KR20190045686A - multi-well magnetic bead pipettor for nucleic acids purification by using magnetic nanoparticle - Google Patents

Abstract

The present invention relates to a pipette-shaped magnetic particle separation device comprising 8 to 96 magnetic bodies. According to the present invention, provided is the pipette-shaped magnetic particle separation device manufactured to prevent direct coupling of magnetic bodies and magnetic particles by allowing an 8-strip PCR tube or a 96-well PCR plate to be attached/detached thereto/therefrom. By using the magnetic particle separation device, nucleic acids and proteins can be simultaneously isolated and purified from 8 to 96 samples by using magnetic particles. Therefore, genomic materials can be effectively and very easily isolated and purified from a large number of samples.

Description

The present invention relates to a multi-well magnetic particle pipettor for purifying nucleic acid using magnetic particles,

The present invention relates to a multi-well magnetic particle pipettor for purifying nucleic acid using magnetic particles.

The purpose of purifying a sample using magnetic particles is to use a large amount of samples in an efficient high throughput method, and is widely used in various fields such as nucleic acid and protein purification, sample concentration and detection. In the case of nucleic acid purification using most magnetic particles, nucleic acid purification is performed using a magnetic stand type product such as DynaMag ™ -2 Magnet of Thermo fisher and 12-tube magnet of Qiagne for a small quantity of samples. Including Thermo fisher's MagMAX ™ Express Particle Processor equipment, KingFisher Purification System automation equipment, and refining methods using expensive automation equipment such as Promega's maxwell® 16 series and Biomek® FX series.

On the other hand, in the case of the magnetic particle separation apparatus disclosed in Korean Patent No. 10-1655233 (entitled "Multi-type magnetic particle separation stand"), there is a limitation in the nucleic acid and protein purification operations by a high throughput method have. Since the presently developed magnetic particle separating apparatus is provided in a stand type in most cases, it is limited in mass processing, and the separating apparatus using the automatic equipment is not only costly but also easy to carry, such as field diagnosis, ) Nucleic acid detection is required and has such limitations as volume, weight and power supply.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have made extensive efforts to improve the limitations of the conventional magnetic particle separation process. As a result, the inventors of the present invention have developed a multi well magnetic particle pipettor, which is a pipetting particle separating apparatus having eight channels and 96 channels, thereby completing the present invention.

Accordingly, it is an object of the present invention to provide a multi-well magnetic bead pipettor.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a multi-well magnetic particle pipettor (multi) for extracting a nucleic acid or protein from a multi-well plate using magnetic beads, -well magnetic bead pipettor:

(a) The lower plate operation switch 120 and the lower plate operation spring 130 which can be engaged with the upper plate 300 and operate the up and down movement of the lower plate 200 by using the lower plate operation switch 120 and the lower plate operation spring Handle portion (H);

(b) An upper plate 300 engageable with the upper portion of the handle portion H and the lower plate 200;

(c) A lower plate 200 engageable with a lower portion of the upper plate 300 and an upper portion of the magnetic material fixing rods 400; And

(d) (I) comprising a plurality of magnetic immobilizing rods (500) which are (i) a plurality of magnetic bodies (100) and (ii) the magnetic bodies (100) are combined;

A magnetic particle separator in the form of a pipette,

The magnetic immobilizing bar 500 includes a tube groove rubbing part 520 at the lower end and an 8-strip PCR tube or a 96-well PCR plate 96- well PCR plate) can be attached and detached.

The present invention is a pipette type magnetic particle separating device comprising a handle portion (H), an upper plate (300), and a lower plate (200) pipet tip portion (I). In the present invention, the handle portion H is coupled to the upper plate 300, and the lower plate can be moved up and down by using the lower plate operation switch 120 interlocked with the lower plate operation spring 130 inside the handle, Is designed to separate the PCR tubes and plates coupled by frictional force with the tube hole rubbing portion 520 located below the magnetic material immobilizing rods 500 of the tip portion I. The magnetic substance 100 is coupled to the tube hole rubbing-magnetic-substance fixing groove 510 of the magnetic substance fixing rod. When the PCR tube and the plate are attached, the magnetic particles are bonded to the outer wall of the PCR tube and the plate, and the magnetic particles attached to the outer wall are separated when the PCR tube and the plate are detached using the lower plate operation switch. The present invention is a pipette-type magnetic particle separating apparatus using adhesion and separation of magnetic particles, and is a multi-well magnetic particle pie (hereinafter referred to as " pellet ") which extracts nucleic acid or protein from a multi-well plate using magnetic beads A multi-well magnetic bead pipettor is provided.

The inventors of the present invention have made extensive efforts to improve the limitations of the conventional magnetic particle separation process, and as a result, the inventors of the present invention have found that a magnetic particle separator of a pipette type having 8 to 96 induction magnet fixing portions, multi -well) developed a multi-well magnetic bead pipettor.

Hereinafter, the configuration of the present invention will be described in detail.

Configuration (a): Handle portion (H)

The handle portion H may have a rod shape, for example, in the shape of a cylinder or a square column, but is not limited thereto.

The handle portion (H) is engageable with the top plate (300). The handle portion includes a support pipe 110, a lower plate operation switch 120, a lower plate operation spring 130, and a support pipe fixing portion 140 (see FIG. 1) , And the support tube fixing part 140 is fixed to the upper plate by a fixing screw T1 (see FIG. 3). The lower plate operation switch 120 and the lower plate operation spring are used to manipulate the lower plate 200 to move up and down.

The fixed cap 1 is a lower plate operation switch fixing cap and may be made of a material such as plastic, steel, stainless steel, or aluminum.

In the handle portion, the support pipe 100 may be made of plastic, steel, stainless steel or aluminum, preferably aluminum.

Configuration (b): The upper plate 300

The upper plate 300 serves as a support for fixing and connecting the handle portion H and the lower plate. The top plate is provided with a fixing screw T1 for fixing the supporting tube fixing part 140 and the fixing screw T1 and is provided with a fixing screw T2, (t2 / 220) are formed (see Figs. 3 and 5).

According to an embodiment of the present invention, the upper plate 300 and the lower plate 200 are provided in parallel, and the upper plate is engageable with the lower portion of the handle portion H and the upper portion of the lower plate 200.

On the other hand, the upper plate is formed with a fitting groove (t2 / 220) for fixing the upper plate and the lower plate (see FIGS. 3 and 5).

The multi-well magnetic particle pipettor according to the present invention may include a pipet tip fixing plate 400 disposed between the upper plate 300 and the lower plate 200 and attached to the lower plate and having a plurality of magnetic substance fixing rods arranged and combined, . ≪ / RTI > The pipet tip fixing plate 400 may be fixed to the lower plate through a fixing screw T3 (see Fig. 5). The pipet tip fixing plate is provided with a pipet tip fixing groove 410 for coupling a magnetic body through a fixing screw T3 (see Fig. 5A).

According to an embodiment of the present invention, the pipet tip fixing plate 400 is magnetically detachable from the bar magnet 3 mounted on the upper plate

In the present invention, the upper plate is generally plate-shaped, but in the case of a pipettor in which two rows of PCR tubes are coupled, the upper plate may be formed into an H-shape as shown in FIG.

Configuration (c): Lower plate 200

The lower plate 200 is engageable with the lower portion of the upper plate 300 and the upper portion of the magnetic material fixing rods 500 in the pipet tip portion I as a portion for fixing the pipet tip portion I,

According to an embodiment of the present invention, the lower plate 200 is formed with the magnetic material fixing bar passage grooves 210 so that the magnetic material fixing rods 500 can be engaged. The magnetic substance fixing rod 500 can be directly coupled to the lower plate through the fixing screw T3.

According to another embodiment of the present invention, the lower plate 200 can be coupled with the magnetic substance fixing rods 500 using the pipet tip fixing plate 400. In this case, the magnetic substance fixing rod 500 is formed with the fixing screw T3 coupling groove t3 so that the fixing screw T3 can be coupled. The ferrule tip fixing plate 400 is mounted on the lower plate through the ferrule fixing rod passing groove 210 in a state where the ferrule fixing rods 500 are coupled to the piet tip fixing plate 400 (see Fig. 5).

Configuration (d): Pipe tip portion (I)

The pipette tip portion I includes (i) a plurality of magnetic bodies 100, and (ii) a plurality of magnetic body fixing rods 500 to which the magnetic bodies 100 are coupled.

In the present invention, the number of the magnetic bodies 100 may be plural, for example, 8 to 100 or 8 to 96. [ According to one embodiment of the present invention, the magnetic body 100 is an induction magnet.

In the present invention, the number of the magnetic substance fixing rods 500 may be plural. According to an embodiment of the present invention, the number of the magnetic material fixing rods 500 is 8 (1 row) to 96 (12 rows); Or 12 (1 row) to 96 (8 rows). For example, the number of magnetic immobilizing rods can be induced to eight magnetic particle separations by mounting only one row; Two rows can be attached to the sixteen magnetic particle separators; One row of magnetic immobilizing rods can be mounted to be led to twelve magnetic particle separators; Two rows of magnetic immobilizing rods could be mounted and guided to the 24 magnetic particle separators; It can be deformed according to the number of 1 to 96 magnetically fixed rods.

In the present invention, the magnetic substance 100 and the magnetic substance immobilizing bar 500 may have a columnar shape, and may be a columnar or polygonal columnar shape. At the lower end of the magnetic substance fixing rod 500, a magnetic substance fixing groove 510 to which a magnetic substance can be coupled is formed.

The lower end of the magnetic immobilizing rod 500 is formed with a tube hole rubbing part 520 so that the PCR tube can be inserted and fitted, and has a smaller diameter than the upper end of the magnetic substance fixing rod. In the present invention, the tube hole rubbing portion 520 at the lower end of the magnetic substance fixing rod 500 is inserted into an 8-strip or 12-strip PCR tube or a 96-well PCR plate and a frictional force (Interference fit). The tube hole rubbing portion 520 at the lower end of the magnetic substance fixing rod 500 is fabricated by a mold process and is fitted into the interior of the 8-strip / 12-strip PCR tube or the well / tube of the 96 well / tube plate .

In the present invention, the length, form size, and number of the magnetic substance fixing rods of the pipette tip portion (I) of the magnetic pipettor are not limited and can be designed and used depending on the container type and purification method of the purified sample.

According to an embodiment of the present invention, in order to extract a nucleic acid from a large amount of sample using an 8-strip or 12-strip PCR tube, The magnetic substance fixing rods are combined with the magnetic substance by the magnetic substance fixing grooves 510 to which the magnetic substance 100 is coupled (refer to FIG. 5).

According to another embodiment of the present invention, in order to be able to extract nucleic acid from a large amount of sample in a 96-well plate, a top plate 300 is provided with a 96 rod- ) Were combined in a form of 8 rows and 12 columns, and the magnetic substance fixing rods were combined with the magnetic substance bodies with the magnetic substance fixing grooves 510 to which the magnetic bodies 100 were coupled.

In particular, a 96-well PCR plate was designed to be able to mount and detach a 96-well PCR plate to a magnetic fixation rod so that magnetic material and magnetic particles can be adsorbed and desorbed during the purification of the sample. The 96-well PCR plate is designed to be mounted under the lower plate using the frictional force of the tube hole rubbing part 520 in the magnetic substance fixing rod. The lower plate operation switch 120 is used to move the lower plate 200 downward The 96 well PCR plate can be pushed out (see FIG. 11). That is, the pipettor of the present invention can detach an 8-strip PCR tube or a 96-well PCR plate using the lower plate manipulation switch.

According to the number of samples and the method of purifying the nucleic acid and the protein in the multi-well magnetic particle of the present invention, the arrangement of the magnetic immobilizing rods 500 in the case of the 96-well type can be subdivided as follows.

8 rows x 1 row = 8 magnetic fixing rods,

8 columns x 2 rows = 16 magnetic fixing rods,

8 rows x 3 rows = 24 magnetic fixing rods,

8 rows x 4 rows = 32 magnetic fixing rods,

...

8 rows x 11 rows = 88 magnetic fixed rods,

8 rows x 12 rows = 96 magnetic fixation rods.

or

12 rows x 1 row = 12 magnetic fixation rods,

12 columns x 2 rows = 24 magnetic fixation rods,

12 rows x 3 rows = 36 magnetic fixing rods,

12 rows x 4 rows = 48 magnetic fixing rods,

...

12 columns x 7 rows = 84 magnetic fixing rods,

12 columns x 8 rows = 96 magnetic fixing rods.

In the case of the 96 well format, the arrangement and shape of the magnetic immobilizing rods can be arranged as described above, and the magnetic body and the magnetic particle binding can be masked directly by using 8-strip PCR tubes, 12-strip PCR tubes, However, when the masking tube is manufactured in various shapes using a mold, the size and length arrangement of the magnetic substance fixing rods are not limited to the shape of 96 wells.

(I) the "bar magnet 3" mounted on the upper plate and (ii) the magnetic substance immobilizer rod 500 attached to the lower plate 200 or the pipet tip fixing A " set screw T3 " for fixing to the plate 400 can be made magnetically attachable and detachable (see Figs. 4 and 5). That is, the pipet tip portion I can be attached to and detached from the upper plate by the magnetic force of the bar magnet mounted on the upper plate 300

10 is a multi-pipette magnetic particle separator in which a magnetic substance 100 is mounted on 96 magnetic substance fixing rods 500. The magnetic particle separator includes a tube hole friction portion A switch 120 for moving the lower plate, a switch restoring spring 130, a support pipe 110 for supporting the switch and the spring, a support pipe 110 for supporting the switch and the spring, A support pipe fixing part 140 for fixing the support pipe 140, and fixing screws T1 and T2. The support pipe fixing portion has a ring shape and a fixing screw groove t1 is formed. The basic coupling relationship of the magnetic particle pipettor configuration of FIG. 10 is the same as that of the FIG. 3 pipettor.

In the present invention, the material of the handle portion H, the upper plate 300, the lower plate 200, and the pipet tip portion I which are components of the multi-well magnetic particle pipettor is made of plastic, metal (for example, iron, stainless steel, ), And may preferably be made of aluminum.

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to a multi-well magnetic bead pipettor for extracting a nucleic acid or a protein.

(b) The pipettor of the present invention is a device for separating a nucleic acid or protein from a sample using a multi-well plate (for example, a 96-well plate) and a plurality of magnetic / magnetic immobilizing rods indirectly bonding with magnetic particles.

(c) The apparatus of the present invention can replace the existing expensive equipment and equipment, and can be easily performed in nucleic acid purification and analysis in a large amount of samples. In addition, it is easy to change the composition according to various sample forms, And can be efficiently used for field diagnosis.

Figure 1 is a 16-channel perfection of a multi-well magnetic bead pipettor of the present invention.
FIG. 2 is a block diagram of a multi-well magnetic particle pipettor according to the present invention.
FIG. 3 is a schematic exploded view of a multi-well magnetic bead pipettor of the present invention.
4 is a detailed exploded view of a multi-well magnetic bead pipettor top plate 300 of the present invention. (I) the "bar magnet (3)" mounted on the upper plate and (ii) the magnetic substance immobilizing rod (2) attached to the upper plate, 500 ") to the pipette tip holding plate 400 can be magnetically attached and detached (see FIGS. 4 and 5). The pipette tip fixing plate 400 may be coupled to the pipette tip fitting groove 320. At this time, the fixing screw T3 coupled to the pipette tip fixing plate 400 and the bar magnet of the upper plate are magnetically detached.
FIG. 5 (a) is a detailed exploded view of a multi-well magnetic bead pipettor pipet tip portion I of the present invention, and FIG. 5 (b) (I) portion and a lower plate (200).
FIG. 6 shows an 8-strip PCR tube mounted on a 16-channel magnetic particle pipettor of a multi-well magnetic bead pipettor of the present invention (FIG. 6 (a) and desorption (Fig. 6 (b)).
FIG. 7 is a graph showing the results of a 96-deep well plate using 16-channel type magnetic particle pipetters of a multi-well magnetic bead pipettor of the present invention. plate for the purification of 16 samples.
FIG. 8 shows the results of purification of the PCR product on a 96-deep well plate using a 16-channel type magnetic particle pipettor of the present invention.
FIG. 9 shows the results of purification of bacterial genomic DNA on a 96-deep well plate using a 16-channel type magnetic particle pipettor of the present invention.
FIG. 10 is a 96-channel 96-channel magnetic particle pipetting perfomance of a multi-well magnetic bead pipettor of the present invention.
FIG. 11 is a schematic diagram of a 96-channel magnetic particle pipettor 96-well PCR plate of the present invention mounted and dismounted. FIG.
12 is a schematic diagram of a PCR product purification process using a 96-channel magnetic particle pipettor of the present invention.
13 shows an example of the result of PCR product purification.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are for further illustrating the present invention and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention.

Example

[Figure 1] and [Figure 2] are diagrams illustrating the completeness and configuration of a multi-well magnetic particle pipettor according to an embodiment of the present invention, and Figure 3 is a diagram showing a multi- This shows the overall decomposition of the particle pipettor.

Referring to FIGS. 1, 2 and 3, the multiwell magnetic particle separation pipette of the present invention has a configuration in which eight to 96 pillar-shaped pellets are formed on a top plate 300 for the purpose of extracting nucleic acid from a large amount of samples in a multi- The magnetic substance fixing rods 500 were coupled in the form of 8 rows and 12 columns and the magnetic substance fixing rods were combined with the magnetic substances by providing the magnetic substance fixing grooves 510 to which the magnetic bodies 100 were coupled. The magnetic fixation rod is made of cylindrical aluminum and the magnetic body is made of commercially available 2 ∮ x 6 mm cylindrical neodymium magnet [purchased from: Daejeon Magnet].

An 8-strip PCR tube or an 8-strip PCR tube may be used depending on the type of the pipettor so that the magnetic material 100 and the magnetic particles can not be directly bonded to each other so that the magnetic material and the magnetic particles are desorbed from time to time in the purification process of the sample. A 96-well PCR plate was used and designed to associate with magnetic particles in a form coupled with PCR tubes or PCR plates. The attachment of the multi-well magnetic intrusion pipettor and the plate is designed to be combined with a portion of the tube hole friction portion 520, which is a portion formed by fitting the magnetic substance fixing rod 500 into the inside of the tube, by friction force without an additional fixing device.

The detaching of the plate is performed by pushing down the lower plate 200 using the lower plate operation switch 120 and the switch restoring spring 130 to separate the PCR tube or the PCR plate coupled to the tube hole friction portion 520 . That is, when the 96-well PCR plate is dissociated, it is a multipipette type in which the magnetic substance and the magnetic particles are separated.

The piezot tip portion I for determining the shape of the magnetic substance fixing rod in the multi-well magnetic particle pipettor is formed by fixing the rod magnet 3 and the magnetic substance fixing rod 500 coupled to the upper plate to the pipet tip fixing plate 400 FIG. 4 and FIG. 5 show an exploded view of the upper plate and an exploded view of the pipet tip portion. FIG.

FIG. 6 is a representative view of a 16-channel type magnetic particle pipetter in a multi-well magnetic particle pipettor, and shows an 8 column PCR tube and a mounting and desorption type.

[Figure 7] is a schematic diagram of a PCR product purification process on a 96-deep well plate using a 16-channel magnetic particle pipettor. In detail, the position of the pipet tip of the 16-channel magnetic particle pipettor is ideally located in columns 1 and 7 out of 12 columns on a 96-well plate, and the process of purifying nucleic acid using the same is as follows .

Firstly, the solution of 96 deep-well plate is constructed as follows.

Columns 1 and 7: binding buffer (B)

Columns 2 and 8: Wash buffer 1 (W1)

Columns 3 and 9: Wash buffer 2 (W2)

Column 4 and column 10: Wash buffer 3 (washing buffer, W3)

Columns 5 and 11: elution buffer (E)

Column 6 and column 12: Blank

The procedure for purifying the nucleic acid after preparing the solution in the 96-well plate as described above is as follows:

1. Binding nucleic acid to magnetic particles by mixing PCR product amplified in column 1 with magnetic particles

2. Step of attaching magnetic particles by mounting 8-strip PCR tubes on a 16-channel magnetic particle pipettor, placing the pipet tip portions on columns 1 and 7

3. The magnetic particles attached to the magnetic particle pipettor were transferred to columns 2 and 8, and the 8-strip PCR tubes were separated using a lower plate separator of the pipettor to remove the washing buffer 1 ( washing bffer1) solution (left for 1 minute)

4. The magnetic particles dispersed in the washing buffer 1 are put back into the 8-strip PCR tube and the magnetic particles are collected on the tip portion (left for 1 minute)

5. The magnetic particles collected in step 4 are moved to the third and the 9th columns of the pipettor tip, dispersed in the washing buffer 2 as in step 3, and collected as in step 4

6. The magnetic particles collected in step 5 are moved to the fourth and tenth rows of the pipettor tip, dispersed in the washing buffer 2 as in step 3, and collected as in step 4

7. Step of evaporating the solution by placing the magnetic particles collected at the step 6 for 5 minutes at room temperature

8. In step 7, the dried magnetic particles attached to the pipettor are transferred to columns 5 and 10, the 8-strip PCR tubes are separated, dispersed in the elution buffer, left for 5 minutes,

≪ / RTI >

In order to purify the PCR product using the above procedure, the PCR product was purified using the HiGene (TM) PCR Purification Kit (Magnetic Bead Type) manufactured by Biofact Co., Ltd. as shown in FIG. (5 '- agagtttgatcctggctcag - 3') primer, which is a primer for 16S ribosomal DNA (16S rDNA) amplification, used for identification of microorganisms from E. coli strain DH5α, and 1492R '-tacggytaccttgttacgactt-3') primer to obtain a 1275 bp PCR product. A solution of HiGene ™ PCR Purification Kit (Magnetic Bead Type) from Biofact Co., Ltd. was dispensed into a 96-well plate as follows .

Column 1 and Column 7: 250ul binding buffer

2 columns and 8 columns: 700ul wash buffer 1 (washing buffer)

Columns 3 and 9: 700ul Wash buffer 1 - Use the same solution as column 2 and column 8

4 rows and 10 columns: 700ul Wash buffer 2 - 100% ethanol use

Columns 5 and 11: 50ul elution buffer

Column 6 and column 12: Blank

Fig. 8 is a graph showing the results obtained by combining 50ul of the 16S rDNA PCR product amplified from E. coli strain DH5α and 20ul of magnetic particles contained in HiGene ™ PCR Purification Kit (Magnetic Bead Type) Buffer, and then purified and electrophoresed on a 96-well plate prepared in the above procedure using a 16-channel magnetic particle pipettor. Repeating the same procedure using the same wash buffer for columns 2 and 3 or columns 8 and 9 is a common method of increasing the purity when purifying nucleic acids and using 100% ethanol as the wash buffer for columns 4 and 10, To evaporate the remaining ethanol rapidly.

In order to extract the bacterial genomic DNA using the above procedure, a solution of the kit phase (Bacterium, cultured cell) as shown in FIG. 7 was prepared by using the Multi Bead (TM) Genomic DNA Pre Kit Was subjected to nucleic acid purification after being dispensed into a 96-well-well plate as follows per well.

Columns 1 and 7: 600 μl Lysis and binding buffer -> 200 μl of MC1 (-) buffer on the kit, 200 μl of MC2 buffer and 200 μl of isopropanol

Columns 2 and 8: 700 ul Wash buffer -> 700 μl of MPW2 buffer on kit

Columns 3 and 9: 700 μl Washing buffer 1 -> 700 μl of MPW2 buffer on kit

Columns 4 and 10: 700 μl Washing buffer 2 - 100% ethanol used

Columns 5 and 11: 100 μl Elution buffer

FIG. 9 shows that DH5α strain was cultured in LB culture medium for 16 hours, and 200 ul of the culture solution was added to the buffer 1 and 7 in a lysis and binding buffer and mixed with a buffer. Thereafter, 16-channel type magnetic It is the result of electrophoresis after purification of bacterial genomic DNA using particle pie petitor.

In this embodiment, a nucleic acid purification process using a multi-well magnetic particle pipettor on a 96-well plate with a small amount of 20 or less samples is shown. In the present invention, the multi-well magnetic particle pipettor can be applied to nucleic acid and protein purification even in a large amount of samples. For example, a 96-channel magnetic particle pipettor as shown in FIG. To purify nucleic acids and proteins. In the 16-channel type magnetic particle pipettor described above, the 8-strip PCR tube can be used to induce coupling and dissociation between the magnetic particle pipettor and the magnetic particles. Similarly, 96-channel (96-channel) magnetic particle pipetters can also induce coupling and dissociation between magnetic particles and pipetters using desorption and attachment of 96-well PCR plates. [Figure 11]

In order to purify the nucleic acid from a large amount of sample, the following type of solution preparation is required.

Plate # 1: binding buffer

No. 2 plate: washing buffer 1 (washing buffer 1)

No. 3 plate: washing buffer 2

No. 4 plate: washing buffer 3

5 plate: elution buffer

FIG. 12 is a schematic diagram of a PCR product purification process using a 96-channel magnetic particle pipettor. In order to perform PCR product purification using a 96-channel magnetic particle pipettor, a buffer of HiGene (TM) PCR Purification Kit (Magnetic Bead Type) manufactured by Biopharmaceutical Co., Ltd. per well was dispensed in the following manner Respectively.

1 plate: 250 [mu] l binding buffer

No. 2 plate: 700 μl Wash buffer 1 (washing buffer)

Plate No. 3: 700 μl Washing buffer 1 (washing buffer) - Use the same solution as columns 2 and 8

Plate No. 4: 700 μl Washing buffer 2 - Use 100% ethanol

5 plate: 50 μl Elution buffer

[Fig. 13] is a graph showing the results obtained when 20 μl of the magnetic particles contained in 50 μl of the 16S rDNA PCR product amplified from the E. coli strain DH5α and the HiGene ™ PCR Purification Kit (Magnetic Bead Type) Buffer, and electrophoresis after purification of the nucleic acid on a 96-well plate prepared in the above procedure using a 96-channel magnetic particle pipettor.

H: Handle portion
I: Pipette tip portion
N: Nut
T1, T2, T3: Set screw
t1, t2, t3: Screw fixing groove
1: Lower plate operation switch fixing cap
2: Lower plate fixing screw groove
3: Bar magnet
100: magnetic substance
110: Support tube
120: Lower plate operation switch
130: Lower plate operating spring
140:
150: Support tube fixing screw groove
200: lower plate
210: magnetic material fixing rod passing groove
220: Lower plate operation switch coupling groove
300: top plate
310: rod magnet attachment groove
320: Pipette tip mating groove
400: pipet tip fixing plate
410: Pipette tip fixing groove
500: magnetic rod
510: magnetic material fixing groove
520: tube hole friction portion

Claims (10)

A multi-well magnetic bead pipettor for extracting nucleic acid or protein from a multi-well plate using magnetic beads, comprising:
(a) a lower plate operating switch 120 and a lower plate operating spring 130, which are engageable with the upper plate 300 and are movable up and down by using the lower plate operating switch 120 and the lower plate operating spring, A handle portion H for operating the handle;
(b) an upper plate 300 engageable with the upper portion of the handle portion H and the lower plate 200;
(c) a lower plate 200 engageable with the lower portion of the upper plate 300 and the upper portion of the magnetic substance fixing rods 400; And
(I) comprising a plurality of magnetic immobilizing rods (500) to which the magnetic bodies (100) are coupled, the plurality of magnetic bodies (100) );
A magnetic particle separator in the form of a pipette,
The magnetic immobilizing bar 500 includes a tube groove rubbing part 520 at the lower end and an 8-strip PCR tube or a 96-well PCR plate 96- well PCR plate) can be attached and detached.
The multi-well magnetic particle pipettor according to claim 1, further comprising a pipet tip fixing plate (400) disposed between the upper plate (300) and the lower plate (200) Magnetic particle pyroteater.
3. The magnetic particle pipettor according to claim 2, wherein the pipet tip fixing plate (400) is magnetically detachably attachable to the bar magnet (3) mounted on the upper plate.
The magnetic particle pipettor according to claim 1, wherein the number of the magnetic bodies (100) is 8-100.
The magnetic particle pipettor according to claim 1, wherein the magnetic body (100) is an induction magnet.
The magnetic recording medium according to claim 1, wherein the upper plate (300) and the lower plate (200) are parallel to each other, and a magnetic immobilizing rod passage groove (210) Pipettor.
The method of claim 1, wherein the pipettor is capable of detaching an 8-strip PCR tube or a 96-well PCR plate using the lower plate manipulation switch Magnetic particle pyroteater.
The magnetic particle pipettor according to claim 1, wherein the magnetic substance fixing unit, the upper plate (300), and the lower plate (200) are made of metal or plastic.
The method according to claim 1, wherein the number of the magnetic substance fixing rods (500) is 8 (1 row) to 96 (12 rows); Or 12 (1 row) to 96 (8 rows).
2. The magnetic particle pipettor according to claim 1, wherein the pipet tip portion (I) is detachable and attachable by a magnetic force of a bar magnet mounted on the upper plate (300).

Images