KR20190047602A - Novel D-stereospecific amino acid amidase and mutants thereof, and method for preparing D-amino acid using the same - Google Patents

Novel D-stereospecific amino acid amidase and mutants thereof, and method for preparing D-amino acid using the same Download PDF

Info

Publication number
KR20190047602A
KR20190047602A KR1020180120620A KR20180120620A KR20190047602A KR 20190047602 A KR20190047602 A KR 20190047602A KR 1020180120620 A KR1020180120620 A KR 1020180120620A KR 20180120620 A KR20180120620 A KR 20180120620A KR 20190047602 A KR20190047602 A KR 20190047602A
Authority
KR
South Korea
Prior art keywords
amino acid
seq
leu
ala
stereospecific
Prior art date
Application number
KR1020180120620A
Other languages
Korean (ko)
Other versions
KR102118898B1 (en
Inventor
염수진
이승구
권길광
나유진
박성현
최민정
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of KR20190047602A publication Critical patent/KR20190047602A/en
Application granted granted Critical
Publication of KR102118898B1 publication Critical patent/KR102118898B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01004—Amidase (3.5.1.4)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a novel D-stereospecific amino acid amidase. Specifically, the present invention provides a novel D-stereospecific amino acid amidase having amino acid sequence of SEQ ID NO: 1 isolated from a Bacillus sp. microorganism or an amino acid sequence having at least 90% homology with SEQ ID NO: 1, and a gene encoding the same. The D-stereospecific amino acid amidase of the present invention is capable of stereoselectively converting an amino acid amide into a D-amino acid, and thus it is possible to produce D-amino acids in a high yield without a separate separation step.

Description

신규 D-입체특이적 아미노산 아미다아제와 그 돌연변이체, 및 이를 이용한 D-아미노산 생산 방법{Novel D-stereospecific amino acid amidase and mutants thereof, and method for preparing D-amino acid using the same}[0001] The present invention relates to novel D-stereospecific amino acid amidases and mutants thereof, and to a D-amino acid producing method using the novel D-stereospecific amino acid amidases and mutants thereof and a method for preparing D-

본 발명은 신규한 D-입체특이적 아미노산 아미다아제에 관한 것으로, 보다 구체적으로는 바실러스(Bacillus) 속 미생물 유래의 D-입체특이적 아미노산 아미다아제와 그의 돌연변이체에 관한 것이다.The present invention relates to novel D-stereospecific amino acid amidases, and more particularly to D-stereospecific amino acid amidases derived from Bacillus genus microorganisms and mutants thereof.

자연계에 존재하는 아미노산들은 대부분 광학활성을 나타내는 알파탄소를 가지고 있으며 입체특이성에 따라 L-아미노산과 D-아미노산으로 나뉜다. 자연계에 존재하는 대부분의 단백질은 L-아미노산으로 구성되어 있으나, 예외적으로 미생물의 펩티도글리칸이나 펩티드계 항생물질의 구성성분 및 고등식물의 생리활성물질의 구성성분 등은 D-아미노산으로 구성되어 있다.Most of the amino acids present in the natural world have alpha carbon which shows optical activity, and they are divided into L-amino acid and D-amino acid depending on stereospecificity. Most of the proteins present in the natural world are composed of L-amino acids, except that the constituents of peptidoglycan or peptide-based antibiotics of microorganisms and the constituents of physiologically active substances of higher plants are composed of D-amino acids have.

현재까지의 연구에 의하면, D-아미노산은 신경전달물질, 백신, 합성감미료, 항생제 및 호르몬 등의 생리활성물질을 합성하는 중간물질로서 식품과 의약분야에서 널리 이용되고 있으며, 이에 D-아미노산을 생산하는 방법들이 개발되어 왔다.Studies have shown that D-amino acids are widely used in food and medicine fields as intermediates for synthesizing physiologically active substances such as neurotransmitters, vaccines, synthetic sweeteners, antibiotics and hormones, and D-amino acids are produced Have been developed.

D-아미노산을 생산하는 방법은 크게 화학 합성법과 생물촉매로 사용하여 생산하는 방법으로 나눌 수 있다. 화학적 합성법에 의한 아미노산의 생산은 D- 또는 L-아미노산이 혼합된 상태(racemic mixture)로 생성물이 얻어지기 때문에, 순수한 D-아미노산을 얻기 위해서는 또 다른 복잡한 광학적 순수화 과정을 거쳐야 하는 어려움이 있다. 이에 비해 미생물 생물촉매를 이용한 D-아미노산 생산방법은 광학적으로 순수한 D-아미노산만을 한 단계로 직접 생산할 수 있기 때문에 환경오염의 문제점을 가지고 있는 다단계 화학합성법을 대체할 수 있는 저공해 청정생산기술로서 주목 받고 있다.D-amino acid production can be divided into chemical synthesis and biocatalyst production. The production of amino acids by the chemical synthesis method is difficult because of the racemic mixture of D- or L-amino acids, and therefore, a complicated optical purifying process is required to obtain pure D-amino acids. On the other hand, since the D-amino acid production method using microbial biocatalyst can directly produce only optically pure D-amino acid in one step, it is attracting attention as a low-pollution clean production technology that can replace the multistage chemical synthesis method having problems of environmental pollution have.

생물촉매를 이용한 D-아미노산 생산법으로는 D,L-아미노산 혼합물로부터 D-아미노산만을 순수하게 분리하여 생산하는 방법이 연구되었는데, 상기 방법은 D,L-아미노산 혼합물을 D,L-아미노산 아미드로 만든 후, 여기에 D-입체특이적 아미노산 아미다아제를 작용시켜 D,L-아미노산 아미드에서 D-아미노산 아미드만을 선택적으로 가수분해하여 D-아미노산을 제조할 수 있고, 남아있는 L-아미노산 아미드는 라세마아제(racemase)를 이용해서 다시 D-아미노산 아미드로 전환한 다음 이를 다시 D-입체특이적 아미노산 아미다아제를 이용하여 D-아미노산을 제조할 수 있는 것이다. 따라서 D-아미노산 생산에 D-입체특이적 아미노산 아미다아제를 사용하면 비교적 저렴한 D,L-아미노산 혼합물(racemic mixture)로부터 산업적으로 유용한 다양한 D-아미노산을 생산할 수 있다는 장점이 있다.The D-amino acid production method using a biocatalyst has been studied in which pure D-amino acids are separated from a D, L-amino acid mixture by pure separation. Amino acid amide can be produced by selectively hydrolyzing only the D-amino acid amide in the D, L-amino acid amide by reacting the D-stereospecific amino acid amidase with the D-amino acid amide, and the remaining L- Amino acid amide using racemase and then D-amino acid amidase using D-stereospecific amino acid amidase. Therefore, the use of the D-stereospecific amino acid amidase for the production of D-amino acid has an advantage in that it can produce a variety of industrially useful D-amino acids from a relatively inexpensive D, L-amino acid mixture (racemic mixture).

이에, 상기와 같은 생물전환공정으로 D-아미노산을 생산하는데 생물촉매로 이용될 수 있는 효소에 관한 연구, 개발이 더욱 필요한 실정이다.Accordingly, research and development of enzymes that can be used as biocatalysts in the production of D-amino acids by the above-mentioned bioconversion process are further needed.

본 발명의 목적은 바실러스(Bacillus) 속 미생물인 바실러스 메가테리움(Bacillus megaterium) 유래의 신규한 D-입체특이적 아미노산 아미다아제 및 상기 D-입체특이적 아미노산 아미다아제를 이용한 D-아미노산의 생산 방법을 제공하는 것이다.The object of the present invention is to provide a novel D-stereospecific amino acid amidase derived from Bacillus megaterium , a microorganism belonging to the genus Bacillus , and a novel D-stereospecific amino acid amidase derived from D-amino acid using the D-stereospecific amino acid amidase. Thereby providing a production method.

상기의 목적을 달성하기 위하여, 본 발명의 일 측면은 서열번호 1의 아미노산 서열, 또는 서열번호 1과 90% 이상의 상동성을 가지는 아미노산 서열을 포함하는 D-입체특이적 아미노산 아미다아제를 제공한다.In order to achieve the above object, one aspect of the present invention provides a D-stereospecific amino acid amidase comprising an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 90% or more homology with SEQ ID NO: 1 .

또한, 상기 목적을 달성하기 위하여, 본 발명은 다른 측면은 상기 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자를 제공한다.In order to achieve the above object, another aspect of the present invention provides a gene encoding the D-stereospecific amino acid amidase.

또한, 상기 목적을 달성하기 위하여, 본 발명은 또 다른 측면은 상기 유전자가 포함된 재조합 발현벡터 및 상기 발현벡터가 도입된 형질전환체를 제공한다.In order to achieve the above object, another aspect of the present invention provides a recombinant expression vector containing the gene and a transformant into which the expression vector is introduced.

아울러, 상기 목적을 달성하기 위하여, 본 발명의 또 다른 측면은 상기 D-입체특이적 아미노산 아미다아제를 포함하는 상기 D-아미노산 생산용 조성물, 및 상기 D-입체특이적 아미노산 아미다아제를 아미노산 아미드와 반응시키는 단계를 포함하는 D-아미노산의 생산 방법을 제공한다.In order to achieve the above object, another aspect of the present invention is to provide a composition for producing D-amino acid comprising the D-stereospecific amino acid amidase and a composition for producing the D-stereospecific amino acid amidase, Amide in the presence of a base.

본 발명의 D-입체특이적 아미노산 아미다아제는 아미노산 아미드를 입체특이적으로 D-아미노산으로 변환시킬 수 있어서, 별도의 분리공정 없이도 D-아미노산을 높은 수율로 생산할 수 있는 장점이 있다.The D-stereospecific amino acid amidase of the present invention is capable of stereoselectively converting an amino acid amide into a D-amino acid, and thus it is possible to produce D-amino acid in a high yield without a separate separation step.

다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned can be clearly understood by those skilled in the art from the following description.

도 1은 형질전환체에서 과발현되어 정제 및 분리된 서열번호 1의 아미노산 서열을 갖는 단백질을 SDS-PGAE로 확인한 사진이다.
도 2는 서열번호 1의 아미노산 서열을 갖는 단백질의 시간에 따른 D-아미노산 전환 정도를 나타낸 그래프이다.
도 3은 서열번호 1의 아미노산 서열을 갖는 단백질의 효소 활성에 영향을 미치는 금속 양이온의 종류(A)와 금속 양이온의 농도(B)를 확인한 그래프이다.
도 4는 온도가 서열번호 1의 아미노산 서열을 갖는 단백질의 효소 활성에 미치는 영향을 확인한 그래프이다.
도 5는 pH가 서열번호 1의 아미노산 서열을 갖는 단백질의 효소 활성에 미치는 영향을 확인한 그래프이다.Fig. 1 is a photograph of a protein having an amino acid sequence of SEQ ID NO: 1 purified and isolated in SDS-PGAE overexpressed in a transformant.
2 is a graph showing the degree of D-amino acid conversion of a protein having the amino acid sequence of SEQ ID NO: 1 over time.
FIG. 3 is a graph showing the type (A) of the metal cation and the concentration (B) of the metal cation affecting the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 1.
4 is a graph showing the effect of temperature on the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 1.
FIG. 5 is a graph showing the effect of pH on the enzyme activity of a protein having the amino acid sequence of SEQ.

먼저, 본 발명의 명세서에서 이용된 용어를 설명한다.First, terms used in the specification of the present invention will be described.

본 발명에서 일컫는 'D-입체특이적 아미노산 아미다아제'는 하기 반응식과 같이 아미노산 아미드(amino acid amide)을 D-아미노산으로 변환시키는 활성을 가진 효소를 의미한다.The term " D-stereospecific amino acid amidase " referred to in the present invention means an enzyme having an activity of converting an amino acid amide into a D-amino acid as shown in the following reaction formula.

[반응식][Reaction Scheme]

Figure pat00001
Figure pat00001

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

1.  One. 신규 D-입체특이적 아미노산 아미다아제 및 그 유전자The novel D-stereospecific amino acid amidase and its gene

본 발명의 일 측면은 서열번호 1의 아미노산 서열, 또는 서열번호 1과 90% 이상의 상동성을 가지는 아미노산 서열을 포함하는 D-입체특이적 아미노산 아미다아제를 제공한다.One aspect of the present invention provides a D-stereospecific amino acid amidase comprising an amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having 90% or more homology with SEQ ID NO: 1.

또한, 본 발명의 다른 측면은 상기 D-입체특이적 아미노산 아미다아제를 암호화하는 D-입체특이적 아미노산 아미다아제의 유전자를 제공한다. Another aspect of the present invention provides a D-stereospecific amino acid amidase gene encoding the D-stereospecific amino acid amidase.

본 발명의 D-입체특이적 아미노산 아미다아제는 바실러스(Bacillus) 속 미생물로부터 유래한 것일 수 있고, 특히 바실러스 메가테리움(Bacillus megaterium)으로부터 유래한 것이 바람직하다.The D-stereospecific amino acid amidase of the present invention may be derived from a microorganism belonging to the genus Bacillus , and is preferably derived from Bacillus megaterium .

본 발명의 D-입체특이적 아미노산 아미다아제는 서열번호 1의 아미노산 서열을 포함하고, 상기 D-입체특이적 아미노산 아미다아제는 단백질의 기능에 영향을 미치지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입, 치환 또는 이들의 조합에 의해서 상이한 서열을 가지는 아미노산의 변이체들, 또는 단편들일 수 있다. 상기 D-입체특이적 아미노산 아미다아제의 활성을 전체적으로 변경시키지 않는 단백질 및 펩티드 수준에서의 아미노산 교환은 당해 분야에 공지되어 있다. 경우에 따라서는 인산화(phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylation), 파네실화(farnesylation) 등으로 변형될 수 있다. 따라서 본 발명은 서열번호 1의 아미노산 서열을 포함하는 단백질과 실질적으로 동일한 아미노산 서열을 갖는 단백질 및 이의 변이체 또는 이의 활성 단편을 포함한다. 상기 실질적으로 동일한 단백질이란 90％ 이상, 바람직하게는 93％ 이상, 가장 바람직하게는 95％ 이상의 아미노산 서열의 상동성을 갖는 것들을 의미하나 이에 한정되지 않으며, 90% 이상의 아미노산 서열의 상동성을 가지며 동일한 효소 활성을 가진다면 본 발명의 범위에 포함된다.The D-stereospecific amino acid amidase of the present invention comprises the amino acid sequence of SEQ ID NO: 1, and the D-stereospecific amino acid amidase has a deletion of amino acid residues within a range that does not affect the function of the protein , Variants, or fragments of amino acids having different sequences by insertion, substitution or a combination thereof. Amino acid exchange at the level of proteins and peptides that do not globally alter the activity of the D-stereospecific amino acid amidase is known in the art. In some cases, it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, and the like. Accordingly, the present invention includes a protein having substantially the same amino acid sequence as the protein comprising the amino acid sequence of SEQ ID NO: 1, a mutant thereof, or an active fragment thereof. The substantially same protein refers to those having an amino acid sequence homology of 90% or more, preferably 93% or more, and most preferably 95% or more, but is not limited thereto. The amino acid sequence having 90% or more amino acid sequence homology Is encompassed within the scope of the present invention.

특히, 상기 서열번호 1과 90% 이상의 상동성을 가지는 아미노산 서열은, 상기 서열번호 1의 아미노산 서열에서 119번째 페닐알라닌(phenylalanine)에 변이가 발생한 것일 수 있다. In particular, the amino acid sequence having 90% or more homology with SEQ ID NO: 1 may be a 119th phenylalanine mutation in the amino acid sequence of SEQ ID NO: 1.

구체적으로, 상기 서열번호 1과 90% 이상의 상동성을 가지는 아미노산 서열은, 상기 서열번호 1의 아미노산 서열에서 상기 119번째 페닐알라닌이 알라닌(alanine), 발린(valine), 이소류신(isoleucine), 류신(leucine), 티로신(tyrosine) 및 트립토판(tryptophan)으로 구성된 군에서 선택되는 어느 하나로 치환될 수 있고, 보다 구체적으로 상기 119번째 페닐알라닌이 알라닌, 발린, 티로신 및 페닐알라닌으로 구성된 군에서 선택되는 어느 하나로 치환될 수 있으며, 예컨대 상기 119번째 페닐알라닌이 알라닌, 티로신 및 페닐알라닌으로 구성된 군에서 선택되는 어느 하나로 치환된 것일 수 있다. 특히, 상기 서열번호 1과 90% 이상의 상동성을 가지는 아미노산 서열은, 상기 서열번호 1의 아미노산 서열에서 119번째 페닐알라닌이 알라닌으로 치환된 서열번호 7의 아미노산 서열, 상기 서열번호 1의 아미노산 서열에서 119번째 페닐알라닌이 티로신으로 치환된 서열번호 9의 아미노산 서열, 또는 상기 서열번호 1의 아미노산 서열에서 119번째 페닐알라닌이 트립토판으로 치환된 서열번호 11의 아미노산 서열일 수 있다.Specifically, the amino acid sequence having 90% or more homology with SEQ ID NO: 1 is the amino acid sequence of SEQ ID NO: 1, wherein the 119th phenylalanine is alanine, valine, isoleucine, leucine, Tyrosine, and tryptophan. More specifically, the 119th phenylalanine may be substituted with any one selected from the group consisting of alanine, valine, tyrosine, and phenylalanine. For example, the 119th phenylalanine may be substituted with any one selected from the group consisting of alanine, tyrosine and phenylalanine. Particularly, the amino acid sequence having 90% or more homology with SEQ ID NO: 1 is the amino acid sequence of SEQ ID NO: 7 in which the 119th phenylalanine in the amino acid sequence of SEQ ID NO: 1 is substituted with alanine, the amino acid sequence of SEQ ID NO: Th phenylalanine is replaced with tyrosine, or the amino acid sequence of SEQ ID NO: 11 in which the 119th phenylalanine in the amino acid sequence of SEQ ID NO: 1 is substituted with tryptophan.

상기 D-입체특이적 아미노산 아미다아제의 유전자는 서열번호 2의 염기 서열로 이루어진 것이 바람직하다. 그러나 본 발명의 D-입체특이적 아미노산 아미다아제 및 이의 변이체 또는 이의 활성 단편을 암호화하는 유전자는 암호화 영역으로부터 발현되는 상기 효소 및 이의 변이체 또는 이의 활성 단편의 아미노산 서열을 변화시키지 않는 범위 내에서 암호화 영역에 다양한 변형이 이루어질 수 있고, 암호화 영역을 제외한 부분에서도 유전자의 발현에 영향을 미치지 않는 범위 내에서 다양한 변이가 이루어질 수 있으며, 이러한 변이 유전자 역시 본 발명의 범위에 포함된다. 따라서 본 발명은 서열번호 2의 유전자와 실질적으로 동일한 염기 서열로 이루어진 유전자 및 상기 유전자의 단편을 포함한다. 상기 실질적으로 동일한 염기서열로 이루어진 유전자란 80％ 이상, 바람직하게는 90％ 이상, 가장 바람직하게는 95％ 이상의 서열 상동성을 갖는 것들을 의미하나, 이에 한정되는 것은 아니며, 80% 이상의 서열 상동성을 가지며 암호화된 단백질이 동일한 효소 활성을 가진다면 본 발명에 포함된다. 상기와 같이, 본 발명의 D-입체특이적 아미노산 아미다아제의 유전자는 이와 동등한 활성을 갖는 단백질을 암호화하는 한, 하나 이상의 핵산 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 변이될 수 있으며, 이들 또한 본 발명의 범위에 포함된다. The D-stereospecific amino acid amidase gene is preferably composed of the nucleotide sequence of SEQ ID NO: 2. However, the gene encoding the D-stereospecific amino acid amidase of the present invention and its mutant or its active fragment can be coded within the scope of not changing the amino acid sequence of the enzyme and its variant or its active fragment expressed from the coding region, Various mutations can be made in the region, and various mutations can be made within a range not affecting the expression of the gene even in the portion excluding the coding region, and such mutant genes are also included in the scope of the present invention. Therefore, the present invention includes a gene consisting of a base sequence substantially identical to the gene of SEQ ID NO: 2, and a fragment thereof. The term "gene comprising substantially the same base sequence" as used herein refers to those having 80% or more, preferably 90% or more, and most preferably 95% or more of sequence homology, but is not limited thereto, and 80% or more of the sequence homology And if the encoded protein has the same enzymatic activity, it is included in the present invention. As described above, the D-stereospecific amino acid amidase gene of the present invention may be mutated by substitution, deletion, insertion, or a combination of at least one nucleotide base so long as it encodes a protein having the equivalent activity , Which are also included in the scope of the present invention.

상기 D-입체특이적 아미노산 아미다아제에 포함되는 서열번호 1의 아미노산 서열은 바람직하게는 서열번호 2의 염기 서열로 이루어진 유전자에 의해 암호화되나, 본 발명은 이에 한정되지 않고, 동일 아미노산 서열을 갖는 본 발명의 단백질을 암호화할 수 있는 한, 서열번호 2의 염기 서열과 실질적으로 동일한 다른 염기 서열로 이루어진 유전자에 의해 암호화될 수도 있다. 이러한 염기 서열은 단일 가닥 또는 이중 가닥일 수 있으며, DNA 분자 또는 RNA 분자일 수 있다.The amino acid sequence of SEQ ID NO: 1 contained in the D-stereospecific amino acid amidase is preferably encoded by the gene consisting of the nucleotide sequence of SEQ ID NO: 2, but the present invention is not limited to this and the amino acid sequence having the same amino acid sequence As long as it can encode the protein of the present invention, it may be encoded by a gene consisting of another nucleotide sequence substantially identical to the nucleotide sequence of SEQ ID NO: 2. Such a base sequence may be a single strand or a double strand, and may be a DNA molecule or an RNA molecule.

본 발명의 바람직한 실시예에서, 본 발명자들은 바실러스 메가테리움(Bacillus megaterium)에서 유래한 서열번호 1의 아미노산 서열을 갖는 단백질의 기능을 규명하기 위하여 상기 서열번호 1의 아미노산 서열을 갖는 단백질을 분리 및 정제하였고(도 1 참고), 그 활성을 연구한 결과 상기 서열번호 1의 아미노산 서열을 갖는 단백질이 D-입체특이적 아미노산 아미다아제로서의 활성을 가진다는 것을 확인하였다(표 1 및 도 2 참고).In a preferred embodiment of the present invention, the present inventors isolated and purified a protein having the amino acid sequence of SEQ ID NO: 1 in order to identify the function of the protein having the amino acid sequence of SEQ ID NO: 1 derived from Bacillus megaterium . (See FIG. 1). As a result of studying its activity, it was confirmed that the protein having the amino acid sequence of SEQ ID NO: 1 had activity as a D-stereospecific amino acid amidase (see Table 1 and FIG. 2) .

2.  2. D-입체특이적 아미노산 아미다아제의 발현 벡터 및 형질전환체D-stereospecific amino acid amidase expression vectors and transformants

본 발명의 또 다른 측면은 본 발명의 D-입체특이적 아미노산 아미다아제의 유전자가 포함된 재조합 발현 벡터 및 상기 발현 벡터가 도입된 형질전환체를 제공한다.Another aspect of the present invention provides a recombinant expression vector containing the D-stereospecific amino acid amidase gene of the present invention and a transformant into which the expression vector is introduced.

본 발명의 재조합 발현 벡터는 상기 D-입체특이적 아미노산 아미다아제의 유전자를 포함한다.The recombinant expression vector of the present invention comprises the gene of the D-stereospecific amino acid amidase.

상기 발현 벡터는 플라스미드 벡터, 코즈미드 벡터, 박테리오파이지 벡터 및 바이러스 벡터 등을 포함하나 이에 한정되지 않는다. The expression vector includes, but is not limited to, a plasmid vector, a cosmid vector, a bacteriophage vector, and a viral vector.

상기 재조합 발현 벡터는 본 발명의 D-입체특이적 아미노산 아미다아제를 생산하고자 하는 숙주 세포의 종류에 따라 프로모터(promoter), 터미네이터(terminator), 엔핸서(enhancer) 등과 같은 발현조절서열, 또는 분비를 위한 서열 등을 적절히 목적에 따라 조합할 수 있다.The recombinant expression vector can be used to regulate an expression regulatory sequence such as a promoter, a terminator, an enhancer, or the like depending on the kind of a host cell to which the D-stereospecific amino acid amidase of the present invention is to be produced And the like may be suitably combined according to the purpose.

상기 발현 벡터는 벡터가 도입된 숙주 세포를 선택하기 위한 선택 마커를 추가로 포함할 수 있고, 복제 가능한 발현 벡터인 경우 복제 기원을 포함할 수 있다. The expression vector may further include a selection marker for selecting a host cell to which the vector is introduced, and may include a replication origin when the expression vector is a replication capable vector.

또한, 상기 재조합 발현 벡터는 발현 단백질의 정제를 용이하게 하기 위한 서열을 포함할 수 있으며, 구체적으로 본 발명의 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자에 작동 가능하도록 분리정제용 태그를 암호화하는 유전자가 연결될 수 있다. 이때, 상기 분리정제용 태그는 GST, poly-Arg, FLAG, 히스티딘-태그(His-tag) 및 c-myc 등이 단독으로 사용되거나 이들 중 두 개 이상을 순차적으로 연결하여 사용할 수도 있다.In addition, the recombinant expression vector may include a sequence for facilitating the purification of the expressed protein, and more specifically, a tag for separation and purification so as to be operable to a gene encoding the D-stereospecific amino acid amidase of the present invention Encoding genes can be linked. At this time, GST, poly-Arg, FLAG, His-tag and c-myc may be used singly or two or more of them may be sequentially connected.

상기 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자는 제한효소 절단위치를 통해 클로닝될 수 있으며, 상기 벡터에 단백질 절단효소 인식부위를 암호화하는 유전자가 사용된 경우에는 상기 D-입체특이적 아미노산 아미다아제의 유전자와 틀이 맞도록(in frame) 연결되어, 상기 효소를 수득한 후 단백질 절단 효소로 절단 시, 원래 형태의 D-입체특이적 아미노산 아미다아제가 생산될 수 있도록 할 수 있다.The gene encoding the D-stereospecific amino acid amidase may be cloned through a restriction enzyme cleavage site. When a gene encoding the protein cleavage enzyme recognition site is used in the vector, the D-stereospecific amino acid Amidase in a frame so as to be in frame with the gene of the amidase to obtain the enzyme and cleave with the protein cleaving enzyme so that the original form of the D-stereospecific amino acid amidase can be produced.

본 발명의 구체적인 실시예에서는, 본 발명의 D-입체특이적 아미노산 아미다아제 유전자를 플라스미드 벡터인 pET28a(+)에 삽입함으로써 재조합 클로닝 벡터를 제조하였다. 상기의 클로닝 벡터의 제조에 이용된 pET28a(+) 이외에도 다양한 원핵세포용 벡터 또는 진핵세포용(pPIC 및 pPICZ 등) 벡터가 알려져 있으므로 발현의 목적에 따라 상기 벡터 이외의 다양한 발현 벡터를 이용할 수 있다.In a specific example of the present invention, a recombinant cloning vector was prepared by inserting the D-stereospecific amino acid amidase gene of the present invention into a plasmid vector pET28a (+). Various vectors for prokaryotic cells or eukaryotic cells (such as pPIC and pPICZ) are known in addition to pET28a (+) used in the production of the above cloning vector. Therefore, various expression vectors other than the above vectors may be used depending on the purpose of expression.

본 발명의 상기 재조합 발현 벡터는 D-입체특이적 아미노산 아미다아제 유전자가 포함되어 있어 이를 생산할 수 있는 벡터로서 유용하게 이용될 수 있다.The recombinant expression vector of the present invention contains a D-stereospecific amino acid amidase gene and can be used as a vector capable of producing the same.

또한, 본 발명의 형질전환체에는 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자를 포함하는 재조합 발현 벡터가 도입된다.In addition, a recombinant expression vector containing a gene encoding D-stereospecific amino acid amidase is introduced into the transformant of the present invention.

본 발명에 따른 상기 재조합 발현 벡터를 발현 목적에 따라 박테리아, 효모, 대장균, 진균류, 식물 세포 및 동물 세포로 구성된 군으로부터 선택되는 어느 하나의 적절한 숙주 세포에 형질 전환시킴으로써 형질전환체를 제조할 수 있다. 예컨대, 상기 숙주 세포는 대장균(E. coli BL21(DE3), DH5α등) 또는 효모 세포 (Saccharomyces 속, Pichia 속 등) 등 일 수 있다. 이때, 숙주 세포의 종류에 따라 적절한 배양 방법 및 배지 조건 등은 당해 분야의 공지 기술로부터 당업자가 용이하게 선택할 수 있다. The recombinant expression vector according to the present invention can be transformed into any suitable host cell selected from the group consisting of bacteria, yeast, E. coli, fungi, plant cells and animal cells according to the purpose of expression, . For example, the host cell may be Escherichia coli ( E. coli BL21 (DE3), DH5α, etc.) or yeast cell ( Saccharomyces sp., Pichia sp. At this time, a suitable culture method and medium conditions depending on the kind of the host cell can be easily selected by those skilled in the art from the known art.

본 발명의 형질전환체의 제조를 위한 재조합 발현 벡터의 도입 방법은 공지의 기술, 즉 열 충격법, 전기충격법 등을 사용할 수 있다.As a method of introducing the recombinant expression vector for the production of the transformant of the present invention, known techniques such as heat shock method, electric shock method and the like can be used.

본 발명의 구체적인 실시예에서, 대장균을 숙주 세포로 하여 본 발명의 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자를 포함하는 재조합 발현 벡터를 대장균에 형질 전환시켜 형질전환체를 제조하였다.In a specific example of the present invention, Escherichia coli was transformed with Escherichia coli as a host cell and a recombinant expression vector containing a gene encoding the D-stereospecific amino acid amidase of the present invention was transformed into a transformant.

상기 형질전환체로부터 발현된 단백질은 D-입체특이적 아미노산 아미다아제는 효소 활성을 가지는 신규한 서열의 단백질이므로, 상기 형질전환체를 대량 배양하여 상기 유전자를 발현시킴으로써 상기 D-입체특이적 아미노산 아미다아제의 대량생산을 용이하게 할 수 있다. Since the D-stereospecific amino acid amidase is a novel sequence protein having an enzyme activity, the protein expressed from the transformant can be produced by mass-culturing the transformant and expressing the D-stereospecific amino acid Mass production of amidase can be facilitated.

3.  3. D-입체특이적 아미노산 아미다아제의 생산 방법Production method of D-stereospecific amino acid amidase

아울러, 본 발명의 또 다른 측면은 본 발명의 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자를 포함하는 재조합 발현 벡터가 도입된 형질전환체를 이용하여 D-입체특이적 아미노산 아미다아제를 생산하는 방법을 제공한다.In another aspect of the present invention, a transformant into which a recombinant expression vector containing a gene encoding the D-stereospecific amino acid amidase of the present invention is introduced is used to transform D-stereospecific amino acid amidase Provides a method of production.

본 발명의 D-입체특이적 아미노산 아미다아제 생산 방법은 1) 본 발명의 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자를 포함하는 재조합 발현 벡터가 도입된 형질전환체를 배양하는 단계; 2) 상기 단계 1)에서 배양된 형질전환체에서 상기 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자의 발현을 유도하는 단계; 및 3) 상기 단계 2)에서 D-입체특이적 아미노산 아미다아제 유전자의 발현이 유도된 형질전환체의 배양물로부터 D-입체특이적 아미노산 아미다아제를 분리하는 단계;를 포함한다. The D-stereospecific amino acid amidase production method of the present invention comprises the steps of: 1) culturing a transformant into which a recombinant expression vector containing a gene encoding the D-stereospecific amino acid amidase of the present invention is introduced; 2) inducing the expression of the gene encoding the D-stereospecific amino acid amidase in the transformant cultured in the step 1); And 3) separating the D-stereospecific amino acid amidase from the culture of the transformant in which the expression of the D-stereospecific amino acid amidase gene is induced in the step 2).

상기 단계 1)의 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자의 N-말단에는 분리정제용 태그를 암호화하는 유전자 또는 단백질 절단효소 절단위치가 추가로 연결될 수 있고, 이로 인해 재조합 D-입체특이적 아미노산 아미다아제의 정제 또는 원래 형태의 D-입체특이적 아미노산 아미다아제의 수득이 가능할 수 있다.A gene coding for a tag for separation and purification or a site for cleaving a protein cleavage enzyme may be additionally linked to the N-terminus of the gene encoding the D-stereospecific amino acid amidase of the step 1), and the recombinant D- It may be possible to purify the specific amino acid amidase or to obtain the original form of the D-stereospecific amino acid amidase.

상기 단계 1)의 형질전환체의 배양은 공지된 방법에 따라서 수행될 수 있고, 배양 온도, 배양 시간 및 배지의 pH 등의 조건은 적절하게 조절될 수 있다. 또한, 배양 방법에는 회분식 배양(batch culture), 연속식 배양(continuous culture) 및 유가식 배양(fed-batch culture)이 포함될 수 있다. 사용되는 배양 배지는 특정한 균주의 요구 조건을 적절하게 충족시켜야 한다. The cultivation of the transformant in the above step 1) can be carried out according to a known method, and the conditions such as the culture temperature, the culture time and the pH of the culture medium can be appropriately controlled. In addition, the culture method may include a batch culture, a continuous culture, and a fed-batch culture. The culture medium used should suitably meet the requirements of a particular strain.

상기 단계 3)의 상기 배양에 의해 생성된 배양물로부터 D-입체특이적 아미노산 아미다아제의 분리는 원심분리, 여과 등 당해 분야에서 통상적으로 수행되는 방법을 실시할 수 있다. 또한, 상기 방법으로 분리된 D-입체특이적 아미노산 아미다아제는 통상의 방식으로 정제될 수 있으며, 예를 들어, 염석(예를 들어 황산암모늄 침전, 인산나트륨 침전), 용매 침전(아세톤, 에탄올 등을 이용한 단백질 분획 침전), 투석, 겔 여과, 이온 교환, 역상 칼럼 크로마토그래피와 같은 크로마토그래피 및 한외여과 등의 기법을 단독 또는 조합하여 본 발명의 효소를 정제할 수 있다.Separation of the D-stereospecific amino acid amidase from the culture produced by the above-mentioned culture in the step 3) can be carried out by a conventional method such as centrifugation, filtration and the like. Further, the D-stereospecific amino acid amidase separated by the above method can be purified in a conventional manner, for example, by salting out (for example, ammonium sulfate precipitation, sodium phosphate precipitation), solvent precipitation (acetone, ethanol Or the like), dialysis, gel filtration, ion exchange, reverse phase column chromatography, and ultrafiltration, can be used alone or in combination to purify the enzyme of the present invention.

본 발명이 구체적인 실시예에서는 상기와 같이 정제된 서열번호 1의 아미노산 서열을 갖는 단백질이 D-입체특이적 아미노산 아미다아제의 활성을 나타냄을 확인하였다(도 2 참고). 상기와 같은 결과로부터, 본 발명의 생산 방법에 따라 D-입체특이적 아미노산 아미다아제의 대량 생산이 가능함을 알 수 있다.In a specific example of the present invention, it was confirmed that the protein having the amino acid sequence of SEQ ID NO: 1 purified as described above shows activity of D-stereospecific amino acid amidase (see FIG. 2). From the above results, it can be seen that the D-stereospecific amino acid amidase can be mass-produced according to the production method of the present invention.

4.  4. D-아미노산의 생산 방법 및 D-아미노산 생산용 조성물Method for producing D-amino acid and composition for producing D-amino acid

본 발명의 또 다른 측면은 본 발명의 D-입체특이적 아미노산 아미다아제를 이용하여 아미노산 아미드로부터 D-아미노산을 인 비트로(in vitro)에서 생산하는 방법 및 인 비트로(in vitro)에서 D-아미노산의 생산에 이용되는 D-아미노산 생산용 조성물을 제공한다.Another aspect of the present invention is a method for producing D-amino acid in vitro from an amino acid amide using the D-stereospecific amino acid amidase of the present invention and a method for producing D-amino acid in vitro , Amino acid composition for production of D-amino acid.

본 발명의 D-아미노산 생산용 조성물은 본 발명의 D-입체특이적 아미노산 아미다아제를 포함한다.The composition for D-amino acid production of the present invention includes the D-stereospecific amino acid amidase of the present invention.

또한, 본 발명의 D-아미노산의 인 비트로(in vitro) 생산 방법은 1) 본 발명의 D-입체특이적 아미노산 아미다아제를 아미노산 아미드와 반응시키는 단계; 및 2) 상기 단계 1)에서의 반응 결과 생성된 반응 생성물로부터 D-아미노산을 회수하는 단계를 포함한다.In addition, the in vitro production method of the D-amino acid of the present invention comprises the steps of 1) reacting the D-stereospecific amino acid amidase of the present invention with an amino acid amide; And 2) recovering the D-amino acid from the reaction product resulting from the reaction in step 1).

상기 D-아미노산의 생산 방법 및 D-아미노산 생산용 조성물은 인 비트로(in vitro)에서 본 발명의 D-입체특이적 아미노산 아미다아제의 효소 활성을 이용하는 것이므로, 상기 D-입체특이적 아미노산 아미다아제를 이용하여 그 기질인 아미노산 아미드로부터 D-아미노산을 생성하는 것이다.Since the method for producing the D-amino acid and the composition for producing the D-amino acid use the enzyme activity of the D-stereospecific amino acid amidase of the present invention in vitro , the D-stereospecific amino acid amide Amino acid is produced from the amino acid amide, which is a substrate thereof, by using an enzyme.

상기 단계 1)의 반응은 40℃ 내지 70℃의 온도 범위, 바람직하게는 45℃ 내지 65℃의 온도 범위, 더욱 바람직하게는 50℃ 내지 65℃의 온도에서 수행될 수 있으나, 이에 한정되지 아니한다. 또한, 상기 단계 1)의 반응은 7 내지 12의 pH 범위, 바람직하게는 8 내지 11의 pH 범위, 더욱 바람직하게는 9 내지 10의 pH에서 수행될 수 있으나, 이에 한정되지 아니한다.The reaction of the step 1) may be carried out at a temperature of 40 ° C to 70 ° C, preferably at a temperature of 45 ° C to 65 ° C, more preferably at a temperature of 50 ° C to 65 ° C, but is not limited thereto. In addition, the reaction of the above step 1) may be carried out at a pH of 7 to 12, preferably at a pH of 8 to 11, more preferably at a pH of 9 to 10, but is not limited thereto.

또한, 상기 단계 1)의 반응에는 상기 D-입체특이적 아미노산 아미다아제의 활성을 향상시키기 위해 상기 D-입체특이적 아미노산 아미다아제와 함께 금속 양이온이 함께 포함될 수 있다. 상기 금속 양이온은 2가 금속 양이온일 수 있고, 상기 2가 금속 양이온은 망간 양이온 또는 코발트 양이온 등일 수 있고, 코발트 양이온인 것이 바람직하다.The reaction of step 1) may include a metal cation together with the D-stereospecific amino acid amidase to improve the activity of the D-stereospecific amino acid amidase. The metal cation may be a divalent metal cation, and the divalent metal cation may be a manganese cation or a cobalt cation, and is preferably a cobalt cation.

상기 단계 1)의 반응에서, 상기 아미노산 아미드는 외부에서 주입되는 것이 바람직하고, 상기 아미노산 아미드는 목적하는 D-아미노산의 양에 맞추어 충분한 양이 주입되어야 한다. 또한, 상기 아미노산 아미드의 주입은 연속적으로 수행될 수 있다. 특히 상기 아미노산 아미드가 연속적으로 주입되는 경우, 상기 D-입체특이적 아미노산 아미다아제에 의하여 D-아미노산을 지속적으로 생성할 수 있다.In the reaction of step 1), the amino acid amide is preferably injected from the outside, and the amino acid amide should be injected in a sufficient amount in accordance with the desired amount of D-amino acid. In addition, the injection of the amino acid amide can be carried out continuously. In particular, when the amino acid amide is continuously injected, the D-amino acid can be continuously produced by the D-stereospecific amino acid amidase.

본 발명의 구체적인 실시예에서는 상기와 같은 D-입체특이적 아미노산 아미다아제에 의하여 아미노산 아미드로부터 D-아미노산이 생산됨을 확인하였고(도 2 참조), 이러한 D-입체특이적 아미노산 아미다아제의 효소 활성이, 코발트 양이온의 첨가에 의해, 55℃에 가까운 온도에서 반응을 수행할수록, 9.5에 가까운 pH에서 반응을 수행할수록 더욱 향상됨을 확인하였다(도 3 내지 도 5 참고).In a specific example of the present invention, it was confirmed that a D-amino acid was produced from an amino acid amide by the D-stereospecific amino acid amidase as described above (refer to FIG. 2), and the enzyme of the D-stereospecific amino acid amidase The activity was further improved by the addition of the cobalt cation, as the reaction was performed at a temperature close to 55 ° C and the reaction was performed at a pH close to 9.5 (see FIGS. 3 to 5).

본 발명의 또 다른 측면은 본 발명의 형질전환체를 이용하여 D-아미노산을 인 비보(in vivo)에서 생산하는 방법을 제공한다.Another aspect of the present invention provides a method for producing D-amino acid in vivo using the transformant of the present invention.

또한, 본 발명의 D-아미노산의 인 비보(in vivo) 생산 방법은 1) 상기 형질전환체를 아미노산 아미드가 공급되는 환경 하에서 배양하는 단계; 및 2) 상기 단계 1)에서의 배양물로부터 D-아미노산을 회수하는 단계;를 포함한다.In addition, the in vivo production method of the D-amino acid of the present invention comprises 1) culturing the transformant in an environment in which amino acid amide is supplied; And 2) recovering the D-amino acid from the culture in step 1).

상기 아미노산 아미드가 공급되는 환경은 외부에서 인위적으로 아미노산 아미드를 공급해 주거나 배양에 이용되는 배지 내에 아미노산 아미드를 첨가하여 함께 공급해 주는 것일 수도 있고, 상기 아미노산 아미드가 생산되는 환경을 제공해 주는 것일 수도 있다. 상기 아미노산 아미드가 생성되는 환경은 상기 아미노산 아미드의 생산에 관여하는 적어도 하나의 효소를 암호화하는 유전자들을 함께 형질전환시킴으로써 제공될 수 있다.The environment in which the amino acid amide is supplied may be one in which the amino acid amide is supplied from the outside, or the amino acid amide is added to the medium used for the culture, or the environment may be provided in which the amino acid amide is produced. The environment in which the amino acid amide is produced may be provided by transforming genes encoding at least one enzyme involved in the production of the amino acid amide.

상기와 같은 형질전환체의 배양은 본 기술 분야에 알려진 적당한 배지와 배양 조건에 따라 이루어질 수 있다. 통상의 기술자라면 선택되는 형질전환체의 숙주세포의 종류에 따라 배지 및 배양조건을 용이하게 조정하여 사용할 수 있다. 배양 방법은 회분식, 연속식, 유가식, 또는 이들의 조합 배양을 포함할 수 있다.Culturing of such transformants may be carried out according to appropriate culture media and culture conditions known in the art. As long as it is conventional, the medium and culture conditions can be easily adjusted depending on the type of the host cell of the transformant to be selected. The culture method may include batch, continuous, fed-batch, or combination culture thereof.

상기 배지는 다양한 탄소원, 질소원 및 미량원소 성분을 포함할 수 있다.The medium may comprise various carbon sources, nitrogen sources and trace element components.

상기 탄소원은, 예를 들면, 포도당, 자당, 유당, 과당, 말토오스, 전분, 셀룰로오스와 같은 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유와 같은 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤 및 에탄올과 같은 알코올, 아세트산과 같은 유기산, 또는 이들의 조합을 포함할 수 있다. 상기 배양은 글루코스를 탄소원으로 하여 수행될 수 있다. 상기 질소원은, 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액(CSL), 및 대두밀과 같은 유기 질소원 및 요소, 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄과 같은 무기 질소원, 또는 이들의 조합을 포함할 수 있다. 상기 배지는 인의 공급원으로서, 예를 들면, 인산이수소칼륨, 인산수소이칼륨 및 상응하는 소듐-함유 염, 황산마그네슘 또는 황산철과 같은 금속염을 포함할 수 있다.The carbon source may be selected from, for example, carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose, fats such as soybean oil, sunflower oil, castor oil, coconut oil, fatty acids such as palmitic acid, stearic acid, linoleic acid, Alcohols such as glycerol and ethanol, organic acids such as acetic acid, or combinations thereof. The culture may be performed with glucose as a carbon source. The nitrogen source may be an organic nitrogen source such as peptone, yeast extract, gravy, malt extract, corn steep liquor (CSL) and soybean wheat and an inorganic nitrogen source such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, And combinations of these. The medium can include, for example, metal salts such as potassium dihydrogenphosphate, dipotassium hydrogenphosphate and the corresponding sodium-containing salts, magnesium sulfate or iron sulfate as a source of phosphorus.

또한, 아미노산, 비타민, 및 적절한 전구체 등이 배지에 포함될 수 있다. 상기 배지 또는 개별 성분은 배양액에 회분식 또는 연속식으로 첨가될 수 있다.In addition, amino acids, vitamins, and suitable precursors and the like may be included in the medium. The medium or the individual components may be added to the culture medium batchwise or continuously.

또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다.In addition, bubble formation can be suppressed by using a defoaming agent such as fatty acid polyglycol ester during the culture.

상기와 같은 형질전환체의 배양은 20℃ 내지 50℃에서 수행될 수 있고, 바람직하게는 25℃ 내지 45℃, 보다 바람직하게는 30℃ 내지 40℃에서 수행될 수 있다. 상기 형질전환체의 배양이 20℃ 미만 또는 50℃ 초과의 온도 범위에서 수행될 경우 충분한 양의 중간 생성물이 생성되지 않아, 결국 최종 생산물인 D-아미노산의 생성량 또는 충분해지지 못하는 문제가 발생하게 된다.The cultivation of such transformants can be carried out at 20 ° C to 50 ° C, preferably at 25 ° C to 45 ° C, more preferably at 30 ° C to 40 ° C. When the culture of the transformant is carried out at a temperature lower than 20 ° C or at a temperature higher than 50 ° C, a sufficient amount of an intermediate product is not produced, resulting in an amount of D-amino acid or an unsatisfactory result.

또한, 상기와 같은 형질전환체의 배양은 pH 5 내지 pH 8에서 수행될 수 있고, 바람직하게는 pH 6 내지 pH 7에서, 더욱 바람직하게는 pH 6.3 내지 pH 6.7에서 수행될 수 있으나, 이에 한정하지 아니한다. 상기와 같은 형질전환체의 배양 pH 조건은 형질전환체의 배양 배지에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 첨가함으로써 조정할 수 있다. 형질전환체의 배양 pH 조건이 상기 범위를 벗어나는 경우 형질전환체의 생장하기 어렵기 때문에 D-아미노산의 발현이 용이하지 않아 D-아미노산의 합성이 효율적으로 이루어지지 않는 문제점이 있다.The cultivation of such a transformant may be carried out at a pH of 5 to 8, preferably at a pH of 6 to 7, more preferably at a pH of 6.3 to 6.7, but is not limited thereto No. The culture pH conditions of such transformants can be adjusted by adding a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the culture medium of the transformant. When the culture pH of the transformant is outside the above range, the transformant is difficult to grow, so that the expression of D-amino acid is not easy and synthesis of D-amino acid is not efficiently performed.

이하, 본 발명을 실시예에 의하여 상세히 설명한다.Hereinafter, the present invention will be described in detail with reference to examples.

단, 하기 실시예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 하기 실시예에 의해 한정되지 아니한다.However, the following examples illustrate the present invention in detail, and the present invention is not limited by the following examples.

서열번호 1의 아미노산 서열을 갖는 단백질의 분리Separation of the protein having the amino acid sequence of SEQ ID NO: 1

[1-1] [1-1] 서열번호 1의 아미노산 서열을 갖는 단백질의 A protein having the amino acid sequence of SEQ ID NO: 1 클로닝Cloning 및 형질전환 And transformation

바실러스 메가테리움(Bacillus megaterium)에서 유래한 서열번호 1의 아미노산 서열을 갖는 단백질을 얻기 위하여, 서열번호 2의 염기 서열을 기초로, 다음 표 1과 같이 서열번호 3 내지 6의 프라이머를 각각 설계하였다.In order to obtain a protein having the amino acid sequence of SEQ ID NO: 1 derived from Bacillus megaterium , the primers of SEQ ID NOS: 3 to 6 were respectively designed based on the nucleotide sequence of SEQ ID NO: 2 as shown in the following Table 1 .

서열번호SEQ ID NO: 프라이머primer 쌍 pair 서열(5'->3Sequences (5 '-> 3 ')') 33 정방향 프라이머Forward primer 5'-tggtgccgcgcggcagccatatgaaactatatctgtcggt-3'5'-tggtgccgcgcggcagccatatgaaactatatctgtcggt-3 ' 44 역방향 프라이머Reverse primer 5'-tggtggtggtggtgctcgagctaacagaatgttgtgcgcg-3'5'-tggtggtggtggtgctcgagctaacagaatgttgtgcgcg-3 ' 55 정방향 프라이머Forward primer 5'-cgcgcacaacattctgttagctcgagcaccaccaccacca-3'5'-cgcgcacaacattctgttagctcgagcaccaccaccacca-3 ' 66 역방향 프라이머Reverse primer 5'-accgacagatatagtttcatatggctgccgcgcggcacca-3'5'-accgacagatatagtttcatatggctgccgcgcggcacca-3 '

㈜바이오니아에 의뢰하여 서열번호 2의 염기 서열의 유전자를 합성하였고, 상기 합성된 유전자를 주형으로 하여 상기와 같이 설계된 서열번호 3, 4의 프라이머 쌍을 이용하여 PCR을 수행함으로써, 상기 서열번호 2의 염기 서열을 증폭하였다. Gibson assembly (New England Biolabs, 미국)를 이용하여 상기와 같이 증폭된 서열번호 2의 염기 서열을 포함하는 PCR 산물을, 서열번호 5, 6의 프라이머 쌍을 이용하여 증폭한 플라스미드 벡터 pET28a(+) (Novagen, 미국)와 깁슨 어셈블리 (Gibson assemably, NEB)기법을 이용하여 클로닝을 진행하였고, 염기 서열 분석(sequencing)(㈜마크로젠)을 통해 상기 서열번호 2의 염기 서열이 제대로 삽입되었음을 확인하였으며, 이를 대장균 ER2566 균주(Novagen, 미국)에 형질전환하였다. 상기와 같이 얻어진 형질전환체는 이용하기 전에 20% 글리세린 용액을 첨가하여 냉동 보관하였다.The gene of the nucleotide sequence of SEQ ID NO: 2 was synthesized with the request of Bioneer Inc. and PCR was performed using the synthesized gene as a template and primer pairs of SEQ ID NOS: 3 and 4 designed as above, The nucleotide sequence was amplified. A PCR product containing the nucleotide sequence of SEQ ID NO: 2 amplified as described above was amplified using the Gibson assembly (New England Biolabs, USA) and the plasmid vector pET28a (+) (SEQ ID NO: Novagen, USA) and Gibson assemably (NEB) technique, and the nucleotide sequence of SEQ ID NO: 2 was correctly inserted through sequencing (Macrogen Co., Ltd.) 0.0 > ER2566 < / RTI > strain (Novagen, USA). The transformant thus obtained was added with a 20% glycerin solution and stored frozen before use.

[1-2] [1-2] 서열번호 1의 아미노산 서열을 갖는 단백질의 과발현 및 정제Over-expression and purification of a protein having the amino acid sequence of SEQ ID NO: 1

상기 실시예 [1-1]에서 냉동 보관된 형질전환체를 5㎖의 LB 배지가 포함된 시험관(test tube)에 접종하고 600㎚에서 흡광도가 2.0이 될 때까지 37℃의 진탕 배양기로 종균 배양을 실시하였다. 그런 다음, 상기 종균 배양된 배양액을 500㎖의 LB 배지가 포함된 2000㎖ 플라스크에 첨가하여 본 배양을 실시하였고, 600㎚에서의 흡광도가 0.6이 될 때 최종 농도 0.1mM이 되도록 IPTG(isopropyl-1-thio-β-D-galactopyranoside)를 첨가하여 상기 서열번호 1의 아미노산 서열을 갖는 단백질의 과발현을 유도하였다. 상기와 같이 서열번호 1의 아미노산 서열을 갖는 단백질의 과발현을 유도하는 과정에서, 교반 속도는 200 rpm이, 배양 온도는 37℃가 유지되도록 조정하였고, IPTG를 첨가 후에는 교반 속도를 150 rpm으로, 배양 온도를 16℃로 조정하여 16시간 동안 배양하였다.In the above Example [1-1], the frozen transformants were inoculated into a test tube containing 5 ml of LB medium and cultured at 37 ° C in a shaking incubator at 600 nm until the absorbance reached 2.0. Respectively. Then, the cultured medium was added to a 2000-ml flask containing 500 ml of LB medium to effect culturing. When the absorbance at 600 nm was 0.6, IPTG (isopropyl-1 -thio- [beta] -D-galactopyranoside) was added to induce over-expression of the protein having the amino acid sequence of SEQ ID NO: 1. In the course of inducing the overexpression of the protein having the amino acid sequence of SEQ ID NO: 1, the agitation speed was 200 rpm and the incubation temperature was maintained at 37 ° C. After the addition of IPTG, the agitation speed was 150 rpm, The culture temperature was adjusted to 16 캜 and cultured for 16 hours.

또한, 상기와 같이 서열번호 1의 아미노산 서열을 갖는 단백질의 과발현이 유도된 형질전환체의 배양액을 4℃에서 4000rpm으로 20분 동안 원심분리하고, 상등액을 분리해 낸 펠렛에 50mM의 제1인산나트륨(NaHPO4), 300mM의 NaCl, 10mM의 이미다졸(immidazole) 및 0.1mM의 PMSF(phenylmethylsulfonyl fluoride, 단백질분해효소 저해제)를 첨가하고, 소니케이션(sonication) 방법으로 세포를 파쇄함으로써, 형질전환체의 세포 용해물(cell lysate)를 수득하였다.Also, as described above, the culture of the transformant in which the over-expression of the protein having the amino acid sequence of SEQ ID NO: 1 was induced was centrifuged at 4000 rpm for 20 minutes at 4 DEG C, and the supernatant was separated, and 50 mM sodium phosphate monobasic (NaHPO 4 ), 300 mM NaCl, 10 mM imidazole, and 0.1 mM PMSF (phenylmethylsulfonyl fluoride, protease inhibitor), and the cells were disrupted by the sonication method to obtain a transformant Cell lysate was obtained.

상기와 같이 수득된 세포 용해물을 4℃에서 14000rpm으로 20분 동안 다시 원심분리하여 상층액을 수득하였고, IMAC Kit His tag 흡착 컬럼(Bio-Rad Laboratories, 미국)이 장착된 고속 단백질 액체 크로마토그라피(Fast Protein Liquid Chromatography)(Bio-Rad Laboratories, 미국)를 이용하여 상기와 같이 수득된 상층액으로부터 과발현된 서열번호 1의 아미노산 서열을 갖는 단백질을 분리하였다.The cell lysate thus obtained was further centrifuged at 14,000 rpm for 20 minutes at 4 DEG C to obtain a supernatant, and IMAC Kit (SEQ ID NO: 1) overexpressed from the supernatant obtained as described above using Fast Protein Liquid Chromatography (Bio-Rad Laboratories, USA) equipped with a His tag adsorption column (Bio-Rad Laboratories, Of the protein having the amino acid sequence of SEQ ID NO.

이렇게 분리된 단백질을 SDS-PAGE를 통해 확인한 결과, 상기와 같은 일련의 과정에 의하여 His-Tag이 붙어 있는 65 kDa의 서열번호 1의 아미노산 서열을 갖는 단백질이 과발현되고, 형질전환체의 세포 용해물로부터 정제 및 분리되었음을 확인하였다(도 1).The thus isolated protein was confirmed by SDS-PAGE. As a result, the protein having the amino acid sequence of SEQ ID NO: 1 of 65 kDa with His-Tag attached thereto was overexpressed by the above-mentioned series of procedures and the cell lysate (Fig. 1). ≪ tb > < TABLE >

서열번호 1의 아미노산 서열을 갖는 단백질의 활성 확인Identification of the activity of a protein having the amino acid sequence of SEQ ID NO: 1

본 발명자들은 상기 서열번호 1의 아미노산 서열을 갖는 단백질이 하기 반응식과 같은 'D-입체특이적 아미노산 아미다아제'로서의 활성을 가질 것으로 예상하고, 이를 확인하였다.The present inventors anticipated that the protein having the amino acid sequence of SEQ ID NO: 1 would have activity as 'D-stereospecific amino acid amidase' as shown in the following reaction formula, and confirmed this.

[반응식][Reaction Scheme]

Figure pat00002
Figure pat00002

구체적으로, 상기 실시예 [1-2]에서 정제 및 분리한 서열번호 1의 아미노산 서열을 갖는 단백질 2㎎/㎖와 10mM의 트레오닌 아미드를 50mM의 CHES 완충용액(pH 9.5)에 첨가하고, 55℃에서 반응시키면서 시간별로 샘플링하여 생성된 D-트레오닌의 양을 측정하였다.Specifically, 2 mg / ml of the protein having the amino acid sequence of SEQ ID NO: 1 purified and isolated in the above Example [1-2] and 10 mM threonamide were added to 50 mM CHES buffer solution (pH 9.5) And the amount of D-threonine produced by the sampling was measured.

상기 생성된 D-아미노산은 OPA/NAC 전처리(OPA/NAC derivatization)한 후 HPLC를 통해 분석하였다. 상기 전처리 과정은 8㎎의 OPA(o-phthalaldelhyde)와 10㎎의 NAC(N-acetylcysteine)를 1㎖의 메탄올에 녹여 OPA/NAC 용액을 만들고, 25㎕의 분석할 샘플을 50㎕의 OPA/NAC 용액 및 0.4M의 붕산나트륨 완충용액(sodium borate buffer)(pH10.4)에 넣고 0.2㎛ 필터로 필터링하여 전처리된 샘플을 준비하였다. 이때 상기 D-아미노산 농도의 측정은 LC-UV 검출기 및 Eclipse XDB-C18 column (Agilent) 칼럼이 장착된 고압 액체 크로마토그래피를 실시하였으며, 상기 Eclipse XDB-C18 column (Agilent) 칼럼은 25℃에서 0.5 ㎖/분 속도로 methanol/50mM sodium acetate (pH5.9) (30:70 v/v)을 3분동안 흘려주고, methanol 을 70%까지 6분동안 순차적으로 통과시키도록 하였다. 생성된 D-트레오닌을 정량화하기 위해 시판되는 D-트레오닌(Sigma-Aldrich, 미국)을 스탠다드로 사용하였다.The resulting D-amino acids were analyzed by HPLC after OPA / NAC derivatization (OPA / NAC derivatization). In the pretreatment, OPA / NAC solution was prepared by dissolving 8 mg of OPA ( o- phthalaldehyde) and 10 mg of NAC ( N- acetylcysteine) in 1 ml of methanol, and 25 μl of sample to be analyzed was added to 50 μl of OPA / NAC Solution and 0.4 M sodium borate buffer (pH 10.4), and the mixture was filtered with a 0.2 탆 filter to prepare a pretreated sample. The D-amino acid concentration was measured by high-pressure liquid chromatography equipped with an LC-UV detector and an Eclipse XDB-C18 column (Agilent) column. The Eclipse XDB-C18 column (Agilent) (30:70 v / v) for 3 minutes and methanol to 70% for 6 minutes. Commercially available D-threonine (Sigma-Aldrich, USA) was used as a standard to quantify the D-threonine produced.

그 결과, 10mM의 트레오닌 아미드가 160분 시점에 D-트레오닌으로 100% 전환됨을 확인하였고(도 2 참고), 반응액에 존재하지 않았던 D-트레오닌이 위 반응 결과 생성된 결과로부터 상기 실시예 [1-2]에서 정제 및 분리한 서열번호 1의 아미노산 서열을 갖는 단백질이 아미노산 아미드를 D-아미노산으로 변환시키는, D-입체특이적 아미노산 아미다아제로서의 활성을 가짐을 확인하였다.As a result, it was confirmed that 10 mM threonamide was 100% converted to D-threonine at 160 minutes (see FIG. 2), and D-threonine, which was not present in the reaction solution, -2], the protein having the amino acid sequence of SEQ ID NO: 1 has an activity as a D-stereospecific amino acid amidase which converts an amino acid amide to a D-amino acid.

서열번호 1의 아미노산 서열을 갖는 단백질의 효소 활성에 영향을 미치는 조건에 관한 연구A Study on the Conditions Affecting the Enzyme Activity of the Protein Having the Amino Acid Sequence of SEQ ID NO: 1

본 발명자들은, 상기 실시예 2에서 확인된 바와 같이, 서열번호 1의 아미노산 서열을 갖는 단백질이 D-입체특이적 아미노산 아미다아제로서 작용함에 그 활성에 영향을 미치는 조건들에 대하여 연구를 진행하였고, 그로부터 상기 서열번호 1의 아미노산 서열을 갖는 단백질의 최적 활성 조건을 도출하였다.The inventors of the present invention studied the conditions that affect the activity of a protein having the amino acid sequence of SEQ ID NO: 1 as a D-stereospecific amino acid amidase, as confirmed in Example 2 above , From which the optimal activity conditions of the protein having the amino acid sequence of SEQ ID NO: 1 were derived.

[3-1] [3-1] 금속 양이온의 영향Effect of Metal Cations

상기 서열번호 1의 아미노산 서열을 갖는 단백질의 효소의 활성에 금속 양이온의 종류가 미치는 영향을 확인하기 위하여, 상기 실시예 [1-2]에서 정제 및 분리한 서열번호 1의 아미노산 서열을 갖는 단백질 0.005㎎/㎖와 트레오닌 아미드 1mM을 50 mM의 CHES 완충용액(pH 9.5)에 10mM의 EDTA 또는 금속 양이온(Mn2 +, Mg2 +, Co2+, Zn2 +)과 함께 첨가하여 55℃에서 10분 동안 반응시키고, 상기 반응을 종료시키기 위해 100℃에서 10분 동안 중탕하였다. 그리고 상기 실시예 2에서와 같은 방법으로, 상기와 같이 반응이 종료된 완충 용액에서 트레오닌 아미드와 D-트레오닌의 농도를 측정하여 그 상대값을 비교하였다.In order to confirm the effect of the kind of the metal cation on the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 1, the protein having the amino acid sequence of SEQ ID NO: 1 purified and isolated in Example [1-2] ㎎ / ㎖ and the threonine amide 1mM in 50 mM CHES buffer solution of 10mM of EDTA or a metal cation (pH 9.5) 55 ℃ added with (Mn 2 +, Mg 2 + , Co 2+, Zn 2 +) 10 Min, and the mixture was stirred at 100 DEG C for 10 minutes to terminate the reaction. In the same manner as in Example 2, the concentration of threonine amide and D-threonine was measured in the buffer solution, and the relative values were compared.

그 결과, 여러 종류의 금속 양이온 중 코발트 양이온과 망간 양이온이 첨가된 경우에 D-입체특이적 아미노산 아미다아제의 활성이 향상되었고, 그 중에서도 코발트 양이온을 이용한 경우에 D-입체특이적 아미노산 아미다아제의 활성이 가장 우수한 것으로 확인되었다(도 3의 (A)).As a result, the activity of D - stereospecific amino acid amidase was improved when cobalt cation and manganese cation were added in various kinds of metal cations. Among them, D - stereospecific amino acid amide It was confirmed that the activity of the enzyme was the most excellent (Fig. 3 (A)).

상기 서열번호 1의 아미노산 서열을 갖는 단백질의 효소의 활성에 금속 양이온의 농도가 미치는 영향을 확인하기 위하여, 상기 실시예 [1-2]에서 정제 및 분리한 서열번호 1의 아미노산 서열을 갖는 단백질 0.005㎎/㎖와 트레오닌 아미드 1mM을 50mM의 CHES 완충용액(pH 9.5)에 코발트 양이온을 0mM, 0.1mM, 0.25mM, 0.5mM, 1mM, 2.5mM 및 5mM의 함량으로 각각 첨가하여 55 ℃에서 10분 동안 반응시키고, 상기 반응을 종료시키기 위해 100℃에서 10분 동안 중탕하였다. 그리고 상기 실시예 2에서와 같은 방법으로, 상기와 같이 반응이 종료된 완충 용액에서 트레오닌 아미드와 D-트레오닌의 농도를 측정하여 그 상대값을 비교하였다.In order to confirm the influence of the metal cation concentration on the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 1, the protein having the amino acid sequence of SEQ ID NO: 1 purified and isolated in Example [1-2] 0.1 mM, 0.25 mM, 0.5 mM, 1 mM, 2.5 mM and 5 mM, respectively, in a 50 mM CHES buffer solution (pH 9.5) of 1 mg / ml and threonine amide at 55 ° C for 10 minutes And the mixture was stirred at 100 DEG C for 10 minutes to terminate the reaction. In the same manner as in Example 2, the concentration of threonine amide and D-threonine was measured in the buffer solution, and the relative values were compared.

그 결과, 0.5mM의 코발트 양이온을 첨가할 때까지는 첨가되는 코발트 양이온의 양이 증가할수록 D-입체특이적 아미노산 아미다아제의 활성도 함께 증가하다가, 0.5mM의 코발트 양이온을 첨가한 경우에 가장 우수한 D-입체특이적 아미노산 아미다아제의 활성을 나타내었으나, 그 이상이 첨가된 경우에는 특별한 활성의 향상은 없는 것으로 확인되었다(도 3의 (B)).As a result, the activity of the D-stereospecific amino acid amidase increased with the increase of the amount of the cobalt cation added until the addition of the 0.5mM cobalt cation, and when the 0.5mM cobalt cation was added, -Specific amino acid amidase activity, but it was confirmed that the addition of more than that did not improve the specific activity (FIG. 3 (B)).

[3-2] [3-2] 온도의 영향Influence of temperature

상기 서열번호 1의 아미노산 서열을 갖는 단백질의 효소 활성에 온도가 미치는 영향을 확인하기 위하여, 상기 실시예 [1-2]에서 정제 및 분리한 서열번호 1의 아미노산 서열을 갖는 단백질 0.005㎎/㎖, 아미노산 아미드 15mM 및 코발트 양이온 50mM을 50mM의 CHES 완충용액(pH 9.5)에 첨가한 다음, 35℃ 내지 75℃의 온도에서 각각 10분 동안 반응시키고, 상기 반응을 종료시키기 위해 100℃에서 10분 동안 중탕하였다. 그리고, 상기 실시예 2에서와 같은 방법으로, 상기와 같이 반응이 종료된 완충 용액에서 트레오닌 아미드와 D-트레오닌의 농도를 측정하여 그 상대값을 비교하였다.In order to confirm the effect of the temperature on the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 1, 0.005 mg / ml of protein having the amino acid sequence of SEQ ID NO: 1 purified and isolated in Example [1-2] 15 mM of amino acid amide and 50 mM of cobalt cation were added to 50 mM CHES buffer solution (pH 9.5), and then reacted at a temperature of 35 ° C to 75 ° C for 10 minutes respectively. To terminate the reaction, Respectively. Then, the concentration of threonine amide and D-threonine in the buffer solution as described above was measured in the same manner as in Example 2, and the relative values were compared.

그 결과, 서열번호 1의 아미노산 서열을 갖는 단백질의 효소 활성은 55℃에 가까울수록 점점 우수해지는 것으로 확인되었다(도 4).As a result, it was confirmed that the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 1 became better as the temperature became closer to 55 ° C (FIG. 4).

[3-3] [3-3] pH의 영향Effect of pH

상기 서열번호 1의 아미노산 서열을 갖는 단백질의 효소 활성에 pH가 미치는 영향을 확인하기 위하여, 상기 실시예 [1-2]에서 정제 및 분리한 서열번호 1의 아미노산 서열을 갖는 단백질 0.005㎎/㎖, 아미노산 아미드 1mM 및 코발트 양이온 0.5mM을 50 mM의 각각 pH 6.5 내지 7.5의 MOPS 완충용액, pH 7.5 내지 8.0의 HEPES 완충 용액, pH 8.0 내지 8.5의 EPPS 완충 용액 및 pH 8.5 내지 10의 CHES 완충 용액에 각각 첨가하여, pH 6.5 내지 10의 범위에서 각각 반응시켰다. 상기 효소 반응은 55℃의 온도에서 10분 동안 수행한 뒤, 상기 반응을 종료시키기 위해 100℃에서 10분 동안 중탕하였다. 그리고 상기 실시예 2에서와 같은 방법으로, 상기와 같이 반응이 종료된 완충 용액에서 트레오닌 아미드와 D-트레오닌의 농도를 측정하여 그 상대값을 비교하였다.In order to confirm the effect of the pH on the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 1, 0.005 mg / ml of the protein having the amino acid sequence of SEQ ID NO: 1 purified and isolated in Example [1-2] Amino acid amide 1 mM and Cobalt cation 0.5 mM were added to 50 mM each of MOPS buffer solution of pH 6.5 to 7.5, HEPES buffer solution of pH 7.5 to 8.0, EPPS buffer solution of pH 8.0 to 8.5 and CHES buffer solution of pH 10 to 10 And the reaction was carried out in the pH range of 6.5 to 10, respectively. The enzyme reaction was carried out at a temperature of 55 캜 for 10 minutes and then boiled at 100 캜 for 10 minutes to terminate the reaction. In the same manner as in Example 2, the concentration of threonine amide and D-threonine was measured in the buffer solution, and the relative values were compared.

그 결과, 서열번호 1의 아미노산 서열을 갖는 단백질의 효소 활성은 pH가 9.5에 가까울수록 점점 우수해지는 것으로 확인되었다(도 5).As a result, it was confirmed that the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 1 became better as the pH was closer to 9.5 (FIG. 5).

서열번호 1의 아미노산 서열을 갖는 단백질의 기질 특이성 확인Identification of the substrate specificity of the protein having the amino acid sequence of SEQ ID NO: 1

상기 서열번호 1의 아미노산 서열을 갖는 단백질의 효소의 활성에 금속 양이온의 종류가 미치는 영향을 확인하기 위하여, 상기 실시예 [1-2]에서 정제 및 분리한 서열번호 1의 아미노산 서열을 갖는 단백질 0.005㎎/㎖와, 2.5mM의 트레오닌 아미드, 알라닌 아미드, 메티오닌 아미드, 발린 아미드 및 글루타민 아미드 각각을 50mM의 CHES 완충용액(pH 9.5)에 첨가한 다음, 55℃의 온도에서 각각 10분 동안 반응시키고, 상기 반응을 종료시키기 위해 100℃에서 10분 동안 중탕하였다. 그리고 상기 실시예 2에서와 같은 방법으로, 상기와 같이 반응이 종료된 완충 용액에서 D-트레오닌, D-알라닌, D-메티오닌, D-발린 및 D-글루타민의 농도를 측정하여 그 상대값을 비교하였다. In order to confirm the effect of the kind of the metal cation on the enzyme activity of the protein having the amino acid sequence of SEQ ID NO: 1, the protein having the amino acid sequence of SEQ ID NO: 1 purified and isolated in Example [1-2] And each of 2.5 mM threonamide, alanine amide, methionine amide, valine amide and glutamine amide was added to 50 mM CHES buffer solution (pH 9.5) and reacted at a temperature of 55 캜 for 10 minutes each, The reaction was stopped by boiling at 100 < 0 > C for 10 minutes to terminate the reaction. Then, the concentration of D-threonine, D-alanine, D-methionine, D-valine and D-glutamine was measured in the buffer solution as described above in the same manner as in Example 2, Respectively.

그 결과, 아래 표 2에 기재된 바와 같이, 서열번호 1의 아미노산 서열을 갖는 단백질은 알라닌 아미드와 메티오닌 아미드에 대해서 가장 우수한 효소 활성을 나타내는 것으로 확인되었다.As a result, as shown in Table 2 below, it was confirmed that the protein having the amino acid sequence of SEQ ID NO: 1 exhibited the most excellent enzyme activity for alaninamide and methionine amide.

기질temperament 비활성(specific activity, U/㎎)Specific activity (U / mg) 알라닌 아미드Alaninamide 21.57±0.1221.57 + - 0.12 메티오닌 아미드Methionine amide 21.03±0.3021.03 + - 0.30 발린 아미드Valine amide 3.90±0.443.90 + - 0.44 글루타민 아미드Glutaminamide 3.01±0.053.01 ± 0.05 트레오닌 아미드Threonamide 0.14±0.000.14 ± 0.00

서열번호 1과 90% 이상의 SEQ ID NO: 1 and 90% or more 상동성을Homology 갖는 아미노산 서열을 갖는 단백질의 활성 확인 Identification of the activity of a protein having an amino acid sequence having

상기와 같이 D-입체특이적 아미노산 아미다아제로서의 활성이 확인된 서열번호 1의 아미노산 서열과 90% 이상의 상동성을 갖는 아미노산 서열을 갖는 단백질에 대해서도 하기와 같이 그 활성을 확인하였다. The activity of the protein having an amino acid sequence having 90% or more homology with the amino acid sequence of SEQ ID NO: 1 whose activity as D-stereospecific amino acid amidase was confirmed as described above was also confirmed as follows.

[5-1] [5-1] 서열번호 7, 9, 11의 아미노산 서열을 갖는 단백질의 분리 및 정제Separation and purification of proteins having the amino acid sequences of SEQ ID NOS: 7, 9 and 11

서열번호 1의 아미노산 서열과 99% 이상의 상동성을 갖는 서열번호 7의 아미노산 서열, 서열번호 9의 아미노산 서열 및 서열번호 11의 아미노산 서열을 갖는 단백질을 얻기 위하여, 각각 서열번호 2의 염기 서열을 기초로, 다음 표 3과 같이 서열번호 14 내지 19의 프라이머를 각각 설계하였고, 서열번호 2의 염기를 주형으로 하여, 서열번호 7의 아미노산 서열은 서열번호 13, 14의 프라이머를, 서열번호 9의 아미노산 서열은 서열번호 15, 16의 프라이머를, 그리고 서열번호 11의 아미노산 서열은 서열번호 17, 18의 프라이머를 이용하여, PCR 증폭하였고 그 산물은 Kination & Ligation 방법을 통하여 클로닝하였다. 클로닝된 각각의 산물은 염기 서열 분석(sequencing)(㈜마크로젠)을 통해 상기 서열번호 2의 염기 서열의 119번 위치의 페닐알라닌이 각각 알라닌, 티로신, 및 트립토판으로 치환되었음을 확인하였으며, 이를 대장균 ER2566 균주(Novagen, 미국)에 형질전환하였다. 상기와 같이 얻어진 형질전환체는 이용하기 전에 20% 글리세린 용액을 첨가하여 냉동 보관하였다. In order to obtain a protein having an amino acid sequence of SEQ ID NO: 7, an amino acid sequence of SEQ ID NO: 9, and an amino acid sequence of SEQ ID NO: 11 having 99% or more homology with the amino acid sequence of SEQ ID NO: 1, , The primers of SEQ ID NOS: 14 to 19 were designed respectively as shown in the following Table 3, the base of SEQ ID NO: 2 was used as a template, the amino acid sequence of SEQ ID NO: 7 was substituted with the primers of SEQ ID NOS: 13 and 14, The primers of SEQ ID NOs: 15 and 16 were used for the sequence, and the primers of SEQ ID NOs: 17 and 18 were used for the amino acid sequence of SEQ ID NO: 11. The products were cloned by the Kination & Ligation method. Each of the cloned products was confirmed to be substituted with alanine, tyrosine, and tryptophan, respectively, at position 119 of the nucleotide sequence of SEQ ID NO: 2 through sequencing (Macrogen Co., Ltd.) Novagen, USA). The transformant thus obtained was added with a 20% glycerin solution and stored frozen before use.

상기 실시예 [1-2]에서와 동일한 방법으로 상기 서열번호 7의 아미노산 서열을 갖는 단백질, 서열번호 9의 아미노산 서열을 갖는 단백질 및 서열번호 11의 아미노산 서열을 갖는 단백질을 각각 분리 및 정제하였다.The protein having the amino acid sequence of SEQ ID NO: 7, the protein having the amino acid sequence of SEQ ID NO: 9, and the protein having the amino acid sequence of SEQ ID NO: 11 were respectively isolated and purified in the same manner as in the above Example [1-2].

서열번호SEQ ID NO: 프라이머primer 쌍 pair 서열(5‘->3’)Sequences (5 '-> 3') 1313 정방향 프라이머Forward primer tcgatgatagctggtgctcgcaata tcgatgatagctggtgctcgcaata 1414 역방향 프라이머Reverse primer atgagacatgacaccaggcatggat atgagacatgacaccaggcatggat 1515 정방향 프라이머Forward primer tcgatgatatatggtgctcgcaatatcgatgatatatggtgctcgcaata 1616 역방향 프라이머Reverse primer atgagacatgacaccaggcatggatatgagacatgacaccaggcatggat 1717 정방향 프라이머Forward primer tcgatgatatggggtgctcgcaatatcgatgatatggggtgctcgcaata 1818 역방향 프라이머 2Reverse primer 2 atgagacatgacaccaggcatggatatgagacatgacaccaggcatggat

[5-2] [5-2] 단백질의 특이 활성도 분석Analysis of specific activity of protein

상기 실시예 [5-1] 에서 분리 및 정제한 서열번호 7, 서열번호 9 및 서열번호 11의 아미노산 서열을 갖는 단백질을 대상으로, 상기 실시예 4에서와 동일한 방법으로 알라닌 아미드에 대한 비활성값 및 특이 활성도를 확인하여 아래 표 4에 나타내다. 상기 비활성도는 서열번호 1의 아미노산 서열을 갖는 단백질의 특이 활성도를 100%로 하였을 때의 상대적인 값으로 환산하였다.The protein having the amino acid sequence of SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 isolated and purified in the above Example [5-1] was subjected to the same procedure as in Example 4, Specific activity was confirmed and shown in Table 4 below. The inactivity was converted to a relative value when the specific activity of the protein having the amino acid sequence of SEQ ID NO: 1 was taken as 100%.

단백질protein 비활성(specific activity, U/㎎)Specific activity (U / mg) 특이 활성도 (Specific activity %% )) 서열번호 1SEQ ID NO: 1 21.6±0.821.6 ± 0.8 100±3.8100 ± 3.8 서열번호 7SEQ ID NO: 7 29.7±1.129.7 ± 1.1 138±4138 ± 4 서열번호 9SEQ ID NO: 9 24.2±1.924.2 ± 1.9 112±8.7112 ± 8.7 서열번호 11SEQ ID NO: 11 22.6±1.122.6 ± 1.1 104.8±4.9104.8 ± 4.9

상기에서는 본 발명의 바람직한 실시예를 예시적으로 설명하였으나, 본 발명의 범위는 상기와 같은 특정 실시예에만 한정되지 아니하며, 해당 분야에서 통상의 지식을 가진 자라면 본 발명의 특허청구범위에 기재된 범주 내에서 적절하게 변경이 가능할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the scope of the invention is not limited to the disclosed exemplary embodiments. It will be possible to change it appropriately.

<110> KOREA RESEARCH INSTITUTE OF BIOSCIENCE AND BIOTECHNOLOGY <120> NOVEL D-STEREOSPECIFIC AMINO ACID AMIDASE AND MUTANTS THEREOF, AND METHOD FOR PREPARING D-AMINO ACID USING THE SAME <130> 2018-DPA-3011 <160> 18 <170> KopatentIn 3.0 <210> 1 <211> 560 <212> PRT <213> Bacillus megaterium <400> 1 Met Cys Ser Ala Ser Thr Gln Val Ser Asp Pro Gln Glu Gly Arg Arg 1 5 10 15 Ser Ala Asn Tyr Gln Pro Ser Val Trp Thr Tyr Asn Tyr Leu Gln Ser 20 25 30 Leu Val Ala Asp Glu Gly Arg Arg Ser His Arg Glu Val Glu Leu Gln 35 40 45 Arg Glu Lys Ala Gln Val Leu Glu Glu Glu Val Arg Gly Ala Leu Asn 50 55 60 Asp Glu Lys Ala Glu Pro Thr Thr Ile Phe Ala Leu Val Asp Asp Ile 65 70 75 80 Arg Arg Leu Gly Leu Gly His Gln Phe Glu Glu Asp Ile Ser Arg Ala 85 90 95 Leu Arg Arg Cys Leu Ser Pro Gly Ala Val Asn Lys Ser Leu Asp Lys 100 105 110 Ser Leu His Gly Thr Ala Leu Gly Phe Arg Ile Leu Arg Gln His Gly 115 120 125 Phe Ala Val Ser Gln Asp Val Leu Lys Ile Phe Met Asp Glu Ser Gly 130 135 140 Ser Phe Met Lys Thr Leu Gly Gly Asp Val Gln Gly Met Leu Ser Leu 145 150 155 160 Tyr Glu Ala Ser His Leu Ala Phe Glu Glu Glu Asp Ile Leu His Gln 165 170 175 Ala Lys Thr Phe Ser Ile Glu His Leu Lys Ser Leu Ser Arg Asp Ile 180 185 190 Ser Lys Asp Leu Gln Asp Leu Val Asn His Glu Leu Glu Leu Pro Leu 195 200 205 His Arg Arg Met Pro Leu Leu Glu Ala Arg Arg Ser Ile Glu Ala Tyr 210 215 220 Ser Lys Arg Gly Tyr Met Asn Asp Arg Ile Leu Lys Leu Ala Ala Thr 225 230 235 240 Asn Phe Asn Thr Ser Gln Ser Ile Leu Gln Arg Asp Leu Gln Glu Met 245 250 255 Leu Gly Trp Trp Asn Asn Val Ser Leu Ala Lys Arg Leu Ser Phe Ala 260 265 270 Arg Asp Arg Leu Met Glu Cys Phe Phe Trp Ala Val Gly Ile Ala Asn 275 280 285 Glu Pro Leu Leu Ser Asn Cys Arg Lys Gly Val Thr Lys Ala Phe Ala 290 295 300 Leu Ile Leu Val Leu Asp Asp Val Tyr Asp Val Phe Gly Thr Leu Asp 305 310 315 320 Glu Leu Glu Leu Phe Thr Asp Ala Val Arg Arg Trp Asp Leu Asn Ala 325 330 335 Val Glu Asp Leu Pro Ala Tyr Met Lys Leu Cys Tyr Leu Ala Leu Tyr 340 345 350 Asn Asn Val Asn Glu Met Ala Tyr Asp Thr Leu Lys Glu Thr Gly Glu 355 360 365 Asn Val Ile Leu Tyr Leu Ala Lys Ala Trp Tyr Asp Leu Cys Lys Ala 370 375 380 Phe Leu Gln Glu Ala Lys Trp Ser Tyr Asn Lys Ile Ile Pro Gly Val 385 390 395 400 Glu Glu Tyr Leu Asn Asn Gly Trp Met Ser Ser Ser Gly Gln Val Met 405 410 415 Leu Thr His Ala Tyr Phe Leu Ala Ser Pro Ser Met Arg Lys Glu Glu 420 425 430 Leu Glu Ser Leu Glu His Tyr His Asp Leu Leu Arg Leu Pro Ser Leu 435 440 445 Ile Phe Arg Leu Thr Asn Asp Leu Ala Ser Ser Ser Ala Glu Leu Glu 450 455 460 Arg Gly Glu Thr Thr Asn Ser Ile Gln Ser Tyr Met Gln Glu Asn Gly 465 470 475 480 Ile Ser Glu Ser Glu Ala Arg Glu Tyr Val Thr Glu Gln Ile Asp Thr 485 490 495 Ala Trp Lys Lys Met Asn Lys Tyr Leu Val Asp His Ser Thr Phe Asp 500 505 510 Gln Ser Phe Val Arg Met Ala Tyr Asn Leu Ala Arg Met Ala His Cys 515 520 525 Val Tyr Gln Asp Gly Asp Ala Ile Gly Ala Pro Asp Asp Gln Ser Trp 530 535 540 Asn Arg Val His Ser Leu Ile Ile Ser Pro Val Ser Leu Ala Pro Arg 545 550 555 560 <210> 2 <211> 1683 <212> DNA <213> Bacillus megaterium <400> 2 atgtgtagtg cttccacaca agtcagtgac ccgcaggaag gacgccgcag cgctaactac 60 caaccctcag tgtggaccta caactactta caatcccttg ttgctgacga gggtcgtcgt 120 agccaccgcg aagtagagtt gcagcgtgag aaagcacaag tcttggagga ggaagttcgt 180 ggtgcgctta acgacgaaaa ggcggagcca accactattt ttgcactggt agacgatatc 240 cgccgcttgg gtcttggtca tcagttcgag gaggatatca gtcgtgcgct tcgtcgttgt 300 ctgagtccgg gtgccgtaaa caagagcttg gataagtcgc ttcatgggac tgccttaggc 360 ttccgtattc tgcgtcaaca cggattcgca gttagccagg atgttcttaa aattttcatg 420 gatgagagcg gcagttttat gaagaccttg ggtggtgatg tccagggaat gctgagttta 480 tatgaggcgt cacatctggc atttgaggaa gaggatatct tacatcaggc aaaaacgttt 540 tccatcgaac acctgaagtc cttgtcgcgt gacatcagta aagatttaca agacctggtc 600 aatcacgaac ttgagcttcc ccttcatcgt cgcatgccac tgttggaagc ccgccgctcg 660 attgaggctt actctaagcg tggctatatg aatgatcgca tcttgaagtt agcagcgacc 720 aatttcaaca cgtctcaatc aattcttcaa cgcgatctgc aagaaatgct gggttggtgg 780 aacaatgtct ctttagcgaa acgtttgagt ttcgcacgcg atcgcctgat ggaatgcttt 840 ttctgggcgg ttggaattgc taacgagcca ttgctttcaa actgccgcaa aggagtgact 900 aaggcattcg cgctgatttt agtgttggat gatgtatatg atgttttcgg aaccctggat 960 gaacttgaac ttttcacaga tgcagtgcgc cgttgggatt tgaacgctgt agaggatctg 1020 ccagcataca tgaaactttg ttatctggcc ttgtataaca atgttaatga aatggcctat 1080 gatacactta aagaaacggg agagaatgtt atcttgtacc ttgcaaaggc gtggtacgat 1140 ctgtgtaagg cattcttaca ggaagcgaag tggagctaca acaaaatcat ccctggcgta 1200 gaagagtact tgaataatgg gtggatgtct tcttctggcc aggtaatgtt aacgcacgct 1260 tactttttgg cttccccctc catgcgtaag gaggagcttg agtctttaga acactatcac 1320 gaccttcttc gccttccatc cttaattttt cgtttaacta acgacctggc ctcttcttct 1380 gctgaacttg agcgtggcga gacgactaat tccattcaga gctatatgca ggaaaacggt 1440 atcagtgagt ctgaagcccg cgagtacgtc accgagcaga ttgacaccgc gtggaaaaag 1500 atgaacaagt acctggtgga tcactccaca ttcgatcaat cattcgttcg tatggcatat 1560 aacttagcac gtatggccca ttgtgtgtat caagatgggg atgccattgg agcgccagac 1620 gatcaatctt ggaaccgcgt acacagtttg atcatttcac ccgtcagtct tgcgccgcgt 1680 taa 1683 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SEQ ID No. 2 <400> 3 tggtgccgcg cggcagccat atgtgtagtg cttccacaca 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SEQ ID No. 2 <400> 4 tggtggtggt ggtgctcgag ttaacgcggc gcaagactga 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for pET28a(+) <400> 5 tcagtcttgc gccgcgttaa ctcgagcacc accaccacca 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for pET28a(+) <400> 6 tgtgtggaag cactacacat atggctgccg cgcggcacca 40 <210> 7 <211> 275 <212> PRT <213> Artificial Sequence <220> <223> Mutant of SEQ ID No. 1 <400> 7 Met Lys Leu Tyr Leu Ser Val Asp Met Glu Gly Ile Thr Gly Leu Val 1 5 10 15 Asp His Thr Asn Val Leu Arg Gln Lys Lys Asn Tyr Glu Arg Ser Arg 20 25 30 Lys Ile Met Thr Asp Glu Ala Asn Ala Val Ile Tyr Ala Gly Phe Arg 35 40 45 Glu Gln Cys Ser Glu Val Val Val Asn Asp Ser His Ser Ser Met Asn 50 55 60 Asn Leu Leu Val Glu Arg Leu His Pro Glu Thr Gln Leu Ile Ser Gly 65 70 75 80 Ser Val Lys Pro Tyr Ser Met Val Gln Gly Leu Asp Gln Thr Phe Asp 85 90 95 Gly Ala Met Phe Leu Gly Tyr His Ala Lys Ala Ser Met Pro Gly Val 100 105 110 Met Ser His Ser Met Ile Ala Gly Ala Arg Asn Met Tyr Ile Asp Asp 115 120 125 Thr Asn Ile Gly Glu Leu Gly Phe Asn Ala Tyr Val Ala Gly Tyr Tyr 130 135 140 Gly Val Pro Val Leu Met Val Val Gly Asp Asp Gln Thr Ala Leu Glu 145 150 155 160 Ala Gln Gln Leu Ile Pro Asn Val Thr Thr Ala Ile Val Lys Gln Ala 165 170 175 Ile Ser Arg Ser Ala Ala Lys Thr Leu Thr Pro Lys Lys Ala Glu Gln 180 185 190 Leu Leu Gln Glu Lys Thr Ala Ala Ala Ile Gln His Arg His Leu Val 195 200 205 Lys Pro Leu Leu Pro Pro Lys His Pro Thr Leu Arg Ile Glu Phe Ala 210 215 220 Asn Tyr Gly Gln Ala Glu Trp Ala His Leu Met Pro Gly Thr Glu Ile 225 230 235 240 Glu Pro Gly Thr Thr Thr Val Arg Phe Gln Ala Lys Asp Ile Leu Glu 245 250 255 Ala Tyr Gln Ala Met Leu Val Met Thr Glu Leu Ala Thr Arg Thr Thr 260 265 270 Phe Cys Glx 275 <210> 8 <211> 825 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence for SEQ ID No. 7 <400> 8 atgaaactat atctgtcggt tgatatggaa ggaattacgg gactcgtcga tcacacaaat 60 gttctgcggc agaaaaaaaa ttatgaaaga agccgcaaaa taatgacgga tgaagcaaat 120 gcagtaattt atgcaggatt tagagaacag tgctcagaag ttgtggtaaa tgacagtcat 180 tcgagtatga ataatctcct tgttgaacgg cttcatccag aaactcagct tatttcagga 240 agcgtaaaac catattcaat ggtacaggga ttagatcaga cttttgatgg tgctatgttt 300 ctaggatatc atgctaaagc atccatgcct ggtgtcatgt ctcattcgat gatagctggt 360 gctcgcaata tgtacataga cgatacgaat attggagagt taggcttcaa tgcatatgtc 420 gcaggctatt acggcgtgcc agttttaatg gtagtcggtg atgaccaaac ggcgttggaa 480 gcacagcagc ttattccaaa cgtgacgact gctatcgtca aacaggccat ttcacgttct 540 gcagccaaaa cattaacccc taagaaagca gaacaattac ttcaagaaaa aacagccgca 600 gctattcaac atagacacct tgttaaacct ttacttccac ctaaacatcc aaccttacga 660 atagagtttg caaattacgg tcaagcagag tgggcgcact taatgccggg cacagaaatt 720 gagcctggaa cgacgactgt tcggtttcaa gcaaaagata ttttagaagc ttatcaggcc 780 atgcttgtta tgactgaatt agcgacgcgc acaacattct gttag 825 <210> 9 <211> 275 <212> PRT <213> Artificial Sequence <220> <223> Mutant of SEQ ID No. 1 <400> 9 Met Lys Leu Tyr Leu Ser Val Asp Met Glu Gly Ile Thr Gly Leu Val 1 5 10 15 Asp His Thr Asn Val Leu Arg Gln Lys Lys Asn Tyr Glu Arg Ser Arg 20 25 30 Lys Ile Met Thr Asp Glu Ala Asn Ala Val Ile Tyr Ala Gly Phe Arg 35 40 45 Glu Gln Cys Ser Glu Val Val Val Asn Asp Ser His Ser Ser Met Asn 50 55 60 Asn Leu Leu Val Glu Arg Leu His Pro Glu Thr Gln Leu Ile Ser Gly 65 70 75 80 Ser Val Lys Pro Tyr Ser Met Val Gln Gly Leu Asp Gln Thr Phe Asp 85 90 95 Gly Ala Met Phe Leu Gly Tyr His Ala Lys Ala Ser Met Pro Gly Val 100 105 110 Met Ser His Ser Met Ile Tyr Gly Ala Arg Asn Met Tyr Ile Asp Asp 115 120 125 Thr Asn Ile Gly Glu Leu Gly Phe Asn Ala Tyr Val Ala Gly Tyr Tyr 130 135 140 Gly Val Pro Val Leu Met Val Val Gly Asp Asp Gln Thr Ala Leu Glu 145 150 155 160 Ala Gln Gln Leu Ile Pro Asn Val Thr Thr Ala Ile Val Lys Gln Ala 165 170 175 Ile Ser Arg Ser Ala Ala Lys Thr Leu Thr Pro Lys Lys Ala Glu Gln 180 185 190 Leu Leu Gln Glu Lys Thr Ala Ala Ala Ile Gln His Arg His Leu Val 195 200 205 Lys Pro Leu Leu Pro Pro Lys His Pro Thr Leu Arg Ile Glu Phe Ala 210 215 220 Asn Tyr Gly Gln Ala Glu Trp Ala His Leu Met Pro Gly Thr Glu Ile 225 230 235 240 Glu Pro Gly Thr Thr Thr Val Arg Phe Gln Ala Lys Asp Ile Leu Glu 245 250 255 Ala Tyr Gln Ala Met Leu Val Met Thr Glu Leu Ala Thr Arg Thr Thr 260 265 270 Phe Cys Glx 275 <210> 10 <211> 825 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence for SEQ ID No. 9 <400> 10 atgaaactat atctgtcggt tgatatggaa ggaattacgg gactcgtcga tcacacaaat 60 gttctgcggc agaaaaaaaa ttatgaaaga agccgcaaaa taatgacgga tgaagcaaat 120 gcagtaattt atgcaggatt tagagaacag tgctcagaag ttgtggtaaa tgacagtcat 180 tcgagtatga ataatctcct tgttgaacgg cttcatccag aaactcagct tatttcagga 240 agcgtaaaac catattcaat ggtacaggga ttagatcaga cttttgatgg tgctatgttt 300 ctaggatatc atgctaaagc atccatgcct ggtgtcatgt ctcattcgat gatatatggt 360 gctcgcaata tgtacataga cgatacgaat attggagagt taggcttcaa tgcatatgtc 420 gcaggctatt acggcgtgcc agttttaatg gtagtcggtg atgaccaaac ggcgttggaa 480 gcacagcagc ttattccaaa cgtgacgact gctatcgtca aacaggccat ttcacgttct 540 gcagccaaaa cattaacccc taagaaagca gaacaattac ttcaagaaaa aacagccgca 600 gctattcaac atagacacct tgttaaacct ttacttccac ctaaacatcc aaccttacga 660 atagagtttg caaattacgg tcaagcagag tgggcgcact taatgccggg cacagaaatt 720 gagcctggaa cgacgactgt tcggtttcaa gcaaaagata ttttagaagc ttatcaggcc 780 atgcttgtta tgactgaatt agcgacgcgc acaacattct gttag 825 <210> 11 <211> 275 <212> PRT <213> Artificial Sequence <220> <223> Mutant of SEQ ID No. 1 <400> 11 Met Lys Leu Tyr Leu Ser Val Asp Met Glu Gly Ile Thr Gly Leu Val 1 5 10 15 Asp His Thr Asn Val Leu Arg Gln Lys Lys Asn Tyr Glu Arg Ser Arg 20 25 30 Lys Ile Met Thr Asp Glu Ala Asn Ala Val Ile Tyr Ala Gly Phe Arg 35 40 45 Glu Gln Cys Ser Glu Val Val Val Asn Asp Ser His Ser Ser Met Asn 50 55 60 Asn Leu Leu Val Glu Arg Leu His Pro Glu Thr Gln Leu Ile Ser Gly 65 70 75 80 Ser Val Lys Pro Tyr Ser Met Val Gln Gly Leu Asp Gln Thr Phe Asp 85 90 95 Gly Ala Met Phe Leu Gly Tyr His Ala Lys Ala Ser Met Pro Gly Val 100 105 110 Met Ser His Ser Met Ile Trp Gly Ala Arg Asn Met Tyr Ile Asp Asp 115 120 125 Thr Asn Ile Gly Glu Leu Gly Phe Asn Ala Tyr Val Ala Gly Tyr Tyr 130 135 140 Gly Val Pro Val Leu Met Val Val Gly Asp Asp Gln Thr Ala Leu Glu 145 150 155 160 Ala Gln Gln Leu Ile Pro Asn Val Thr Thr Ala Ile Val Lys Gln Ala 165 170 175 Ile Ser Arg Ser Ala Ala Lys Thr Leu Thr Pro Lys Lys Ala Glu Gln 180 185 190 Leu Leu Gln Glu Lys Thr Ala Ala Ala Ile Gln His Arg His Leu Val 195 200 205 Lys Pro Leu Leu Pro Pro Lys His Pro Thr Leu Arg Ile Glu Phe Ala 210 215 220 Asn Tyr Gly Gln Ala Glu Trp Ala His Leu Met Pro Gly Thr Glu Ile 225 230 235 240 Glu Pro Gly Thr Thr Thr Val Arg Phe Gln Ala Lys Asp Ile Leu Glu 245 250 255 Ala Tyr Gln Ala Met Leu Val Met Thr Glu Leu Ala Thr Arg Thr Thr 260 265 270 Phe Cys Glx 275 <210> 12 <211> 825 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence for SEQ ID No. 11 <400> 12 atgaaactat atctgtcggt tgatatggaa ggaattacgg gactcgtcga tcacacaaat 60 gttctgcggc agaaaaaaaa ttatgaaaga agccgcaaaa taatgacgga tgaagcaaat 120 gcagtaattt atgcaggatt tagagaacag tgctcagaag ttgtggtaaa tgacagtcat 180 tcgagtatga ataatctcct tgttgaacgg cttcatccag aaactcagct tatttcagga 240 agcgtaaaac catattcaat ggtacaggga ttagatcaga cttttgatgg tgctatgttt 300 ctaggatatc atgctaaagc atccatgcct ggtgtcatgt ctcattcgat gatatggggt 360 gctcgcaata tgtacataga cgatacgaat attggagagt taggcttcaa tgcatatgtc 420 gcaggctatt acggcgtgcc agttttaatg gtagtcggtg atgaccaaac ggcgttggaa 480 gcacagcagc ttattccaaa cgtgacgact gctatcgtca aacaggccat ttcacgttct 540 gcagccaaaa cattaacccc taagaaagca gaacaattac ttcaagaaaa aacagccgca 600 gctattcaac atagacacct tgttaaacct ttacttccac ctaaacatcc aaccttacga 660 atagagtttg caaattacgg tcaagcagag tgggcgcact taatgccggg cacagaaatt 720 gagcctggaa cgacgactgt tcggtttcaa gcaaaagata ttttagaagc ttatcaggcc 780 atgcttgtta tgactgaatt agcgacgcgc acaacattct gttag 825 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SEQ ID No. 8 <400> 13 tcgatgatag ctggtgctcg caata 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SEQ ID No. 8 <400> 14 atgagacatg acaccaggca tggat 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SEQ ID No. 10 <400> 15 tcgatgatat atggtgctcg caata 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SEQ ID No. 10 <400> 16 atgagacatg acaccaggca tggat 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SEQ ID No. 12 <400> 17 tcgatgatat ggggtgctcg caata 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SEQ ID No. 12 <400> 18 atgagacatg acaccaggca tggat 25 <110> KOREA RESEARCH INSTITUTE OF BIOSCIENCE AND BIOTECHNOLOGY <120> NOVEL D-STEREOSPECIFIC AMINO ACID AMIDASE AND MUTANTS THEREOF,          AND METHOD FOR PREPARING D-AMINO ACID USING THE SAME <130> 2018-DPA-3011 <160> 18 <170> Kopatentin 3.0 <210> 1 <211> 560 <212> PRT <213> Bacillus megaterium <400> 1 Met Cys Ser Ala Ser Thr Gln Val Ser Asp Pro Gln Glu Gly Arg Arg   1 5 10 15 Ser Ala Asn Tyr Gln Pro Ser Val Trp Thr Tyr Asn Tyr Leu Gln Ser              20 25 30 Leu Val Ala Asp Glu Gly Arg Arg Ser His Arg Glu Val Glu Leu Gln          35 40 45 Arg Glu Lys Ala Gln Val Leu Glu Glu Glu Val Arg Gly Ala Leu Asn      50 55 60 Asp Glu Lys Ala Glu Pro Thr Thr Ile Phe Ala Leu Val Asp Asp Ile  65 70 75 80 Arg Arg Leu Gly Leu Gly His Gln Phe Glu Glu Asp Ile Ser Arg Ala                  85 90 95 Leu Arg Arg Cys Leu Ser Pro Gly Ala Val Asn Lys Ser Leu Asp Lys             100 105 110 Ser Leu His Gly Thr Ala Leu Gly Phe Arg Ile Leu Arg Gln His Gly         115 120 125 Phe Ala Val Ser Gln Asp Val Leu Lys Ile Phe Met Asp Glu Ser Gly     130 135 140 Ser Phe Met Lys Thr Leu Gly Gly Asp Val Gln Gly Met Leu Ser Leu 145 150 155 160 Tyr Glu Ala Ser His Leu Ala Phe Glu Glu Glu Asp Ile Leu His Gln                 165 170 175 Ala Lys Thr Phe Ser Ile Glu His Leu Lys Ser Leu Ser Arg Asp Ile             180 185 190 Ser Lys Asp Leu Gln Asp Leu Val Asn His Glu Leu Glu Leu Pro Leu         195 200 205 His Arg Arg Met Met Le Leu Glu Ala Arg Arg Ser Ile Glu Ala Tyr     210 215 220 Ser Lys Arg Gly Tyr Met Asn Asp Arg Ile Leu Lys Leu Ala Ala Thr 225 230 235 240 Asn Phe Asn Thr Ser Gln Ser Ile Leu Gln Arg Asp Leu Gln Glu Met                 245 250 255 Leu Gly Trp Trp Asn Asn Val Ser Leu Ala Lys Arg Leu Ser Phe Ala             260 265 270 Arg Asp Arg Leu Met Glu Cys Phe Phe Trp Ala Val Gly Ile Ala Asn         275 280 285 Glu Pro Leu Leu Ser Asn Cys Arg Lys Gly Val Thr Lys Ala Phe Ala     290 295 300 Leu Ile Leu Val Leu Asp Asp Val Tyr Asp Val Phe Gly Thr Leu Asp 305 310 315 320 Glu Leu Glu Leu Phe Thr Asp Ala Val Arg Arg Trp Asp Leu Asn Ala                 325 330 335 Val Glu Asp Leu Pro Ala Tyr Met Lys Leu Cys Tyr Leu Ala Leu Tyr             340 345 350 Asn Asn Val Asn Glu Met Ala Tyr Asp Thr Leu Lys Glu Thr Gly Glu         355 360 365 Asn Val Ile Leu Tyr Leu Ala Lys Ala Trp Tyr Asp Leu Cys Lys Ala     370 375 380 Phe Leu Gln Glu Ala Lys Trp Ser Tyr Asn Lys Ile Ile Pro Gly Val 385 390 395 400 Glu Glu Tyr Leu Asn Asn Gly Trp Met Ser Ser Ser Gly Gln Val Met                 405 410 415 Leu Thr His Ala Tyr Phe Leu Ala Ser Pro Ser Met Arg Lys Glu Glu             420 425 430 Leu Glu Ser Leu Glu His Tyr His Asp Leu Leu Arg Leu Pro Ser Leu         435 440 445 Ile Phe Arg Leu Thr Asn Asp Leu Ala Ser Ser Ala Glu Leu Glu     450 455 460 Arg Gly Glu Thr Thr Asn Ser Ile Gln Ser Tyr Met Gln Glu Asn Gly 465 470 475 480 Ile Ser Glu Ser Glu Ala Arg Glu Tyr Val Thr Glu Gln Ile Asp Thr                 485 490 495 Ala Trp Lys Lys Met Asn Lys Tyr Leu Val Asp His Ser Thr Phe Asp             500 505 510 Gln Ser Phe Val Arg Met Ala Tyr Asn Leu Ala Arg Met Ala His Cys         515 520 525 Val Tyr Gln Asp Gly Asp Ala Ile Gly Ala Pro Asp Asp Gln Ser Trp     530 535 540 Asn Arg Val His Ser Leu Ile Ile Ser Pro Val Ser Leu Ala Pro Arg 545 550 555 560 <210> 2 <211> 1683 <212> DNA <213> Bacillus megaterium <400> 2 atgtgtagtg cttccacaca agtcagtgac ccgcaggaag gacgccgcag cgctaactac 60 caaccctcag tgtggaccta caactactta caatcccttg ttgctgacga gggtcgtcgt 120 agccaccgcg aagtagagtt gcagcgtgag aaagcacaag tcttggagga ggaagttcgt 180 ggtgcgctta acgacgaaaa ggcggagcca accactattt ttgcactggt agacgatatc 240 cgccgcttgg gtcttggtca tcagttcgag gaggatatca gtcgtgcgct tcgtcgttgt 300 ctgagtccgg gtgccgtaaa caagagcttg gataagtcgc ttcatgggac tgccttaggc 360 ttccgtattc tgcgtcaaca cggattcgca gttagccagg atgttcttaa aattttcatg 420 gatgagagcg gcagttttat gaagaccttg ggtggtgatg tccagggaat gctgagttta 480 tatgaggcgt cacatctggc atttgaggaa gaggatatct tacatcaggc aaaaacgttt 540 tccatcgaac acctgaagtc cttgtcgcgt gacatcagta aagatttaca agacctggtc 600 cgcatgccac attgaggctt actctaagcg tggctatatg aatgatcgca tcttgaagtt agcagcgacc 720 aatttcaaca cgtctcaatc aattcttcaa cgcgatctgc aagaaatgct gggttggtgg 780 aacaatgtct ctttagcgaa acgtttgagt ttcgcacgcg atcgcctgat ggaatgcttt 840 ttctgggcgg ttggaattgc taacgagcca ttgctttcaa actgccgcaa aggagtgact 900 aaggcattcg cgctgatttt agtgttggat gatgtatatg atgttttcgg aaccctggat 960 gaacttgaac ttttcacaga tgcagtgcgc cgttgggatt tgaacgctgt agaggatctg 1020 ccagcataca tgaaactttg ttatctggcc ttgtataaca atgttaatga aatggcctat 1080 gatacactta aagaaacggg agagaatgtt atcttgtacc ttgcaaaggc gtggtacgat 1140 ctgtgtaagg cattcttaca ggaagcgaag tggagctaca acaaaatcat ccctggcgta 1200 gaagagtact tgaataatgg gtggatgtct tcttctggcc aggtaatgtt aacgcacgct 1260 tactttttgg cttccccctc catgcgtaag gaggagcttg agtctttaga acactatcac 1320 gaccttcttc gccttccatc cttaattttt cgtttaacta acgacctggc ctcttcttct 1380 gctgaacttg agcgtggcga gacgactaat tccattcaga gctatatgca ggaaaacggt 1440 atcagtgagt ctgaagcccg cgagtacgtc accgagcaga ttgacaccgc gtggaaaaag 1500 atgaacaagt acctggtgga tcactccaca ttcgatcaat cattcgttcg tatggcatat 1560 aacttagcac gtatggccca ttgtgtgtat caagatgggg atgccattgg agcgccagac 1620 gatcaatctt ggaaccgcgt acacagtttg atcatttcac ccgtcagtct tgcgccgcgt 1680 taa 1683 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SEQ ID No. 2 <400> 3 tggtgccgcg cggcagccat atgtgtagtg cttccacaca 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> Reverse primer for SEQ ID NO. 2 <400> 4 tggtggtggt ggtgctcgag ttaacgcggc gcaagactga 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for pET28a (+) <400> 5 tcagtcttgc gccgcgttaa ctcgagcacc accaccacca 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for pET28a (+) <400> 6 tgtgtggaag cactacacat atggctgccg cgcggcacca 40 <210> 7 <211> 275 <212> PRT <213> Artificial Sequence <220> <223> Mutant of SEQ ID No. One <400> 7 Met Lys Leu Tyr Leu Ser Val Asp Met Glu Gly Ile Thr Gly Leu Val   1 5 10 15 Asp His Thr Asn Val Leu Arg Gln Lys Lys Asn Tyr Glu Arg Ser Arg              20 25 30 Lys Ile Met Thr Asp Glu Ala Asn Ala Val Ile Tyr Ala Gly Phe Arg          35 40 45 Glu Gln Cys Ser Glu Val Val Val Asn Asp Ser His Ser Ser Met Asn      50 55 60 Asn Leu Leu Val Glu Arg Leu His Pro Glu Thr Gln Leu Ile Ser Gly  65 70 75 80 Ser Val Lys Pro Tyr Ser Met Val Gln Gly Leu Asp Gln Thr Phe Asp                  85 90 95 Gly Ala Met Phe Leu Gly Tyr His Ala Lys Ala Ser Met Pro Gly Val             100 105 110 Met Ser His Ser Met Ile Ala Gly Ala Arg Asn Met Tyr Ile Asp Asp         115 120 125 Thr Asn Ile Gly Glu Leu Gly Phe Asn Ala Tyr Val Ala Gly Tyr Tyr     130 135 140 Gly Val Pro Val Leu Met Val Val Gly Asp Asp Gln Thr Ala Leu Glu 145 150 155 160 Ala Gln Gln Leu Ile Pro Asn Val Thr Thr Ala Ile Val Lys Gln Ala                 165 170 175 Ile Ser Arg Ser Ala Lys Thr Leu Thr Pro Lys Lys Ala Glu Gln             180 185 190 Leu Leu Gln Glu Lys Thr Ala Ala Ala Ile Gln His Arg His Leu Val         195 200 205 Lys Pro Leu Leu Pro Pro Lys His Pro Thr Leu Arg Ile Glu Phe Ala     210 215 220 Asn Tyr Gly Gln Ala Glu Trp Ala His Leu Met Pro Gly Thr Glu Ile 225 230 235 240 Glu Pro Gly Thr Thr Thr Val Arg Phe Gln Ala Lys Asp Ile Leu Glu                 245 250 255 Ala Tyr Gln Ala Met Leu Val Met Thr Glu Leu Ala Thr Arg Thr Thr             260 265 270 Phe Cys Glx         275 <210> 8 <211> 825 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > nucleotide sequence for SEQ ID NO. 7 <400> 8 atgaaactat atctgtcggt tgatatggaa ggaattacgg gactcgtcga tcacacaaat 60 gttctgcggc agaaaaaaaa ttatgaaaga agccgcaaaa taatgacgga tgaagcaaat 120 gcagtaattt atgcaggatt tagagaacag tgctcagaag ttgtggtaaa tgacagtcat 180 tcgagtatga ataatctcct tgttgaacgg cttcatccag aaactcagct tatttcagga 240 agcgtaaaac catattcaat ggtacaggga ttagatcaga cttttgatgg tgctatgttt 300 ctaggatatc atgctaaagc atccatgcct ggtgtcatgt ctcattcgat gatagctggt 360 gctcgcaata tgtacataga cgatacgaat attggagagt taggcttcaa tgcatatgtc 420 gcaggctatt acggcgtgcc agttttaatg gtagtcggtg atgaccaaac ggcgttggaa 480 gcacagcagc ttattccaaa cgtgacgact gctatcgtca aacaggccat ttcacgttct 540 gcagccaaaa cattaacccc taagaaagca gaacaattac ttcaagaaaa aacagccgca 600 gctattcaac atagacacct tgttaaacct ttacttccac ctaaacatcc aaccttacga 660 atagagtttg caaattacgg tcaagcagag tgggcgcact taatgccggg cacagaaatt 720 gagcctggaa cgacgactgt tcggtttcaa gcaaaagata ttttagaagc ttatcaggcc 780 atgcttgtta tgactgaatt agcgacgcgc acaacattct gttag 825 <210> 9 <211> 275 <212> PRT <213> Artificial Sequence <220> <223> Mutant of SEQ ID No. One <400> 9 Met Lys Leu Tyr Leu Ser Val Asp Met Glu Gly Ile Thr Gly Leu Val   1 5 10 15 Asp His Thr Asn Val Leu Arg Gln Lys Lys Asn Tyr Glu Arg Ser Arg              20 25 30 Lys Ile Met Thr Asp Glu Ala Asn Ala Val Ile Tyr Ala Gly Phe Arg          35 40 45 Glu Gln Cys Ser Glu Val Val Val Asn Asp Ser His Ser Ser Met Asn      50 55 60 Asn Leu Leu Val Glu Arg Leu His Pro Glu Thr Gln Leu Ile Ser Gly  65 70 75 80 Ser Val Lys Pro Tyr Ser Met Val Gln Gly Leu Asp Gln Thr Phe Asp                  85 90 95 Gly Ala Met Phe Leu Gly Tyr His Ala Lys Ala Ser Met Pro Gly Val             100 105 110 Met Ser His Met Ser Tyr Gly Ala Arg Asn Met Tyr Ile Asp Asp         115 120 125 Thr Asn Ile Gly Glu Leu Gly Phe Asn Ala Tyr Val Ala Gly Tyr Tyr     130 135 140 Gly Val Pro Val Leu Met Val Val Gly Asp Asp Gln Thr Ala Leu Glu 145 150 155 160 Ala Gln Gln Leu Ile Pro Asn Val Thr Thr Ala Ile Val Lys Gln Ala                 165 170 175 Ile Ser Arg Ser Ala Lys Thr Leu Thr Pro Lys Lys Ala Glu Gln             180 185 190 Leu Leu Gln Glu Lys Thr Ala Ala Ala Ile Gln His Arg His Leu Val         195 200 205 Lys Pro Leu Leu Pro Pro Lys His Pro Thr Leu Arg Ile Glu Phe Ala     210 215 220 Asn Tyr Gly Gln Ala Glu Trp Ala His Leu Met Pro Gly Thr Glu Ile 225 230 235 240 Glu Pro Gly Thr Thr Thr Val Arg Phe Gln Ala Lys Asp Ile Leu Glu                 245 250 255 Ala Tyr Gln Ala Met Leu Val Met Thr Glu Leu Ala Thr Arg Thr Thr             260 265 270 Phe Cys Glx         275 <210> 10 <211> 825 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > nucleotide sequence for SEQ ID NO. 9 <400> 10 atgaaactat atctgtcggt tgatatggaa ggaattacgg gactcgtcga tcacacaaat 60 gttctgcggc agaaaaaaaa ttatgaaaga agccgcaaaa taatgacgga tgaagcaaat 120 gcagtaattt atgcaggatt tagagaacag tgctcagaag ttgtggtaaa tgacagtcat 180 tcgagtatga ataatctcct tgttgaacgg cttcatccag aaactcagct tatttcagga 240 agcgtaaaac catattcaat ggtacaggga ttagatcaga cttttgatgg tgctatgttt 300 ctaggatatc atgctaaagc atccatgcct ggtgtcatgt ctcattcgat gatatatggt 360 gctcgcaata tgtacataga cgatacgaat attggagagt taggcttcaa tgcatatgtc 420 gcaggctatt acggcgtgcc agttttaatg gtagtcggtg atgaccaaac ggcgttggaa 480 gcacagcagc ttattccaaa cgtgacgact gctatcgtca aacaggccat ttcacgttct 540 gcagccaaaa cattaacccc taagaaagca gaacaattac ttcaagaaaa aacagccgca 600 gctattcaac atagacacct tgttaaacct ttacttccac ctaaacatcc aaccttacga 660 atagagtttg caaattacgg tcaagcagag tgggcgcact taatgccggg cacagaaatt 720 gagcctggaa cgacgactgt tcggtttcaa gcaaaagata ttttagaagc ttatcaggcc 780 atgcttgtta tgactgaatt agcgacgcgc acaacattct gttag 825 <210> 11 <211> 275 <212> PRT <213> Artificial Sequence <220> <223> Mutant of SEQ ID No. One <400> 11 Met Lys Leu Tyr Leu Ser Val Asp Met Glu Gly Ile Thr Gly Leu Val   1 5 10 15 Asp His Thr Asn Val Leu Arg Gln Lys Lys Asn Tyr Glu Arg Ser Arg              20 25 30 Lys Ile Met Thr Asp Glu Ala Asn Ala Val Ile Tyr Ala Gly Phe Arg          35 40 45 Glu Gln Cys Ser Glu Val Val Val Asn Asp Ser His Ser Ser Met Asn      50 55 60 Asn Leu Leu Val Glu Arg Leu His Pro Glu Thr Gln Leu Ile Ser Gly  65 70 75 80 Ser Val Lys Pro Tyr Ser Met Val Gln Gly Leu Asp Gln Thr Phe Asp                  85 90 95 Gly Ala Met Phe Leu Gly Tyr His Ala Lys Ala Ser Met Pro Gly Val             100 105 110 Met Ser His Ser Met Ile Trp Gly Ala Arg Asn Met Tyr Ile Asp Asp         115 120 125 Thr Asn Ile Gly Glu Leu Gly Phe Asn Ala Tyr Val Ala Gly Tyr Tyr     130 135 140 Gly Val Pro Val Leu Met Val Val Gly Asp Asp Gln Thr Ala Leu Glu 145 150 155 160 Ala Gln Gln Leu Ile Pro Asn Val Thr Thr Ala Ile Val Lys Gln Ala                 165 170 175 Ile Ser Arg Ser Ala Lys Thr Leu Thr Pro Lys Lys Ala Glu Gln             180 185 190 Leu Leu Gln Glu Lys Thr Ala Ala Ala Ile Gln His Arg His Leu Val         195 200 205 Lys Pro Leu Leu Pro Pro Lys His Pro Thr Leu Arg Ile Glu Phe Ala     210 215 220 Asn Tyr Gly Gln Ala Glu Trp Ala His Leu Met Pro Gly Thr Glu Ile 225 230 235 240 Glu Pro Gly Thr Thr Thr Val Arg Phe Gln Ala Lys Asp Ile Leu Glu                 245 250 255 Ala Tyr Gln Ala Met Leu Val Met Thr Glu Leu Ala Thr Arg Thr Thr             260 265 270 Phe Cys Glx         275 <210> 12 <211> 825 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > nucleotide sequence for SEQ ID NO. 11 <400> 12 atgaaactat atctgtcggt tgatatggaa ggaattacgg gactcgtcga tcacacaaat 60 gttctgcggc agaaaaaaaa ttatgaaaga agccgcaaaa taatgacgga tgaagcaaat 120 gcagtaattt atgcaggatt tagagaacag tgctcagaag ttgtggtaaa tgacagtcat 180 tcgagtatga ataatctcct tgttgaacgg cttcatccag aaactcagct tatttcagga 240 agcgtaaaac catattcaat ggtacaggga ttagatcaga cttttgatgg tgctatgttt 300 ctaggatatc atgctaaagc atccatgcct ggtgtcatgt ctcattcgat gatatggggt 360 gctcgcaata tgtacataga cgatacgaat attggagagt taggcttcaa tgcatatgtc 420 gcaggctatt acggcgtgcc agttttaatg gtagtcggtg atgaccaaac ggcgttggaa 480 gcacagcagc ttattccaaa cgtgacgact gctatcgtca aacaggccat ttcacgttct 540 gcagccaaaa cattaacccc taagaaagca gaacaattac ttcaagaaaa aacagccgca 600 gctattcaac atagacacct tgttaaacct ttacttccac ctaaacatcc aaccttacga 660 atagagtttg caaattacgg tcaagcagag tgggcgcact taatgccggg cacagaaatt 720 gagcctggaa cgacgactgt tcggtttcaa gcaaaagata ttttagaagc ttatcaggcc 780 atgcttgtta tgactgaatt agcgacgcgc acaacattct gttag 825 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SEQ ID No. 8 <400> 13 tcgatgatag ctggtgctcg caata 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> Reverse primer for SEQ ID NO. 8 <400> 14 atgagacatg acaccaggca tggat 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SEQ ID No. 10 <400> 15 tcgatgatat atggtgctcg caata 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> Reverse primer for SEQ ID NO. 10 <400> 16 atgagacatg acaccaggca tggat 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SEQ ID No. 12 <400> 17 tcgatgatat ggggtgctcg caata 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> Reverse primer for SEQ ID NO. 12 <400> 18 atgagacatg acaccaggca tggat 25

Claims (14)

서열번호 1의 아미노산 서열, 또는 서열번호 1과 90% 이상의 상동성을 가지는 아미노산 서열을 포함하는 D-입체특이적 아미노산 아미다아제.A D-stereospecific amino acid amidase comprising an amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having 90% or more homology with SEQ ID NO: 1. 청구항 1에 있어서,
상기 서열번호 1과 90% 이상의 상동성을 가지는 아미노산 서열은 서열번호 7, 서열번호 9 및 서열번호 11로 이루어진 군에서 선택되는 적어도 하나인 D-입체특이적 아미노산 아미다아제.The method according to claim 1,
Wherein the amino acid sequence having 90% or more homology with SEQ ID NO: 1 is at least one selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11. 청구항 1 또는 청구항 2의 D-입체특이적 아미노산 아미다아제를 암호화하는 유전자.A gene encoding the D-stereospecific amino acid amidase of claim 1 or claim 2. 청구항 3에 있어서,
상기 유전자는 서열번호 2, 서열번호 8, 서열번호 10 및 서열번호 11로 이루어진 군에서 선택되는 적어도 하나의 염기 서열로 이루어진 것을 특징으로 하는 유전자.The method of claim 3,
Wherein the gene comprises at least one base sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 11. 청구항 3의 유전자를 포함하는 재조합 발현벡터.A recombinant expression vector comprising the gene of claim 3. 청구항 5의 재조합 발현벡터가 숙주세포에 도입된 형질전환체.A transformant wherein the recombinant expression vector of claim 5 is introduced into a host cell. 청구항 6에 있어서,
상기 숙주세포는 대장균인 것을 특징으로 하는 형질전환체.The method of claim 6,
Wherein the host cell is Escherichia coli. 청구항 1의 D-입체특이적 아미노산 아미다아제를 유효성분으로 포함하는 D-아미노산 생산용 조성물.A composition for producing D-amino acid comprising D-stereospecific amino acid amidase of claim 1 as an active ingredient. 청구항 6의 형질전환체를 배양하는 단계; 및
상기 형질전환체의 배양물로부터 D-입체특이적 아미노산 아미다아제를 분리하는 단계를 포함하는 D-입체특이적 아미노산 아미다아제의 생산 방법.Culturing the transformant of claim 6; And
And separating the D-stereospecific amino acid amidase from the culture of said transformant. 청구항 1의 D-입체특이적 아미노산 아미다아제를 아미노산 아미드와 반응시키는 단계;를 포함하는 D-아미노산 생산 방법.Reacting the D-stereospecific amino acid amidase of claim 1 with an amino acid amide. 청구항 10에 있어서,
상기 D-입체특이적 아미노산 아미다아제와 아미노산 아미드의 반응 생성물로부터 D-아미노산을 회수하는 단계;를 더 포함하는 것을 특징으로 하는 D-아미노산 생산 방법.The method of claim 10,
And recovering the D-amino acid from the reaction product of the D-stereospecific amino acid amidase and the amino acid amide. 청구항 6의 형질전환체를 아미노산 아미드의 존재 하에서 배양하는 단계;를 포함하는 D-아미노산 생산 방법.6. A method for producing D-amino acid comprising culturing the transformant of claim 6 in the presence of an amino acid amide. 청구항 12에 있어서,
상기 형질전환체된 배양물로부터 D-아미노산을 회수하는 단계;를 더 포함하는 것을 특징으로 하는 D-아미노산 생산 방법.The method of claim 12,
And recovering the D-amino acid from the transformed culture. 청구항 10 또는 청구항 12에 있어서,
상기 D-아미노산은 D-트레오닌인 것을 특징으로 하는 D-아미노산 생산 방법.The method according to claim 10 or 12,
Wherein the D-amino acid is D-threonine.
KR1020180120620A 2017-10-27 2018-10-10 Novel D-stereospecific amino acid amidase and mutants thereof, and method for preparing D-amino acid using the same KR102118898B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170141116 2017-10-27
KR1020170141116 2017-10-27

Publications (2)

Publication Number Publication Date
KR20190047602A true KR20190047602A (en) 2019-05-08
KR102118898B1 KR102118898B1 (en) 2020-06-05

Family

ID=66580531

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180120620A KR102118898B1 (en) 2017-10-27 2018-10-10 Novel D-stereospecific amino acid amidase and mutants thereof, and method for preparing D-amino acid using the same

Country Status (1)

Country Link
KR (1) KR102118898B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010077613A (en) * 2000-02-03 2001-08-20 복성해 A New thermophilic bacterium Brevibacillus borstelensis BCS-1 and A thermostable D-stereospecific amino acid amidase produced therefrom
KR20030006724A (en) * 2001-07-14 2003-01-23 한국생명공학연구원 Novel d-stereo specific amino acid amidase, gene thereof, preparation method thereof and production method of d-amino acid by using the same

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010077613A (en) * 2000-02-03 2001-08-20 복성해 A New thermophilic bacterium Brevibacillus borstelensis BCS-1 and A thermostable D-stereospecific amino acid amidase produced therefrom
KR20030006724A (en) * 2001-07-14 2003-01-23 한국생명공학연구원 Novel d-stereo specific amino acid amidase, gene thereof, preparation method thereof and production method of d-amino acid by using the same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Eur J Biochem.,267(7):2028-2035(2000.4.) *
J Ind Microbiol Biotechnol.,69(2):980-986(2003.2.) *

Also Published As

Publication number Publication date
KR102118898B1 (en) 2020-06-05

Similar Documents

Publication Publication Date Title
JP5232247B2 (en) L-succinylaminoacylase and method for producing L-amino acid using the same
JPH08333395A (en) Human proinsulin derivative and production of human insulin
JP4672815B2 (en) L-succinylaminoacylase and method for producing L-amino acid using the same
KR20140080282A (en) Method for preparing psicose from fructose by using D-psicose 3-epimerase
RU2669996C2 (en) Novel mutant ornithine decarboxylase protein and use thereof
KR102212488B1 (en) A Novel Enzyme for Production of D-threonine, and A Method for Sterospecific Preparing D-threonine Using The Same
CN109295023B (en) Glutamate oxidase mutant, nucleic acid molecule, application and method for preparing ketoglutaric acid
KR102118898B1 (en) Novel D-stereospecific amino acid amidase and mutants thereof, and method for preparing D-amino acid using the same
CN109136209B (en) Enterokinase light chain mutant and application thereof
KR101708974B1 (en) Novel sucrose isomerase and process for preparing the same
KR20180041377A (en) A Novel alpha-neoagarobiose hydrolase from Gayadomonas joobiniege G7 and use thereof
JP6510733B2 (en) O-acetylhomoserine sulfhydrylase mutant and method for producing L-methionine using the same
KR102207688B1 (en) A Novel Enzyme for Production of D-threonine, and A Method for Preparing D-threonine Using The Same
KR101725454B1 (en) Gene encoding lysine decarboxylase derived from H. alvei, recombinant vector, host cell and method for producing cadaverine using the same
KR20200045978A (en) A Novel Alcohol Dehydrogenase and Mutants thereof, and A Method for Preparing Aldehyde Compounds Using The Same
KR101965210B1 (en) Novel isoprene synthase, and method for preparing isoprene using the same
CN110951711B (en) Esterase with activity of degrading chiral ester and coding gene and application thereof
KR20080055588A (en) Novel n-acetylglucosamine-2-epimerase and method for producing cmp-neuraminic acid using the same
ES2963672T3 (en) Arylalkylamine N-acetyltransferase and uses thereof
KR102424603B1 (en) A Mutants of Alcohol Dehydrogenase, and A Method for Preparing Aldehyde Compounds Using The Same
KR20160144258A (en) Enzyme Complex of Succinic Acid Synthetases and Producing Method of Succinic Acid Using the Same
JP2011067105A (en) Method for degrading unsaturated aliphatic aldehyde by aldehyde dehydrogenase originated from microorganism
WO2023004772A1 (en) Fructosamine deglycase vector, transgenic cell line and genetically engineered bacterium expressing fructosamine deglycase, and use of fructosamine deglycase
KR20230077068A (en) A Mutants of CYP153A33 Enzyme, and A Method for Preparing α,ω-diol Compounds Using The Same
KR101715882B1 (en) - - Novel -caprolactam convertase and method for preparing -caprolactam using the same

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right