KR20190041680A - Recombinant Microorganism Producing 1-Deoxynojirymicin and Method of Preparing 1-Deoxynojirymicin Using the Same - Google Patents

Abstract

The present invention relates to a recombinant microorganism having 1-deoxynojirimycin (DNJ) producing ability and a process for producing DNJ using the same. When the recombinant microorganism having the ability to produce DNJ according to the present invention is used, DNJ is produced at a higher concentration than in the prior art, thereby being useful as a pharmaceutical composition through various actions on antidiabetic activities, anticancer activities, antiviral activities, anti-obesity activities, treatment of HIV infection, and treatment of Gaucher′s disease.

Description

Technical Field The present invention relates to a recombinant microorganism having 1-deoxynojirimycin producing ability and a method for producing 1-deoxynojirimycin using the recombinant microorganism.

The present invention relates to a recombinant microorganism having 1-deoxynojirimycin producing ability and a process for producing 1-deoxynojirimycin using the recombinant microorganism. More particularly, the present invention relates to a microorganism having fructose- A gene encoding 4-aminobutyrate transaminase, a gene encoding inositol or phosphatidylinositol phosphatase, a gene encoding oxidoreductase having I236V mutation, 1-deoxynojirimycin, in which a gene encoding fructokinase or a gene encoding fructose-1,6-bisphosphatase is introduced or amplified And a process for producing 1-deoxynojirimycin using the recombinant microorganism.

1-Deoxynojirimycin (DNJ), a multiple hydroxylated alkaloid, is a glucose analogue in which the oxygen atom of the pyranose ring has been replaced with an NH group. DNJ exhibits important biological activities such as antidiabetic, anticancer and antiviral activity and inhibits? -Glucosidase (Asano N., Curr Top Med Chem ., 3 : 471-84, 2003; Kang KD et. al., J Microbiol., 49 : 431-40, 2011). Has in recent years, has an anti-obesity activity, used to treat HIV infection, Gaucher disease therapeutic agent (Kong WH et al, J Agric Food Chem, 56: 2613-9, 2008; Shimizu H. et al, AIDS; 4:.. 975 -80, 1990; Yu L. et al., Bioorg Med Chem. 14 : 7736-44, 2006). These diverse potential activities have led to the development and production of DNJ and analogs in the functional food and pharmaceutical industries.

1-deoxynojirimycin is isolated from Morus alba L. or Bombyx mori L. (Aasno, N. et al, J. Agric. Food Chem. , Vol . 49 , (Evans, SV et al, Phytochemistry, vol . 24, pp . 1953-1955, 1985; Murao, S. et al , Agric Biol Chem, vol.44, pp.219-221 , 1980;... Yamada, H. et al, Shoyakugaku Zasshi, vol.47, pp.47-55, 1993) and the microorganism of the strap Sat My process and (Ezure, Y. et al, Agric. Biol., Chem. , Vol . 49 , pp . 1119-1125, 1985; Hardick, DJ et al, Biochemistry, vol. , pp. 6707-6716, 1993; Shibano, M. et al, Phytochemistry, vol . 65, pp . 2661-2665, 2004). There is also a method of chemical synthesis (Bernotas RC et al., Tetrahedron Lett., 26 : 1123-6; 1985; Iida H. et al, J Org Chem., 52 : 3337-42, 1987; Schaller C. et al., Carbohydr Res ., 314 : 25-35, 1998).

On the other hand, the method of extracting from plants has difficulties in purification and very low yields due to its numerous components and similar structures, while the method of producing 1-deoxynojirimycin from microorganisms can be produced in a short time Unlike the plant extraction method, it does not destroy the environment and has an advantage of producing 1-deoxynojirimycin with a high yield. However, despite such usefulness as described above, it is difficult to produce at industrial level because of complicated culture medium conditions or growth conditions of microorganisms.

Recently, a gene encoding 4-aminobutyrate transaminase, a gene encoding inositol or phosphatidylinositol phosphatase, a gene coding for an oxidoreductase having an I236V mutation Deoxynojirimycin using a recombinant microorganism into which a gene is introduced is known, but there is a problem in that the concentration and yield of 1-deoxynojirimycin are low (Jiang P. et al, Sci. Rep., 5 : 8563, 2015).

Thus, the present inventors have made intensive efforts to increase the concentration and yield of 1-deoxynojirimycin using recombinant microorganisms produced by a metabolic engineering method. As a result, in the microorganism having the ability to produce fructose-6-phosphate (F6P) A gene encoding 4-aminobutyrate transaminase, a gene encoding inositol or phosphatidylinositol phosphatase, and a gene encoding oxidoreductase having I236V mutation are introduced As a result of further introducing or amplifying a gene encoding fructokinase or a gene encoding fructose-1,6-bisphosphatase into the recombinant microorganism, Deoxynojirimycin and the production amount thereof were remarkably increased compared with that of the present invention, and the present invention was completed It was good.

It is an object of the present invention to provide a recombinant microorganism having 1-deoxynojirimycin-producing ability with increased concentration and yield of 1-deoxynojirimycin.

It is another object of the present invention to provide a process for producing 1-deoxynojirimycin using a recombinant microorganism having 1-deoxynojirimycin producing ability.

In order to achieve the above object, the present invention provides a gene encoding a 4-aminobutyrate transaminase in a microorganism having a fructose-6-phosphate (F6P) producing ability, an inositol or a phosphatidylinositol phosphatase or phosphatidylinositol phosphatase) and a gene encoding an oxidoreductase having an I236V mutation are introduced into a recombinant microorganism, a gene encoding fructokinase or a fructose-1,6-bis A recombinant microorganism having the ability to produce 1-deoxynojirimycin by further introducing or amplifying a gene encoding fructose-1,6-bisphosphatase.

The present invention also provides a method for producing 1-deoxynojirimycin, comprising: (a) culturing the recombinant microorganism to produce 1-deoxynojirimycin; And (b) recovering the produced 1-deoxynojirimycin. The present invention also provides a method for producing 1-deoxynojirimycin.

When the recombinant microorganism having the ability to produce 1-deoxynojirimycin according to the present invention is used, 1-deoxynojirimycin is produced at a higher concentration than in the prior art, and the antidiabetic activity, anticancer activity, antiviral activity, And can be usefully used as a pharmaceutical composition through various actions ranging from anti-obesity activity, HIV infection treatment, and Gaucher disease treatment.

Figure 1 is a representative azasugar structural formula used as a pharmaceutical composition.
Fig. 2 is a schematic diagram showing a metabolic pathway during 1-deoxynojirimycin biosynthesis in the recombinant E. coli of the present invention.
(I) a culture solution of recombinant Escherichia coli containing a TYB gene cluster; (ii) a culture solution of a recombinant Escherichia coli containing a TYB gene cluster 1-deoxynojirimycin).
3B is a calibration curve prepared for quantifying 1-deoxynojirimycin.
4A is a result of mass spectrometry of standard 1-deoxynojirimycin with HR-QTOF.
4B shows the result of mass spectrometry of 1-deoxynojirimycin prepared using the recombinant microorganism of the present invention with HR-QTOF.
5 is a graph showing the production yield of 1-deoxynojirimycin of the recombinant microorganism of the present invention.
6 is a graph showing the yield and cell growth of 1-deoxynojirimycin produced by culturing the strain of E. coli S5 of the present invention.
Figure 7 shows the transcription levels of E. coli piBR181 and E. coli S5 of the present invention.

In the present invention, in a microorganism having the ability to produce fructose-6-phosphate (F6P), a gene encoding 4-aminobutyrate transaminase, a gene coding for inositol or phosphatidylinositol phosphatase Gene, a recombinant microorganism into which a gene encoding an oxidoreductase having an I236V mutation has been introduced, a gene encoding fructokinase or a fructose-1,6-bisphosphatase -bisphosphatase was further introduced or amplified. As a result, it was confirmed that 1-deoxynojirimycin (1-DNJ) can be produced at a higher concentration than the conventional one.

Accordingly, in one aspect, the present invention relates to a gene encoding 4-aminobutyrate transaminase, inositol or phosphatidylinositol phosphatase (inositol or phosphatidylinositol phosphatase) in a microorganism having fructose-6-phosphate (F6P) a gene encoding phosphatidylinositol phosphatase, a gene encoding an oxidoreductase having an I236V mutation, and a gene encoding fructokinase or a fructose-1,6-bisphosphatase- 1,6-bisphosphatase) is introduced or amplified. The present invention also relates to a recombinant microorganism having the ability to produce 1-deoxynojirimycin.

In the present invention, 1-deoxynojirimycin is a kind of azasugar, which is a nitrogen derivative of a sugar in which the piperidine structure replaces the tetrahydropyran structure (Fig. 1 ).

In the present invention, the microorganism may be characterized in that it contains a gene encoding a fructokinase and a gene encoding fructose-1,6-bisphosphatase .

In the present invention, the gene coding for the 4-aminobutyrate transaminase (SEQ ID NO: 1) is gabT1 . The gene encoding inositol or phosphatidylinositol phosphatase (SEQ ID NO: 2) is yktc1 , and the gene encoding the oxidoreductase (SEQ ID NO: 3) is gutB1 , and the genes are derived from Bacillus amyloliquefaciens KCTC1660 ).

In the present invention, the genes gabT1, yktc1 and gutB1 were named TYB gene clusters.

In the present invention, the gene coding for the fructose Tokina claim (fructokinase) is characterized in that the yajF, gene coding for the fructose-1,6-bis phosphatase (fructose-1,6-bisphosphatase) has to be the glpX (Fig. 2).

In the present invention, the gene coding for the fructokinase may be represented by SEQ. ID. NO. 4, and the fructose-1,6-bisphosphatase may be The coding gene may be characterized by being represented by SEQ ID NO: 5.

In the present invention, yajF and glpX were introduced to increase the concentration of fructose-6-phosphate (F6P) which is a precursor of 1- deoxynojirimycin .

In one embodiment of the invention, the introduction of the yajF and glpX genes in TYB gene cluster with the I236V mutations in the gutB1, it was confirmed that 1-having increased significantly the producing ability of oxy Nojiri azithromycin (Fig. 5).

In the present invention, the vector is a multi-monocystronic vector piBR818, and each of the foreign genes inserted into the vector contains its own promoter, RBS and terminator.

In the present invention, the microorganism is characterized by being E. coli , preferably E. coli BL21 (DE3).

The introduction of the gene can be carried out by a commonly known gene manipulation method. For example, a physical method such as a method using a vector such as a virus, a non-viral method using a synthetic phospholipid or a synthetic cationic polymer, or an electrotransfer method in which a gene is introduced by applying temporary electrical stimulation to the cell membrane can be used , But is not limited thereto.

The term " amplification " in the present invention refers to amplification, substitution, or deletion of a part of the gene, introduction of a certain base, or introduction of a gene derived from another microorganism encoding the same enzyme to increase the activity of the corresponding enzyme .

As used herein, the term " vector " means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms " plasmid " and " vector " are sometimes used interchangeably in the context of the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or known in the art.

In the present invention, " expression vector " is usually a recombinant carrier into which a fragment of different DNA is inserted, and generally means a fragment of double stranded DNA. Herein, the heterologous DNA means a heterologous DNA that is not naturally found in the host cell. Once an expression vector is in a host cell, it can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (heterologous) DNA can be generated. As is well known in the art, to increase the level of expression of a transfected gene in a host cell, the gene must be operably linked to a transcriptional and detoxification regulatory sequence that functions in the selected expression host. Preferably the expression control sequence and the gene are contained within an expression vector containing a bacterial selection marker and a replication origin. If the expression host is a eukaryotic cell, the expression vector should further comprise a useful expression marker in the eukaryotic expression host.

In the present invention, " integrative vector " means a vector in which integration or insertion into a nucleic acid is performed through integrase. Examples of integrated vectors include retrovirus vector, transposon and adeno-associated viral vector. But is not limited to.

A host cell transformed or transfected with the vector constitutes another aspect of the present invention. As used herein, the term " transformation " means introducing DNA into a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosomal integration. This includes any method of introducing the nucleic acid into an organism, cell, tissue or organ, and can be carried out by selecting a suitable standard technique depending on the host cell as is known in the art. Such methods include electroporation, protoplast fusion, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, agitation with silicon carbide fibers, Agrobacterium mediated transformation, PEG, dextran sulfate , Lipofectamine, and dry / inhibition-mediated transformation methods, and the like. The host cell of the invention may be a prokaryotic or eukaryotic cell. In addition, a host having high efficiency of introduction of DNA and high efficiency of expression of the introduced DNA is usually used. Known eukaryotic and prokaryotic hosts such as Escherichia coli, Pseudomonas, Bacillus, Streptomyces, fungi and yeast, insect cells such as Spodoptera prolipida (SF9), animal cells such as CHO and mouse cells, COS 1, COS 7, BSC 1, BSC 40 and BMT 10, and tissue cultured human cells are examples of host cells that can be used.

Of course, it should be understood that not all vectors function equally well in expressing the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections among a variety of vectors, expression control sequences, and hosts without undue experimentation and without departing from the scope of the present invention. For example, in selecting a vector, the host should be considered because the vector must be replicated within it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered. In selecting the expression control sequence, a number of factors must be considered. For example, the relative strength of the sequence, controllability and compatibility with the DNA sequences of the present invention should be considered in relation to particularly possible secondary structures. The single cell host may be selected from a selected vector, the toxicity of the product encoded by the DNA sequence of the present invention, the secretion characteristics, the ability to fold the protein correctly, the culture and fermentation requirements, the product encoded by the DNA sequence of the invention And ease of purification. Within the scope of these variables, one skilled in the art can select various vector / expression control sequences / host combinations that can express the DNA sequences of the invention in fermentation or in large animal cultures. A binding method, a panning method, a film emulsion method, or the like can be applied as a screening method for cloning cDNA of NSP protein by expression cloning.

In the present invention, " protoplast fusion " means a technique of fusing two cells having different traits using a protoplast from which cell walls of plant cells or fungi have been removed. Protoplast fusion involves the use of chemical methods such as the addition of metal ions such as calcium and magnesium to high osmotic solutions or physical exposure such as by increasing the DNA absorption of the protoplasts by exposing the protoplasts to temporary pores in the cell membrane, There is a way.

In another aspect, the present invention provides a method for producing a recombinant microorganism, comprising: (a) culturing the recombinant microorganism to produce 1-deoxynojirimycin; And (b) recovering the produced 1-deoxynojirimycin. The present invention also relates to a method for producing 1-deoxynojirimycin.

In the present invention, the culture medium for culturing the recombinant microorganism may be LB medium, and glucose, fructose and L-glutamine may be further added to improve the production of 1-deoxynojirimycin.

Table 1 compares the ability of plants, microorganisms and recombinant microorganisms to produce conventional 1-deoxynojirimycin.

number 1-deoxynojirimycin producing strain Maximum production concentration references One Native production in Streptomyces lavendulae 10.5 g / L Kojima M. et al, J Ferm Bioeng. 79: 391-4, 1995 2 Native production in Bacillus subtilis 460 mg / L Onose S. et al, Food Chem . 138: 516-23, 2013 3 Heterologous production in E. coli 6 mg / L Kang KD. et al . , J Microbiol. 49: 431-40, 2011 4 Native production in Bacillus amyloliquefaciens 800 mg / L Seo MJ. et al, Biosci Biotechnol Biochem . 77: 398-401, 2013 5 Native production in Bacillus subtilis 700 mg / L Cho YS. et al., J Korean Soc Food Sci Nutr. 37: 1401-7, 2008 6 Heterologous production in E. coli Detected Clark LF. Et al, ChemBio Chem., 12: 2147-50, 2011 7 Heterologous production in E. coli 50 mg / L Jiang P. et al, Sci. Rep., 5: 8563, 2015 8 Heterologous production in E. coli ~ 264 mg / L Invention

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example 1: Preparation of recombinant microorganisms

1-1: Preparation of chemicals and reagents

Standard 1-DNJ was purchased from Sigma-Aldrich, HPLC grade acetonitrile and water were purchased from Mallinckrodt Baker (Phillipsburg, USA). Culture medium and assay components were purchased from BD-Difco (New Jersey, USA) or Sigma-Aldrich (St. Louis). All chemicals used are of high analytical grade and are commercially available.

1-2: Bacterial strains, plasmids and culture conditions

Table 2 shows the bacterial strains and plasmids used in the present invention.

Bacterial strains, plasmids and rDNAs Explanation source Bacterial strain E. coli XL1Blue MRF ? (McrA) 183? (McrCB-hsdSMR-mrr) 173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac Stratagene, USA E. coli BL21 (DE3) ompT hsdT hsdS (rB-mB-) gal (DE3) Novagen, USA E. coli piBR181 E. coli BL21 (DE3) with piBR181 vector introduced Invention E. coli S1 E. coli BL21 (DE3) with piBRTY1 introduced Invention E. coli S2 E. coli BL21 (DE3) with piBRTYB2 introduced Invention E. coli S3 E. coli BL21 (DE3) with piBRTYB3 introduced Invention E. coli S4 E. coli BL21 (DE3) with piBRTYB2 and pGlpX introduced Invention E. coli S5 E. coli BL21 (DE3) with piBRTYB3 and pGlpX introduced Invention Bacillus amyloliquefaciens KCTC1660 1-Deoxynojirimycin (DNJ) producing bacteria KCTC Plasmids and rDNAs pGEM®-TEasy T7 and SP6 promoters, ColE1 ori, lacZ, AmpR Promega, USA pETDuet-1 Double T7promoter, ColE1 ori, AmpR
piBR181 pET28a (+) strain vector Chaudhary et al. piBRTYB1 PiBR181 with TYB biosynthetic gene clusters Invention piBRTYB2 piBR181 containing a TYB biosynthetic gene cluster mutated in gutB1 Invention piBRTYB3 A TYB biosynthetic gene cluster mutated in gutB1 and piBR181 containing yajF Invention pGlpX pETDuet-1 vector containing glpX Invention

Table 3 shows the PCR primers used in the present invention.

gene The sequence (5'-3 ') Gene size (bp) Restriction enzyme site yktC1-F
(SEQ ID NO: 6) TCTAGAATGAGAGACTATATCATTGAGC 951 Xba I yktC1-R
(SEQ ID NO: 7) AAGCTTTTAGGAGTCCAGACCAACGCCT Hind III gabT1-F
(SEQ ID NO: 8) TCTAGAATGGGAACGAAGGAAATCACGA 1,269 Xba I gabT1-R
(SEQ ID NO: 9) AAGCTTTCACTTGATTTCCTCCAATAGC Hind III gutB1-F
(SEQ ID NO: 10) TCTAGAATGAAGGCGTTGGTCTGGACTCCTAATGATAAACTAGAATATCAAGAGGTGGACGAGC 1,047 Xba I gutB1-R
(SEQ ID NO: 11) AAGCTT TTATAAAAGTTCCGGATCAGAC Hind III mgutB-F
(SEQ ID NO: 12) ATGTGATTTTTGACGCGGTCGGCAACCAGCTTGATTGG 1,047 mgutB-R
(SEQ ID NO: 13) CCAATCAAGCTGGTTGCCGACCGCCGCGTCAAACACAT yajF-F
(SEQ ID NO: 14) GGTCTAGAGTGCGTATAGGTATCGATTT 909 Bgl II YajF-R
(SEQ ID NO: 15) AAGCTTACTCTTGTGGCCATAAC Xho I glpX-F
(SEQ ID NO: 16) CATATGAGACGAGAACTTGCCATC 1,011 Nde I glpX-R
(SEQ ID NO: 17) CTCGAGTCAGAGGATGTGCACCTGCAT Xho I

PGEM®-T Easy vector (Promega, WI) was used to clone the PCR product and DNA manipulation was performed in E. coli XL1-Blue (Stratagene, California).

To isolate the gene gabT1 (a gene encoding 4-aminobutyrate transaminase), yktc1 (a gene encoding inositol or phosphatidylinositol phosphatase) and gutB1 (a gene encoding oxidoreductase) required for 1- deoxynojirimycin biosynthesis, And an enzyme gene fragment was obtained from Bacillus amyloliquefaciens KCTC1660 genome using a conventional PCR technique. glpX (gene encoding fructose-1,6-bisphosphatase, 1,011 bp) and yajF (gene encoding fructokinase, 909 bp) were PCR amplified from E. coli BL21 using the respective primers (Table 3).

The PCR amplification was carried out at 95 캜 for 7 minutes at a total volume of 20 7, then 30 cycles of 1 min at 95 캜, 1 min at 55 캜, 1 min at 72 캜 and then 7 min at 72 캜 Respectively.

After sequencing the sequence of each amplification product gabT1 (1,269 bp), yktc1 (951 bp), gutB1 (1,047 bp), yajF (909 bp) and glpX (1,011 bp) GibT1, yktc1, gutB1 and yajF were used for sequential cloning in piBR181, a multiple monocystronic vector. The gutB1 produced a positional mutation according to standard protocols to produce the I236V mutation. glpX used the pCDF-duet vector as the carrier.

E. coli strain BL21 (DE3) (Stratagene, California) was used as a protein expression strain and Lysogeny broth (LB) culture medium was used as a culture medium. The recombinant strains containing the vectors were incubated overnight at 37 ° C and 150 rpm in a shaking incubator with the appropriate antibiotics. 500 μL of seed culture was transferred to fresh 50 mL LB medium, supplemented with appropriate antibiotic plus an additional carbon source. Then, the cells were cultured at 37 ° C until the cell concentration reached OD ₆₀₀ = 0.5-0.6. Subsequently, the expression of the protein was induced with 0.5 mM IPTG, followed by continued incubation at 15 ° C for 72-96 hours.

Example 2: Production of 1-deoxynojirimycin

Five recombinant strains ( E. coli S1, E. coli S2, E. coli S3, E. coli S4 and E. coli S5) shown in Table 2 were cultured under the culture conditions of Example 1, The production of nojirimycin was investigated.

As a result, in the case of E. coli S1 (piBR818 containing TYB gene cluster was introduced), the concentration of 1-deoxynojirimycin produced was 42 mg / L.

The concentration of 1-deoxynojirimycin produced was 68.24 mg / ml for E. coli S2 (gutB1 introduced piBR818 containing a TYB gene cluster with I236V mutation), indicating that E. coli S1 production Which is 1.62 times higher.

In the case of E. coli S3 (piB818, which contains the TYB gene cluster with I236V mutation in gutB1 and the gene encoding fructokinase), the concentration of 1-deoxynojirimycin produced is 81.97 mg / L, It is about 1.9 times higher than E. coli S1.

E. coli S4 In the case of (the vector is introduced containing piBR818 and glpX containing TYB gene cluster is I236V mutation takes place gutB1), the production of 1-deoxy Nojiri concentration of azithromycin is 89.24 mg / L, which It is about 2.1 times higher than E. coli 1.

E. coli In S5 (the vector is introduced containing piBR818 and glpX containing the gene coding for the mutation I236V TYB gene cluster and fructokinase gutB1 takes place), the concentration of oxy Nojiri azithromycin to produce the 1-is 117.42 mg / L, which is about 2.7 times higher than E. coli S1 (FIG. 5).

Production of biomass and 1-deoxynojirimycin was observed at intervals of 12 hours. Biomass was produced 24 hours after incubation, 8-10 hours after induction of protein, and increased production of 1-deoxynojirimycin as well as increased biomass (FIG. 6).

Example 3: Detection and quantification of 1-deoxynojirimycin

For the detection and quantification of 1-deoxynojirimycin, HPLC analysis and calibration curve creation according to standard protocols were performed.

To prepare a calibration curve for 1-deoxynojirimycin, HPLC-ELSD (High Performance Liquid Chromatography (HPLC-ELSD) according to a previously reported protocol (Kimura T. et al, J Agric Food Chem., 55: 5869-74, 2007) -Evaporative light scattering detector.

10 占 퐇 of standard 1-deoxynojirimycin at different concentrations (2 mg / ml, 1 mg / ml, 0.2 mg / ml, 0.1 mg / ml, and 0.05 mg / ml) was injected to prepare a calibration curve.

Then, 50 ml of the fermentation broth was centrifuged, and cell pellets produced by centrifugation were removed, and the culture filtrate was added to a column of Amberlite IR-120 resin (H ⁺ form). It was then washed with H ₂ O and eluted with 0.5 N NH ₄ OH. The eluate was concentrated to dryness and the residue was dissolved in 10 ml of extraction solvent (mixture of acetonitrile and water (50:50, containing 6.5 mM ammonium acetate, pH 5.5) 10 μl of the extracted supernatant was extracted with 1 ml of extraction 10 [mu] l of the obtained sample was applied to a Shimadzu LC-10A high-speed liquid (4.6 x 250 mm, Tosoh, Japan) connected to a TSK gel Amide-80 column (4.6 x 250 mm, Tosoh, Japan). The sample was dissolved in a solvent and filtered with a PTFE filter having a size of 0.45 mu m. A mixture of acetonitrile and distilled water (81:19 (v / v); containing 6.5 mM ammonium acetate, pH 5.5) was maintained at a flow rate of 1 ml / min and the column temperature was maintained at 40 ° C The ELSD optimized the conditions by using a nitrogen gas as the atomizing gas, maintaining the pressure at 1.2 bar, and setting the gain to 8. Then, the peak area was calculated and a calibration curve was prepared 3b). The product was analyzed by UPLC-ESI-QTOF-MS / MS.

Ultra-high pressure liquid chromatography (UPLC) -photodiode array (PDA) analysis was carried out using a reversed phase UPLC-PDA coupled with a C ₁₈ column (ACQUITY UPLC BEH, C ₁₈ , 1.7 μm) connected to a PDA Lt; / RTI >

The same binary solvent phase was used for the binary mobile phase. The total flow rate was maintained at 0.3 μL / min for 15 minutes. The flow rate of methanol is (0-100)% until (0-9) minute, 100% until (9-12) minute, (100-0)% after (12-15) I stopped at the minute.

As a result, it was confirmed that the retention time of the standard 1-deoxynojirimycin coincided with the retention time of the culture solution of the recombinant E. coli of the present invention (Fig. 3A).

For accurate mass analysis, HR-QTOF ESI / MS (high-resolution quadrupole-time of flight electrospray ionization-mass) was performed using ACQUITY (Billerica, USA) column coupled with SYNAPT G2- spectrometry analysis was performed.

As a result, in the case of the standard 1-deoxynojirimycin, the mass of the compound was measured as [M + H] ⁺ m / z to 164.0922 at a retention time of 0.801 (FIG. 4A), and the recombinant E. coli For the culture, the mass of the compound was measured as [M + H] ⁺ m / z ~ 164.0922 at retention time 0.809 (FIG. 4b).

Therefore, it was confirmed that the recombinant E. coli produced 1-deoxynojirimycin.

Example 4: Detection of 1-deoxynojirimycin by enzyme analysis

Production and confirmation of 1-deoxynojirimycin by α-glucosidase inhibition assay was carried out by measuring the absorbance at 405 nM using a microplate reader, and E. coli- piBR181 was used as a control.

To prepare a-glucosidase solution, 0.1% rat intestinal acetone powder was dissolved in 0.1 M potassium phosphate buffer (pH 6.8), sonicated for 6 minutes on ice, and then the supernatant was collected Respectively.

In order to prepare a reaction mixture for inhibition of α-glucosidase, the culture medium cultured in the present invention was heated at 100 ° C. for 10 minutes, and centrifuged to obtain a supernatant. Then, 50 ml of the heated culture supernatant, 170 ml of potassium buffer (pH 6.8) and 20 [mu] l of a 1% rat intestinal solution containing [alpha] -glucosidase were added. Then, the cells were cultured in a shaking incubator at 37 ° C. After 10 minutes of incubation, 50 ml of 12 mM p-nitrophenyl-α-D-glucopyranoside was added to the mixture and incubated for an additional 45 minutes under the same conditions . Finally, the reaction was terminated by the addition of 50 ml of 200 mM sodium carbonate and the absorbance was measured at 405 nm using a microplate reader.

In order to calculate the? -glucosidase inhibitory activity, the formula used is as follows.

% Inhibition = {(Ac-Ab / Ac) * 100} where Ac is the absorbance of the control and Ab is the absorbance of the product at 405 nm.

As a result, it was confirmed that 1-deoxynojirimycin was produced from all the recombinant microorganisms.

Example 4: Comparison of production ability of 1-deoxynojirimycin according to medium

In order to compare the ability of 1-deoxynojirimycin to produce according to the medium, E.coli S5 was cultured in a strain containing glycerol (1% v / v), fructose (1% w / v) and 10 mM L- glutamate Lt; RTI ID = 0.0 > LB < / RTI >

As a result, E. coli S5 cultured in modified LB medium produced 263.82 mg / L 1-deoxynojirimycin. This is approximately 2.2 times higher than the 1-deoxynojirimycin production of 117.42 mg / L of E. coli S5 cultured on LB medium. It is about 6.2 times higher than E. coli S1 grown on LB medium (Fig. 5).

Example 5: Comparison of gene expression

In order to determine the level of transcription of all genes, we compared the expression levels in E.coli E. coli and S5 piBR181. E. coli piBR181 retained only the empty piBR181 vector and was used as a negative control. Both strains were cultured in 50 ml of LB medium.

RNA was isolated, quantified, and subjected to RT-PCR using the same primers (Table 3) used for PCR amplification of genes according to standard protocols.

As a result, gabT1 and yktc1 gutB1 genes were not expressed in E. coli piBR181, whereas they were expressed in E. coli S5. In addition, it was confirmed that expression of yajF and glpX was increased in E. coli S5 as compared to E. coli piBR181 (Fig. 7).

Therefore, it was confirmed that the production of 1-deoxynojirimycin was increased by increasing the concentration of fructose-6-phosphate (F6P).

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Industry-University Cooperation Foundation Sunmoon University <120> Recombinant Microorganism Producing 1-Deoxynojirymicin and Method          of Preparing 1-Deoxynojirymicin Using the Same <130> P17-B235 <160> 17 <170> KoPatentin 3.0 <210> 1 <211> 1269 <212> DNA <213> Bacillus amyloliquefaciens <400> 1 gtgggaacga aggaaatcac gaatccagac agcttgtatt acagtgttga cgatgtagta 60 atggagcgcg gagaagggat ttacctgtac gatcaagaag gtaatgagta tattgattgt 120 gcttctgcca cgtttaactt gaatttagga tacggtaaca aagaagtcat tgatacggtt 180 aaagatcaag ccgataagct gatccatgtg acatcgtcct ttcaaacaga cgccgtaaat 240 aaactagcag aaaaactagt cgaaatcgcc cccgataatc tcacaaaagt acaccctaaa 300 gtcagcagcg gttccggtgc gaatgaagga gctattaaaa tggctcagta ttactccggg 360 aaaaccgacg tcatctcctt atttcgaagc cacctcggac aaacctatat gacatccgct 420 ttgtccggca actcattcag aaaagaacct ttcccgccgc aaatctcttt tggcctacaa 480 gtacctgatc cctattgcag ccgctgtttt tataatcaga aacctgattc gtgcggtatg 540 ctgtgcgtag aaagaattaa tgattttatt gagtatgcga gcaatggaaa aattgccgcc 600 atgattattg aaccgatatc cggaaacgga ggaaacgtcg ttccgcctaa agagtatttt 660 aaacagctga gaaagctatg tgatgaacat gatatcgccc tgatctttga tgaaattcag 720 accgggttcg gacggacggg taaaatgttt gccgcggacc atttcgatgt gaaacccaat 780 atgatgaccg tagcaaaagg gctcgggggc acaggctttc aagttgccgc cactctgacg 840 gaggagaagt ataccggact tccgggatat acacattcct ttacgtacgg atctaatgtg 900 atggccgctg cagccgcgtg taaaaccata gatatcatgc agcgtccagg atttttggaa 960 aacgtaacga cggtcggaaa ttatattatg gaccgcttag aaacgatgaa agaggatttt 1020 gcttttattt ctgaagtaag aggcgtcggt ctgatgatcg gtgttgagat tgtcaaagag 1080 aacaatgaac ctgatgtgga gctgaccaat tatattgcca aacgggcgat ggattacgga 1140 ctgattctcc ggacatcccg ttacggattc ggaaatgtat ttaaaatccg tccgccttta 1200 accattacac ttagtgaagc tgaggtgctc tgctacagac ttcgcaagct attggaggaa 1260 atcaagtga 1269 <210> 2 <211> 951 <212> DNA <213> Bacillus amyloliquefaciens <400> 2 gtgagagact atatcattga gcttggacaa tatgtttatc aaaaggtgaa aaatcaaaaa 60 ggcacgctga aaaatcggct cgtaaacgga tattcccccg gaggcgatgc tcaatttaat 120 atagacgccg ctgctgagga ggcggtgctg gattatattc aagaaaaggg ccatccggtt 180 gctttttaca cggaggatgg cggcctcaag ctgattggag agaatccgca atatatttta 240 attgtagatc cgatagacgg aacgcgcccg gccgccgcgg gacttgaaat gtcatgtatt 300 tcgattgcgc ttgcttccta taagccaaac gcaagaatta aggatatcga atttgctttt 360 ttacttgaat tgaaatcagg cgcttatatg tacggtgata tttacagcga taccattcaa 420 tttgaagggt atcagggaga attgccgaat ttgagcggag tgcaggatat taaaaatatg 480 ttttggagcc ttgagtttaa cgggcatccg gcgcagctga tgacggacgc atacggccat 540 ttgattgacc agtcggccaa taacggcgga gtctttgttt tcaacagcgc ttcttattcg 600 atttcacgaa ttattacggg gcagatggat gcttatgtgg atatcggcaa tcgtctgctg 660 aaagatgatc cgaagctgct ttcagatttt cagcaggtcg ggaacggaca ggtgctgcac 720 ttatttcctt atgatattgc cgcgagcgtc tttttggcga agaaagcggg agtggtcatt 780 acggatgcgt acggccggtc tttagacgac acacttctga cagatttaag ttaccagaat 840 cagcaatcat gtatcgctgc atcaacgaag gagcttcatc agacattatt agaccaaatc 900 cgctggggca gaaaggaaga gagatatgaa ggcgttggtc tggactccta a 951 <210> 3 <211> 1047 <212> DNA <213> Bacillus amyloliquefaciens <400> 3 atgaaggcgt tggtctggac tcctaatgat aaactagaat atcaagaggt ggacgagcct 60 caaattcgaa aagccaatga tgtgaaggtg aaaattttcg gcaccggtat ctgcggcacg 120 gacttaaatg tgctgaaagg aaaaatgaat gcaacccatc atatgattat ggggcatgaa 180 tcggtgggag cggtcgtgga agtcgggccg gacgtgacaa atgtaaaagt cggagaccgc 240 gtcgtgatag atcccacaca gttttgcggg aaatgccatt attgccggag aggactgacg 300 tgttattgcg aaaccttcga ggaatggcag cttggaatcg gggcgcatgg gacgtttgcg 360 gaatattacg tgggggaaga tcggttcatg tacaaaattc cggattccat ggaatgggag 420 cgagccacgt tggttgaacc tctctcctgt gtgctgaacg ttgtggataa ggcttcgatt 480 cagccggagg attcggtttt ggttttgggt tccggaccga tcggactgct tgtgcaaatg 540 atggtgaaaa aactggcgcg tttgacggtc gcgactgaaa taggcagctt ccggagtgag 600 gcggcaagcc ggatatcgga ttatgtctac catcctgaag cgctaaccgt ggatgaagtg 660 aaacggatta atcaaggaag aaaatttgat gtgatttttg acgcgatcgg caaccagctt 720 gattgggctt atcctttcat tgaaaaggga ggcagaattg tgccgatggg ctttgatgat 780 acgtatgaga tgacggtaag gccgtaccag ctgctgtcaa acggcgtgac gattgtgggc 840 acaggtgaag cccggcagat catggaggct gcgttggcat gtgcgtccga ccttccgcag 900 ctctatgatt tcattactga aaagacggaa ctgaagaatt atgaagaagc cattgatcat 960 ctcatgggca tcgacccggt gacaaaagag agaaaggata tcagcgcgat aaaaaccatt 1020 ctcgtgtctg atccggaact tttataa 1047 <210> 4 <211> 909 <212> DNA <213> Escherichia coli <400> 4 gtgcgtatag gtatcgattt aggcggcacc aaaactgaag tgattgcact gggcgatgca 60 ggggagcagt tgtaccgcca tcgtctgccc acgccgcgtg atgattaccg gcagactatt 120 gaaacgatcg ccacgttggt tgatatggcg gagcaggcga cggggcagcg cggaacggta 180 ggtatgggca ttcctggctc aatttcgcct tacaccggtg tggtgaagaa tgccaattca 240 acctggctca acggtcagcc attcgataaa gacttaagcg cgaggttgca gcgggaagtg 300 cggctggcaa atgacgctaa ctgtctggcg gtttcagaag cagtagatgg cgcggcagcg 360 ggagcgcaga cggtatttgc cgtgattatc ggcacgggat gcggcgcggg cgtggcattc 420 aatgggcggg cgcatatcgg cggcaatggc acggcaggtg agtggggaca caatccgcta 480 ccgtggatgg acgaagacga actgcgttat cgcgaggaag tcccttgtta ttgcggtaaa 540 caaggttgta ttgaaacctt tatttcgggc acgggattcg cgatggatta tcgtcgtttg 600 agcggacatg cgctgaaagg cagtgaaatt atccgcctgg ttgaagaaag cgatccggta 660 gcggaactgg cattgcgtcg ctacgagctg cggctggcaa aatcgctggc acatgtcgtg 720 aatattctcg atccggatgt gattgtcctg gggggcggga tgagcaatgt agaccgttta 780 tatcaaacgg ttgggcagtt gattaaacaa tttgtcttcg gcggcgaatg tgaaacgccg 840 gtgcgtaagg cgaagcacgg tgattccagc ggcgtacgcg gcgctgcgtg gttatggcca 900 caagagtaa 909 <210> 5 <211> 1011 <212> DNA <213> Escherichia coli <400> 5 atgagacgag aacttgccat cgaattttcc cgcgtcaccg aatcagcggc gctggctggc 60 tacaaatggt taggacgcgg cgataaaaac accgcggacg gcgcggcggt aaacgccatg 120 cgtattatgc tcaaccaggt caacattgac ggcaccatcg tcattggtga aggtgaaatc 180 gacgaagcac cgatgctcta cattggtgaa aaagtcggta ctggtcgcgg cgacgcggta 240 gatattgctg ttgatccgat tgaaggcacg cgcatgacgg cgatgggcca ggctaacgcg 300 ctggcggtgc tggcagtagg cgataaaggc tgcttcctca atgcgccgga tatgtatatg 360 gagaagctga ttgtcgggcc gggagccaaa ggcaccattg atctgaacct gccgctggcg 420 gataacctgc gcaatgtagc ggcggcgctc ggcaaaccgt tgagcgaact gacggtaacg 480 attctggcta aaccacgcca cgatgccgtt atcgctgaaa tgcagcaact cggcgtacgc 540 gtatttgcta ttccggacgg cgacgttgcg gcctcaattc tcacctgtat gccagacagc 600 gaagttgacg tgctgtacgg tattggtggc gcgccggaag gcgtagtttc tgcggcggtg 660 atccgcgcat tagatggcga catgaacggt cgtctgctgg cgcgtcatga cgtcaaaggc 720 gacaacgaag agaatcgtcg cattggcgag caggagctgg cacgctgcaa agcgatgggc 780 atcgaagccg gtaaagtatt gcgcctgggc gatatggcgc gcagcgataa cgtcatcttc 840 tctgccaccg gtattaccaa aggcgatctg ctggaaggca ttagccgcaa aggcaatatc 900 gcgactaccg aaacgctgct gatccgcggc aagtcacgca ccattcgccg cattcagtcc 960 atccactatc tggatcgcaa agacccggaa atgcaggtgc acatcctctg a 1011 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> yktC1-F primer <400> 6 tctagaatga gagactatat cattgagc 28 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> yktC1-R primer <400> 7 aagcttttag gagtccagac caacgcct 28 <210> 8 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> gabT1-F primer <400> 8 tctagaatgg gaacgaagga aatcacga 28 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> gabT1-R primer <400> 9 aagctttcac ttgatttcct ccaatagc 28 <210> 10 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> gutB1-F primer <400> 10 tctagaatga aggcgttggt ctggactcct aatgataaac tagaatatca agaggtggac 60 gagc 64 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> gutB1-R primer <400> 11 aagcttttat aaaagttccg gatcagac 28 <210> 12 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> mgutB-F primer <400> 12 atgtgatttt tgacgcggtc ggcaaccagc ttgattgg 38 <210> 13 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> mgTB-R primer <400> 13 ccaatcaagc tggttgccga ccgccgcgtc aaacacat 38 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> yajF-F primer <400> 14 ggtctagagt gcgtataggt atcgattt 28 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> yajF-R primer <400> 15 aagcttactc ttgtggccat aac 23 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> glpX-F primer <400> 16 catatgagac gagaacttgc catc 24 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> glpX-R primer <400> 17 ctcgagtcag aggatgtgca cctgcat 27

Claims (4)

A gene coding for 4-aminobutyrate transaminase, a gene encoding inositol or phosphatidylinositol phosphatase (I236V), a gene coding for inositol or phosphatidylinositol phosphatase, and a gene coding for 4-aminobutyrate transaminase in a microorganism having fructose-6-phosphate (F6P) A gene coding for an oxidoreductase having a mutation has been introduced and a gene coding for a fructokinase or a gene coding for a fructose-1,6-bisphosphatase A recombinant microorganism having the ability to produce 1-deoxynojirimycin in which a gene is introduced or amplified.
The recombinant microorganism of claim 1, wherein the microorganism comprises a gene encoding a fructokinase and a gene encoding fructose-1,6-bisphosphatase. microbe.
3. The method according to claim 1 or 2, wherein the gene coding for the fructokinase is represented by SEQ ID NO: 4, wherein the fructose-1,6-bisphosphatase (fructose-1,6- wherein the gene coding for bisphosphatase is SEQ ID NO: 5.
A process for preparing 1-deoxynojirimycin comprising the steps of:
(a) culturing the recombinant microorganism of claim 1 to produce 1-deoxynojirimycin; And
(b) recovering the produced 1-deoxynojirimycin.

Images