KR20190075269A - Alpha neoagarobiose hydrolase derived from cellulophaga omnivescoria w5c strain and application thereof - Google Patents

Abstract

The present invention relates to an alpha neoagarobiose hydrolase derived from a Cellulophaga omnivescoria W5C strain and an application thereof and, more specifically, to a novel alpha neoagarobiose hydrolase capable of hydrolyzing agarobiose to produce a hydrolysate that can be used as a food, a drug, and a cosmetic material; and an application thereof. According to the present invention, an alpha neoagarobiose hydrolase derived from a Cellulophaga omnivescoria W5C strain may be provided. In addition, the present invention may produce a recombinant E. coli by isolating an alpha neoagarobiose hydrolase gene from the Cellulophaga omnivescoria W5C strain, and thus may produce the alpha neoagarobiose hydrolase in a large batch. The produced alpha neoagarobiose hydrolase may produce D-galactose, which is the substrate of D-galactonate that can be beneficially utilized in the food, drug, and cosmetics industries.

Description

[0001] ALPHA NEOAGAROBIOSE HYDROLASE DERIVED FROM CELLULOPHAGA OMNIVESCORIA [0002] W5C STRAIN AND APPLICATION THEREOF [0003]

The present invention relates to an alpha neo-agarose biosynthetic enzyme derived from Omnivus Korea W5C strain and its application, more specifically, to a hydrolyzate of agarose bios, which can be used as a raw material for food, medicine and cosmetics To a novel alpha neoagarotic biosynthetic enzyme capable of producing a degradation product and its application technology.

Crops such as sugar cane, barley, potatoes and corn have been used to produce biofuels and platform chemicals because they are a rich source of fermentable sugars. As crops are used for food, the use of crops for biofuel production compete with food supplies. Thus, non-edible resources such as lignocellulosic biomass have been used as an alternative source. Although lignocellulose does not compete with food supply, the presence of lignin makes it difficult to hydrolyse, resulting in an increase in total energy demand and production costs. In recent years, interest in renewable biomass resources has been shifted to marine large algae or seaweeds. Compared to land biomass and lignocellulosic biomass, seaweeds do not require land and fresh water for cultivation, produce significantly higher per unit area, and have little or no lignin content.

Agar and carrageenan are major polysaccharides present in large red algae. In particular, agar is composed of agarose and agaropectin. Agarose is a mixture of D-galactose (D-gal) and 3,6-anhydro-L-galactose (3,6- anhydro-L-galactose, and L-AHG) are composed of linear polymers, while agaropectin is composed of D-gal residues of β-1,3-bonds which are partially sulfuric acid. On the other hand, carrageenan has a structure similar to the sulfuric acid structure for D-gal and L-AHG units of agar. To use such a complex polysaccharide, the linear polymer must first be hydrolyzed into an agarase to release (produce) a monomeric sugar that can be readily catabolized by a suitable microorganism.

Agarase plays an important role in the depolarization of the baby and is classified according to the type of cleavage. Β-agarase cleaves β-1,4-glycosidic bonds and releases neoagarooligosaccharides (NAOSs) and D-gal at the reducing end. On the other hand, alpha-agarase produces agarooligosaccharides having L-AHG at the reducing end by cleaving the alpha-1,3-bond. In agar-degrading organisms, a combination of agarolytic enzymes is required for complete hydrolysis of agarose.

The combination of agarose degrading enzymes is necessary to complete the hydrolysis of agarose. On the other hand, neoagarobiose hydrolase (known as α-agarase), which catalyzes the production (release) of fermentable sugar D-galactose from neoagarobiose (NA2) (See FIG. 1).

The present inventors have recently isolated a new marine bacterium ( Cellulophaga sp. W5C), and it has been confirmed that this strain contains gene clusters that decompose polymers derived from marine algae through genome sequence analysis. In the present invention, A new α-neoagarobiose hydrolase (α-NABH) enzyme was identified from the W5C genome. The members of the cellulophagous genus are known to produce hydrolytic enzymes other than carrageenan degrading enzymes. However, the above-mentioned α-NABH derived from the genus has not been reported so far. The α-NABH was overexpressed in E. coli. The purified enzyme was applied to a prototype process that converts G. amansii biomass to D- galactonate , an expensive compound that is applied in the food, pharmaceutical and cosmetic industries. The α-NABH obtained from cellulophaga was first discovered by the present inventor and can be applied to biosynthesis of D-galactonate from large red algae.

S. Ma, G. Duan, W. Chai, C. Geng, Y. Tan, L. Wang, et al., Purification, cloning, characterization and essential amino acid residues analysis of a new ι-carrageenase from Cellulophaga sp. QY3, PLoS ONE. 8 (2013)

The present invention provides an alpha neoagarotic biosynthetic enzyme derived from an omnibus Korea W5C cellulopathogen.

Also provided is a recombinant Escherichia coli into which an expression vector containing the gene is introduced and a method for producing the same.

The present invention also provides a method for producing D-galactonate using the alpha neo-agarose biosynthetic enzyme produced from the recombinant E. coli.

In order to achieve the above object, the present invention provides an alpha neoagarotic biosynthetic enzyme derived from Cellulophaga omnivescoria W5C strain.

The accession number of the cellulophagus Omnibus Korea W5C strain is KCTC 13157BP.

The alpha neo-agarose biosynthetic enzyme can be encoded by a gene consisting of the nucleotide sequence of SEQ ID NO: 1.

The alpha neo-agarose biosynthetic enzyme may be composed of the amino acid sequence of SEQ ID NO: 2.

The present invention also provides a recombinant Escherichia coli into which an expression vector containing a gene encoding an alpha neoagarotic biosynthetic enzyme derived from Omnibus Korea W5C cellulosum is introduced.

The gene may be composed of the nucleotide sequence of SEQ ID NO: 1.

The present invention also relates to a method for producing an expression vector comprising the steps of: (a) preparing an expression vector into which a gene coding for an alpha neoagarotic biosynthetic enzyme derived from a strain of cellulo phage Omnibus Korea W5C is introduced; And introducing the expression vector into Escherichia coli and transforming the transformed Escherichia coli (step b).

The gene may be composed of the nucleotide sequence of SEQ ID NO: 1.

In the present invention, a "vector" is a DNA product containing a DNA sequence operably linked to an appropriate regulatory sequence capable of expressing the DNA in an appropriate host, and is used interchangeably with a "plasmid" do. The production of the recombinant E. coli can be carried out by a method of inserting a gene coding for an alpha neoagarose biosynthesis enzyme into a vector through a known gene manipulation method and then introducing the gene into E. coli.

As a vector used for overexpression of the gene according to the present invention, an expression vector known in the art can be used, and it is preferable to use a pET family vector (Invitrogen).

The present invention also provides a method for producing a recombinant Escherichia coli comprising the step of culturing a recombinant Escherichia coli into which an expression vector containing a gene encoding an alpha neoagarotic biosynthetic enzyme derived from Omnibus Korea W5C strain is introduced, A method for producing agarose biosynthetic enzymes is provided.

The recombinant E. coli can be cultured at 20 ° C to 40 ° C.

The present invention also provides a recombinant Escherichia coli or a lysate thereof, into which an expression vector containing a gene encoding an alpha neoagarotic biosynthetic enzyme derived from Omnibus Korea W5C strain is introduced, is introduced into Neo Agarobiose Galactose to produce D-galactose.

The present invention also relates to a method for producing a recombinant Escherichia coli or a lysate thereof in which an expression vector containing a gene encoding an alpha neoagarotic biosynthetic enzyme derived from Omnibus Korea W5C strain is introduced Galactosyltransferase to obtain D-galactose and then producing D-galactonate from the D-galactose by using recombinant E. coli containing a gene encoding galactose dehydrogenase ( gld ).

The lysate may be prepared by culturing the recombinant E. coli, followed by centrifugation and sonication, followed by obtaining a lysate in the supernatant.

The recombinant E. coli can be deleted from the gene encoding galactokinase ( galK ) and 2-oxo-3- deoxygalactonate kinase ( dgoK ).

The accession number of the cellulophagus Omnibus Korea W5C strain is KCTC 13157BP.

According to the present invention, it is possible to provide an alpha neoagarobiose hydrolase derived from Omnibus Korea W5C cellulopa. In addition, it is possible to mass-produce alpha neoagarose biosyse hydrolase by preparing recombinant E. coli by isolating the alpha neoagarose biosynthetic enzyme gene from the cellulopathy Omnibus Korea W5C strain. The produced alpha neoagarose biosynthetic enzymes can produce D-galactose, a substrate of D-galactonate, which can be useful in the food, pharmaceutical and cosmetic industries.

Figure 1 is a schematic diagram of a prototype process for the conversion of marine biomass, G. amansii to D- galactonate .
Fig. 2 shows the results of (a) cellulo sp. Gene cluster for L-AHG metabolism in W5C; (b) Agar counts for agarase of the GH96 and GH117 families.
Figure 3 relates to the amino acid alignment of AhgI with the alpha-NABH / NAOS hydrolase, where the inverted triangle represents the sequence of the signal peptide sequence cleavage, the quadrangle represents the residue involved in substrate binding, do.
Figure 4 shows (a) SDS-PAGE analysis results of intact AhgI and truncated AhgI; (b) TLC analysis of NA2 hydrolyzed with AhgI.
Figure 5 relates to the biochemical properties of AhgI, (a) pH effect, (b) temperature effect and (c) metal ion effect on enzyme activity. The pH effect on AhgI activity was measured by carrying out the reaction at 30 ° C for 15 minutes and the temperature analysis was carried out at pH 7.0. The metal ion effect was measured under optimal conditions for enzyme activity. (a) and (b) indicate the relative enzymatic activity measured in the absence of pre-incubation and the relative enzyme activity measured in the pre-incubated state, respectively.
Figure 6 (a) shows the hydrolysis products of agar extracted from G. amansii with [beta] -agarase and AhgI. (b) is a graph showing the relationship between the amount of D-galactonate produced in the hydrolyzed agar and the time. (a) in a TLC plate; The second lane represents the reaction products NA4 and NA6 produced when the agar is hydrolyzed to AgaA7 and the third lane represents the reaction product NA2 produced when the reaction product of the second lane is hydrolyzed to Aga50D and NA4 And NA6, and the fourth lane represents L-AHG, D-gal, which are reaction products produced when the reaction products of the third lane are hydrolyzed to AhgI, and NA2 and NA3, respectively.
Figure 7 shows (a) expression and secretion of Aga50D of B. subtilis ; (b) B. subtilis the growth of pBE-Aga50D and the activity of secreted Aga50D expressed in terms of oligosaccharide concentration; And (c) TLC analysis results for the Aga50D hydrolyzate (NA2).
Figure 8 shows (A) TLC analysis and (B) DNS analysis for agar hydrolysis of AgaA7 and Aga50D.
Figure 9 relates to TLC analysis results for NAOS (obtained by hydrolyzing agarose with AgaA7) hydrolysis by AhgI. Lane 1: D-galactose; Lane 2: D-AHG; Lane 3: NA2; Lane 4: L-AHG and D-gal, which are products produced when NA2 is hydrolyzed to AhgI; Lane 5: NA4 and NA6, which are products produced when agar is hydrolyzed to AgaA7; Lane 6: L-AHG, NA3, and trace NA5, products produced when the NA4 / NA6 substrate is hydrolyzed to AhgI.

Hereinafter, the present invention will be described in more detail with reference to Examples. The objects, features and advantages of the present invention will be readily understood through the following examples. The present invention is not limited to the embodiments described herein, but may be embodied in other forms. The embodiments described herein are provided to enable those skilled in the art to fully understand the spirit of the present invention. Therefore, the present invention should not be limited by the following examples.

Figure 1 is a schematic diagram of a prototype process for the conversion of marine biomass, G. amansii to D- galactonate . According to one embodiment of the present invention, cellulophagus sp. D-galactose can be obtained from neoagarobiose using a novel α-neoagarobiose hydrolase (α-NABH) identified from W5C.

≪ Materials and methods >

1. Cloning, expression and purification of AhgI

All DNA manipulations were performed using standard protocols. The ahgI gene is a celluloprotein sp. Was identified in the genomic sequence of W5C (KCTC 13157BP; GenBank Acc. No. MDDP00000000.1). The target open reading frame for ahgI was prepared using the appropriate primers in Table 1, The DNA of W5C was amplified by PCR.

primer Sequence (5 '→ 3') ^a function W5CNABH-F
CTC ATTAAAAAAAGCATAGCATT GGATCC (SEQ ID NO: 3) Intact ahgI Forward primer for amplification W5CNABH'-F CTC GCCTGTAAAAATAATACCAA GGATCC (SEQ ID NO: 4) Truncated ahgI Forward primer for amplification W5CNABH-R GTA GAATTC TTTAGATTTTACACCTTTAG (SEQ ID NO: 5) khaki Reverse primer for amplification

^a underline is a restriction enzyme site

The PCR product was inserted into the pET28a vector (Invitrogen, South Korea) at the BamHI-EcoRI site. E. coli DH5α was used for plasmid maintenance and E. coli BW25113 (DE3) was used as an expression host. In addition, EWG3 strain ( E. coli Δ galK ? DgoK pET28a- gld ) was used for D-galactonate production (H. Liu, KRM Ramos, KNG Valdehuesa, GM Nisola, LB Malihan, W.-K. Lee, et al., Metabolic engineering of Escherichia coli for biosynthesis of D-galactonate, Bioproc Biosyst Eng. 37 (2014) 383391. doi: 10.1007 / s00449-013-1003-6.)

SDS-PAGE analysis was performed to confirm the expression of AhgI cloned into E. coli BW25113 (DE3) pET28a- ahgI strain. Expression of AhgI was induced by the addition of 0.5 mM isopropyl [beta] -D-1-thiogalactopyranoside (IPTG). The 6 × histidine-tagged protein was purified using a Protino® Ni-TED pre-packed column (Macherey-Nagel, BMS, Korea). Protein concentration was measured by Bradford method and sample purity was confirmed by SDS-PAGE.

2. AhgI sequence analysis

The nucleotide and amino acid sequences of AhgI are available from the BLAST program at Uniprot (http://www.uniprot.org/blast/) and the National Center for Biotechnology Information (NCBI; https://blast.ncbi.nlm.nih.gov/Blast. cgi). SignalP 4.1 was used to determine if the enzyme had an amino-terminal signal peptide sequence. Multiple sequence alignment was performed with the Clustal Omega program (http://www.ebi.ac.uk/Tools/msa/clustalo/).

3. Analysis of enzyme characterization

The enzyme was analyzed by mixing 3 mM of NA2 produced by continuous hydrolysis of agarose with AgaA7 and Aga50D and 100 단백질 of protein (see Supplementary Experimental Methods below). The samples were incubated at 30 ° C for 2 hours and the progress of the reaction was monitored by thin layer chromatography (TLC). Samples were spotted on a Silica Gel 60 plate (Merck, USA) and chromatographed with a solution of n -butanol-ethanol-water (3: 2: 2 by volume). The reaction products were visualized by spraying plates with 0.2% resorcinol solution and 10% H ₂ SO ₄ solution in ethanol and exposed to heat. Because of the lack of commercially available L-AHG, D-AHG (Dextra Laboratories, UK) was used instead as a standard. The optimal pH for AhgI activity was determined by first reacting at 30 ° C for 15 minutes at different pH values using the following buffers: 50 mM citric acid (pH 5.0-6.0), 50 mM Tris-Cl (pH 7.0-8.0) And 50 mM glycine-NaOH (pH 9.0-10.0). The temperature effect on enzyme activity was confirmed at pH 7.0 to 20 ℃ and 60 ℃. Similarly, the reaction mixture was incubated for 15 minutes. The stability of AhgI was determined by preincubating the enzyme at different pH and temperature for 1 hour. In addition, Ca ^{2 +} , K ⁺ , Mg ^{2 +} and Na ⁺ effects at 10 and 100 mM concentrations were tested for enzyme activity. The reaction was carried out at the optimum pH and temperature. The kinematic coefficients K _m and V _max were derived from the line Weiber-Burk equation by culturing AhgI (8.5 μg) at NA2 concentrations ranging from 1-30 mM. The reaction was carried out at 30 DEG C for 10 minutes at pH 7.0.

4. Production of D-galactonate from large red algae

1) Agar extraction

The dried Gelidium amansii was purchased from Natural Food (http://0808.or.kr), Mokpo Sanjung-dong, Korea. The seaweed raw material was washed with deionized water, dried and then pulverized to remove residual salt. Agar was suspended in 10 g of G. amansii in 500 mL of 50 mM Tris-Cl buffer (pH 7.0), suspended in a boiling water bath for 4 hours and then extracted from the dried seaweed. The solids were removed by filtration.

2) Agar hydrolysis

The initial saccharification of the extracted agar was performed. Some 10 mL of agarose was hydrolyzed with 25 μg of AgaA7 at 40 ° C for 3 hours (see Additional Experimental Methods). The shortened oligosaccharide was converted to NA2 by adding 25 μg of Aga50D and incubated at 30 ° C (see additional experimental procedure). To complete the depolarization from agar to monosaccharide, 15 [mu] g AhgI was added to the hydrolyzate and incubated at room temperature for 12 hours. The final hydrolyzate was used for D-galactonate production.

3) Microbial conversion of D-galactose

EWG3 was cultured overnight in LB medium and transferred to final hydrolyzate supplemented with M9 minimal salts and appropriate antibiotics. The culture was incubated with stirring at 30 ° C. After incubation for 3 hours, 0.5 mM IPTG was added to induce the expression of galactose dehydrogenase. The samples were set and checked for time intervals to observe cell growth and metabolite concentrations.

5. Analysis Method

The amount of D-gal and L-AHG released during hydrolysis was measured by GC-MSD (HP 6890 GC / HP5973 mass selective detector) with slight modification of the known method. Some 500 μL samples were dehydrated in Labconco Freeze dryer at 40 ° C and 133 mbar. The carbonyl group of the sugar was obtained by dissolving the sample in 500 μL of 2% methoxyamine hydrochloride in pyridine and protecting it with 10 mM dodecane as an internal standard through methoxymation. The mixture was incubated at 75 ° C for 30 minutes and was derivatized with 80 μL N-methyl-N-trimethylsilyltrifluoroacetamide at 45 ° C for 30 minutes (MSTFA; Fluka, St Louis, MO, USA). D-galactonates can be prepared by hydroxamate method known to Lien (OG Lien, Determination of gluconolactone, galactonolactone, and their free acids by hydroxamate method, Anal Chem. 31 (1959) 13631366. doi: 10.1021 / ac60152a035) ). Other metabolites have been identified by Liu et al (H. Liu, KRM Ramos, KNG Valdehuesa, GM Nisola, LB Malihan, W.-K. Lee, et al., Metabolic engineering of Escherichia coli for biosynthesis of D-galactonate, Bioproc Biosyst Eng. 37 (2014) 383391. doi: 10.1007 / s00449-013-1003-6).

6. Supplementary Experiment Contents

1) Construction of Bacillus subtilis strain overexpressing and secreting < RTI ID = 0.0 >

B. subtilis pBE-AgaA7 is AgaA7 (KRM Ramos, KNG Valdehuesa, RB Cabulong, LS Moron, GM Nisola, S.-K. Hong, et al., Overexpression and secretion of AgaA7 from Pseudoalteromonas hodoensis sp. nov in Bacillus subtilis for the depolymerization of agarose, Enzyme Microbial Technol. 90 (2016) 1925. doi: 10.1016 / j.enzmictec.2016.04.009.). On the other hand, Aga50D expression hosts were constructed in a known manner. First, the aga50D gene was amplified using the following primers: Aga50DF (5 '→ 3') CGTGAGCTCTTATTCGATTTTGAAAACGA (SEQ ID NO: 6) and Aga50DR (5 '→ 3') CTTTCTAGATTTGCTGCCTAGCCTTTCGG (SEQ ID NO: 7). The amplified fragment was inserted into SacI-XbaI site of pBE-S vector and B. subtilis was transformed. Enzyme activity was measured by liquid culture according to the protocol described in Ramos et al.

2) Extracellular Aga50D analysis

Expression and secretion of Aga50D through B. subtilis was demonstrated by culturing recombinant strains in medium containing LB agar and kanamycin. The hydrolysis zone was visualized by staining with Lugol's iodine solution. B. subtilis B. subtilis cells and the cell which bears a pBE- agaA7 carrying an pBE was used as negative control and positive control, respectively (Figure 7). Compared to negative control strains, Aga50D secretion in B. subtilis was observed through Lugol's iodine reaction in agar plates. However, the agarase activity of Aga50D on agar plates was not as high as the AgaA7 expression strain (positive control). This is because Aga50D, an exolytic activity, basically slows depolarization from agar to NA2. On the other hand, AgaA7, an endolytic active, can rapidly produce short oligosaccharides in one long agar polymer chain.

B. subtilis carrying pBE- aga50D was cultured at 30 DEG C in LB liquid medium containing kanamycin. Samples were taken at time intervals in the liquid medium to determine cell growth and activity of secreted Aga50D. 200 μL clean supernatant was mixed with 800 μL of 0.25% agarose solution in 50 mM sodium phosphate buffer (pH 7.0). The samples were incubated at 30 ° C for 2 hours. The oligosaccharide content (mM) released from the agarose was measured by dinitrosalicylic acid (DNS) method. Briefly, 1 mL of the DNS reagent (6.5 g dinitrosalicylic acid in 1 L distilled water, 325 mL 2 M NaOH and 45 mL glycerol) was added to the 1 mL reaction mixture. The solution was placed in a boiling water bath for 10 minutes for color development. The reaction was completed by placing the sample in an ice bath. The absorbance at 540 nm was recorded, while the number of oligosaccharides released after agarose hydrolysis was measured using D-galactose as a reference (Fig. 7B). Agarose degradation products were analyzed by thin layer chromatography (Fig. 7C).

3) Enzyme preparation

B. subtilis carrying pBE-AgaA7 or pBE-Aga50D was cultured in LB liquid medium containing 10 [mu] g / mL kanamycin. After culturing at 30 ° C for 24 hours, the cells were removed by centrifugation and the extracellular proteins were precipitated by addition of solid ammonium sulfate until 80% saturation. The precipitate was obtained by centrifugation and dialyzed with a pH 7.0, 50 mM Tris-Cl buffer.

4) Agar hydrolysis with AgaA7 and Aga50D

Agar was hydrolyzed continuously with AgaA7 and Aga50D. The agar solution was treated with AgaA7 for 3 hours and Aga50D for 48 hours. The hydrolysis was monitored by TLC (FIG. 8A) and DNS analysis (FIG. 8B).

<Experimental Results>

1. Identification and sequence analysis of AhgI

Figure 2a shows that cellulofac is sp. A gene cluster for L-AHG metabolism in W5C (Gene cluster for L-AHG metabolism in Cellulophaga sp. W5C). Figure 2b shows phylogenetic tree of agarases from the GH96 and GH117 families of the GH96 and GH117 families. The ahgI gene encoding potential α-NABH was found downstream of the cluster and tinned with hypothetical glycosyl hydrolase protein (FIG. 2a). In terms of proximity and genomic context, the gene appears to be associated with agar-colloid hyperactivity. The ahgI gene is translated into a 408-amino acid protein, AhgI, with 1227 base pairs. Amino acid sequence analysis showed that AhgI belongs to the Glycosylase 117 (GH117) family, which is involved in α-1,3-L-neoagarooligosaccharide hydrolase activity or α-1,3-L-neo It is known to exhibit agarose biosynthetic enzyme activity. Phylogenetic analysis results, the enzyme closest to the tank and AhgI Velia galactose Tani's borane (Zobellia galactanivorans) to AhgA origin, was found to share 83% homology (Fig. 2b). It also appears to be associated with other α-agarases, members of the GH96 family.

The protein sequence alignment of AhgI, known as the α-NABH / NAOS hydrolase, was consistent with some conserved regions of the enzyme, a member of the GH117 family (FIG. 3). AhgI has the SxAxxR motif in the N-terminal helix-turn-helix domain. This sequence has been known as a basic requirement for the formation of GH117 &lt; RTI ID = 0.0 &gt; The helical-turn-helix (HTH) secondary structure formed in this region is involved in the dimerization interaction of two protein molecules. Thus, AhgI appears to have a dimeric quaternary structural protein similar to AhgA from Z. galactanivorans . The most conserved region in the peptide sequence of AhgI is associated with substrate binding. Trp-127, Thr-172, Gln-187, His-251 and His-309, conserved residues in AhgI, appear to be associated with the combination of neoagaro- oligosaccharide substrates. On the other hand, the acidic residues Asp-97, Asp-252 and Glu-310 appear to be the catalyst sites (Fig. 3).

Through comparison of genetic and peptide content between AhgI and other enzymes known as α-NABH / NAOS hydrolases, cellulophagus sp. We can see the role of AhgI in the W5C's broader easing path. The potential L-AHG metabolic gene present in the vicinity of AhgI may be a clue to the hydrolytic activity of AhgI. In addition, in the amino acid sequence of AhgI, substrate binding and spatial conservation of the catalytic residues indicate the activity of the glycoside hydrolase. AhgI is indeed a member of the GH117 family and can catalyze the cleavage of L-AHG at the non-reducing end of the oligosaccharide.

Cellulopa sp. To determine the location of AhgI in W5C, the amino acid sequence was analyzed with SignalP. Analysis showed that amino-terminal signal peptide sequences were present, which could be cleaved between the 18th and 19th residues (Figure 3). This is due to the fact that AhgI &lt; RTI ID = 0.0 &gt;Lt; RTI ID = 0.0 &gt; W5C. &Lt; / RTI &gt; The peptide sequence of AhgI also has a complete HTH N-terminal domain that is internal to the extracellular a-NABH / NAOS hydrolase. In contrast, Sd NABH, AgaNash, and AgaWH117 do not have the? 1 helix of HTH at the N-terminus (FIG. 3).

2. AhgI expression and crude assay

The full-length ahgI and truncated ahgI open reading frames (without N-terminal signal peptide sequence) were cloned from W5C genomic DNA and expressed in E. coli BW25113 (DE3) under the T7 promoter. SDS-PAGE analysis of the whole cell fraction revealed that the AhgI protein, in which the cells were cut, was expressed (Fig. 4A). Exclusion of the signal peptide sequence resulted in overexpression of the appropriate cytoplasm of AhgI. Factors such as DNA / RNA secondary structure and RNA stability in the nucleotide region coding for the signal peptide appear to be responsible for stopping AhgI expression. The exclusion of signal peptides was beneficial for the expression of mature proteins. In addition, overexpression of W5C-derived [beta] -agarase in E. coli was observed as described above. Next crude intracellular extracts were prepared and assayed for NA2 activity. It was confirmed that L-AHG and D-gal were produced in NA2, while corresponding points were observed in the TLC plate while culturing at 30 ° C for 15 minutes (FIG. 4B). As the reaction progressed, it was observed that the intensity of the point corresponding to NA2 decreased. Since the GH117 enzyme also has activity against NA4 and NA6, it was tested whether AhgI also shows activity against long-chain NAOS (see Fig. 9). Activity analysis has confirmed that the initial assumption is that α-NABH catalyzes the hydrolysis of short-chain and medium-length NAOS (NA2, NA4 and NA6), in which AhgI releases L-AHG as the major product.

3. Ahg's  Analysis of biochemical characterization

First, the effect of pH on AhgI activity was analyzed using various buffer systems. And the hydrolysis reaction was carried out at pH = 5.0-10.0 at 30 DEG C for 15 minutes. The enzyme showed optimal activity at pH = 7.0 (Fig. 5A). The effect of temperature on enzyme activity was measured by performing hydrolysis at pH = 7.0 at different temperature conditions. The maximum activity was observed at 20 占 폚 and 30 占 폚, and activity was rapidly decreased when the temperature was increased to 40 占 폚 (FIG. 5b). We also observed residual activities of AhgI after pre - culture at different pH and temperature conditions. The enzyme was stable at pH = 7.0-9.0 and was found to possess 84-97% of the original activity. It was also found to lose more than half of its original activity under conditions of weak acidity (pH = 5.0-6.0) or weakly basic (pH = 10.0). When preincubated, AhgI was stable only at 20 ° C and activity was observed to decrease rapidly. Further, it was confirmed that the divalent ion improves the activity of AhgI (Fig. 5C). Ca ²⁺ increased AhgI activity more than 2 times at 10 mM and increased 2.5 times at 100 mM. Other metal ions, such as Na ⁺ , K ⁺ and Mg ^{2 +} , showed no apparent effect on enzyme activity (Figure 5c). For kinetic parameters measurements, AhgI was incubated with different concentrations of NA2 at pH 7.0 and 30 ° C for 10 minutes. K _m and V _max of AhgI were 1.03 mM and 10.22 U mg ^-1 , respectively.

The biochemical characteristics of AhgI and other α-NABH / NAOS hydrolases are shown in Table 2 (Table 2).

α-NABH / NAOS hydrolase
(Organic material) size
(kDa) ^b optimal
pH optimal
Temperature
(° C) K _m
(mM) V _max
(U / mg) assistant
factor temperament Reference
literature Pa NABH
( Pseudomonas atlantica ) 10 7.3 n.a. n.a. n.a. Na ⁺ NA2 D.F. Day et al., Can J Microbiol. 21 (1975) 15121518. Cf NABH
( Cytophaga flevensis ) n.a. 6.8 25 n.a. n.a. n.a. NA2 H.J. van der Meulen et al., Ant Van Leeu. 42 (1976) 8194. Vs NAOSH
( Vibrio sp. JT0107) 42
(84) 7.7 30 5.37 92.00 n.a. NA2 / 4/6 Y. Sugano et al., J Bacteriol. 176 (1994) 68126818. Bs NAOSH
( Bacillus sp. MK03) 42
(320) 6.1 30 n.a. n.a. Mg ^{2 +} NA2 / 4/6 H. Suzuki et al., J Biosci Bioeng. 93 (2002) 456463. Ahgah
( Zobellia
galactanivorans ) 42 n.a. 20 n.a. n.a. n.a. NA4 / 6 E. Rebuffet et al., Environ Microbiol. 13 (2011) 12531270. Sd NABH
( Saccharophagus degradans 2-40) 42 6.5 42 3.50 n.a. - NA2 / 4/6 S.C. Ha et al., Biochem Biophys Res Comm. 412 (2011) 238244. AgaWH117
( Agarivorans gilvus WH0801) 41 6.0 30 6.45 6.98 n.a. NA2 / 4 N. Liu et al., Biotechnol Appl. Biochem. 63 (2016) 230237. AhgI
( Cellulophaga sp. W5C) 48 7.0 20 1.03 10.22 Ca ^{2 +} NA2 / 4/6 Invention

^a na - no data

^{b The} parentheses indicate the multimeric forms of the protein.

The enzymes showed maximum activity at neutral and ambient temperatures close to pH = 7.0, while Sd NABH preferred a slightly elevated temperature (42 ° C). For the co-factor, the α-NABH / NAOS hydrolase generally does not require metal ions. Crystallographic data for Bp GH117 (BpGH117) showed that the protein binds to Mg ^{2 +} , but this was not demonstrated in vitro . On the other hand, Zn ^{2 +} showed various effects on other enzymes. AhgA activity was improved when Zn ^{2 +} was present, whereas Cf NABH enzyme was decreased in activity. On the other hand, Zn ^{2 +} has no effect on Sd NABH. In conclusion AhgI has a distinctive feature in that it prefer Ca ^{2 +} cations as auxiliary factor.

4. Gelidium amansii From D-galactonate production

A pipeline for the production of D- galactonate was established in G. amansii . The agar was obtained from G. amansii through a known hot water extraction method. The sol-gel material obtained contained 1.02% (w / v) of agar. The extract was hydrolyzed to 0.1625 U / mg AgaA7 at pH 7.0, 40 ° C for 3 hours. Two major spots corresponding to NA4 and NA6 were identified by TLC analysis. This is based on a prior study which discloses that AgaA7, an endolytic type agarase, produces the major hydrolysis products NA4 and NA6. Then, to form NA2 from NA4 / NA6, Aga50D (1.725 占^10-3 U / mg) was added to the solution and cultured at 30 占 폚. The reaction was monitored for 48 hours until the main oligosaccharide NA2 appeared. Finally, 0.0153 U / mg of AhgI was added to the reaction mixture to produce fermentable D-gal from NA2 (Fig. 6A). The final hydrolyzate contained 3.74 ± 0.13 mM of D-gal and was used to convert to D-galactonate. The hydrolyzate also contained L-AHG and trace amounts of NA2 and NA3 (Fig. 6A). These compounds are non-reducing compounds.

To convert D-gal to D-galactonate, the strain EWG3 proposed in the prior art (see Korean Patent Publication No. 10-2015-0006581) was used. The strain is a galK and dgoK deletion mutant that inhibits the consumption of D-gal and D- galactonate . The strain also carries a gld gene encoding a galactose dehydrogenase that converts D-gal to D-galactonate in a single step. An initial starter culture of EWG3 was added to the final hydrolyzate along with other essential medium components. After 72 hours of culture, D-galactonate 2.30 ± 0.15 mM was identified in the medium (FIG. 6b). In particular, the strain showed no growth inhibition because hydrolysis products treated with enzymes in the culture medium did not contain any known inhibitory compounds. No other fermentation products such as acetic acid were observed.

The prototype process for producing D- galactonate from G. amansii proceeded as follows. The process is divided into three stages: (1) production of agar from G. amansii , (2) enzymatic hydrolysis of agar to produce D-gal, (3) D-gal to D- galactonate Microbial conversion. The method of hydrothermal extraction of the agar from G. amansii was chosen because it is easy to experiment and does not produce toxic substances. Other extraction techniques, including acid / base or microwave assisted extraction, are shown to increase the speed of the extraction process or to improve the physico-chemical properties of the agar. In the present invention, the hot water extraction method extracts agar up to 0.51 g per gram of G. amansii , which is an amount corresponding to 90-97% of the seaweed agar content.

On the other hand, three hydrolases are required to obtain D-gal from agar. First, AgaA7 is used in the early depolarization of agar to produce NA4 and NA6 molecules. The reason for choosing AgaA7 here is that endolytic β-agarase shows optimal activity of the enzyme at 40 ° C., which is 5 ° C. higher than the sol-gel transition temperature of 1% agar solution. This is an important consideration when using agar for biorefinery. Because agar solidifies at low temperatures, making the polymer chain less susceptible to enzymatic attack. By applying AgaA7, the agar solution remained liquid and promoted continuous substrate-enzyme interactions. The second enzyme, exo-enzyme β-agarase Aga50D, was selected to hydrolyze NA4 and NA6 to NA2. Since the short chain oligosaccharide solution is not solidified, there is no problem in carrying out the reaction with Aga50D at low hydrolysis temperature. The reaction mixture contains NA2, the major polysaccharide. The third enzyme, AhgI, was identified and analyzed as described in the Materials and Methods section above. AhgI catalyzes the hydrolysis of NA2 to produce L-AHG and D-gal. Where D-gal is used as a substrate for D-galactonate production. In addition, AhgI is active against NA4 and NA6 to produce L-AHG and odd short chain NAOS (Figure 9). Simultaneous hydrolysis of agar to all three enzymes can lead to low D-gal yield. Performing the hydrolysis in a continuous manner can inhibit the formation of odd-numbered NAOS during the depolymerization process of the agar.

In the third step, the D-gal produced in the first and second steps was oxidized to D-galactonate using the EWG3 strain. Accumulation of D-galactonate successfully in the culture of EWG3 results in the completion of D-galactonate production from G. amansii . The flow of this process can be improved by enabling microbial catabolism to L-AHG, which will prove useful for the use of large red algae as economically available feedstocks in bio-refineries.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Korea Biotechnology Research Institute KCTC13157BP 20161123

<110> MYONGJI UNIVERSITY INDUSTRY AND ACADEMIA COOPERATION FOUNDATION <120> ALPHA NEOAGAROBIOSE HYDROLASE DERIVED FROM CELLULOPHAGA          OMNIVESCORIA W5C STRAIN AND APPLICATION THEREOF <130> P17-0204 <160> 7 <170> KoPatentin 3.0 <210> 1 <211> 1227 <212> DNA <213> Artificial Sequence <220> <223> AhgI DNA sequences <400> 1 atgattaaaa aaagcatagc attttgtgca atagcttgtt tattgctaat ggctgcctgt 60 aaaaataata ccaaagctac aaatactgcc atagagcaag aaaccaaact agaaattacc 120 ccaaaacaaa ttgatgagtt aggtataaca aacccagact ctttaagtgc tgcaacaaaa 180 agagctttgc aatggccaaa agatttagga aatgaatggt ttatacagtt ctctaacctt 240 aaacctttaa aaggtgattt agcttatgaa gaaggtgttg tacgtagaga ccctagtgca 300 gtaattaaag aaaatggtaa atactacgtt tggtacagca aaagcacagg accttcacaa 360 ggttttggtg gtgatgtaga aaatgaaaaa gtttttcctt gggatagatg tgatatttgg 420 tacgctacat ctgaagacgg tgaaacttgg aaagaagaag gtattgccgt tgcaagaggt 480 gaaaaaggcg cttatgatga cagatctgtt tttacagtag aaataatgaa atatcagaac 540 aaatattact tatgctacca aaccgtaaaa tctccttaca cagtacgcgt taaaaatcag 600 gttggtttag cctggtcaga ttcgccaaac ggaccttgga caaaaagtga agagcctata 660 cttagtcctg cagataatgg tatttggaaa ggagaagaac aagaccgttt tgctgtagag 720 aaaaaaggag attttgatag tcacaaagta catgatcctt gtattttgcc ttacaagggc 780 aaattttact tgtactataa aggcgagcaa atgggcgaaa aaattacatt tggtggtaga 840 caaatacgcc atggtgttgc tattgcagac aatcctttag ggccttacgt aaaatcacct 900 tacaacccaa taagtaatag tggtcatgaa atttgtgttt ggccatacaa tggtggtatt 960 gcgtcattaa ttactacaga tggtccagaa aaaaatacta tccaatgggc tccagatggt 1020 attaattttg aaattaaatc tgttattcct ggtgtaccag ctcatgcaat aggcttaaac 1080 agatctgcag atacagaaaa agaaccaaca gaaatattac gctggggact tacacatata 1140 tacaatagta gcgactacca aagtattatg agttttacat ctgccagaaa aactacacac 1200 agagctaaag gtgtaaaatc taaataa 1227 <210> 2 <211> 408 <212> PRT <213> Artificial Sequence <220> <223> AhgI amino acid sequences <400> 2 Met Ile Lys Lys Ser Ale Phe Cys Ala Ile Ala Cys Leu Leu Leu   1 5 10 15 Met Ala Ala Cys Lys Asn Asn Thr Lys Ala Thr Asn Thr Ala Ile Glu              20 25 30 Gln Glu Thr Lys Leu Glu Ile Thr Pro Lys Gln Ile Asp Glu Leu Gly          35 40 45 Ile Thr Asn Pro Asp Ser Leu Ser Ala Ala Thr Lys Arg Ala Leu Gln      50 55 60 Trp Pro Lys Asp Leu Gly Asn Glu Trp Phe Ile Gln Phe Ser Asn Leu  65 70 75 80 Lys Pro Leu Lys Gly Asp Leu Ala Tyr Glu Glu Gly Val Val Arg Arg                  85 90 95 Asp Pro Ser Ala Val Ile Lys Glu Asn Gly Lys Tyr Tyr Val Trp Tyr             100 105 110 Ser Lys Ser Thr Gly Pro Ser Gln Gly Phe Gly Gly Asp Val Glu Asn         115 120 125 Glu Lys Val Phe Pro Trp Asp Arg Cys Asp Ile Trp Tyr Ala Thr Ser     130 135 140 Glu Asp Gly Glu Thr Trp Lys Glu Glu Gly Ile Ala Val Ala Arg Gly 145 150 155 160 Glu Lys Gly Ala Tyr Asp Asp Arg Ser Val Phe Thr Val Glu Ile Met                 165 170 175 Lys Tyr Gln Asn Lys Tyr Tyr Leu Cys Tyr Gln Thr Val Lys Ser Pro             180 185 190 Tyr Thr Val Arg Lys Asn Gln Val Gly Leu Ala Trp Ser Asp Ser         195 200 205 Pro Asn Gly Pro Trp Thr Lys Ser Glu Glu Pro Ile Leu Ser Pro Ala     210 215 220 Asp Asn Gly Ile Trp Lys Gly Glu Glu Gln Asp Arg Phe Ala Val Glu 225 230 235 240 Lys Lys Gly Asp Phe Asp Ser His Lys Val His Asp Pro Cys Ile Leu                 245 250 255 Pro Tyr Lys Gly Lys Phe Tyr Leu Tyr Tyr Lys Gly Glu Gln Met Gly             260 265 270 Glu Lys Ile Thr Phe Gly Gly Arg Gln Ile Arg His Gly Val Ala Ile         275 280 285 Ala Asp Pro Leu Gly Pro Tyr Val Lys Ser Pro Tyr Asn Pro Ile     290 295 300 Ser Asn Ser Gly His Glu Ile Cys Val Trp Pro Tyr Asn Gly Gly Ile 305 310 315 320 Ala Ser Leu Ile Thr Thr Asp Gly Pro Glu Lys Asn Thr Ile Gln Trp                 325 330 335 Ala Pro Asp Gly Ile Asn Phe Glu Ile Lys Ser Val Ile Pro Gly Val             340 345 350 Pro Ala His Ala Ile Gly Leu Asn Arg Ser Ala Asp Thr Glu Lys Glu         355 360 365 Pro Thr Glu Ile Leu Arg Trp Gly Leu Thr His Ile Tyr Asn Ser Ser     370 375 380 Asp Tyr Gln Ser Ile Met Ser Phe Thr Ser Ala Arg Lys Thr Thr His 385 390 395 400 Arg Ala Lys Gly Val Lys Ser Lys                 405 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplification of intact AhgI <400> 3 ctcggatcca ttaaaaaaag catagcatt 29 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplification of truncated AhgI <400> 4 ctcggatccg cctgtaaaaa taataccaa 29 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplification of AhgI <400> 5 gtagaattct ttagatttta cacctttag 29 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Aga50DF <400> 6 cgtgagctct tattcgattt tgaaaacga 29 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Aga50DR <400> 7 ctttctagat ttgctgccta gcctttcgg 29

Claims (13)

Cellulopa was purchased from Omnibus Korea W5C ( Cellulophaga omnivescoria W5C) strain.
The method according to claim 1,
Wherein the cellulofa is the KCTC 13157BP accession number of Omnibus Korea W5C strain.
The method according to claim 1,
Wherein the alpha neoagarotic biosynthetic enzyme is encoded by a gene consisting of the nucleotide sequence of SEQ ID NO: 1.
A recombinant Escherichia coli into which an expression vector containing a gene coding for an alpha neoagarotic biosynthetic enzyme derived from a cellulophagus Omnibus Korea W5C strain is introduced.
The method of claim 4,
Wherein said gene is composed of the nucleotide sequence of SEQ ID NO: &lt; RTI ID = 0.0 &gt; 1. &lt; / RTI &gt;
A step (step a) of producing an expression vector into which a gene coding for an alpha neoagarobiohydrolase derived from a cellulo phage Omnibus Korea W5C strain is introduced; And
Introducing the expression vector into Escherichia coli and transforming the transformed Escherichia coli (step b).
The method of claim 6,
Wherein the gene is composed of the nucleotide sequence of SEQ ID NO: &lt; RTI ID = 0.0 &gt; 1. &lt; / RTI &gt;
And culturing the recombinant Escherichia coli into which an expression vector containing a gene encoding an alpha neoagarotic biosynthetic enzyme derived from Omnibus Korea W5C strain is introduced. Method of production of enzyme.
The method of claim 8,
Wherein the recombinant Escherichia coli is cultured at 20 ° C to 40 ° C.
Recombinant Escherichia coli, or a lysate thereof, into which an expression vector containing a gene encoding an alpha neoagarotic biosynthetic enzyme derived from Omnivus Korea W5C strain of Cellulofase has been treated with Neoagarobiose to produce D-galactose &Lt; / RTI &gt;
The recombinant Escherichia coli or a lysate thereof into which an expression vector containing a gene encoding an alpha neoagarotic biosynthetic enzyme derived from Omnibus Korea W5C strain of Cellulopa is treated with agarose biosensor to produce D-galactose A method for producing D-galactonose from D-galactose by using recombinant E. coli comprising a gene ( gld ) encoding galactose dehydrogenase.
The method of claim 11,
Wherein the lysate is prepared by culturing the recombinant E. coli, followed by centrifugation and sonication, followed by obtaining a lysate in the supernatant.
The method of claim 11,
Recombinant E. coli is characterized in that the gene coding for galactokinase ( galK ) and 2-oxo-3- deoxygalactonate kinase ( dgoK ) is deleted.

Images