondary antibody was reacted with HRP-conjugated anti-mouse, anti-rabbit and anti-goat IgG (Immunoglobulin G) at room temperature and washed with TTBS to remove WEST-ZOL ) Was post-sensitized to the X-ray film.

<Experimental Example 1> Induction induction of Nrf2 expression by non-extract

(BRE) samples extracted from various conditions of Table 1 were treated with HepG2 cells and analyzed for expression of Nrf2 using western blot after 16 hours, as shown in Fig.

In FIG. 1, Nrf2 expression is very low in cells treated with DMSO alone as a control. However, in the cells treated with the extract No. 127 (BRE NO) 101, 103, 115, 116, 117 and 122 Nrf2 was expressed very strongly.

<Experimental Example 2> Activation of Nrf2 by non-extract

Nrf2 activation of non - extract was confirmed by confirming whether Nrf2 present in cytoplasm in Keap1 was separated from Keap1 by non - extract treatment and moved to the inside of nucleus to express target gene (CYP1A2) as a transcription factor. The results are shown in Fig.

HepG2 cells were cultured in a 6-well plate at a density of 1 x 10 &lt; ⁵ &gt; / ml in a MEM medium containing 10% FCS for 24 hours. After that, the extract was treated with 600 uM OA (Oleic acid) and then cultured for 16 hours and western blotted. At this time, the extract of the present invention was prepared as Sample Nos. 115, 116 and 122 (Examples) No extracts were 125, 250, 500, and 1000 ug / ml, respectively.

FIG. 2 shows that Nrf2 and its target gene CYP1A2 are expressed in a concentration-dependent manner in the respective extract-free extracts. However, the target gene was not expressed in the untreated group and only the OA treated group and the no extract treated group.

Hereinafter, the non-extract used in the following Experimental Example is a sample No. 122 extract, which is an example.

<Experimental Example 3> Determination of transcription inducing effect of Nrf2 target genes CYP1A1 and HO-1 by non-extract

Analysis of CYP1A1 and HO-1 gene transcription induction effects of extract-free (sample No. 122) using quantitative PCR was shown in FIG.

HepG2 cells were treated with OA and extracts (122 samples) at various concentrations and 8 hours later, total RNA was isolated and cDNA was synthesized and quantitative PCR was performed. Total RNA was isolated from the cultured HepG2 cells using the NucleoSpin RNA reagent kit (Macherey-Nagel), and cDNA synthesis was performed using ReverTra Ace-a synthesis kit (Japan). Quantitative PCR was performed by mixing SYBR green master premix (Biorad) with cDNA and primer for 40 cycles. The primers used are as follows.

human-GAPDH-F: TCGACAGTCAGCCGCATCTTCTTT,

      GAPDH-R: ACCAAATCCGTTGACTCCGACCTT

human-CYP1A1-F; TCCGGGACATCACAGACAGC,

      CYP1A1-R; ACCCTGGGGTTCATCACCAA

human-HO-1-F; ACGCGTTGTAATTAAGCCTCGCAC,

      HO-1-R; TTCCGCTGGTCATTAAGGCTGAGT,

3 (A), CYP1A1 mRNA was transcribed 5 times more than the untreated group or OA treated group in the 200 ug / ml treated group without extract (122th sample) and treated with 25 ug / ml of the extract And 1.8 times more.

3 (B), HO-1 mRNA was transcribed 2- to 5-fold more than the untreated or OA-treated group in the extract-free (122) samples.

Therefore, the extract (No. 122) showed strong Nrf2 expression as well as activation of Nrf2 and strong transcription of the target gene.

<Experimental Example 4> Reduction of fat accumulation by non-extract in fatty liver model

The results are shown in FIG. 4, which shows that the extract of non-extract and OA (oleic acid) in hepatocyte HepG2 cells inhibits the differentiation of OA-induced lipid hepatocytes by the extract-free extract.

First, Nrf2 expression and its target gene CYP1A2 (cytochrome P450 1A2) were detected in cells treated with various extracts (125, 250, 500, 1000 μg / HO-1 (heme oxygenase-1) expression was analyzed by western blot. The same procedure as in Experimental Example 2 is repeated except that the kinds of the extract without extract are different.

4 (A), it can be confirmed that Nrf2, CYP1A2, and HO-1 are expressed in a concentration-dependent manner in the extract without extract (sample No. 122). Thus, it was confirmed that the extract without extract (sample No. 122) strongly induced the expression of Nrf2 and activated Nrf2.

In addition, the amount of fat accumulated in hepatocytes was analyzed using Oil Red O staining. The cultured HepG2 cells were treated with no extract (sample No. 122) one hour before treatment with 600 uM OA by concentration. After 600 hours of OA treatment, the cells were fixed for 24 hours with 10% formalin for 10 minutes and then washed twice with PBS. After staining with Oil Red O for 20 min, the cells were washed three times with PBS and observed under a microscope.

4 (B), no stained cells were observed in control (OA treated group), but OA (600 uM OA treated hepatocytes) showed accumulation of triglyceride in cytoplasm. However, fat accumulation was remarkably decreased in OA + BRE 250 (treated with OA and 250 μg / ml extract) or OA + BRE 500 (treated with OA and 500 μg / ml without extract). The results are quantified and shown in Fig. 4 (C).

&Lt; Experimental Example 5 >

(3-hydroxymethyl-2-pyrrolidinethione), C5 (3- [ethoxy- (methylthio) -1,2,3,4-tetrahydroisoquinolinone) as a result of separating the extract without extract (sample No. 122) using HP- 20 column, organic solvent fraction and Sephadex LH- 2-pyrrolidinethione compounds of C7 (3- (E) - (methylthio) methylene-2-pyrrolidinethione) . This result is shown in Fig. 5 (A).

In addition, the presence of eleven components of glucosinolate was analyzed by HPLC using a no-extract (sample No. 122), and it was analyzed that four kinds (glucoraphanin, glucoerucin, glucoraphasatin, 4-methoxylglucobrassicin) were present. This result is shown in Fig. 5 (B). glucosinolate is a secondary metabolite of Brassicaceae family crops and has been reported to be present in more than 120 species.

<Experimental Example 6> Activation of Nrf2 and induction of expression of isolated single extract of extract-free ingredient

The compounds C4, C5, C6, and C7 isolated in Experimental Example 5 were treated with HepG2 cells, and Nrf2 activation and expression were analyzed by Western blot.

As a result, expression of Nrf2 was strongest in C5 and C6 treated cells, and its target gene, CYP1A2, was expressed in a concentration dependent manner by all four compounds. However, CYP1A2, the target gene, was not expressed in cells treated with neither OA nor with OA alone.

&Lt; Experimental Example 7 > Comparison of effects of extracts of no-extract and milk seed extract

The expression of Nrf2 by the extract of milk thistle, which has already been used as a raw material for health functional food, and the extract of the present invention are compared by Western blotting and shown in FIG.

As a result, Nrf2 as well as its target genes CYP1A2 and HO-1 were strongly induced by BRE. However, Nrf2 expression was significantly improved in the milk - treated group than in the untreated group, but significantly lower than that in the non - extract - treated group. In addition, the expression of target genes CYP1A2 and HO-1 in the milk seedling group was significantly lower than that of the non-extract-treated group.

As a result, mushroom could be used as a health functional food material which is superior to milk seeds in the improvement of diseases caused by oxidative stress.

<Experimental Example 8> Induction of HO-1 expression of no-extracts in inflammatory model cells

Inflammatory cell model FIG. 8 shows the expression of HO-1 (Heme oxygenase-1) by western blotting after treatment of LPS and non-extract (sample No. 122) in RAW264.7 cells (mouse macrophages) at various concentrations. Fig. 8 (A) is an image of western blot, and Fig. 8 (B) is a quantification of the image.

RAW 264.7 cells were seeded at a density of 0.5 × 10 ⁵ / ml in a 6-well plate while being maintained in DMEM medium containing 10% FBS, treated with LPS (500 ng / ml) and extract extract (sample No. 122) And cultured for 12 to 16 hours.

FIG. 8 shows that treatment with RAW264.7 cells with no extract increases the expression of HO-1 in a concentration-dependent manner.

<Experimental Example 9> Anti-inflammatory effect of no-extracts on inflammatory model cells

Recent inflammatory cell models have been reported to stimulate RAW264.7 cells with LPS (lipopolysaccharide) to rapidly increase inflammatory factors. On the other hand, Nrf2 is known to induce transcription of HO-1 (Heme oxygenase-1) to inhibit inflammation and protect cells. In addition, it is known that HO-1 synthesizes iron (Fe) ion, carbon monoxide (CO) and biliverdin to help anti-inflammation and antioxidant activity.

RAW264.7 cells were treated with LPS and non-extract (sample No. 122) to analyze the secretion level of nitric oxide (NO), which is an inflammation factor, and it is shown in FIG. RAW 264.7 cells were seeded at a density of 0.5 × 10 ⁵ / ml in a 6-well plate while being maintained in DMEM medium containing 10% FBS. After 16 hours, the extracts (sample No. 122) and LPS were treated for 12-16 hours Lt; / RTI &gt;

As shown in the graph of FIG. 9, when the LPS-treated group was further treated with no extract, the secretion of NO, an inflammatory factor, decreased. In addition, the degree of reduction depends on the concentration of the extract-free extract. This result is consistent with the fact that the non-extract induces HO-1 expression in Experimental Example 8, and HO-1 is a result of inhibiting the secretion of NO, an inflammatory factor induced by LPS, to protect cells or tissues .

Experimental Example 10 Detection of active genes by non-extract in inflammatory model cells and hepatocytes through NGS analysis technique

RAW264.7 cells were treated with 3 replicates of 5 treatment groups (control, LPS treated group, 1000 ug of LPS + no extract, 500 ug of LPS + no extract and 250 ug of LPS + no extract). TruSeq Stranded mRNA sample preparation kit was used for RNA preparation. RNA analysis was performed using Illumina NextSeq500 model, and sequence reading was performed using 76 Paired-end read. The reference genome used was mmu 10 (ver10).

The number of genes that can be read using NGS (Next Generation Sequencing) is 26,665. As a result of comparing with the center of LPS-treated cells, the number of genes whose expression is increased is about 8,000 and the number of genes whose expression is decreased is 8,000 It is inside and outside. P test results showed that 2,627 genes were significantly different from the control and LPS - treated groups (P value ≤0.05). However, the number of genes with high significance was decreased to less than half when compared with LPS treatment group and LPS + no extract group. The results are shown in Table 2 below.

compare Total number of expressed genes
(P value &lt; = 0.05) Number of expression-increasing genes
(P value &lt; = 0.05) Number of expression-reducing genes
(P value &lt; = 0.05) Control group / LPS treated group 26,665
(2,627) 8,246
(1,157) 8,172
(1,470) LPS treated group /
LPS + no extract 1000ug 26,665
(986) 8,200
(404) 8,236
(582) LPS treated group /
LPS + no extract 500ug 26,665
(324) 8.066
(149) 8,311
(175) LPS treated group /
LPS + no extract 250ug 26,665
(46) 8,146
(33) 8,117
(13)

In this experiment, we found 14 genes (Abcc1, Blvrb, Cat, Cxcl3, Ftl1, Gclm, Gsr, Ho-1, Plin2, Prdx1, Prr13, Slc48a1, Srxn1, Esd) The results are shown in Fig. Among them, 9 genes (Blvrb, Cxcl3, Ftl1, Gsr, Plin2, Prr13, Slc48a1, Srxn1, and Esd) are transcriptionally induced by the newly discovered radish extract.

Blvrb is an isoform of flavin reductase that acts on oxidative stress. Cxcl3 is a C-X-C motif chemokine 3 precursor molecule that is involved in the regulation of chemokines. Ftl1 (ferritin light chain 1) is an iron molecule receptor and Gsr is a glutathione reductase. Prr13 (proline-rich protein) inhibits the expression of TSP1 (Thrombospondin 1) at the transcriptional stage. Plin2 (Perilipin-2) is a lipoprotein-related protein, and Slc48a1 is a heme transporter. Srxn1 is sulfiredoxin and is involved in antioxidant metabolism. Esd is an s-formylglutathione hydrolase.

Therefore, in the inflammatory model cells, the extract without extract inhibits the oxidative stress as well as the inflammation stress.

In addition, the HepG2 cells were treated with 600 uM of FFA (oleic acid + palmitic acid) and no extract (BRE) and their expression-induced genes were analyzed by the NGS technique and shown in Fig. As a result, the mRNA of CYP1A1, SULT2A1, NKA1N1, AHRR, HO-1, ALDH3A1, GCLM and OLFM2 genes in the FFA and FFA-treated groups (FFA + BRE) ~ 8 times more. These genes are genes derived through the Nrf2 activation of the non-extract, and can be considered to enhance hepatocyte function through cell protection, lipid accumulation inhibition, and antioxidation.

<Experimental Example 11> Inhibition of differentiation into adipocytes by no-extract in adipocyte model

3T3L1 cells were treated with MDI (3-isobutyl-1-methylxanthine, Dexamethasone, Insulin) to induce differentiation into adipocytes. 12.

3T3-L1 cells were plated on a 12-well plate and cultured for 2 days. After 2 days, MDI (0.5 mM 3-isobutyl-1-methylxanthine (Sigma, USA), 1 μM dexamethasone (Sigma, USA) and 10 μg / (DMEM / 10% fetal bovine serum) for 2 days. After 2 days, the medium was replaced with DMEM / 10% FBS containing 10 μg / ml insulin for 2 days, and then cultured in DMEM / 10% FBS. The total differentiation induction was carried out for 8 days, and the non - extract was treated with the differentiation inducing substance. Then, the accumulated fat amount was analyzed using Oil Red O staining.

12 (A), it can be confirmed that the differentiation into adipocytes was markedly inhibited in the group treated with 100 μg / ml and 200 μg / ml of the extract-free extract.

Figure 12 (B) shows the result of quantitatively measuring the amount of fat after dissolving Oil Red O stained in adipocytes in isopropanol. (A) results showed that the fat content was decreased depending on the extract-free concentration.

EXPERIMENTAL EXAMPLE 12 Expression of Nrf2 and HO-1 by no-extract in Fatty Cell Model

FIG. 13 shows the results of analysis of the expression level of Nrf2 and HO-1 using western blot after protein extraction from the cells of Experimental Example 11. FIG. The higher the concentration of extract-free extract, the higher the expression of Nrf2 and the target gene, HO-1. This result suggests that the non-extract induces the expression of Nrf2 and activates Nrf2 to express the target gene HO-1, which is involved in the inhibition of differentiation into adipocytes from pre-adipocytes.

<Experimental Example 13> Transcription induction of HO-1 and NQO1 by non-extract in adipocyte model

Quantitative PCR was used to analyze the transcription induction effect of DHA-1 and NQO1 mRNA of the extract-free extract, and it is shown in FIG.

3T3L1 cells were treated with MDI and various extracts at various concentrations. After 2 and 6 days, total RNA isolation and cDNA synthesis were performed and quantitative PCR was performed. In the case of extract-free extract, HO-1 was transcribed 2 to 20 times higher for 2 days and 2.5 to 15 times higher for 6 days. NQO1 mRNA was significantly reduced in the untreated group and MDI treated group compared to the no extract treated group.

In the group treated with no extracts for 2 days, both genes were transcriptionally induced in a dose dependent manner. However, the pattern in the group treated for 6 days was very different from the treatment for 2 days.

The conclusion is that Nrf2 is activated by non-extract from both undifferentiated adipocytes and differentiated adipocytes, thereby suppressing adipocyte differentiation by expressing HO-1 and NQO1 genes.

Claims (8)

Nrf2 activation and expression inducing composition comprising radish extract as an active ingredient The method according to claim 1, wherein the extract is selected from the group consisting of Abcc1, Blvrb, Cat, Cxcl3, Ftl1, Gclm, Gsr, Ho-1, Plin2, Prdx1, Prr13, Slc48a1, Srxn1, Esd, Cyp1A1, Cyp1A2, NQO1, Sult2a1, NKAIN1, AHRR, and OLFM2. &Lt; RTI ID = 0.0 &gt; 21. &lt; / RTI &gt; 2. The method according to claim 1, wherein the extract is selected from the group consisting of 3-hydroxymethyl-2-pyrrolidinethione, 3- ethoxy- (methylthio) methyl] -2-pyrrolidinethione and 3- (E) - (methylthio) methylene- &Lt; / RTI &gt; or a pharmaceutically acceptable salt thereof. The composition according to claim 1, wherein the extract has a glucosinolate selected from the group consisting of glucoraphanin, glucoerucin, glucoraphasatin, and 4-methoxylglucobrassicin. A step of heat-treating after cutting the radish;
Hot air drying;
Extracting with 70% ethanol;
Of the extract of claim 1. A method for inhibiting differentiation into fatty liver cells induced by OA (oleic acid) by treating the cell extract with the extract of claim 1. A method for inhibiting the inflammatory reaction induced by LPS (lipopolysaccharide) by treating the cell extract with the extract of claim 1. A method for inhibiting differentiation into adipocytes induced by MDI (3-Isobutyl-1-methylxanthine (IBMX) -Dexamethasone (DEX) -Insulin) by treating the cells with the extract of claim 1.

Images