KR20190062149A - Composition for treating metastic cancer - Google Patents

Abstract

The present invention relates to a composition for treating metastatic cancer, which has a strong inhibitory effect on metastasis and invasiveness of metastatic cancer cells by inhibiting expression and action of PLK1. Since PLK1 protein inhibiting the expression and action of PLK1 or comprising specific point mutations of the present invention can treat or prevent cancer by inhibiting the expression and action of PLK1, and particularly has a strong inhibitory effect on metastasis or invasion of cancer cells, it is possible to be widely used for treating metastatic cancer.

Description

Technical Field [0001] The present invention relates to a composition for treating metastatic cancer,

The present invention relates to a composition for treating metastatic cancer, which has a strong inhibitory effect on metastasis and invasiveness of metastatic cancer cells through expression and inhibition of action of PLK1.

Polo-like kinase 1 (PLK1) has recently been studied as a target molecule responsible for the cause and metastasis of cancer, and research on the development of an anticancer drug through the development of an inhibitor against PLK1 has been conducted in a multinational corporation (Yim, Anti-Cancer Drugs 24 (2013) 999-1006, Yim and Erikson, Mutation Research Reviews Mutation Research, 761 (2014) 31-39). PLK1 has an enzymatically active domain with structurally phosphorylated enzyme activity and a poloxane domain that binds to the substrate. Phosphorylation at T210 induces PLK1 activation. The phosphorylated enzyme of PLK1 activated by the pololic domain binding of the substrate is an enzyme that induces phosphorylation at the Ser / Thr residue of the substrate (Barr et al., Nat Rev Mol Cell Biol 5 (2004) 429-440). Functionally, expression is increased in cells that grow and divide, especially at the apex of cell cycle, expression and activity in cell division. (Yim and Erikson, Mutation Research Reviews Mutation Research, 761 (2014) 31-39), the expression of cancer cells in cancer cells has been reported to be high It has been experimentally reported that in many cases, the expression level increases in stages of malignancy. It has been reported that the higher the malignant stage in non-small cell lung cancer, head and neck cancer, laryngeal cancer, breast cancer, liver cancer, endometrial cancer, colon cancer, ovarian cancer, pancreatic cancer and prostate cancer (Yim, Anti-Cancer Drugs 24 (2013) 999-1006, Yim and Erikson, Mutation Research Reviews Mutation Research, 761 (2014) 31-39). Clinical results show that the lower the expression of PLK1 is, the better the prognosis of cancer patients, while the higher the expression of PLK1, the lower the survival rate of cancer patients is reported in various carcinomas such as non-small cell lung cancer and colorectal cancer. PLK1 is clinically used as an indicator to judge.

Research on the development of PLK1 target cancer drug has been started in the mid 2000s, with research results being reported in the academic circles of the early 2000s. Currently, more than 10 candidate PLK1 anticancer drugs are being studied, focusing on volasertib. However, in addition to volasertib, which has been approved by the US FDA as an innovative therapeutic drug, PLK1 is a clinically approved anticancer drug Not known

Cancer is a phenomenon that occurs as a result of progression of cancer, but even if the cancer is actually removed or treated, the survival rate is very low due to recurrence of the cancer if it can not prevent metastasis. The larger the size of the cancer, the higher the rate of metastasis to the surrounding lymph nodes and other tissues. However, the metastasis may be present despite the small size of the cancer, and the relationship between cancer metastasis and proliferation remains to be clarified . In the treatment of cancer, inhibition of proliferation of cancer cells and inhibition of metastasis are not always the same effect. If cancer metastasis can be suppressed, the treatment efficiency of many cancers can be dramatically improved. There is a need for the development of a therapeutic target or therapeutic agent that effectively inhibits metastasis and invasion of cancer.

As a result of efforts to develop an anticancer drug based on gene therapy that inhibits the expression of PLK1, the present inventors have found that PLK1 shRNA which inhibits mRNA expression of PLK1 has an inhibitory effect on PLK1-mediated metastatic cancer cell metastasis, invasiveness and tumor formation Respectively. In addition, it was confirmed that the mutant protein containing the point mutation of PLK1 significantly reduced the metastasis, invasiveness and tumor formation of liver cancer, colorectal cancer and non-small cell lung cancer, and in particular, the PLK1 mutant was found to be involved in the metastatic, The present inventors have completed the present invention by confirming that they can be effectively used for the treatment of metastatic cancer.

In this respect, the present invention relates to an oligonucleotide which inhibits the expression of PLK1 (Polo-like kinase 1) mRNA of SEQ ID NO: 1; An antibody that inhibits the activity of the PLK1 protein or an antigen-binding fragment thereof; A prophylactic or therapeutic agent for cancer comprising at least one selected from the group consisting of a PLK1 mutant protein comprising any one mutation selected from the group consisting of K82M, W414F and V415A mutations in the amino acid sequence of SEQ ID NO: 2, and a nucleotide encoding a PLK1 mutant protein A pharmaceutical composition is provided.

In another aspect, the present invention provides an oligonucleotide that is siRNA or shRNA that inhibits mRNA expression of PLK1 comprising a consecutive 5-50 nucleotide sequence or a sequence complementary thereto in the displayed nucleotide sequence of SEQ ID NO: 1.

In another aspect, the invention provides a recombinant vector expressing said siRNA or shRNA.

In another aspect, the invention provides a polypeptide comprising a) a K82M mutation in the amino acid sequence of SEQ ID NO: 2; Or b) a PLK1 mutant protein comprising the W414F and V415A mutations.

In another aspect, the invention provides a polynucleotide encoding said mutated protein.

In another aspect, the invention provides an oligonucleotide that inhibits expression of PLK1 mRNA of SEQ ID NO: 1; A recombinant vector expressing it; A polynucleotide encoding a PLK1 mutant protein comprising any one mutation selected from the group consisting of K82M, W414F and V415A mutations in the amino acid sequence of SEQ ID NO: 2; Or a recombinant vector comprising the polynucleotide.

In another aspect, the present invention provides a polynucleotide comprising an oligonucleotide that inhibits the expression of PLK1 (Polo-like kinase 1) mRNA of SEQ ID NO: 1; An antibody that inhibits the activity of the PLK1 protein or an antigen-binding fragment thereof; A mutation of a tumor comprising at least one selected from the group consisting of a PLK1 mutant protein comprising any one mutation selected from the group consisting of K82M, W414F and V415A mutations in the amino acid sequence of SEQ ID NO: 2 and a nucleotide encoding a PLK1 mutant protein ≪ / RTI >

As described above, the PLK1 mutant or PLK1 inhibitor of the present invention can be effectively used for the treatment or prevention of cancer through the expression and suppression of PLK1. In particular, the PLK1 mutant protein has a strong inhibitory effect on proliferation, metastasis and invasion of cancer cells, and thus can be effectively used for treatment of metastatic cancer as well as primary cancer chemotherapy.

FIG. 1 shows the results of confirming the inhibitory effect of the PLK1 protein on cancer metastasis by the point mutation in the colorectal cancer HCT116 according to an embodiment of the present invention:
A: Polymerase chain reaction (TACE) in control, control (TGF-beta), PLK1 circular (WT), PLK1 active type (T210D), ATP binding site mutation type (K82M) : W414F and V415A mutations), showing changes in the metastasis of cancer cells over time;
B: A graph showing the transformation of cancer cell metastasis to a percentage according to the relative distance;
C: Relative distance of cancer cells after 72 hours is a graph that shows the relative metastasis of cancer cells in other experimental groups when the control is 0%.
FIG. 2 shows the results of confirming the inhibitory effect of PLK1 protein on the metastatic effect of cancer cells including point mutations in liver cancer cells Hep3B, lung cancer cells H460 and A549 according to an embodiment of the present invention:
A: A graph showing the mobility of cancer cells by PLK1 protein including point mutation in hepatoma cell Hep3B, converted to percentage according to relative distance;
B: A graph showing the relative ratio of cancer cell mobility converted into a percentage when the control (control) is 0% relative to the relative distance of cancer cells after 72 hours in hepatoma cell Hep3B;
C: A graph showing the mobility of cancer cells by PLK1 protein including point mutation in lung cancer cell H460, converted into a percentage according to relative distance;
D: graph showing the relative ratio of cancer cell mobility converted into a percentage when the control group is 0% relative to the relative distance of cancer cells after 72 hours in lung cancer cell H460;
E: graph showing the mobility of cancer cells by PLK1 protein including point mutation in lung cancer cell A549, converted to percentage according to relative distance;
F: A graph showing the relative ratio of cancer cell mobility converted into a percentage when the control group is 0% relative to the relative distance of cancer cells after 72 hours in lung cancer cell A549.
FIG. 3 shows the results of confirming the inhibitory effect of PLK1 inhibitor BI 6727 (volasertib) on lung cancer cell A549 according to an embodiment of the present invention by inhibiting metastasis of cancer cells over time:
A: A cell microphotograph showing the cancer cell mobility induced by the PLK1 active type (TD-PLK1) is decreased with time by BI 6727 (volasertib) treatment,
B: a graph in which cancer cell mobility induced by PLK1 active type (TD-PLK1) was converted to a relative percentage with time by treatment with BI 6727 (volasertib);
C: A graph in which the mobility of cancer cells is converted into a relative percentage when the control group (Mock + Veh) is 0% relative to the relative distance of the cells after 72 hours;
D: a graph in which cancer cell mobility by the PLK1 active type (TD-PLK1) is converted into a percentage when the control group is 0% relative to the relative distance of cells after 72 hours;
E: graph showing conversion of cancer cell mobility by BI6727 to a percentage when the control group is 0% relative to the relative distance of cells after 72 hours;
F: Graph showing conversion of cancer cell mobility by treatment with BI6727 in PLK1-activated (TD-PLK1) -expressing cells to percentage, when PLK1 active type (TD-PLK1) is 0% relative to cell relative distance after 72 hours ;
G: An experiment to observe the inhibitory effect of BI6727 treatment on metastatic cancer formation in mice injected intravenously with A549 lung cancer cells expressing PLK1 active (TD-PLK1) protein;
H: photographs showing the metastatic and tumor suppressive effects of treatment with BI6727 in mice injected intravenously with A549 lung cancer cells expressing the PLK1 active type (TD-PLK1) protein, and the frequency of metastatic cancer generation in each experimental group graph.
FIG. 4 is a graph showing the time-dependent inhibition effect on cancer cell metastasis by treatment with PLK1 shRNA which is a PLK1 mRNA inhibitory substance according to an embodiment of the present invention.
A: A cell microphotograph showing that the cancer cell mobility induced by PLK1 active type (TD-PLK1) is decreased with time by PLK1 shRNA treatment;
B is a graph in which cancer cell mobility induced by PLK1 active type (TD-PLK1) is converted to a relative percentage with time by treatment with PLK1 shRNA;
C: A graph in which the mobility of cancer cells by treatment with PLK1 shRNA was converted to a relative percentage when the control group was 0% relative to the relative distance of cells after 72 hours;
D: a graph in which cancer cell mobility by treatment with PLK1 shRNA was converted into a percentage when the control group was 0% relative to the relative distance of cells after 72 hours;
E: a graph in which cancer cell mobility by treatment with PLK1 shRNA was converted into a percentage when the control group was 0% relative to the relative distance of cells after 72 hours;
F: Cellular mobility due to PLK1 shRNA treatment in PLK1-activated (TD-PLK1) expressing cells was converted to a percentage when the PLK1 active type (TD-PLK1) was 0% relative to the relative distance of cells after 72 hours graph;
FIG. 5 shows the results of confirming the inhibitory effect of PLK1 protein including point mutation on the tumor formation of cancer cells according to an embodiment of the present invention:
A: Cell microphotograph showing the tumor formation pattern of cancer cells by PLK1 protein including point mutation;
B: a graph showing the number of tumor lumps formed by the PLK1 protein including the point mutation;
C: A graph showing the relative proportion of the number of tumor masses formed by the PLK1 protein containing the point mutation, when the control group is 1;
D: a graph showing the relative proportion of the number of tumor masses formed by the PLK1 protein containing the point mutation, when the number of PLK1 circularly expressed cells is 1;
FIG. 6 is a graph showing an inhibitory effect of PLK1 protein including a point mutation on invasiveness of cancer cells according to an embodiment of the present invention:
A: An experiment to observe the inhibitory effect of PLK1 protein including point mutation on the invasion of cancer cells;
B: A graph showing the degree of invasiveness of other experimental groups as a relative value when the absorbance was measured after staining with crystal violet in the invasion test using Matrigel and the degree of invasiveness of the control group was 1;
A graph showing the relative invariance of the invasiveness of the other experimental groups when the invasiveness of the PLK1 circularity was 1 in an invasive experiment using C: B Matrigel.
FIG. 7 is a graph showing the effect of inhibiting metastatic cancer formation in a mouse when an intravenous injection of a PLK1 protein-expressing lung cancer cell comprising a point mutation according to an embodiment of the present invention is performed:
A: An experiment to observe the inhibitory effect of intravenous injection of lung cancer cells expressing PLK1 protein including point mutation in mice in metastatic cancer formation;
B: A graph showing numerical values of metastatic cancer production in each experimental group by observing metastatic cancer formation and inhibitory effect in mice when intravenously injected lung cancer cells expressing PLK1 protein including point mutation;
C: graph showing changes in the epithelial mesenchymal transition protein markers obtained by pulverizing the lung tissue obtained in the case of intravenous injection of lung cancer cells expressing the PLK1 protein containing the point mutation;
D: graph showing the weight change of spleen in mice when intravenously injected cancer cells expressing PLK1 protein containing point mutation.
Figure 8 shows the mRNA sequence of PLK1 of the present invention.
9 shows the amino acid sequence of the PLK1 protein of the present invention.

Hereinafter, the present invention will be described in detail with reference to examples.

The present invention relates to a composition for preventing or treating cancer comprising an inhibitor or a PLK1 mutant protein which inhibits the expression or activity of PLK1 (Polo-like kinase 1) mRNA and / or protein.

The inhibitor is an oligonucleotide which inhibits the expression of PLK1 (Polo-like kinase 1) mRNA; An antibody that inhibits the activity of the PLK1 protein or an antigen-binding fragment thereof; A PLK1 mutant protein comprising any one mutation selected from the group consisting of K82M, W414F and V415A mutations in the amino acid of the PLK1 protein; And nucleotides encoding the same.

In the present invention, "PLK1 (Polo-like kinase 1; Human Plk1 mRNA [NM_005030.5] - SEQ ID NO: 1, Human Plk1 protein [NP_005021.2] polio-box domain and catalytic domain, which are known to be important for protein function (Yim, Anti-Cancer Drugs 24 (2013) 999-1006; Yim and Erikson, Mutation Research Reviews Mutation Research, 761 (2014) 31-39; Barr et al., Nat Rev Mol Cell Biol 5 (2004) 429-440). Regarding the function depending on the structure of the protein, the mutation (T210D) of the phosphorylation form at the T210 position is known to maintain PLK1 in the active state, and the ATP binding site at position 82, Lysine K) is known to be an important site for binding to ATP. It is known that when this site is replaced with Methinone (M) (K82M variant), the enzyme activity is inhibited. In addition, the amino acid residues of the first domain 414 Tryptophan (W) and the second domain 538 Histidine (H) or 540 Lysine (K) in the two poloxane domains found to bind to the substrate are important for binding to the substrate Region. However, in the PLK1 protein, it is known that the poloxane domain that binds to the active site, ATP binding site or substrate for the phosphorylation enzyme functions in the activity of the PLK1 protein itself, and the use of the mutated PLK1 protein itself has been disclosed There is no way.

The inventors of the present invention have found that a mutant protein comprising any one mutation selected from the group consisting of K82M, W414F and V415A mutations in the PLK1 protein inhibits the action of PLK1, thereby improving or treating cancer cell proliferation, metastasis or invasion . In this respect, the present invention may be an inhibitor for inhibiting the expression or activity of mRNA and / or protein of PLK1 (Polo-like kinase 1) or a composition for inhibiting the transfer of tumor (or cancer cells) comprising the PLK1 mutant protein.

In the present invention, " PLK1 inhibitor " is used to collectively refer to any agent that reduces the expression or activity of PLK1 mRNA or PLK1 protein. Specifically, PLK1 inhibitor may be a PLK1 mRNA or a PLK1 inhibitor in a manner that acts directly on PLK1 or indirectly acts on PLK1 May include all agents which interfere with the expression of the gene at the transcriptional level or inhibit its activity, thereby reducing the expression or activity of PLK1. In the present invention, " PLK1 " can be interpreted to refer to both PLK1 mRNA and protein unless otherwise mentioned.

The PLK1 inhibitor is included in the present invention without limitation, including a compound capable of inhibiting the expression or activity of PLK1 mRNA or protein, a nucleic acid, a peptide virus, or a vector containing the nucleic acid. The PLK1 inhibitor includes, but is not limited to, an oligonucleotide that specifically inhibits the expression of PLK1 mRNA; Or an antibody that inhibits the activity of the PLK1 protein or an antigen-binding fragment of said antibody.

In this respect, the oligonucleotide which inhibits the expression of PLK1 mRNA of the present invention is characterized in that the oligonucleotide which inhibits the expression of PLK1 mRNA of the present invention comprises 5 to 50 nucleotides or 10 to 30 nucleotides consecutive in the indicated nucleotide sequence of SEQ ID NO: 1 as a target sequence, Lt; / RTI > nucleotides. As a specific example, nucleotides 1424-1444 in SEQ ID NO: 1 (SEQ ID NO: 3); 286-306 th nucleotide (SEQ ID NO: 4); 785-805 < th > nucleotide (SEQ ID NO: 5); 554-574 < th > nucleotide (SEQ ID NO: 6); 593-613 < th > nucleotide (SEQ ID NO: 7); 1028-1048 nucleotides (SEQ ID NO: 8); Nucleotide 671-691 (SEQ ID NO: 9); 501-521 < th > nucleotide (SEQ ID NO: 10); 431-451 < th > nucleotide (SEQ ID NO: 11); 110-130 < th > nucleotide (SEQ ID NO: 12); Nucleotide 542-562 (SEQ ID NO: 13); 725-745 th nucleotide (SEQ ID NO: 14); 1497-1517 < th > nucleotide (SEQ ID NO: 15); Or the 1649-1669th nucleotide (SEQ ID NO: 16) as the target sequence, but is not limited thereto. When the above sequence is targeted, the expression or activity of PLK1 can be inhibited more effectively. In the present invention, " to be a target sequence " means that the expression of PLK1 is inhibited by complementary binding to the corresponding nucleotide sequence.

Thus, in this aspect, the oligonucleotides that inhibit the expression of PLK1 mRNA of the present invention include the nucleotide sequence of nucleotides 1424-1444 in SEQ ID NO: 1; 286-306 th nucleotide sequence; 785-805 th nucleotide sequence; 554-574 th nucleotide sequence; 593-613 < th > nucleotide sequence; 1028-1048 th nucleotide sequence; 671-691 th nucleotide sequence; 501-521 < th > nucleotide sequence; 431-451 < th > nucleotide sequence; 110-130 < th > nucleotide sequence; The 542-562nd nucleotide sequence; 725-745 th nucleotide sequence; The 1497-1517th nucleotide sequence; And 1649-1669 < th > nucleotide sequence, or a sequence complementary to any one of these nucleotide sequences.

In another aspect, the present invention may be a recombinant vector expressing an oligonucleotide that inhibits the expression of PLK1 mRNA of SEQ ID NO: 1. In this aspect, the pharmaceutical composition of the present invention may contain an oligonucleotide that inhibits the expression of PLK1 mRNA in the form of a recombinant vector expressing the nucleotide. Therefore, the present invention provides an oligonucleotide that inhibits the expression of PLK1 mRNA A pharmaceutical composition for preventing or treating cancer comprising a recombinant vector expressing the nucleotide; Or a composition for inhibiting tumor metastasis; Or a composition for gene therapy.

In the present invention, " composition for gene therapy " is a composition comprising as an active ingredient for the treatment of a genetic disease, and has an effect of alleviating or treating a symptom by injecting a gene having an effect of converting a wrong gene into a normal gene or treating it . In the present invention, an oligonucleotide may be contained as a genetic substance that inhibits the expression or activity of PLK1, or a polynucleotide encoding the PLK1 mutation protein may be contained as an active ingredient. The composition for gene therapy may be a composition for gene therapy of cancer in that it can inhibit the proliferation, metastasis or invasion of cancer by inhibiting the expression of PLK1 or expressing a PLK1 mutation protein including specific mutations.

In the present invention, " vector " means capable of introducing a target protein or a target RNA in a suitable host cell, and includes an expression vector capable of introducing and expressing an essential control element operably linked to the gene expression ≪ / RTI > The vector may be, for example, a viral vector. More preferably, a Lenti Viral Vector, an Adono Viral Vector or an Adeno-associated Viral Vector (AAV), which is stable in gene expression and can effectively deliver genes to cells, Lt; / RTI > Preferably a lentiviral vector or an adeno-associated viral vector. When lentivirus is used as a vector, it has an advantage of high gene transfer efficiency and little side reaction of immune reaction. These vectors may be those routinely used in the technical field of the present invention. Such a vector is capable of expressing an oligonucleotide of the present invention and, when administered into an individual, can provide an excellent anticancer effect by providing an oligonucleotide over a long period of time.

The oligonucleotide which inhibits the expression of PLK1 mRNA may be selected from the group consisting of antisense oligonucleotides specific to PLK1 mRNA, aptamer, siRNA, shRNA and miRNA.

In the present invention, " antisense oligonucleotide " refers to DNA, RNA or derivatives thereof containing a nucleic acid sequence complementary to the sequence of a characteristic mRNA, which binds to a complementary sequence in mRNA and inhibits translation of mRNA into a protein can do. The antisense oligonucleotide sequence refers to a DAN or RNA sequence that is complementary to the PLK1 sequence of SEQ ID NO: 1 and is capable of binding to the sequence. Examples include, but are not limited to, sequences comprising or consisting of sequences complementary to any one of the sequences selected from the group consisting of SEQ ID NOS: 3 to 16. The length of the antisense oligonucleotides may be from 5 to 100 bases, or from 8 to 60 bases, or from 10 to 40 bases, or from 10 to 30 bases. The antisense oligonucleotides can be synthesized in vitro in a conventional manner and administered in vivo, or in vivo in the form of synthesis of antisense oligonucleotides. Methods for synthesizing antisense oligonucleotides in vitro may be synthesized by biological / chemical methods according to methods conventional in the art. In addition, a form in which an antisense oligonucleotide is synthesized in vivo can be realized by using a recombinant vector or the like that expresses the antisense oligonucleotide, and such a commercial method can be easily carried out according to a conventional method in the technical field of the present invention have. Thus, the design of the antisense oligonucleotides of the present invention can be readily produced by methods known in the art, with reference to the nucleotide sequence of SEQ ID NO: 1. For example, the antisense oligonucleotide may comprise a base sequence complementary to a base sequence selected from the group consisting of the sequences of SEQ ID NOS: 3 to 16.

In the present invention, " aptamer " means a single-stranded oligonucleotide, a nucleic acid molecule having a size of about 20 to 60 nucleotides and having a binding activity to a predetermined target. Depending on the sequence, it has various three-dimensional structures and can have a high affinity with a specific substance such as an antigen-antibody reaction. An aptamer can inhibit the activity of a given target by binding to a given target. The aptamers of the present invention may be RNA, DNA, modified nucleic acids, or mixtures thereof, and may also be in linear or cyclic form. Preferably, the aptamer is capable of binding PLK1 mRNA and inhibiting the expression or activity of PLK1. Such an aptamer can be prepared from a sequence of PLK1 of SEQ ID NO: 1 by a method known to a person skilled in the art.

The term " siRNA " and " shRNA " in the present invention are nucleic acid molecules capable of mediating RNA interference or gene silencing, and can inhibit the expression of a target gene. Therefore, an efficient gene knockdown method or gene It is used as a treatment method. shRNA is a hairpin structure formed by binding between complementary sequences in a single strand oligonucleotide. In vivo, the shRNA is cleaved by a dicer and a small RNA fragment of 8 to 30 nucleotides in size SiRNA, which is a double strand oligonucleotide, can be specifically bound to mRNA having a complementary sequence to inhibit its expression. Thus, the use of either shRNA or siRNA can be determined by the choice of those skilled in the art, and similar expression reduction effects can be expected if the mRNA sequences to which they are targeted are identical. For the purpose of the present invention, PLK1 can be inhibited by specifically acting on PLK1 to induce RNA interference (RNAi, RNA interference) by cleaving PLK1 mRNA molecules. siRNA can be chemically or enzymatically synthesized. The method for producing siRNA is not particularly limited, and methods known in the art can be used. For example, a method of directly synthesizing siRNA, a method of synthesizing siRNA using in vitro transcription, a method of cutting long double-stranded RNA synthesized by in vitro transcription using an enzyme, expression through an intracellular delivery of an shRNA expression plasmid or a viral vector, and expression through an intracellular delivery of a polymerase chain reaction (siRNA) expression cassette.

In particular, the siRNA and shRNA for PLK1 of the present invention may contain an antisense nucleotide of a sense nucleotide and a complementary sequence thereof, and may include a loop sequence between the sense and antisense nucleotides. As a specific example, the siRNA for PLK1 of the present invention may comprise any one of the oligonucleotide sequences selected from the group consisting of the sequences of SEQ ID NOS: 3 to 16; And / or a double strand of an oligonucleotide having a sequence complementary to the oligonucleotide sequence, but the present invention is not limited thereto. In addition, the shRNA for PLK1 of the present invention may be a target sequence of any one selected from the group consisting of the sequences of SEQ ID NOS: 3 to 16, or may be selected from the group consisting of the sequences of SEQ ID NOS: 3 to 16 Any one oligonucleotide sequence; And / or a sequence complementary to the oligonucleotide sequence.

In addition, when the loop sequence used in the shRNA of the present invention clarifies the target sequence for the expression or inhibition of the activity of PLK1, the loop sequence can use a sequence commonly used in the technical field of the present invention, Is not limited thereto. For example, the loop sequence of SEQ ID NO: 45 may be included, but is not limited thereto.

The PLK1 inhibitor of the present invention can be used in a conventional manner. For example, the shRNA may be prepared using the primer pairs selected from SEQ ID NO: 17 to SEQ ID NO: 44 according to the target target.

In the present invention, " miRNA (microRNA) " is a substance naturally present in a cell, and refers to a substance involved in the regulation of a specific gene by inducing an RNAi phenomenon. The miRNA which can inhibit the expression or action of PLK1 of the present invention is not limited to the type but is included in the present invention.

As used herein, the term " antibody " is a protein molecule that comprises an immunoglobulin molecule immunologically reactive with a specific antigen. The protein molecule serves as an antigen receptor that specifically recognizes and reacts when specific antigens intrude into the body Protein molecule. An antibody molecule is composed of two heavy chains and two light chains, each of which has a variable region and a light region. The variable region includes three complementarity determining regions (CDRs) and four framework regions (FRs), and binding sites between the antibody and the antigen are formed by the complementary crystal regions, The binding specificity of the antibody to the antigen can be generated.

The antibody that can be used in the present invention is not particularly limited as long as it is an antibody that inhibits the activity of the PLK1 protein. For example, the antibody may include a polyclonal antibody, a monoclonal antibody, or an antibody fragment. Also included are all genetically engineered antibodies, such as chimeric antibodies or heterologous binding antibodies.

The prevention or treatment of cancer of the present invention may be accomplished by cancer cell-specific apoptosis. The cell death is a form of death of a cell, which is distinguished from necrosis, in which cells are physically destroyed. It is also referred to as programmed cell death, and refers to a process in which a cell in which DNA is damaged or becomes unnecessary kills itself .

In a specific embodiment of the present invention, it was confirmed that the cancer cell proliferation or metastasis inhibiting effect by PLK1 shRNA suppresses the proliferation, metastasis or invasion of cancer cells by inhibiting the expression or action of PLK1. As a result, It has an effect of inhibiting metastasis and invasion in metastatic cancer as well as cancer cell death.

Further, the present invention relates to a PLK1 mutant protein.

The PLK1 mutant protein may include any mutation selected from the group consisting of K82M, W414F and V415A mutations in the amino acid sequence of SEQ ID NO: 2. Alternatively, the PLK1 mutant protein comprises a) a K82M mutation in the amino acid sequence of SEQ ID NO: 2; And / or b) W414F and V415A variants. It was confirmed in one embodiment that the PLK1 mutant protein has excellent activity in suppressing excellent anticancer activity, particularly metastasis and invasiveness of cancer cells, in the pharmaceutical composition of the present invention. In this respect, the present invention relates to a composition for treating or preventing cancer comprising a PLK1 mutated protein. In particular, the present invention may be a composition for treating or preventing metastatic cancer comprising a PLK1 mutant protein.

Preferably, the mutant protein as an active ingredient of the anticancer composition comprises a) a mutant protein comprising a K82M mutation; And / or b) a mutated protein comprising W414F and V415A variants. The mutated protein has an excellent effect on the treatment of metastatic cancer in that it inhibits or treats the proliferation, metastasis or invasion of PLK1-based cancer by inhibiting the activity or action of PLK1.

The PLK1 mutant protein of the present invention can be contained as an active ingredient of a pharmaceutical composition in the form of a recombinant vector into which a gene (polynucleotide) encoding the same or a gene (polynucleotide) encoding the same is inserted. a) K82M mutation; b) a polynucleotide encoding a mutant protein comprising the W414F and V415A mutations, or a pharmaceutical composition for the prevention or treatment of cancer comprising a recombinant vector comprising said polynucleotide. Further, in this aspect, the present invention provides a recombinant vector which expresses an oligonucleotide which inhibits the expression of PLK1 mRNA; A polynucleotide encoding a PLK1 mutant protein comprising any one mutation selected from the group consisting of the mutations K82M, W414F and V415A in the amino acid sequence of SEQ ID NO: 2 in SEQ ID NO: 2; Or a recombinant vector comprising the polynucleotide.

In the present invention, " cancer " refers to a disease associated with the regulation of death of a cell, which refers to a disease caused by excessive cell proliferation when a normal cell death balance is broken. These abnormal hyperproliferative cells sometimes invade surrounding tissues and organs to form a mass, which destroys or transforms normal structures in the body. Such a condition is called cancer. In general, a tumor refers to a mass abnormally grown by autonomous overgrowth of the body tissue, and can be divided into a benign tumor and a malignant tumor. Malignant tumors can be classified into metastatic (invasive) cancers that have a higher rate of growth than benign tumors and metastasis to primary cancer and surrounding tissues. These malignant tumors are commonly referred to as 'cancer'.

The composition of the present invention not only inhibits the proliferation of cancer but also has the effect of inhibiting the metastasis of cancer cells even when developed into a metastatic cancer which is metastasized to other tissues, the present invention provides a pharmaceutical composition for preventing or treating metastatic cancer Composition. In addition, the active ingredient of the present invention inhibits the proliferation, metastasis or invasion of cancer by inhibiting the expression or action of PLK1, and therefore, a cancer showing overexpression of PLK1, a solid cancer showing overexpression of PLK1, or a composition for treating metastatic solid cancer showing overexpression of PLK1 Lt; / RTI >

The cancer may be a solid cancer. Specific examples of the cancer include brain tumor, head and neck cancer, lung cancer, breast cancer, thymoma, mesothelioma, esophageal cancer, cervical cancer, colon cancer, liver cancer, gastric cancer, pancreatic cancer, Cancer, testicular cancer, germ cell tumor, ovarian cancer, cervical cancer, endometrial cancer, colon cancer, lymphoma, multiple myeloma, sarcoma, malignant melanoma and skin cancer, but the types of cancer of the present invention are limited by the above examples no.

In the present invention, the term " individual " refers to all animals including humans, who have or have developed cancer. By administering the pharmaceutical composition or composition for an anti-cancer adjuvant of the present invention to a subject, have. This relaxation refers to any action that improves or alleviates the cancer disease by the administration of the composition according to the present invention.

Specifically, the subject may be an individual having a cancer disease that exhibits PLK1 over-expressing characteristics.

As used herein, the term " treatment " refers to the clinical intervention to alter the natural course of an individual or cell to be treated, and may be performed during or during the course of a clinical pathology. The desired therapeutic effect is to prevent the occurrence or recurrence of the disease, to alleviate the symptoms, to reduce all direct or indirect pathological consequences of the disease, to prevent metastasis, to reduce the rate of disease progression, Or temporary relief, and improving the prognosis. Preferably, the present invention includes all actions that improve the course of cancer by administration of a substance that inhibits PLK1 or a composition that includes a PLK1 mutant protein.

In addition, " prevention " refers to any action that inhibits or delays the onset of cancer by administering a composition comprising an inhibitor of PLK1 or a mutated PLK1 protein according to the present invention.

An effective amount of the active ingredient of the pharmaceutical composition of the present invention means an amount required for the treatment of the disease. Accordingly, the present invention is not limited to the particular type of the disease, the severity of the disease, the kind and amount of the active ingredient and other ingredients contained in the composition, the type of formulation and the patient's age, body weight, general health status, sex and diet, Rate of administration, duration of treatment, concurrent medication, and the like.

The dosage is preferably selected depending on the degree of absorption, inactivation rate and excretion rate of the active ingredient in the body, the age, sex and condition of the patient, and the severity of the disease to be treated. Anticancer drugs showing the cancer cell death promoting effect of the present invention The composition for oral administration may be administered once to several times per day in an administration amount of 0.01 to 100 mg, preferably 0.1 to 10 mg per 1 kg body weight of an adult.

In addition, the anticancer agent which promotes the cancer cell death of the present invention can be administered parenterally, and when administered parenterally, it is preferably administered by intravenous injection, intramuscular injection, or intramuscular injection. In order to formulate the composition for parenteral administration, the cell death-attenuating anticancer agent may be mixed with water or a stabilizer or a buffer to prepare a solution or suspension, which may be formulated into unit dosage forms of ampoules or vials.

The pharmaceutical compositions of the present invention may further comprise suitable carriers, excipients or diluents conventionally used in the manufacture of pharmaceutical compositions. As used herein, " pharmaceutically acceptable carrier " means a known pharmaceutical excipient which is useful when formulating pharmaceutically active compounds for administration and which is substantially non-toxic and non-sensitive under the conditions of use. The exact ratio of such excipients is determined by standard pharmaceutical practice, as well as the solubility and chemical properties of the active ingredient, the route of administration chosen.

Compositions comprising a pharmaceutically acceptable carrier can be of various oral or parenteral formulations. In the case of formulation, it can be prepared using diluents or excipients such as fillers, extenders, binders, humectants, disintegrants, surfactants and the like which are usually used. Solid formulations for oral administration may include tablet pills, powders, granules, capsules and the like, which may contain one or more excipients, such as starch, calcium carbonate, sucrose or lactose, lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate, talc, and the like may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, syrups and the like. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the non-aqueous solvent and the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. Examples of the suppository base include witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like.

In addition, the composition of the present invention is not limited to the pharmaceutical composition of the present invention, but may be in the form of tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterilized aqueous solutions, , A freeze-dried preparation, and a suppository. In addition, it can be suitably formulated according to each disease or component using a suitable method in the art or a method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

[ Example  One] Of Plk1  Active type and point Mutant type  For expression Lentivirus  System construction

The present inventors constructed a lentivirus system for expression of active and inactive genes of Plk1. Specifically, the PLK1 circular (WT) or PLK1 mutants (K82M-PLK1, T210D-PLK1 (active mutant), or FA-PLK1 (W414F / V415A) were obtained after cleavage of the pLVX-TRE3G-eRFP vector with Mlu1 and Apa1, ) Were amplified by PCR using 5'-ACGGGGCCCATGAGTGCTGCAGTGA-3 '(forward primer) and 5'-ACGACGCGTTTAGGAGGCCTTGAGA-3' (reverse primer) and then digested with Mlu1 and Apa1 (NEB, MA, USA) , And subcloned into vector pLVX-TRE3G-eRFP. The constructed lentiviral plasmid was transfected into HEK293 cells using the CaCl ₂ method to express the plasmid in HEK293 cells (ATCC, USA). After the transfection, the viral culture was collected at intervals of 12 hours for 72 hours, and the culture was filtered with a 0.2 mm filter and centrifuged at 17000 rpm and 4 ° C for 90 minutes. The supernatant was discarded and the virus collected in TNE buffer was stored at 4 ° C and used for cancer cell treatment from the next day.

[ Example  2] Lentivirus  Used Of Plk1  Active type and Inactive type  Gene expression cell selection

(ATCC, USA), lung cancer cells A549 (ATCC, USA) and H460 (ATCC, USA) and colorectal cancer cells HCT-116 (ATCC, USA) were treated with lentivirus expressing Plk1 active or inactive mutant To infect, cancer cells were cultured as follows.

Lung cancer cells, A549 is put 1X10 ⁵ cells (1X10 ⁵ cells / well) per well were cultured using MEM medium (Corning Cellgro, VA, USA) , lung cancer cells, H460 and colorectal cancer cells, HCT-116 is RPMI 1640 was spread in a culture medium as per well 1X10 ⁵ cells (1X10 ⁵ cells / well) culture, cancer cells of Hep3B was RPMI 1640 culture medium (Corning Cellgro, VA, USA) 5X10 4 cells (5X10 ⁴ cells / well) per well in ≪ / RTI > Each cell was placed and cultured. The next day, each PLK1 active or point mutant was added to Infection Buffer (10 mM HEPES (Sigma-Aldrich, USA), 1 mg / ml polybrene (Sigma-Aldrich, MO, USA) The expressed lentivirus was added at 20 ml / well to infect cancer cells. After 24 hours, puromycine (Sigma-Aldrich, MO, USA) was treated for 48 hours to select live, infected cells without dying.

[ Example  3] containing point mutations PLK1  Metastatic activity measurement of cancer cells by protein

The present inventors conducted a migration assay of cancer cells using cancer cells expressing an active or point mutation type gene of PLK1 to observe cell mobility.

Specifically, liver cancer cells Hep3B, lung cancer cells A549 and H460 expressing the active or point mutation type gene of PLK1 prepared in Example 2, and colorectal cancer cells HCT-116 were dispensed into 6 well plates, and after 24 hours, The plate was scratched at regular intervals using a 200 [mu] l tip. In the mobility test, 5 ng / ml of TGF-β (Sigma-Aldrich, MO, USA) was used as a positive control and lentivirus treatment group in which no specific gene was expressed was used as a control. After the scratches, the interval and mobility of the cells were observed with a microscope at intervals of 24 hours, and the degree of restoration of the interval was measured by the distance between the cells through a microscope.

When the measured value was 100% of the distance of the control group, the relative movement distance was calculated, and the graph was displayed in% (see FIG. 1B).

Relative distance (%) = measured value in the experimental group x 100 / measured value in the control group

As shown in Figs. 1 and 2, it was observed that the mobility of cancer cells was increased in the experimental group (TD-PLK1) in which an active PLK1 mutant protein containing the T210D mutation was expressed over time. Conversely, mobility was decreased in cells expressing the K82M mutant PLK1 protein in which the lysine (K) at position 82 of the catalytic domain was replaced with methionine (M). It was also observed that the mobility of cancer cells was decreased when the polk-box domain mutant (FA; W414F and V415A) PLK1 protein was expressed. After 72 hours, mobility was compared with that of the control group, and it was observed that the mobility of the active Plk1-TD was increased more than the 5 ng / ml TGF-beta treatment of the positive control group. In the case of the ATP-binding domain mutation (K82M mutant) and the polo-box domain mutant (FA mutant; W414F and V415A), the control It was confirmed that the mobility of the cancer cells was drastically reduced. As a result, the PLK1 mutant protein of the present invention has an effect of inhibiting the mobility of cancer cells.

[Example 4] Evaluation of inhibition of metastasis by BI 6727 (volasertib)

In order to confirm the effect of inhibiting metastasis by BI 6727, a mobility test was conducted using a lentiviral system expressing PLK1 active type protein. Experiments were carried out by dividing into cell lines (TD-PLK1) infected with lentivirus expressing the active PLK1 protein and Mock (lentivirus-treated group not expressing the target gene) The TD-PLK1 experimental group was further divided into the experimental group (BI6727) treated with BI6727 and the vehicle treated with 0.01% DMSO instead of BI6727 (vehicle).

A549 lung cancer cells were plated in a 1 × 10 ⁵ cells / well plate and cultured using MEM medium. Then 20 μl / well of lentivirus expressing TD-PLK1 was infected with Infection Buffer (10 mM HEPES, 1 ug / ml Polybrene) wells were infected with A549 lung cancer cells. After 24 hours, puromycin was treated for 48 hours to select live, infected cells without dying. Selected cells were plated in a 6-well plate at a concentration of 1 x 10 < ⁵ > cells. After 24 hours, the cells were scratched at regular intervals using a pipette tip, and the medium was changed. After treatment with 10 nM of BI 6727, the cell mobility was observed at 24 hours, 48 hours, and 72 hours intervals, and the distance between cells was measured and analyzed by microscope.

When the distance from the untreated control group (Mock + Veh) was taken as 100%, the relative movement distance was calculated and the graph was displayed in% (FIG. 3B).

Relative movement distance (%) = measured value in the experimental group x 100 / measured value in the control group

In addition, in order to confirm whether the effect of inhibiting the metastasis of cancer cells is also observed in animal models, a metastatic inhibitory effect experiment was carried out using an animal model of metastatic cancer using BALB / c nude mice. A549 lung cancer cells expressing the active form of TD-PLK1 were injected into the tail vein at 4 weeks old Nude Balb / c mice at 2 × 10 ⁶ cells, and then tumor cells were induced in the lungs by the cancer cells that migrated along the blood vessel system . In order to observe whether the mobility and carcinogenicity of these tumors were reduced by treatment with BI 6727, BI 6727 drug was administered at 20 mg / kg or 2 weeks after the injection of cells, or 0.01% DMSO (vehicle) After 10 weeks of gestation, the mice were lavaged and examined for the metastasis of cancer cells.

As shown in FIG. 3, BI6727 decreased the metastasis of the lung cancer cell itself according to the treatment time. In particular, when the mobility of the untreated control (Mock + Veh) was set to 0% at 72 hours, about 400% (Mock + BI6727) (see C in Figure 3). At 72 hours, the PLK1 activating type (TD-PLK1) increased the mobility of about 100% compared to the control. The metastasis of these lung cancer cells was reduced to about -350% as compared with the control group by treatment with BI 6727, Showed a -450% reduction effect (see FIG. 3C).

In addition, the expression of PLK1-activated (TD-PLK1) in the metastasis model using the tail vein administration of nude mice was observed to be due to tumor formation and vascular migration, and this effect was observed in the BI 6727- BI 6727), it was confirmed that cancer cells could be transferred by inhibition of PLK1. Therefore, BI6727 was found to have a strong inhibitory effect on not only the metastasis of the cancer cell itself but also the metastasis by the expression of the PLK1 active form.

[Example 5] Evaluation of metastatic inhibitory effect of PLK1 shRNA

In order to confirm the effect of inhibiting mRNA expression of PLK1, shRNA and a lentivirus containing the same were prepared.

In order to inhibit mRNA expression of PLK1 (Yim and Erikson, Mol Cell Biol 29 (2009) 2609-2621) In order to construct a shRNA targeting a nucleotide sequence at positions 1424-1444 in human PLK1 mRNA (Human Plk1 mRNA [NM_005030.5]) sequence, 5'-AGATCACCCTCCTTAAATATT-3 'was used as an antisense region, and 5'-AATATTTAAGGAGGGTGATCT-3' site was used as an antisense region, thereby constructing pLKO-puro.1-PLK1 plasmid using pLKO-puro.1 vector. As a forward primer, 5'-CCGGAGATCACCCTCCTTAAATATTCTCGAGAATATTTAAGGAGGGTGATCTTTTTTGG -3 'was used and 5'-AATTCAAAAAAGATCACCCTCCTTAAATATTCTCGAGAATATTTAAGGAGGGTGATCT-3' was used as a reverse primer. The loop sequence was 5'-CTCGAG-3 'and shRNA was prepared in the form contained in the primer. The cells were transfected with HEK293 cells transfected with pHR'-CMV-VSVG, pHR'-CMV-deltaR8.2, and then cultured in a cell culture medium to produce lentivirus. The lentivirus was concentrated using a centrifuge. The effect of PLK1 shRNA on the metastasis of lung cancer cells was investigated after infection with A549 cells.

The shCtrl control group and the shPLK1 test group (shRNA expression for PLK1) were divided into shCtrl control group and shRNA control group, respectively. In the control group and the test group, cells treated with no treatment (Mock; Cells expressing PLK1 (TD-PLK1) were used to confirm the mobility of cancer cells.

Lung cancer cell A549 expressing the control (Mock) or active PLK1 (TD-PLK1) protein was divided into 1 × 10 ⁵ cells / well and cultured in MEM medium. Twenty milliliters of viral PLK1 shRNA expressed using pLKO-puro1.-PLK1, which was prepared for the suppression of PLK1 mRNA expression, was mixed with Infection Buffer (10 mM HEPES, 1 μg / ml Polybrene) mock of the shPLK1 experimental group) or TD-PLK1 expressing cells (TD-PLK1 of shPLK1). After 24 hours, the strips were scratched at regular intervals using a pipette tip, and the medium was changed. After this, the mobility of cancer cells was observed at intervals of 24 hours, 48 hours, and 72 hours, and the distance of healing was measured and analyzed after taking a picture with a microscope.

As shown in Fig. 4, in the case of cells expressing the active PLK1 (TD-PLK1), the metastasis was increased about 100% compared to the control group at 72 hours. On the other hand, when the PLK1 shRNA was expressed in the untreated lung cancer cells (Mock + shPLK1 treatment), the relative metastasis of the cells was decreased to about -200% or less at 72 hours (FIG. In addition, when PLK1 shRNA was expressed in cells expressing active PLK1 (TD-PLK1) at the same time (TD-PLK1 + shPLK1 treatment), the metastasis was about -200% or less relative to TD-PLK1 + shCtrl treatment (Fig. 4F). Therefore, PLK1 shRNA has a metastatic inhibitory effect that inhibits not only the metastasis due to the PLK1 active type but also the metastasis of the cancer cell itself, and thus has a superior anticancer effect.

[ Example  6] containing point mutations PLK1  Of cancer cells by protein Tumor formation  Evaluation of inhibitory effect

To investigate the invasiveness and tumorigenic effect of cancer cells, FA mutant proteins (WT-PLK1), PLK1 active (TD-PLK1), K82M mutant (KM-PLK1), W414F and V415A mutants (Soft agar assay) was carried out in a lung cancer cell A549 expressing L-PLK1-PLK1 using a soft agar.

Specifically, to make a 0.6% agar layer at the bottom, 300 ml of 4% stock agar, 200 ml of FBS and 1500 ml of free MEM were added to a total of 2 ml of agar medium and the mixture was put in a 60 mm diameter plate and hardened for 1 hour . To make a 0.35% agar layer on the top, 175 ml of 4% stock agar and 1625 ml of MEM medium containing 2 × 10 ⁵ cells of A549 cells were mixed with 200 μl of 10% FBS for 1 hour. The medium was changed at 5-day intervals and after 6 weeks, a colony of tumor mass was observed under a microscope. After staining with 0.05% crystal violet-methanol solution for 15 minutes, it was washed with 20% methanol-PBS solution and the total number of colonies was measured with a microscope Respectively.

As shown in FIG. 5, the positive control group, 5 ng / ml TGF-β treated group, showed an 8-fold increase in colony formation compared to the control group. TD-PLK1- And the number of colonies increased 5 times as compared to that of FA variant. Therefore, it has been shown that Plk1-activated (TD-PLK1) is an important factor promoting invasion and colony formation of cancer cells while FA mutant (FA-PLK1) is a mutant PLK1 protein .

[ Example  7] containing point mutations PLK1  Of cancer cells by protein Invasiveness  Evaluation of inhibitory effect

To investigate the effect of these point mutants on the invasiveness and mobility of cancer cells in lung cancer cell A549 expressing the PLK1 circular, active, K82M mutant and FA mutant proteins, Matrigel assay (Matrigel assay, invasion assays.

Specifically, Matrigel was completely dissolved at 4 캜 for 16 to 20 hours, and then Matrigel was diluted with cold serum free MEM (4 캜) to 1 mg / ml. 1 ml of a Matrigel mixture (1 mg / ml) was added to an 8.0 mm 24 well insert and allowed to solidify in a 37 ° C incubator for 12-20 hours. Lung cancer cell A549 expressing the respective PLK1 circular (WT), active PLK1 (TD), K82M mutant (KM), W414F and V415A mutant (FA) proteins was immobilized on a solid Matrigel insert at 2X10 ⁵ cells / well and diluted in serum-free MEM (36 ° C) and dispensed into inserts. Warm MEM (containing 10% FBS) at 36 占 폚 was dispensed at a rate of 0.5 ml / well. For the positive control group, 0.5 ml of MEM (10% FBS) containing 5 ng / ml TGF-β was used. The medium was exchanged once every 3 days and the degree of invasion was observed. After 5 days of observation that the invasion of cancer cells was sufficiently occurred, the medium was removed, and the cells were washed with 1XPBS. Then, the cells inside the insert were scraped with a cotton swab And washed with 1XPBS to remove cells and Matrigel residues in the insert. 500 μl of 4% paraformaldehyde was dispensed into 24 wells with the outer surface of the insert, incubated for 5 minutes at room temperature, washed three times with 1 × PBS for 5 minutes, and then incubated for 5 minutes with 0.5% Lt; / RTI > After 5 minutes, it was washed 5 times with 1XPBS, and the wavelength was measured at 590nm. When the absorbance of the control group is 1, the relative absorbance of each experimental group is calculated and the graph is displayed.

As shown in FIG. 6, in the experimental group expressing the active type TD-PLK1 similar to the TGF-beta treated group as the positive control group, the absorbance value was increased 8 times as compared with the control group and the KM-PLK1 mutation type, FA-PLK1 mutation type The relative absorbance of the KM-PLK1 mutant and the FA-PLK1 mutant were lower than those of the TD-PLK1 experimental group or the control group, indicating that the mutant KM-PLK1 and FA-PLK1 mutants were superior in inhibiting the mobility and invasiveness of lung cancer cells.

[ Example  8] animal models that include point mutations PLK1  Evaluation of inhibition of metastasis of cancer cells by protein

To evaluate the effect of PLK1 protein including point mutation on cancer cell metastasis inhibition in BALB / c nude mouse transgenic animal models.

Specifically, A549 lung cancer cells (2X10 < ⁶ > cells) in which PLK1 protein containing a point mutation was stably expressed Cells) were injected into the tail vein of the mice by placing them in PBS, and they were kept for 10 weeks, and then examined for cancer cell metastasis (FA treatment group). For comparison, the A549 lung cancer cell line (WT) expressing the PLK1 protein without mutation, the A549 lung cancer cell line (TD) expressing the active PLK1 protein, and the control group (Mock , And the presence or absence of cancer cell metastasis was observed under the same conditions as above. Experiments were performed on 5 mice in each experimental group and the frequency of generation of nodules as metastatic cancer in lungs was measured and plotted (FIG. 7).

As shown in FIG. 7, most of the tumors were generated in the lungs, and thus the present experiment was also analyzed based on the lungs. In all of the FA mice treated with A549 cells expressing the PLK1 protein containing the control (Mock) and point mutations, no metastasis was observed in all five mice. In the WT group, tumors were formed in two out of five, and in the experimental group (TD) in which A549 cells expressing active PLK1 were expressed, 5 to 9 tumors were formed in all five. In addition, the size of the spleen involved in tumor immunity was increased in A549-injected mice in which active PLK1 was expressed (Fig. 7D). In addition, the protein level of the mesenchymal marker N-cadherin increased and the level of E-cadherin decreased in the TD-treated group by dissolving a portion of the lung and observing the protein level of the epithelial mesenchymal transition marker. On the other hand, in the FA group, the generation of metastatic cancer was blocked to the control level lower than the metastatic frequency of the WT test group, both in the lung and spleen. Therefore, in the TD group with active PLK1 expression consistent with the cell line experiment, the most strongly expressed metastasis suggests that phosphorylation of PLK1 T210 promotes epithelial mesodermal migration and metastasis. On the other hand, the FA test group, which is a polo box domain point mutation of the present invention, has a lower metastasis than the circular PLK1 test group, and the PLK1 point mutant is excellent in inhibiting the metastasis of cancer cells.

                         SEQUENCE LISTING <110> Industry-University Cooperation Foundation Hanyang        University ERICA Campus   <120> COMPOSITION FOR TREATING METASTIC CANCER <130> P20180610KR / P18U22C1009 <150> 10-2017-0159265 <151> 2017-11-27 <160> 45 <170> PatentIn version 3.2 <210> 1 <211> 1812 <212> DNA <213> Homo sapiens <400> 1 atgagtgctg cagtgactgc agggaagctg gcacgggcac cggccgaccc tgggaaagcc 60 ggggtccccg gagttgcagc tcccggagct ccggcggcgg ctccaccggc gaaagagatc 120 ccggaggtcc tagtggaccc acgcagccgg cggcgctatg tgcggggccg ctttttgggc 180 aagggcggct ttgccaagtg cttcgagatc tcggacgcgg acaccaagga ggtgttcgcg 240 ggcaagattg tgcctaagtc tctgctgctc aagccgcacc agagggagaa gatgtccatg 300 cggctttttc gaggacaacg acttcgtgtt cgtggtgttg gagctctgcc gccggaggtc tctcctggag 420 ctgcacaaga ggaggaaagc cctgactgag cctgaggccc gatactacct acggcaaatt 480 gtgcttggct gccagtacct gcaccgaaac cgagttattc atcgagacct caagctgggc 540 aaccttttcc tgaatgaaga tctggaggtg aaaatagggg attttggact ggcaaccaaa 600 gtcgaatatg acgggagag gaagaagacc ctgtgtggga ctcctaatta catagctccc 660 gaggtgctg gcaagaaagg gcacagtttc gaggtggatg tgtggtccat tgggtgtatc 720 atgtatacct tgttagtggg caaaccacct tttgagactt cttgcctaaa agagacctac 780 ctccggatca agaagaatga atacagtatt cccaagcaca tcaaccccgt ggccgcctcc 840 ctcatccaga agatgcttca gacagatccc actgcccgcc caaccattaa cgagctgctt 900 aatgacgagt tctttacttc tggctatatc cctgcccgtc tccccatcac ctgcctgacc 960 attccaccaa ggttttcgat tgctcccagc agcctggacc ccagcaaccg gaagcccctc 1020 acagtcctca ataaaggctt ggagaacccc ctgcctgagc gtccccggga aaaagaagaa 1080 ccagtggttc gagagacagg tgaggtggtc gactgccacc tcagtgacat gctgcagcag 1140 ctgcacagtg tcaatgcctc caagccctcg gagcgtgggc tggtcaggca agaggaggct 1200 gaggatcctg cctgcatccc catcttctgg gtcagcaagt gggtggacta ttcggacaag 1260 tacggccttg ggtatcagct ctgtgataac agcgtggggg tgctcttcaa tgactcaaca 1320 cgcctcatcc tctacaatga tggtgacagc ctgcagtaca tagagcgtga cggcactgag 1380 tcctacctca ccgtgagttc ccatcccaac tccttgatga agaagatcac cctccttaaa 1440 tatttccgca attacatgag cgagcacttg ctgaaggcag gtgccaacat cacgccgcgc 1500 gaaggtgatg agctcgcccg gctgccctac ctacggacct ggttccgcac ccgcagcgcc 1560 atcatcctgc acctcagcaa cggcagcgtg cagatcaact tcttccagga tcacaccaag 1620 ctcatcttgt gcccactgat ggcagccgtg acctacatcg acgagaagcg ggacttccgc 1680 acataccgcc tgagtctcct ggaggagtac ggctgctgca aggagctggc cagccggctc 1740 cgctacgccc gcactatggt ggacaagctg ctgagctcac gctcggccag caaccgtctc 1800 aaggcctcct aa 1812 <210> 2 <211> 603 <212> PRT <213> Homo sapiens <400> 2 Met Ser Ala Ala Val Thr Ala Gly Lys Leu Ala Arg Ala Pro Ala Asp 1 5 10 15 Pro Gly Lys Ala Gly Val Pro Gly Val Ala Pro Gly Ala Pro Ala             20 25 30 Ala Ala Pro Pro Ala Lys Glu Ile Pro Glu Val Leu Val Asp Pro Arg         35 40 45 Ser Arg Arg Tyr Val Arg Gly Arg Phe Leu Gly Lys Gly Gly Phe     50 55 60 Ala Lys Cys Phe Glu Ile Ser Asp Ala Asp Thr Lys Glu Val Phe Ala 65 70 75 80 Gly Lys Ile Val Pro Lys Ser Leu Leu Leu Lys Pro His Gln Arg Glu                 85 90 95 Lys Met Ser Met Glu Ile Ser Ile His Arg Ser Leu Ala His Gln His             100 105 110 Val Val Gly Phe His Gly Phe Phe Glu Asp Asn Asp Phe Val Phe Val         115 120 125 Val Leu Glu Leu Cys Arg Arg Arg Ser Leu Leu Glu Leu His Lys Arg     130 135 140 Arg Lys Ala Leu Thr Glu Pro Glu Ala Arg Tyr Tyr Leu Arg Gln Ile 145 150 155 160 Val Leu Gly Cys Gln Tyr Leu His Arg Asn Arg Val Ile His Arg Asp                 165 170 175 Leu Lys Leu Gly Asn Leu Phe Leu Asn Glu Asp Leu Glu Val Lys Ile             180 185 190 Gly Asp Phe Gly Leu Ala Thr Lys Val Glu Tyr Asp Gly Glu Arg Lys         195 200 205 Lys Thr Leu Cys Gly Thr Pro Asn Tyr Ile Ala Pro Glu Val Leu Ser     210 215 220 Lys Lys Gly His Ser Phe Glu Val Asp Val Trp Ser Ile Gly Cys Ile 225 230 235 240 Met Tyr Thr Leu Leu Val Gly Lys Pro Pro Phe Glu Thr Ser Cys Leu                 245 250 255 Lys Glu Thr Tyr Leu Arg Ile Lys Lys Asn Glu Tyr Ser Ile Pro Lys             260 265 270 His Ile Asn Pro Val Ala Ala Ser Leu Ile Gln Lys Met Leu Gln Thr         275 280 285 Asp Pro Thr Ala Arg Pro Thr Ile Asn Glu Leu Leu Asn Asp Glu Phe     290 295 300 Phe Thr Ser Gly Tyr Ile Pro Ala Arg Leu Pro Ile Thr Cys Leu Thr 305 310 315 320 Ile Pro Pro Arg Phe Ser Ile Ala Pro Ser Ser Leu Asp Pro Ser Asn                 325 330 335 Arg Lys Pro Leu Thr Val Leu Asn Lys Gly Leu Glu Asn Pro Leu Pro             340 345 350 Glu Arg Pro Glu Lys Glu Glu Pro Val Val Arg Glu Thr Gly Glu         355 360 365 Val Val Asp Cys His Leu Ser Asp Met Leu Gln Gln Leu His Ser Val     370 375 380 Asn Ala Ser Lys Pro Ser Glu Arg Gly Leu Val Arg Gln Glu Glu Ala 385 390 395 400 Glu Asp Pro Ala Cys Ile Pro Ile Phe Trp Val Ser Lys Trp Val Asp                 405 410 415 Tyr Ser Asp Lys Tyr Gly Leu Gly Tyr Gln Leu Cys Asp Asn Ser Val             420 425 430 Gly Val Leu Phe Asn Asp Ser Thr Arg Leu Ile Leu Tyr Asn Asp Gly         435 440 445 Asp Ser Leu Gln Tyr Ile Glu Arg Asp Gly Thr Glu Ser Tyr Leu Thr     450 455 460 Val Ser Ser His Pro Asn Ser Leu Met Lys Lys Ile Thr Leu Leu Lys 465 470 475 480 Tyr Phe Arg Asn Tyr Met Ser Glu His Leu Leu Lys Ala Gly Ala Asn                 485 490 495 Ile Thr Pro Arg Glu Gly Asp Glu Leu Ala Arg Leu Pro Tyr Leu Arg             500 505 510 Thr Trp Phe Arg Thr Arg Ser Ale Ile Ile Leu His Leu Ser Asn Gly         515 520 525 Ser Val Gln Ile Asn Phe Phe Gln Asp His Thr Lys Leu Ile Leu Cys     530 535 540 Pro Leu Met Ala Ala Val Thr Tyr Ile Asp Glu Lys Arg Asp Phe Arg 545 550 555 560 Thr Tyr Arg Leu Ser Leu Leu Glu Glu Tyr Gly Cys Cys Lys Glu Leu                 565 570 575 Ala Ser Arg Leu Arg Tyr Ala Arg Thr Met Val Asp Lys Leu Leu Ser             580 585 590 Ser Arg Ser Ala Ser Asn Arg Leu Lys Ala Ser         595 600 <210> 3 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 3 agatcaccct ccttaaatat t 21 <210> 4 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 4 gagaagatgt ccatggaaat a 21 <210> 5 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 5 ggatcaagaa gaatgaatac a 21 <210> 6 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 6 atgaagatct ggaggtgaaa a 21 <210> 7 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 7 caaccaaagt cgaatatgac g 21 <210> 8 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 8 tcaataaagg cttggagaac c 21 <210> 9 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 9 gcaagaaagg gcacagtttc g 21 <210> 10 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 10 gcaccgaaac cgagttattc a 21 <210> 11 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 11 ggaggaaagc cctgactgag c 21 <210> 12 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 12 cgaaagagat cccggaggtc c 21 <210> 13 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 13 gccagtacct gcaccgaaac c 21 <210> 14 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 14 ataccttgtt agtgggcaaa c 21 <210> 15 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 15 gcgcgaaggt gatgagctcg c 21 <210> 16 <211> 21 <212> DNA <213> Artificial <220> <223> Target sequence for PLK1 mRNA <400> 16 tgacctacat cgacgagaag c 21 <210> 17 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 1 <400> 17 ccggagatca ccctccttaa atattctcga gaatatttaa ggagggtgat cttttttg 58 <210> 18 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 1 <400> 18 aattcaaaaa agatcaccct ccttaaatat tctcgagaat atttaaggag ggtgatct 58 <210> 19 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 2 <400> 19 ccgggagaag atgtccatgg aaatactcga gtatttccat ggacatcttc tctttttg 58 <210> 20 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 2 <400> 20 aattcaaaaa gagaagatgt ccatggaaat actcgagtat ttccatggac atcttctc 58 <210> 21 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 3 <400> 21 ccggggatca agaagaatga atacactcga gtgtattcat tcttcttgat cctttttg 58 <210> 22 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 3 <400> 22 aattcaaaaa ggatcaagaa gaatgaatac actcgagtgt attcattctt cttgatcc 58 <210> 23 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 4 <400> 23 ccggatgaag atctggaggt gaaaactcga gttttcacct ccagatcttc attttttg 58 <210> 24 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 4 <400> 24 aattcaaaaa atgaagatct ggaggtgaaa actcgagttt tcacctccag atcttcat 58 <210> 25 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 5 <400> 25 ccggcaacca aagtcgaata tgacgctcga gcgtcatatt cgactttggt tgtttttg 58 <210> 26 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 5 <400> 26 aattcaaaaa caaccaaagt cgaatatgac gctcgagcgt catattcgac tttggttg 58 <210> 27 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 6 <400> 27 ccggtcaata aaggcttgga gaaccctcga gggttctcca agcctttatt gatttttg 58 <210> 28 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 6 <400> 28 aattcaaaaa tcaataaagg cttggagaac cctcgagggt tctccaagcc tttattga 58 <210> 29 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 7 <400> 29 ccgggcaaga aagggcacag tttcgctcga gcgaaactgt gccctttctt gctttttg 58 <210> 30 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 7 <400> 30 aattcaaaaa gcaagaaagg gcacagtttc gctcgagcga aactgtgccc tttcttgc 58 <210> 31 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 8 <400> 31 ccgggcaccg aaaccgagtt attcactcga gtgaataact cggtttcggt gctttttg 58 <210> 32 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 8 <400> 32 aattcaaaaa gcaccgaaac cgagttattc actcgagtga ataactcggt ttcggtgc 58 <210> 33 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 9 <400> 33 ccggggagga aagccctgac tgagcctcga ggctcagtca gggctttcct cctttttg 58 <210> 34 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 9 <400> 34 aattcaaaaa ggaggaaagc cctgactgag cctcgaggct cagtcagggc tttcctcc 58 <210> 35 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 10 <400> 35 ccggcgaaag agatcccgga ggtccctcga gggacctccg ggatctcttt cgtttttg 58 <210> 36 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 10 <400> 36 aattcaaaaa cgaaagagat cccggaggtc cctcgaggga cctccgggat ctctttcg 58 <210> 37 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 11 <400> 37 ccgggccagt acctgcaccg aaaccctcga gggtttcggt gcaggtactg gctttttg 58 <210> 38 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 11 <400> 38 aattcaaaaa gccagtacct gcaccgaaac cctcgagggt ttcggtgcag gtactggc 58 <210> 39 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 12 <400> 39 ccggatacct tgttagtggg caaacctcga ggtttgccca ctaacaaggt attttttg 58 <210> 40 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 12 <400> 40 aattcaaaaa ataccttgtt agtgggcaaa cctcgaggtt tgcccactaa caaggtat 58 <210> 41 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 13 <400> 41 ccgggcgcga aggtgatgag ctcgcctcga ggcgagctca tcaccttcgc gctttttg 58 <210> 42 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 13 <400> 42 aattcaaaaa gcgcgaaggt gatgagctcg cctcgaggcg agctcatcac cttcgcgc 58 <210> 43 <211> 58 <212> DNA <213> Artificial <220> <223> Forward primer # 14 <400> 43 ccggtgacct acatcgacga gaagcctcga ggcttctcgt cgatgtaggt catttttg 58 <210> 44 <211> 58 <212> DNA <213> Artificial <220> <223> Reverse primer # 14 <400> 44 aattcaaaaa tgacctacat cgacgagaag cctcgaggct tctcgtcgat gtaggtca 58 <210> 45 <211> 6 <212> DNA <213> Artificial <220> <223> loop sequence <400> 45 ctcgag 6

Claims (15)

An oligonucleotide that inhibits the expression of PLK1 (Polo-like kinase 1) mRNA of SEQ ID NO: 1; An antibody that inhibits the activity of the PLK1 protein or an antigen-binding fragment thereof; A PLK1 mutant protein comprising any one mutation selected from the group consisting of K82M, W414F and V415A mutations in the amino acid sequence of SEQ ID NO: 2, and a nucleotide encoding the PLK1 mutant protein; A pharmaceutical composition for therapeutic use. The method according to claim 1,
An oligonucleotide that inhibits mRNA expression of PLK1 is selected from the group consisting of an antisense oligonucleotide, an aptamer, an siRNA, an shRNA, and a miRNA that complementarily bind to PLK1 mRNA of SEQ ID NO: 1. 3. The method according to claim 1 or 2,
The oligonucleotide which inhibits the mRNA expression of PLK1 includes the nucleotide sequence of 1424-1444 nucleotides in SEQ ID NO: 1; 286-306 th nucleotide sequence; 785-805 th nucleotide sequence; 554-574 th nucleotide sequence; 593-613 &lt; th &gt; nucleotide sequence; 1028-1048 th nucleotide sequence; 671-691 th nucleotide sequence; 501-521 &lt; th &gt; nucleotide sequence; 431-451 &lt; th &gt; nucleotide sequence; 110-130 &lt; th &gt; nucleotide sequence; The 542-562nd nucleotide sequence; 725-745 th nucleotide sequence; The 1497-1517th nucleotide sequence; And a nucleotide sequence of 1649-1669 nucleotides, or a sequence complementary thereto. The method according to claim 1,
Wherein said PLK1 mutant protein comprises the amino acid sequence of SEQ ID NO: 2
a) a mutated protein comprising a K82M mutation; And
b) a mutant protein comprising W414F and V415A variants
&Lt; / RTI &gt; or a pharmaceutically acceptable salt thereof. The method according to claim 1,
Wherein said composition is for the prevention or treatment of metastatic cancer. The method according to claim 1,
Wherein said composition is for the treatment of cancer with overexpression of PLK1. An oligonucleotide that is an siRNA or shRNA that inhibits mRNA expression of PLK1 comprising a contiguous 5 to 50 nucleotide sequence or a sequence complementary thereto in the indicated nucleotide sequence of SEQ ID NO: The 1424-1444 th nucleotide sequence in SEQ ID NO: 1; 286-306 th nucleotide sequence; 785-805 th nucleotide sequence; 554-574 th nucleotide sequence; 593-613 &lt; th &gt; nucleotide sequence; 1028-1048 th nucleotide sequence; 671-691 th nucleotide sequence; 501-521 &lt; th &gt; nucleotide sequence; 431-451 &lt; th &gt; nucleotide sequence; 110-130 &lt; th &gt; nucleotide sequence; The 542-562nd nucleotide sequence; 725-745 th nucleotide sequence; The 1497-1517th nucleotide sequence; And 1649-1669 &lt; th &gt; nucleotide sequence, or an siRNA or shRNA that inhibits mRNA expression of PLK1 comprising a sequence complementary thereto. 8. A recombinant vector expressing the siRNA or shRNA of claim 7 or 8. A) K82M mutation in the amino acid sequence of SEQ ID NO: 2; Or b) a PLK1 mutation protein comprising the W414F and V415A mutations. A polynucleotide encoding the mutant protein of claim 10. An oligonucleotide that inhibits the expression of PLK1 mRNA of SEQ ID NO: 1; A recombinant vector expressing it; A polynucleotide encoding a PLK1 mutant protein comprising at least one mutation selected from the group consisting of mutations K82M, W414F and V415A in the amino acid sequence of SEQ ID NO: 2; Or a recombinant vector comprising the polynucleotide. 13. The method of claim 12,
Wherein the oligonucleotide which inhibits mRNA expression of PLK1 is selected from the group consisting of antisense oligonucleotides complementary to PLK1 mRNA of SEQ ID NO: 1, aptamer, siRNA, shRNA and miRNA. The method according to claim 12 or 13,
The oligonucleotide which inhibits the mRNA expression of PLK1 includes the nucleotide sequence of 1424-1444 nucleotides in SEQ ID NO: 1; 286-306 th nucleotide sequence; 785-805 th nucleotide sequence; 554-574 th nucleotide sequence; 593-613 &lt; th &gt; nucleotide sequence; 1028-1048 th nucleotide sequence; 671-691 th nucleotide sequence; 501-521 &lt; th &gt; nucleotide sequence; 431-451 &lt; th &gt; nucleotide sequence; 110-130 &lt; th &gt; nucleotide sequence; The 542-562nd nucleotide sequence; 725-745 th nucleotide sequence; The 1497-1517th nucleotide sequence; And a nucleotide sequence of 1649-1669 nucleotides, or a sequence complementary thereto. An oligonucleotide that inhibits the expression of PLK1 (Polo-like kinase 1) mRNA of SEQ ID NO: 1; An antibody that inhibits the activity of the PLK1 protein or an antigen-binding fragment thereof; A mutation of a tumor comprising at least one selected from the group consisting of a PLK1 mutant protein comprising any one mutation selected from the group consisting of K82M, W414F and V415A mutations in the amino acid sequence of SEQ ID NO: 2 and a nucleotide encoding a PLK1 mutant protein / RTI &gt;

Images