KR20190030833A - Age-specific markers for diagnosing prognosis and determining treatment strategies of patient of clear cell renal cell carcinoma - Google Patents

Abstract

The present invention relates to markers for diagnosing a difference in effects of renal cancer treatment or prognosis of renal cancer patients depending on the age of renal cancer patients. A survival rate or recurrence rate of renal cancer of a particular age respectively relates to the mutation of genes, of the present invention, in renal cancer patients, and thus the mutated genes of the present invention can be used as markers in predicting, on the basis of age, the difference in effects of renal cancer treatment or the prognosis of renal cancer patients.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to age-specific markers for the diagnosis and treatment of kidney cancer patients,

The present invention provides a method for diagnosing the prognosis of renal cancer using the marker for prognosis diagnosis of kidney cancer patients, a kit for the prognosis diagnosis of kidney cancer patients containing the same, and a marker for the prognosis diagnosis of kidney cancer patients .

The kidney is an important urogenital organ that plays a role in excretion of the waste matter in vivo by filtering the blood to generate urine. It is also an important endocrine organ that produces hormones such as angiotensin, which regulates blood pressure, and erythropoietin, an erythropoietic factor.

Renal cell carcinoma is a renal cell carcinoma that occurs in adults, Wilms' tumor that occurs in children, and sarcomas that are rare tumors. Renal cell carcinoma is the most common malignancy. The incidence of kidney cancer in Japan is about 2.5 per 100,000 population, and the ratio of male and female is 2 to 3: 1, which tends to be much for males. Of the urological malignancies, there are many tumors following prostate cancer and bladder cancer. Kidney cancer is a kidney cancer that occurs mainly in the kidneys (composed of the water and the cortex, where the urine is gathered in the kidneys).

Genetic factors are known to be risk factors for kidney cancer, but smoking and excessive fat intake are common. It is also known that the incidence of such tumors is high in patients undergoing long-term dialysis.

In kidney cancer, the maximum diameter of the tumor is less than 5cm, there are rarely any subjective symptoms and it is often found by CT scan at the time of examination. Large tumors include hematuria, abdominal tumors, and pain. In addition, systemic symptoms such as fever, weight loss, and anemia may be caused. In rare cases, red blood cell hypertension, hypertension, hypercalcemia may occur due to endocrine factors. On the other hand, the progression of the descending vein of the kidney cancer may cause vomiting of the vein of the abdominal surface and occlusion of the testis varices. Approximately 20% of kidney cancers are found from lung or bone metastases. In kidney cancer, the tendency of the tumor to spread in the vein is strong, and it is likely to cause metastasis to other organs.

Kidney cancer has little symptoms when the size of the tumor is small, and it only occurs when the tumor grows to some extent and pushes out the organ. Therefore, diagnosis is delayed in many cases, and when first diagnosed, about 30% of the patients are already metastasized. The most common symptom is hematuria, but it also occurs in only 60% of patients. Rather, depending on the site of the transition, symptoms such as dyspnea, cough, headache, and so on, the diagnosis of kidney cancer due to such metastases in 30% of the total patients. Because kidney cancer can cause hypertension, hypercalcemia, liver dysfunction, and so on, due to the specific hormones produced by cancer cells, a tumor may be found while testing for these other symptoms. In recent years, however, there have been many cases of medical examination without any symptoms, which are usually found on imaging studies. Therefore, early diagnosis of renal cancer is very important.

Kidney cancer accounts for about 3% of adult cancers in the United States, with about 32,000 new cases occurring annually. It is estimated that about 12,000 people die from kidney cancer and the incidence is increasing every year around the world. According to the 2002 Central Cancer Registry data, 1,578 patients are newly registered and account for 1.6% of total cancer incidence. Kidney cancer is most common in the 40s to 60s, and the 60s are the most common (479, 30.2%), 50s (412, 26.0%), 40s (268 persons, 16.9%). Renal cancer has a high survival rate due to tumor removal after onset, but it is difficult to diagnose early because of lack of definite symptoms. For this reason, it is necessary to develop a marker for early diagnosis and remaining life after cancer.

As a marker used for detection or diagnosis of human kidney cancer, Transglutaminase 2 (Patent Document 1) is disclosed. Although there have been developed markers for the diagnosis of cancers including renal cancer, there has been no research on the relationship between markers capable of measuring up to the prognosis of renal cancer patients, particularly the age of patients with renal cancer and mutations of specific genes to be.

The inventors of the present invention focused on the need to develop a marker capable of diagnosing the prognosis of patients with kidney cancer in order to diagnose kidney cancer or to determine a therapeutic strategy by identifying therapeutic agents for patients with kidney cancer, The relationship between the variation and the age of the patients was studied.

Korean Patent No. 1267580

In order to apply appropriate therapeutic strategies for kidney cancer patients, it is necessary to develop a marker that predicts the prognosis of kidney cancer patients and helps to determine treatment strategies. It is an object of the present invention to provide a marker that helps diagnose a prognosis of a kidney cancer patient and determine a treatment strategy based on the age of a kidney cancer patient.

In one aspect of the present invention there is provided a compound of formula I wherein R is selected from the group consisting of ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, MYH1, NDUFAF3, NKAIN3, SERPINI2, ZBTB41, MUC6, SLC27A6, A group consisting of PLSEC, ADAMTS20, ODZ4, PLSEC, PDS4C, PRKCQ, PDS4C, PRKCQ, PPNL3, CADPS, CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, TMEM184C, WDR62, RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, A kit for providing information necessary for predicting the effect of treating renal cancer according to the age of a kidney cancer patient or diagnosing the prognosis of a kidney cancer patient which can detect an age specific marker that is a mutation of a gene encoding at least one selected from to provide.

Another aspect of the present invention provides a method for identifying a cancer patient, comprising the steps of: preparing sample DNA from a sample of a patient of renal cancer whose age is known; Amplifying the sample DNA using the kit; Confirming presence or absence of an age-specific marker specific to the age group of the subject from the amplification result; Treating a kidney cancer patient whose age-specific marker is confirmed by treating or treating any kidney cancer candidate candidate with an arbitrary method; And employing the candidate renal cancer therapeutic candidate or any therapeutic method as a candidate therapeutic substance or treatment method suitable for the age group of the kidney cancer patient whose age-specific marker has been identified when the kidney cancer is treated, The present invention provides a method for providing information necessary for determining the difference in the effect of treating renal cancer according to the age of the subject.

Another aspect of the present invention provides a method for preparing a test sample, comprising: preparing a sample DNA from a sample of a kidney cancer patient; Amplifying the sample DNA using the kit; And confirming the presence or absence of an age-specific marker from the amplification result. The present invention provides a method for providing information necessary for diagnosing a prognosis of renal cancer according to the age of a renal cancer patient.

The genes ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, MYH1, NDUFAF3, NKAIN3, SERPINI2, ZBTB41, MUC6, SLC27A6, BTNL3, CADPS, CCDC173, PPIL4, Mutation of at least one gene selected from the group consisting of SHMT2, SLC47A2, TMEM169, TMEM184C and WDR62 is correlated with age of kidney cancer patients, so that mutation of the gene is confirmed, The difference in treatment effect and the difference in survival rate can be predicted.

In addition, mutations of a gene selected from the gene group consisting of genes RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ, PRSS38, ADAMTS20, , The survival rate of renal cancer patients at a specific age, or the mutation of the gene of the present invention as a marker for predicting the prognosis of patients with renal cancer, since the mutation of the gene and the recurrence rate of kidney cancer are respectively correlated.

However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned can be clearly understood by those skilled in the art from the following description.

Figure 1 shows 10 age-specific mutant genes that were specifically expressed when comparing age-specific kidney cancer patients (Ⅰ vs Ⅱ vs Ⅲ vs Ⅳ). The numbers represent the number of kidney cancer patients whose mutated genes were identified.
FIG. 2 shows seven age-specific mutant genes that were specifically expressed when the age-specific renal cancer patients were classified into the age range of about 50 years old (Ⅰ vs Ⅱ + Ⅲ + Ⅳ). The numbers represent the number of kidney cancer patients whose mutated genes were identified.
FIG. 3 shows two age-specific mutant genes that were specifically expressed when the age-specific renal cancer patients were classified into the age range of about 60 years (Ⅰ + Ⅱ vs Ⅲ + Ⅳ). The numbers represent the number of kidney cancer patients whose mutated genes were identified.
FIG. 4 shows nine age-specific mutant genes that were specifically expressed when the age-specific renal cancer patients were classified into the age range of about 70 years (Ⅰ + Ⅱ + Ⅲ vs Ⅳ). The numbers represent the number of kidney cancer patients whose mutated genes were identified.
FIGS. 5 to 19 are graphs showing changes in the genes of renal cancer patients having mutations in the genes of RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ, PRSS38, ADAMTS20, ODZ4 and PLEC (Red), and the total survival or disease-free survival rate of kidney cancer patients (blue) without mutations in the gene.

In this specification, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, unless otherwise defined. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

Hereinafter, the present invention will be described in detail.

 1. Age-specific mutant genes in kidney cancer patients and primer sets capable of detecting these mutant genes

One aspect of the present invention is to provide an ARP3 (Gene bank accession number: NM_022481.5), an ERBB4 (Gene bank accession number: NM_001042599.1), a F8 (Gene bank accession number: NM_000132.3), an RNF40 , Gene bank accession number (NM_03121.2), GXYLT1 (Gene bank accession number: NM_173601.1), CEP295 (Gene bank accession number: NM_033395.1), SLC4A2 (Gene bank accession number: NM_001199692.2), SCAF1 ), PCDHA6 (Gene bank accession number: NM_018909.3), ZNF844 (Gene bank accession number: NM_001136501.2), MAFA (Gene bank accession number: NM_201589.3), MYH1 (Gene bank accession number: NM_005963.3) (Gene bank accession number: NM_199069.1), NKAIN3 (Gene bank accession number: NM_001304533.1), SERPINI2 (Gene bank accession number: NM_006217.4), ZBTB41 (Gene bank accession number: NM_194314.2), MUC6 Gene bank accession number NM_005961.2), SLC27A6 (Gene bank accession number NM_001017372.2), BTNL3 (Gene bank accession number NM_197975.2), CADPS (Gene bank accession number: NM_003716.3), CCDC173 (Gene bank accession number: NM_001085447.1), PPIL4 (Gene bank accession number: NM_139126.3), SHMT2 (Gene bank accession number: NM_001166356.1), SLC47A2 (Gene bank accession number: NM_152908. 3), TMEM169 (Gene bank accession number: NM_001142310.1), TMEM184C (Gene bank accession number: NM_018241.2), WDR62 (Gene bank accession number: NM_001083961.1), RTN3 (Gene bank accession number: NM_001265589.1) , Gene bank accession number (SCN2A), NM_001040142.1, SLC25A13 (Gene bank accession number NM_001160210.1), DDX20 (Gene bank accession number NM_007204.4), AGAP7P (Gene bank accession number: Unregistered), ARHGAP26 bank accession number NM_001135608.2), GABRE (Gene bank accession number NM_004961.3), IPO7 (Gene bank accession number NM_006391.2), PDE4C (Gene bank accession number NM_000923.5), PRKCQ number: NM_001242413.2), PRSS38 (Gene bank accession number: NM_183062.2), ADAMTS20 (Gene bank accession number: NM_025003.4), ODZ4 (Gene bank accession num , which is a mutation of at least one gene selected from the group consisting of a gene selected from the group consisting of: A kit for providing information necessary for predicting a difference in treatment effect or for diagnosing a prognosis of a kidney cancer patient.

In one embodiment of the invention, prediction of the effect of treatment of renal cancer according to the age of a kidney cancer patient who can detect a mutation of at least one gene selected from mutations of the following genes, or diagnosis of the prognosis of kidney cancer patients Provide kits that provide the information you need to:

A mutation of the gene encoding ARAP3 represented by the amino acid sequence of SEQ ID NO: 1, a mutation of the gene encoding ERBB4 represented by the amino acid sequence of SEQ ID NO: 2, a mutation of the gene encoding F8 represented by the amino acid sequence of SEQ ID NO: 3, 4, a mutation of the gene encoding SLC4A2 represented by the amino acid sequence of SEQ ID NO: 5, a mutation of the gene encoding SCAF1 represented by the amino acid sequence of SEQ ID NO: 6, a mutation of the gene encoding SLC4A2 of SEQ ID NO: A mutation of a gene encoding GXYLT1 represented by an amino acid sequence, a mutation of a gene encoding CEP295 represented by an amino acid sequence of SEQ ID NO: 8, a mutation of a gene encoding PCDHA6 represented by an amino acid sequence of SEQ ID NO: 9, Rona A mutation of a gene encoding ZNF844, a mutation of a gene encoding an MAFA represented by an amino acid sequence of SEQ ID NO: 11, a mutation of a gene encoding MYH1 represented by an amino acid sequence of SEQ ID NO: 12, a mutation of a gene encoding an NDFFAF3 A mutation of a gene encoding NKAIN3 represented by an amino acid sequence of SEQ ID NO: 14, a mutation of a gene encoding SERPINI2 represented by an amino acid sequence of SEQ ID NO: 15, and a mutation of a gene encoding ZBTB41 represented by an amino acid sequence of SEQ ID NO: Mutation of the gene encoding MUC6 represented by the amino acid sequence of SEQ ID NO: 17, mutation of the gene encoding SLC27A6 represented by the amino acid sequence of SEQ ID NO: 18, mutation of the gene encoding SLC27A6 represented by the amino acid sequence of SEQ ID NO: A mutation of the gene encoding the CADPS represented by the amino acid sequence of SEQ ID NO: 20, a mutation of the gene encoding the CCDC173 represented by the amino acid sequence of SEQ ID NO: 21, a gene encoding the PPIL4 represented by the amino acid sequence of SEQ ID NO: A mutation of the gene encoding SHMT2 represented by the amino acid sequence of SEQ ID NO: 23, a mutation of the gene encoding SLC47A2 represented by the amino acid sequence of SEQ ID NO: 24, a mutation of the gene encoding TMEM169 represented by the amino acid sequence of SEQ ID NO: A mutation of a gene encoding TMEM184C represented by the amino acid sequence of SEQ ID NO: 26, a mutation of a gene encoding WDR62 represented by the amino acid sequence of SEQ ID NO: 27, a mutation of a gene encoding RTN3 represented by the amino acid sequence of SEQ ID NO: A mutation of a gene encoding SCN2A represented by an amino acid sequence of SEQ ID NO: 29, a mutation of a gene encoding SLC25A13 represented by an amino acid sequence of SEQ ID NO: 30, a mutation of a gene encoding DDX20 represented by an amino acid sequence of SEQ ID NO: 31, A mutation of a gene encoding ARHGAP26 represented by an amino acid sequence of SEQ ID NO: 32, a mutation of a gene encoding GABRE represented by an amino acid sequence of SEQ ID NO: 33, a mutation of a gene encoding IPO7 represented by an amino acid sequence of SEQ ID NO: 34, 36, a mutation of a gene encoding PRKCQ represented by an amino acid sequence of SEQ ID NO: 36, a mutation of a gene encoding PRSS38 represented by an amino acid sequence of SEQ ID NO: 37, a mutation of a gene encoding SEQ ID NO: A mutation of a gene encoding ADAMTS20 represented by an acid sequence, a mutation of a gene encoding ODZ4 represented by an amino acid sequence of SEQ ID NO: 39, and a mutation of a gene encoding PLEC represented by an amino acid sequence of SEQ ID NO:

The term " diagnosis " in the present invention is used to identify the presence or characteristic of a pathological condition. For the purpose of the present invention, not only to confirm the difference in cancer treatment effect according to the age of a cancer patient, Relapse, metastasis, drug reactivity, resistance, and the like. Preferably, when the mutation of the gene of the present invention is used, the mutation is confirmed from the sample of the kidney cancer patient, so that the difference in the effect of treating the kidney cancer according to the age of the kidney cancer patient and the survival rate difference Can be predicted.

The term " prognosis " as used herein refers to the progression and cure of disease such as cancer-induced death or the possibility of progression, including recurrence, metastatic spread and drug resistance, for example neoplastic diseases such as cancer. For the purpose of the present invention, to predict the prognosis of renal cancer, and preferably to predict the disease-free survival rate or survival rate of renal cancer patients.

The term ' cancer ' in the present invention includes any member of the disease class that is characterized by uncontrolled growth of abnormal cells. The term encompasses all time and grade cancers, including all known cancer and neoplastic conditions, and pre / post metastatic cancers, whether characterized as malignant, benign, soft or solid.

The term " gene " and variants thereof in the present invention include DNA fragments involved in polypeptide chain production; This includes intervening sequences (introns) between the individual coding fragments (exons), as well as the sites before and after the coding region, such as the promoter and the 3'-untranslated region, respectively.

A mutation of the gene may comprise any one or more mutations, for example, a truncating mutation, a missense mutation (or a mutation), a nonsense mutation, a frame shift ) Mutation, an in-frame mutation (or an in-vitro mutation), a splice mutation, and a splice_region mutation. The frame shift mutation may be at least one of a frame shift insert (FS ins) mutation and a frame shift delete (FS del) mutation. The in-frame mutation may be at least one of an in-frame insertion (IF ins) mutation and an in-frame delete (IF del) mutation.

The term " X # Y " is understood in the art in the context of a mutation in a polypeptide sequence, where "#" denotes the mutation position in relation to the amino acid number of the polypeptide and "X" And " Y " represents the mutant amino acid at that position. For example, with reference to the BAZ2B polypeptide, the notation " G1717V " indicates that glycine is present in amino acid number 1717 of the wild type BAZ2B sequence and glycine is replaced by valine in the mutant BAZ2B sequence. Mutations in these genes are as follows:

The mutation of the gene encoding ARAP3 may be a mismatch mutation which is C527F or a nonsense mutation which is at least one of S836 * and S836 * or a mutation of Q391Pfs * 35, R763Efs * 11, P744Tfs * 3 and A652Sfs * 3, and in the nonsense mutation, * indicates that the amino acid synthesis at the corresponding amino acid position is terminated (the description is omitted hereafter) ;

Wherein the mutation of the gene encoding ERBB4 comprises, in the amino acid sequence of SEQ ID NO: 2, at least one mismatch mutation selected from the group consisting of C593F, M799L, P1054H, I353N and C293F;

The mutation of the gene encoding F8 may be a mutation of frame shift delete (FS del), N1460Kfs * 2 frame shift mutation in the amino acid sequence of SEQ ID NO: 3, N1460Ifs * 5, or at least one of S372F and L1462H Is a nonsense mutation or a nonsense mutation that is Q2055 *, and the notation of frame shift mutation is amino acid type (amino acid position) amino acid type fs * (the number of nucleotides from the amino acid position to the stop codon in the downstream direction) Insertion mutation, and frame shift deletion mutants all have the same notation, and the description thereof is omitted below);

Wherein the mutation of the gene encoding RNF40 comprises, in the amino acid sequence of SEQ ID NO: 4, at least one mismatch mutation selected from the group consisting of T277I, R369L and E113D;

Wherein the mutation of the gene encoding SLC4A2 comprises a mutation in the amino acid sequence of SEQ ID NO: 5, a missense mutation of R793C or a frame shift insertion mutation of P928Sfs * 28;

Wherein the mutation of the gene encoding SCAF1 comprises at least one frame shift insertion mutation selected from the group consisting of A219Sfs * 11, P211Tfs * 19 and P211Tfs * 19, or a frame shift deletion of A216Pfs * 94 in the amino acid sequence of SEQ ID NO: Mutation;

Wherein the mutation of the gene encoding GXYLT1 comprises at least one mismatch mutation selected from the group consisting of S107R, D373G and P204L in the amino acid sequence of SEQ ID NO: 7;

The mutation of the gene encoding CEP295 is a missense mutation of R793C in the amino acid sequence of SEQ ID NO: 8 or a frame shift insertion mutation of P928Sfs * 28;

Wherein the mutation of the gene encoding PCDHA6 comprises at least one mismatch mutation selected from the group consisting of S608L, A731T and Y718H in the amino acid sequence of SEQ ID NO: 9;

Wherein the mutation of the gene encoding ZNF844 comprises at least one mismatch mutation selected from the group consisting of H514D, N508I, T91R and Q241K in the amino acid sequence of SEQ ID NO: 10;

The mutation of the gene encoding the MAFA is an in-frame deletion (IF del) mutation in the amino acid sequence of SEQ ID NO: 11, which is H208del. In the notation of the in-frame insertion mutation, del is the amino acid sequence position Indicates that the corresponding amino acid is deleted, and a description thereof will be omitted below.

Wherein the mutation of the gene encoding MYH1 comprises at least one mismatch mutation selected from the group consisting of P685A, R823H, S1144F and A13V in the amino acid sequence of SEQ ID NO: 12, or a frame shift insertion mutation of K59Efs * 5;

Wherein the mutation of the gene encoding NDUFAF3 comprises at least one mismatch mutation of S62G and Q88K in the amino acid sequence of SEQ ID NO: 13;

Wherein the mutation of the gene encoding NKAIN3 comprises at least one mismatch mutation selected from the group consisting of A35G, C185F and E174V in the amino acid sequence of SEQ ID NO: 14;

Wherein the mutation of the gene encoding SERPINI2 comprises the amino acid sequence of SEQ ID NO: 15, a mismatch mutation of at least one of S344G and A110S;

Wherein the mutation of the gene encoding ZBTB41 comprises at least one mismatch mutation selected from the group consisting of E346G, R61G and A449E in the amino acid sequence of SEQ ID NO: 16, or a F444Sfs * 3 frame shift insertion mutation;

The mutation of the gene encoding MUC6 is an in-frame deletion mutation in the amino acid sequence of SEQ ID NO: 17, which is T1544del, or a frame shift insertion mutation that is at least one of P1570Tfs * 136 and P1570Tfs * 136, or N1937T, T1861A, D1187N, A1471S At least one mismatch mutation selected from the group consisting of A1479T, S2156W, T1911M, F1585L, G1581E, P1569L, V1416I and T1138M, or a frame shift deletion mutant of P1571Hfs * 21;

Wherein the mutation of the gene encoding SLC27A6 comprises at least one mismatch mutation selected from the group consisting of G77R, M564I, G615A, G375W, R140L and L35M in the amino acid sequence of SEQ ID NO: 18;

Wherein the mutation of the gene encoding BTNL3 comprises at least one mismatch mutation selected from the group consisting of A448V, R82Q and S187R, or an in-frame deletion mutant in the amino acid sequence of SEQ ID NO: 19, which is M254del;

Wherein the mutation of the gene encoding CADPS is selected from the group consisting of a mismatch mutation in at least one of D1242H and S1332I in the amino acid sequence of SEQ ID NO: 20, a nonsense mutation in Q1285 *, or a splice mutation in X1185_splice , Or a frame shift insertion mutation of T1111Yfs * 6;

Wherein the mutation of the gene encoding the CCDC173 is a nonsense mutation which is E419 * in the amino acid sequence of SEQ ID NO: 21, or a mutation of at least one of K375N and V431F;

Wherein the mutation of the gene encoding PPIL4 comprises at least one mismatch mutation selected from the group consisting of D353E, G328V, T389S and D168N in the amino acid sequence of SEQ ID NO: 22;

Wherein the mutation of the gene encoding SHMT2 comprises a mutation in the amino acid sequence of SEQ ID NO: 23 that is a mismatch mutation of at least one of E401K and F79L, or a frame shift deletion mutation that is Y195 *;

The mutation of the gene coding for SLC47A2 may be a frame shift deletion mutation of F397Lfs * 11, a splice mutation of X530_splice (substitution of T with C at chromosome 19582221), at least one of F291L and F27L in the amino acid sequence of SEQ ID NO: One missense mutation;

Wherein the mutation of the gene encoding TMEM169 is a frame shift mutation of K42Rfs * 43 in the amino acid sequence of SEQ ID NO: 25, or a nonstun mutation of * 298Yext * 18, and at least one mismatch mutation of A240T and Y181F;

Wherein the mutation of the gene encoding TMEM184C comprises at least one mismatch mutation selected from the group consisting of S389F, D96N, R85T and F363C in the amino acid sequence of SEQ ID NO: 26;

Wherein the mutation of the gene encoding WDR62 comprises a nonsense mutation that is E541 * in the amino acid sequence of SEQ ID NO: 27, or a mutation in at least one of G494E and P1054S, or at least one frame shift deletion mutation of S1105Qfs * 22 and S1105 * ;

Wherein the mutation of the gene encoding RTN3 comprises at least one mismatch mutation selected from the group consisting of E622K, E260D and S312N in the amino acid sequence of SEQ ID NO: 28;

Wherein the mutation of the gene encoding SCN2A comprises at least one mismatch mutation selected from the group consisting of G899S, D693E and E44G in the amino acid sequence of SEQ ID NO: 29, or a G59Vfs * 30 frame shift insertion mutation;

Wherein the mutation of the gene encoding SLC25A13 comprises, in the amino acid sequence of SEQ ID NO: 30, at least one mismatch mutation selected from the group consisting of G482R, S426P and G441S;

Wherein the mutation of the gene encoding SLC4A2 comprises a mutation in the amino acid sequence of SEQ ID NO: 5, a missense mutation of R793C or a frame shift insertion mutation of P928Sfs * 28;

Wherein the mutation of the gene encoding DDX20 comprises at least one mismatch mutation selected from the group consisting of S172P, F403L and S685Y in the amino acid sequence of SEQ ID NO: 31, or a splice mutation wherein X438_splice is a mutation;

The mutation of the gene encoding ARHGAP26 comprises at least one mismatch mutation selected from the group consisting of N621Y, K566N and R19L in the amino acid sequence of SEQ ID NO: 32, or a mutant of N666Efs * 79, N666Efs * 79 and N666Efs * 79 At least one frame shift insertion mutation selected from the group consisting of:

Wherein the mutation of the gene encoding GABRE is a mismatch mutation of at least one of R472H and Y478N in the amino acid sequence of SEQ ID NO: 33, or a frame shift insertion mutation of I234Nfs * 3;

Wherein the mutation of the gene encoding IPO7 comprises, in the amino acid sequence of SEQ ID NO: 34, at least one mismatch mutation selected from the group consisting of N34H, R427Q and M781I;

The mutation of the gene encoding PDE4C is at least one mismatch mutation selected from the group consisting of S254F, D429N, T561M, L488Q and N437K, or a frame shift insertion mutation of Y557Lfs * 21 in the amino acid sequence of SEQ ID NO: 35;

Wherein the mutation of the gene encoding PRKCQ comprises a frame shift deletion mutation in the amino acid sequence of SEQ ID NO: 36, Q43Rfs * 32, or at least one meseSense mutation in F448V and L350V, or a frame shift insertion mutation in V457Cfs * 31;

The mutation of the gene coding for PRSS38 may be a frame shift insertion mutation of S314Qfs * 21, a Missense mutation of V315I, or a splice mutation of X104_splice (substitution of G for T at chromosome position 228004909) in the amino acid sequence of SEQ ID NO: ;

The mutation of the gene encoding ADAMTS20 is a splice mutation in at least one of X1741_splice (C is substituted for T at position 43769952) and X205_splice (C is substituted at T at position 43896209 for C) in the amino acid sequence of SEQ ID NO: 38 At least one mismatch mutation selected from the group consisting of R1630W, V1383I, S1546L and G1209V, or a nonsense mutation that is W1085 *;

The mutation of the gene encoding ODZ4 is at least one mismatch mutation selected from the group consisting of V2177L, L697F and M2761T in the amino acid sequence of SEQ ID NO: 39, or a frame shift insertion mutation of K619Efs * 4;

Wherein the mutation of the gene encoding the PLEC is at least one mismatch mutation selected from the group consisting of K1427R, P3986Q, T2862M, R609C, A2774G and A1713V in the amino acid sequence of SEQ ID NO: 40, or a nonsense mutation E4243 *.

Next Generation Sequencing (NGS), RT-PCR, direct nucleic acid sequence analysis, microarray can be used as an assay method for diagnosing the prognosis of renal cancer using the mutation of the gene. Any method that can confirm the presence of a mutation using a mutation of a gene can be applied without limitation. In one embodiment, the presence of the mutation is determined using an anti- (mutant of each gene) antibody or nucleic acid probe that hybridizes under stringent conditions to a polynucleotide of the mutation of each gene. In another embodiment, the antibody or nucleic acid probe is detectably labeled. In another embodiment, the label is selected from the group consisting of an immunofluorescent label, a chemiluminescent label, a phosphorescent label, an enzyme label, a radioactive label, avidin / biotin, colloidal gold particles, colored particles and magnetic particles. In another embodiment, the presence of the mutation can be determined by one or more of the following methods: radioimmunoassay, western blot assay, immunofluorescence assay, enzyme immunoassay, immunoprecipitation assay, chemiluminescence assay, immunohistochemistry assay, dot blot assay, It is determined by the test. In another embodiment, the presence of the mutation is determined by RT-PCR. In another embodiment, the presence of the mutation is determined by nucleic acid sequence analysis.

The term " polynucleotide " in the present invention refers to any polyribonucleotide or polydeoxyribonucleotide, which may generally be unmodified RNA or DNA or modified RNA or DNA. Thus, for example, polynucleotides as defined herein include, but are not limited to, single- and double-stranded DNA, DNA comprising single- and double-stranded regions, single- and double-stranded RNA, Stranded regions, hybrid molecules comprising DNA and RNA which may be single-stranded or more typically double-stranded or may include single- and double-stranded regions. Thus, DNA or RNA having a modified backbone for stability or other reasons is a ' polynucleotide ' as the term is intended herein. Also included in the term " polynucleotide " is DNA or RNA, as defined herein, comprising an unconventional base such as inosine or a modified base such as a tritiated base. In general, the term " polynucleotide " encompasses all chemically, enzymatically and / or metabolically modified forms of unmodified polynucleotides. Polynucleotides may be prepared by a variety of methods, including in vitro recombinant DNA-mediated techniques, and by expression of DNA in cells and organisms.

A set of primers for detecting the mutation, i.e., a prognosis for kidney cancer, is as follows:

SEQ ID NO: 41 and SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44, SEQ ID NO: 45 and SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48, SEQ ID NO: 49 and SEQ ID NO: 50 and SEQ ID NO: 51 for mutation detection of ARAP3 At least one primer set selected from the group consisting of base sequence pairs shown in SEQ ID NO: 52;

SEQ ID NO: 53 and SEQ ID NO: 54, SEQ ID NO: 55 and SEQ ID NO: 56, SEQ ID NO: 57 and SEQ ID NO: 58, SEQ ID NO: 59 and SEQ ID NO: 60, SEQ ID NO: 61 and SEQ ID NO: 62 for mutation detection of ERBB4 At least one primer set selected from the group consisting of:

At least one primer set selected from the group consisting of SEQ ID NO: 63 and SEQ ID NO: 64 for the mutation detection of F8, SEQ ID NO: 65 and SEQ ID NO: 66, and SEQ ID NO: 67 and SEQ ID NO: 68;

At least one primer set selected from the group consisting of SEQ ID NO: 69 and SEQ ID NO: 70, SEQ ID NO: 71 and SEQ ID NO: 72 and SEQ ID NO: 73 and SEQ ID NO: 74 for mutation detection of RNF40;

A primer set of the nucleotide sequence pair shown in SEQ ID NO: 75 and SEQ ID NO: 76 for mutation detection of SLC4A2;

SEQ ID NO: 77 and SEQ ID NO: 78, SEQ ID NO: 79 and SEQ ID NO: 80, SEQ ID NO: 81 and SEQ ID NO: 82, SEQ ID NO: 83 and SEQ ID NO: 84, SEQ ID NO: 85 and SEQ ID NO: 86 for mutation detection of SCAF1 At least one primer set selected from the group consisting of:

At least one primer set selected from the group consisting of SEQ ID NO: 87 and SEQ ID NO: 88, SEQ ID NO: 89 and SEQ ID NO: 90, SEQ ID NO: 91 and SEQ ID NO: 92 for mutation detection of GXYLT1;

A primer set of the nucleotide sequence pair shown in SEQ ID NO: 93 and SEQ ID NO: 94 for the mutation detection of CEP295;

A primer set of base sequence pairs shown in SEQ ID NO: 95 and SEQ ID NO: 96 for mutation detection of PCDHA6;

At least one primer set selected from the group consisting of SEQ ID NO: 97 and SEQ ID NO: 98, SEQ ID NO: 99 and SEQ ID NO: 100 and SEQ ID NO: 101 and SEQ ID NO: 102 for mutation detection of ZNF844;

SEQ ID NO: 103 and SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106, SEQ ID NO: 107 and SEQ ID NO: 108, SEQ ID NO: 109 and SEQ ID NO: 110 and SEQ ID NO: 111 and SEQ ID NO: 112 for mutation detection of MAFA At least one primer set selected from the group consisting of:

113 and SEQ ID NO: 114, SEQ ID NO: 115 and SEQ ID NO: 116, SEQ ID NO: 117 and SEQ ID NO: 118, SEQ ID NO: 119 and SEQ ID NO: 120, SEQ ID NO: 121 and SEQ ID NO: 122 for the mutation detection of MYH1 At least one primer set selected from the group consisting of:

A primer set of a nucleotide sequence pair shown in SEQ ID NO: 123 and SEQ ID NO: 124 for mutation detection of NDUFAF3;

At least one primer set selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126, SEQ ID NO: 127 and SEQ ID NO: 128, SEQ ID NO: 129 and SEQ ID NO: 130 for mutation detection of NKAIN3;

At least one primer set of SEQ ID NO: 131 and SEQ ID NO: 132, SEQ ID NO: 133 and SEQ ID NO: 134 for the mutation detection of SERPINI2;

At least one primer set selected from the group consisting of SEQ ID NO: 135 and SEQ ID NO: 136, SEQ ID NO: 137 and SEQ ID NO: 138 and SEQ ID NO: 139 and SEQ ID NO: 140 for mutation detection of ZBTB41;

SEQ ID NO: 141 and SEQ ID NO: 142, SEQ ID NO: 143 and SEQ ID NO: 144, SEQ ID NO: 145 and SEQ ID NO: 146, SEQ ID NO: 147 and SEQ ID NO: 148 for mutation detection of MUC6, The nucleotide sequence shown in SEQ ID NO: 149 and SEQ ID NO: 150, SEQ ID NO: 151 and SEQ ID NO: 152, SEQ ID NO: 153 and SEQ ID NO: 154, SEQ ID NO: 155 and SEQ ID NO: 156, SEQ ID NO: 157 and SEQ ID NO: 158, SEQ ID NO: At least one primer set selected from the group consisting of sequence pairs;

SEQ ID NO: 161 and SEQ ID NO: 162, SEQ ID NO: 163 and SEQ ID NO: 164, SEQ ID NO: 165 and SEQ ID NO: 166, SEQ ID NO: 167 and SEQ ID NO: 168, SEQ ID NO: 169 and SEQ ID NO: 170 and SEQ ID NO: 171 and SEQ ID NO: 171 for mutation detection of SLC27A6, At least one primer set selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 172;

At least one nucleotide sequence selected from the group consisting of SEQ ID NO: 173 and SEQ ID NO: 174, SEQ ID NO: 175 and SEQ ID NO: 176, SEQ ID NO: 177 and SEQ ID NO: 178, SEQ ID NO: 179 and SEQ ID NO: 180 for mutation detection of BTNL3 Primer set;

181 and SEQ ID NO: 182, SEQ ID NO: 183 and SEQ ID NO: 184, SEQ ID NO: 185 and SEQ ID NO: 186, SEQ ID NO: 187 and SEQ ID NO: 188 and SEQ ID NO: 189 and SEQ ID NO: 190 for mutation detection of CADPS At least one primer set selected from the group consisting of:

A primer set of at least one of the nucleotide sequence pairs shown in SEQ ID NO: 191 and SEQ ID NO: 192 and SEQ ID NO: 193 and SEQ ID NO: 194 for mutation detection of CCDC173;

At least one selected from the group consisting of SEQ ID NO: 195 and SEQ ID NO: 196, SEQ ID NO: 197 and SEQ ID NO: 198, SEQ ID NO: 199 and SEQ ID NO: 200 and SEQ ID NO: 201 and SEQ ID NO: 202 for the mutation detection of PPIL4 Primer set;

At least one primer set selected from the group consisting of SEQ ID NO: 203 and SEQ ID NO: 204, SEQ ID NO: 205 and SEQ ID NO: 206 and SEQ ID NO: 207 and SEQ ID NO: 208 for mutation detection of SHMT2;

At least one primer set selected from the group consisting of SEQ ID NO: 209 and SEQ ID NO: 210, SEQ ID NO: 211 and SEQ ID NO: 212 and SEQ ID NO: 213 and SEQ ID NO: 214 for mutation detection of SLC47A2;

At least one nucleotide sequence selected from the group consisting of SEQ ID NO: 215 and SEQ ID NO: 216, SEQ ID NO: 217 and SEQ ID NO: 218, SEQ ID NO: 219 and SEQ ID NO: 220, SEQ ID NO: 221 and SEQ ID NO: 222 for mutation detection of TMEM169 Primer set;

At least one selected from the group consisting of SEQ ID NO: 223 and SEQ ID NO: 224, SEQ ID NO: 225 and SEQ ID NO: 226, SEQ ID NO: 227 and SEQ ID NO: 228, SEQ ID NO: 229 and SEQ ID NO: 230 for mutation detection of TMEM184C Primer set;

At least one nucleotide sequence selected from the group consisting of SEQ ID NO: 231 and SEQ ID NO: 232, SEQ ID NO: 233 and SEQ ID NO: 234, SEQ ID NO: 235 and SEQ ID NO: 236, SEQ ID NO: 237 and SEQ ID NO: 238 for mutation detection of WDR62 Primer set;

At least one primer set selected from the group consisting of SEQ ID NO: 239 and SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO: 243 and SEQ ID NO: 244 for mutation detection of RTN3;

245, SEQ ID NO: 247, SEQ ID NO: 248, SEQ ID NO: 249 and SEQ ID NO: 250 and SEQ ID NO: 251 and SEQ ID NO: 252 for the mutation detection of SCN2A, Primer set;

At least one primer set selected from the group consisting of SEQ ID NO: 253 and SEQ ID NO: 254, SEQ ID NO: 255 and SEQ ID NO: 256, SEQ ID NO: 257 and SEQ ID NO: 258 for mutation detection of SLC25A13;

A primer set of a nucleotide sequence pair shown in SEQ ID NO: 259 and SEQ ID NO: 260 for mutation detection of SLC4A2;

At least one selected from the group consisting of SEQ ID NO: 261 and SEQ ID NO: 262, SEQ ID NO: 263 and SEQ ID NO: 264, SEQ ID NO: 265 and SEQ ID NO: 266, SEQ ID NO: 267 and SEQ ID NO: 268 for mutation detection of DDX20 Primer set;

At least one selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 269 and SEQ ID NO: 270, SEQ ID NO: 271 and SEQ ID NO: 272, SEQ ID NO: 273 and SEQ ID NO: 274, SEQ ID NO: 275 and SEQ ID NO: 276 for mutation detection of ARHGAP26 Primer set;

277 and SEQ ID NO: 278 for the mutation detection of GABRE, and at least one of the pair of base sequences shown in SEQ ID NO: 279 and SEQ ID NO: 280;

At least one primer set selected from the group consisting of SEQ ID NO: 281 and SEQ ID NO: 282, SEQ ID NO: 283 and SEQ ID NO: 284, and SEQ ID NO: 285 and SEQ ID NO: 286 for mutation detection of IPO7;

At least one selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 287 and SEQ ID NO: 288, SEQ ID NO: 289 and SEQ ID NO: 290, SEQ ID NO: 291 and SEQ ID NO: 292, SEQ ID NO: 293 and SEQ ID NO: 294 for mutation detection of PDE4C, Primer set;

At least one selected from the group consisting of SEQ ID NO: 295 and SEQ ID NO: 296, SEQ ID NO: 297 and SEQ ID NO: 298, SEQ ID NO: 299 and SEQ ID NO: 300, SEQ ID NO: 301 and SEQ ID NO: 302 for mutation detection of PRKCQ, Primer set;

A primer set of at least one of the nucleotide sequence pairs shown in SEQ ID NO: 303 and SEQ ID NO: 304, and SEQ ID NO: 305 and SEQ ID NO: 306 for the mutation detection of PRSS38;

SEQ ID NO: 307 and SEQ ID NO: 308, SEQ ID NO: 309 and SEQ ID NO: 310, SEQ ID NO: 311 and SEQ ID NO: 312, SEQ ID NO: 313 and SEQ ID NO: 314, SEQ ID NO: 315 and SEQ ID NO: 316 for mutation detection of ADAMTS20, At least one primer set selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 318, SEQ ID NO: 319, and SEQ ID NO: 320;

At least one selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 321 and SEQ ID NO: 322, SEQ ID NO: 323 and SEQ ID NO: 324, SEQ ID NO: 325 and SEQ ID NO: 326, and SEQ ID NO: 327 and SEQ ID NO: 328 for mutation detection of ODZ4 Primer set;

At least one primer set selected from the group consisting of SEQ ID NO: 329 and SEQ ID NO: 330, SEQ ID NO: 331, SEQ ID NO: 332, SEQ ID NO: 333 and SEQ ID NO: 334 for mutation detection of PLEC.

The kit of the present invention produced as described above is more economical because it saves time and cost as compared with the conventional gene mutation search method. In order to examine all of the genes using conventional gene mutation detection methods such as SSCP (Single Strand Conformational Polymorphism), PTT (Protein Truncation Test), cloning, direct sequencing, etc., It takes several months. In addition, next generation sequencing (NGS) allows for quick and simple inspections of genetic mutations. When the mutation is examined by conventional methods such as SSCP, cloning, direct sequence analysis, and RFLP (Restriction Fragment Length Polymorphism), it takes about one month to complete the test. On the other hand, when the kit of the present invention is used, The result can be obtained within about 10 to 11 hours, and since a set of primers capable of detecting a mutation in one chip are integrated together, time and cost can be reduced as compared with the conventional method. Since less than half of the reagent is consumed per experiment compared to the conventional method, the cost savings can be expected when the labor cost of the researcher is taken into consideration.

 2. A method to provide information necessary for the diagnosis of kidney cancer prognosis using a survival-specific mutant gene

Another aspect of the present invention provides a method for identifying a cancer patient, comprising the steps of: preparing sample DNA from a sample of a patient of renal cancer whose age is known; Amplifying the sample DNA using the kit; And confirming presence or absence of an age-specific marker specific to the age group of the subject from the amplification result; Treating a kidney cancer patient whose age-specific marker is confirmed by treating or treating any kidney cancer candidate candidate with an arbitrary method; And employing the candidate renal cancer therapeutic candidate or any therapeutic method as a candidate therapeutic substance or treatment method suitable for the age group of the kidney cancer patient whose age-specific marker has been identified when the kidney cancer is treated, The present invention provides a method for providing information necessary for determining the difference in the effect of treating renal cancer according to the age of the subject.

 Yet another aspect of the present invention provides a method of preparing a sample of kidney cancer comprising the steps of: preparing a sample DNA from a sample of a kidney cancer patient; Amplifying the sample DNA using the kit; And confirming the presence or absence of an age-specific marker from the amplification result. The present invention provides a method for providing information necessary for diagnosing a prognosis of renal cancer according to the age of a renal cancer patient.

The description of the 'kit for prognosis of kidney cancer' is the same as that described in ' 1. Age-specific mutant gene and a primer set capable of detecting these mutant genes in patients with kidney cancer ', and thus a detailed description thereof will be omitted.

Any of the candidate therapeutic agents may be a conventional therapeutic agent for renal cancer treatment or a novel agent for which the therapeutic effect on renal cancer is unknown. By examining the therapeutic effect after treating any of the candidate therapies with a kidney cancer patient having an age-specific marker, it can be determined whether the candidate therapeutic substance is effective for a specific patient group. If the treatment of renal cancer is effective, it can be predicted that the treatment effect is high when applied to patients having the same age-specific marker, so that it can provide useful information for determining treatment strategies. In addition, if the treatment effect does not appear when using any candidate for treatment, the patient group having the same age-specific marker does not proceed any further treatment, so that unnecessary treatment is not performed. Therefore, the treatment strategy can be efficiently designed have.

Any renal cancer treatment method may also be applied in place of any of the treatment candidate substances, and it may be determined whether or not to apply to the patient group having the same age-specific marker by confirming the therapeutic effect in a patient group having a specific age-specific marker. In the case of patients with age-specific markers, any treatment candidate and any renal cancer treatment method may be combined to confirm the therapeutic effect.

The term " sample " as used herein includes any biological sample obtained from a patient. The sample may be a whole blood, plasma, serum, red blood cells, leukocytes (e. G., Peripheral blood mononuclear cells), ductal fluid, ascites, pleural efflux, nipple aspirate, lymphatic fluid (E. G., Harvested by random wired microneedle aspiration), any other body fluids, tissues (e. G., Cells), bone marrow aspirates, saliva, urine, feces (E. G., Tumor biopsy) or a tissue sample (e. G., A tumor tissue), e. G., Surgical resection of the tumor , And cell extracts thereof. In some embodiments, the sample is whole blood or some of its components, such as plasma, serum or cell pellets. In other embodiments, the sample is obtained by isolating circulating cells of solid tumors from whole blood or cell fraction thereof using any technique known in the art. In another embodiment, the sample is a sample of formalin-fixed paraffin embedded (FFPE) tumor tissue from a solid tumor, such as, for example, colorectal cancer.

In certain embodiments, the sample is a tumor lysate or extract prepared from frozen tissue obtained from a subject having colon cancer.

The term " patient " includes not only humans but also other animals such as other primates, rodents, dogs, cats, horses, sheep, pigs and the like.

The term " individual " includes an object other than a human, which is judged to be kidney cancer or suspected.

The above method can predict the total survival rate or disease-free survival rate of kidney cancer patients.

The term " overall survival " as used herein includes clinical endpoints describing patients who are alive for a defined period of time after diagnosis or treatment of a disease, such as cancer, It means possibility.

The term " disease-free survival (DFS) " in the present invention encompasses the period of time a patient survives without recurrence of cancer after treatment for a particular disease (e.g., cancer).

The present invention can identify the prognosis of a subject having a subject sample by analyzing the presence of a mutation of the gene of the present invention in a sample of a patient with kidney cancer. This method can also be achieved by comparing the total survival or disease-free survival rate of individuals of the control group without a mutation known to be good in prognosis. In the present invention, an individual known to have good prognosis means an individual having no history such as metastasis, recurrence, or death after the cancer has developed.

A sample of a subject suspected of having cancer refers to a sample of a subject or tissue that has or has already developed a cancer or tumor and is intended to diagnose the prognosis.

The age-specific marker may be selected from the group consisting of ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, MYH1, NDUFAF3, NKAIN3, SERPINI2, ZBTB41, MUC6, SLC27A6, BTNL3, CADPS, CCDC173, SHMT2, SLC47A2, TMEM169, TMEM184C and WDR62.

Age-specific markers in patients with renal cancer less than 50 years of age may be mutations in a gene encoding one selected from the group consisting of RNF40, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, NDUFAF3, NKAIN3, RNF40, and SERPINI2 have.

In one embodiment of the invention, one selected from the group consisting of RNF40, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, MYH1, NDUFAF3, NKAIN3, RNF40, SERPINI2 and ZBTB41 in a patient Mutations in the encoding gene were confirmed (Example 2).

Age-specific markers in kidney cancer patients aged 51 to 60 years may be a mutation in a gene encoding one selected from the group consisting of ARAP3, MYH1, and ZBTB41.

Age-specific markers in kidney cancer patients aged 60 years or younger may be a mutation in the gene encoding SLC27A6.

Age-specific markers in kidney cancer patients over the age of 61 may be a mutation in the gene encoding MUC6.

Age-specific markers in kidney cancer patients aged 71 years or older can mutate in a gene encoding one selected from the group consisting of ERBB4, F8, SLC4A2, BTNL3, CADPS, CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, TMEM184C and WDR62 have.

The method of providing information necessary for the diagnosis of renal cancer according to the age of the renal cancer patients can predict the total survival rate or disease free survival rate of renal cancer patients. For example, the method may comprise mutating in a gene encoding one selected from the group consisting of RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ, PRSS38, ADAMTS20, ODZ4 and PLEC And determining that the survival rate of the renal cancer patient is not good or that the renal cancer recurrence rate of the renal cancer patient is high when the renal cancer patient is confirmed.

A method of providing information necessary for diagnosis of renal cancer according to the age of the renal cancer patient is as follows. When a renal cancer patient is under 50 years of age and a mutation is confirmed in a gene encoding PRSS38, And determining that the recurrence rate of renal cancer is high.

Methods for providing information for the diagnosis of renal cancer according to the age of the renal cancer patients are as follows: age of the renal cancer patients is 61 to 70 years old and RTN3, SLC25A13, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ in the case where a mutation is confirmed in the gene encoding the one selected from the group consisting of PRKCQ, PRKCQ, PRKCQ, PRKCQ, PRKCQ, .

A method of providing information necessary for diagnosis of renal cancer according to the age of the renal cancer patient is as follows. When the age of the renal cancer patient is over 61 years old and the mutation is confirmed in the gene encoding at least one of ODZ4 and PLEC, And determining that the renal cancer recurrence rate of the kidney cancer patient is high.

A method for providing information necessary for the diagnosis of renal cancer according to the age of the renal cancer patient is as follows. When the mutation is confirmed in a gene encoding at least one of SCN2A and SLC4A2, And determining that the renal cancer recurrence rate of the kidney cancer patient is high.

Thus, mutations of the gene of the present invention, ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, MYH1, NDUFAF3, NKAIN3, SERPINI2, ZBTB41, MUC6, SLC27A6, BTNL3, CADPS, There is still a difference in the gene mutation depending on the age at onset of cancer, particularly the renal cancer, using the mutation of at least one gene selected from the gene group consisting of CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, TMEM184C and WDR62 It has not been revealed. In addition, mutations of at least one gene selected from the group consisting of RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ, PRSS38, ADAMTS20, ODZ4, The prognosis for cancer, especially renal cancer, is still unknown. In addition, no report has been made that the total survival rate or disease-free survival rate of each gene may be different. The inventors of the present invention for the first time identified the mutation of the above genes as a diagnostic marker for predicting the difference in the therapeutic effect of renal cancer according to the age of patients with renal cancer or diagnosing the prognosis of renal cancer patients.

The method of providing the information necessary for predicting the difference in the effect of treating renal cancer according to the age of the present invention is to diagnose the gene mutation of kidney cancer based on age or to increase the survival rate of kidney cancer patients, It can be used to lower the recurrence rate. The method for diagnosing the prognosis of renal cancer according to the present invention can predict the therapeutic effect of renal cancer using the gene mutation information which is different depending on the age of onset of kidney cancer or predict the survival rate or recurrence rate of renal cancer patients, In addition to finding appropriate therapies for each patient, information on the choice of therapy can be provided, so that a therapeutic strategy for kidney cancer can be efficiently designed.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

However, the following examples and experimental examples are provided only for illustrating the present invention, and the content of the present invention is not limited by the following examples and experimental examples.

Obtaining genetic information and clinical information

The genes (ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, MYH1, NDUFAF3, NKAIN3, SERPINI2, ZBTB41, MUC6, SLC27A6, BTNL3, CADPS, CCDC173, PPIL4, Can be utilized as age-dependent renal cancer markers, such as, for example, SHMT2, SLC47A2, TMEM169, TMEM184C, WDR62, RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ, PRSS38, ADAMTS20, ODZ4, The data were collected from 417 patients with clear kidney cancer who had both genetic and clinical information from TCGA (Cancer Genome Atlas). The data were used to analyze the recurrence, metastasis, death, and observation time. Table 1 below shows data on relapse, metastasis and death of patients with transparent kidney cancer.

Number of patients (persons) ratio(%) Relapse 0 229 55.2% One 109 26.1% Not observed 79 18.7% transition 0 351 84.2% One 66 15.8% Dead 0 270 65.0% One 147 35.0% Total number of patients 417

Age-specific As a marker  Availability verification

417 patients were classified into four groups by age group (see Table 2), and the correlation between the mutation and the age of the candidate genes of Example 1 was confirmed by three Feature Selection (Information Gain, Chi-Square, MRMR). The mutated positions of the genes are shown in Tables 3 to 6 below.

Age group of patients with kidney cancer Age group age Percentage of patients (%) AG-Ⅰ ≤50 88 (21%) AG-II 51 ~ 60 119 (29%) AG-III 61 to 70 107 (25%) AG-IV ≥ 71 103 (25%) Age Group Comparison Test Set Type Detail Remarks Test set 1 AG-Ⅰ vs Ⅱ vs Ⅲ vs Ⅳ Comparative analysis between groups Test Set 2 AG-Ⅰ vs Ⅱ, Ⅲ, Ⅳ Comparative analysis around 50 years
(Patients under 50 years old vs patients over 51 years old) Test Set 3 AG-Ⅰ, Ⅱ vs Ⅲ, Ⅳ Comparative analysis around 60 years
(60 years old vs 61 years old or older) Test Set 4 AG-Ⅰ, Ⅱ, Ⅲ vs Ⅳ Comparative analysis about 70 years old
(Under 70 years vs 71 years old) Comparison of age groups Test Set Type Age-specific genes Test set 1 ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844 Test Set 2 MAFA, MYH1, NDUFAF3, NKAIN3, RNF40, SERPINI2, ZBTB41 Test Set 3 MUC6, SLC27A6 Test Set 4 BTNL3, CADPS, CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, TMEM184C, WDR62

Gene Accession No. AA change Type Copy # COSMIC Mutation
Assessor Chr Start Pos End Pos Ref Yes SCAF1 NM_021228.2 A219Sfs * 11 FS ins ShallowDel chr19 50154294 50154295 - C SCAF1 NM_021228.2 P211Tfs * 19 FS ins Diploid chr19 50154270 50154271 - C SCAF1 NM_021228.2 P211Tfs * 19 FS ins Diploid chr19 50154270 50154271 - C SCAF1 NM_021228.2 A216Pfs * 94 FS del Diploid chr19 50154291 50154294 TGCA - GXYLT1 NM_173601.1 S107R Missense Diploid One Neutral chr12 42512967 42512967 A T GXYLT1 NM_173601.1 D373G Missense Diploid 2 Medium chr12 42491287 42491287 T C GXYLT1 NM_173601.1 P204L Missense Diploid One Medium chr12 42503369 42503369 G A MAFA NM_201589.3 H208del IF del Diploid 5 chr8 144511954 144511956 TGG - MAFA NM_201589.3 H208del IF del Diploid 5 chr8 144511954 144511956 TGG - MYH1 NM_005963.3 P685A Missense ShallowDel One Medium chr17 10409332 10409332 G C MYH1 NM_005963.3 R823H Missense ShallowDel 3 High chr17 10408350 10408350 C T MYH1 NM_005963.3 S1144F Missense Diploid One Medium chr17 10404734 10404734 G A MYH1 NM_005963.3 A13V Missense Diploid 2 Medium chr17 10419922 10419922 G A MYH1 NM_005963.3 K59Efs * 5 FS ins Gain chr17 10419785 10419786 - C MYH1 NM_005963.3 K59Efs * 5 FS ins Diploid chr17 10419785 10419786 - C NDUFAF3 NM_199069.1 S62G Missense ShallowDel One Neutral chr3 49059885 49059885 A G NDUFAF3 NM_199069.1 Q88K Missense DeepDel One Low chr3 49059963 49059963 C A NKAIN3 NM_001304533.1 A35G Missense Diploid 2 Medium chr8 63492147 63492147 C G NKAIN3 NM_001304533.1 C185F Missense Diploid One Neutral chr8 63902748 63902748 G T NKAIN3 NM_001304533.1 E174V Missense Diploid One Medium chr8 63831061 63831061 A T SERPINI2 NM_006217.4 S344G Missense ShallowDel 2 Medium chr3 167167125 167167125 T C SERPINI2 NM_006217.4 A110S Missense Gain One Low chr3 167184993 167184993 C A ZBTB41 NM_194314.2 E346G Missense Diploid One Low chrl 197168567 197168567 T C ZBTB41 NM_194314.2 R61G Missense Diploid One Low chrl 197169423 197169423 T C ZBTB41 NM_194314.2 A449E Missense Diploid One Neutral chrl 197159944 197159944 G T ZBTB41 NM_194314.2 F444Sfs * 3 FS del Diploid chrl 197159958 197159959 AA - MUC6 NM_005961.2 T1544del IF del Diploid chr11 1018168 1018170 TCG - MUC6 NM_005961.2 P1570Tfs * 136 FS ins Diploid chr11 1018093 1018094 - T MUC6 NM_005961.2 P1570Tfs * 136 FS ins Diploid chr11 1018093 1018094 - T MUC6 NM_005961.2 N1937T Missense Diploid One Neutral chr11 1016991 1016991 T G MUC6 NM_005961.2 T1861A Missense Diploid One Neutral chr11 1017220 1017220 T C MUC6 NM_005961.2 D1187N Missense Diploid One Low chr11 1021245 1021245 C T MUC6 NM_005961.2 A1471S Missense Diploid One Neutral chr11 1018390 1018390 C A MUC6 NM_005961.2 A1479T Missense Diploid 4 Neutral chr11 1018366 1018366 C T MUC6 NM_005961.2 S2156W Missense Diploid One Neutral chr11 1016334 1016334 G C MUC6 NM_005961.2 P1571Hfs * 21 FS del Diploid 14 chr11 1018089 1018089 G - MUC6 NM_005961.2 T1911M Missense Diploid 2 Medium chr11 1017069 1017069 G A MUC6 NM_005961.2 F1585L Missense Diploid 3 Low chr11 1018048 1018048 A G MUC6 NM_005961.2 G1581E Missense Diploid One Low chr11 1018059 1018059 C T MUC6 NM_005961.2 P1569L Missense ShallowDel 3 Medium chr11 1018095 1018095 G A MUC6 NM_005961.2 V1416I Missense ShallowDel 2 Low chr11 1018555 1018555 C T MUC6 NM_005961.2 T1138M Missense Diploid One Low chr11 1023622 1023622 G A

Gene Accession No. AA change Type Copy # COSMIC Mutation
Assessor Chr Start Pos End Pos Ref Yes SLC27A6 NM_001017372.2 G77R Missense Diploid One Medium chr5 128302059 128302059 G A SLC27A6 NM_001017372.2 M564I Missense AMP 2 Neutral chr5 128368807 128368807 G A SLC27A6 NM_001017372.2 G615A Missense Gain One Medium chr5 128368959 128368959 G C SLC27A6 NM_001017372.2 G375W Missense Gain One High chr5 128351731 128351731 G T SLC27A6 NM_001017372.2 R140L Missense Gain 3 Medium chr5 128302249 128302249 G T SLC27A6 NM_001017372.2 L35M Missense Diploid One Medium chr5 128301933 128301933 T A BTNL3 NM_197925.2 A448V Missense AMP 2 Low chr5 180432814 180432814 C T BTNL3 NM_197925.2 M254del IF del AMP One chr5 180429757 180429759 GAT - BTNL3 NM_197925.2 R82Q Missense Gain One Neutral chr5 180420008 180420008 G A BTNL3 NM_197925.2 S187R Missense Diploid One Neutral chr5 180424374 180424374 A C CADPS NM_003716.3 D1242H Missense Diploid Medium chr3 62423832 62423832 C G CADPS NM_003716.3 Q1285 * Nonsense ShallowDel chr3 62388785 62388785 G A CADPS NM_003716.3 S1332I Missense ShallowDel Medium chr3 62385148 62385148 C A CADPS NM_003716.3 X1185_splice Splice ShallowDel chr3 62451127 62451127 T A CADPS NM_003716.3 X1185_splice Splice Diploid chr3 62451127 62451127 T A CADPS NM_003716.3 T1111Yfs * 6 FS ins ShallowDel chr3 62459994 62459995 - A CCDC173 NM_001085447.1 E419 * Nonsense Gain chr2 170505754 170505754 C A CCDC173 NM_001085447.1 K375N Missense Gain Low chr2 170506866 170506866 T G CCDC173 NM_001085447.1 V431F Missense Diploid Low chr2 170505718 170505718 C A PPIL4 NM_139126.3 D353E Missense Diploid Neutral chr6 149838510 149838510 A C PPIL4 NM_139126.3 G328V Missense Diploid One Medium chr6 149838586 149838586 C A PPIL4 NM_139126.3 T389S Missense Diploid One Neutral chr6 149833352 149833352 G C PPIL4 NM_139126.3 D168N Missense ShallowDel One Medium chr6 149855873 149855873 C T SHMT2 NM_001166356.1 E401K Missense Diploid High chr12 57627609 57627609 G A SHMT2 NM_001166356.1 F79L Missense Diploid One Medium chr12 57625269 57625269 C A SHMT2 NM_001166356.1 Y195 * FS del Diploid chr12 57626066 57626066 T - SLC47A2 NM_152908.3 F397Lfs * 11 FS del Diploid chr17 19606416 19606416 A - SLC47A2 NM_152908.3 X530_splice Splice Diploid chr17 19582221 19582221 T C SLC47A2 NM_152908.3 F291L Missense Diploid One Neutral chr17 19610039 19610039 A G SLC47A2 NM_152908.3 F27L Missense Diploid One Neutral chr17 19619790 19619790 A G TMEM169 NM_001142310.1 K42Rfs * 43 FS del Diploid chr2 216960807 216960807 A - TMEM169 NM_001142310.1 * 298Yext * 18 Nonstop Diploid One chr2 216965265 216965265 A T TMEM169 NM_001142310.1 A240T Missense Diploid One Low chr2 216965089 216965089 G A TMEM169 NM_001142310.1 Y181F Missense Diploid One Medium chr2 216964913 216964913 A T

Gene Accession No. AA change Type Copy # COSMIC Mutation
Assessor Chr Start Pos End Pos Ref Yes TMEM184C NM_018241.2 S389F Missense Diploid Low chr4 148555434 148555434 C T TMEM184C NM_018241.2 D96N Missense ShallowDel One Low chr4 148545244 148545244 G A TMEM184C NM_018241.2 R85T Missense Diploid One High chr4 148545115 148545115 G C TMEM184C NM_018241.2 F363C Missense ShallowDel One Medium chr4 148555356 148555356 T G WDR62 NM_001083961.1 E541 * Nonsense Diploid One chr19 36575625 36575625 G T WDR62 NM_001083961.1 G494E Missense Diploid One Low chr19 36574074 36574074 G A WDR62 NM_001083961.1 P1054S Missense Diploid One Medium chr19 36592993 36592993 C T WDR62 NM_001083961.1 S1105Qfs * 22 FS del Diploid chr19 36593730 36593730 C - WDR62 NM_001083961.1 S1105 * FS del Diploid chr19 36593732 36593733 CA - ARAP3 NM_022481.5 C527F Missense Diploid One High chr5 141051674 141051674 C A ARAP3 NM_022481.5 S836 * Nonsense Gain 4 chr5 141046056 141046056 G T ARAP3 NM_022481.5 S836 * Nonsense Diploid 4 chr5 141046056 141046056 G T ARAP3 NM_022481.5 Q391Pfs * 35 FS ins Diploid One chr5 141052414 141052415 - G ARAP3 NM_022481.5 R763Efs * 11 FS ins Diploid chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins AMP chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins Diploid chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins AMP chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins Diploid chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins Diploid chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins Gain chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins Diploid chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins AMP chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins Gain chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins Diploid chr5 141049341 141049342 - C ARAP3 NM_022481.5 R763Efs * 11 FS ins Diploid chr5 141049341 141049342 - C ARAP3 NM_022481.5 P744Tfs * 3 FS ins Diploid chr5 141049509 141049510 - G ARAP3 NM_022481.5 P744Tfs * 3 FS ins AMP chr5 141049509 141049510 - G ARAP3 NM_022481.5 P744Tfs * 3 FS ins Diploid chr5 141049509 141049510 - G ARAP3 NM_022481.5 P744Tfs * 3 FS ins Diploid chr5 141049509 141049510 - G ARAP3 NM_022481.5 P744Tfs * 3 FS ins Diploid chr5 141049509 141049510 - G ARAP3 NM_022481.5 P744Tfs * 3 FS ins Diploid chr5 141049509 141049510 - G ARAP3 NM_022481.5 P744Tfs * 3 FS ins AMP chr5 141049509 141049510 - G ARAP3 NM_022481.5 P744Tfs * 3 FS ins Gain chr5 141049509 141049510 - G ARAP3 NM_022481.5 A652Sfs * 3 FS ins Gain chr5 141050869 141050870 - G ERBB4 NM_001042599.1 C593F Missense Gain High chr2 212530141 212530141 C A ERBB4 NM_001042599.1 M799L Missense Diploid One Low chr2 212426720 212426720 T A ERBB4 NM_001042599.1 P1054H Missense Diploid One Neutral chr2 212252692 212252692 G T ERBB4 NM_001042599.1 I353N Missense Gain One Medium chr2 212576841 212576841 A T ERBB4 NM_001042599.1 C293F Missense Diploid One High chr2 212587123 212587123 C A F8 NM_000132.3 N1460Ifs * 5 FS del ShallowDel 10 chr23 154157686 154157686 T - F8 NM_000132.3 N1460Kfs * 2 FS ins Gain 10 chr23 154157685 154157686 - T F8 NM_000132.3 S372F Missense Diploid One Medium chr23 154194857 154194857 G A F8 NM_000132.3 Q2055 * Nonsense Diploid One chr23 154129670 154129670 G A F8 NM_000132.3 L1462H Missense Diploid One Medium chr23 154157680 154157680 A T

Gene Accession No. AA change Type Copy # COSMIC Mutation
Assessor Chr Start Pos End Pos Ref Yes RNF40 NM_001207033.1 T277I Missense Diploid One Medium chr16 30776560 30776560 C T RNF40 NM_001207033.1 R369L Missense Diploid One Low chr16 30777596 30777596 G T RNF40 NM_001207033.1 E113D Missense Diploid One Neutral chr16 30774777 30774777 G T CEP295 NM_033395.1 R793C Missense Gain 2 High chr7 150769065 150769065 C T CEP295 NM_033395.1 P928Sfs * 28 FS ins Diploid chr7 150771368 150771369 - T PCDHA6 NM_018909.3 S608L Missense Gain 4 Medium chr5 140209499 140209499 C T PCDHA6 NM_018909.3 A731T Missense Gain 3 Low chr5 140209867 140209867 G A PCDHA6 NM_018909.3 Y718H Missense Diploid One High chr5 140209828 140209828 T C ZNF844 NM_001136501.2 H514D Missense Diploid 12 Neutral chr19 12187475 12187475 C G ZNF844 NM_001136501.2 N508I Missense Diploid One Low chr19 12187458 12187458 A T ZNF844 NM_001136501.2 T91R Missense Diploid One Neutral chr19 12186207 12186207 C G ZNF844 NM_001136501.2 Q241K Missense Diploid One Neutral chr19 12186656 12186656 C A SLC4A2 NM_001199692.2 R793C Missense Gain 2 High chr7 150769065 150769065 C T SLC4A2 NM_001199692.2 P928Sfs * 28 FS ins Diploid chr7 150771368 150771369 - T

 [2-1] Angle Between groups  Comparative analysis (test set 1)

In Table 2, we confirmed the association between the mutation of candidate genes and the age of kidney cancer patients in each of the four age groups divided into groups. A P-value less than 0.05 was considered statistically significant. Table 7 and Table 8 below show the information of candidate genes associated with test set 1 (M0: no distant metastasis, M1: distant metastasis).

　
Age group
(Number of patients whose mutations in the gene were confirmed) Total number of patients whose mutations in the gene were identified
Anova (P-value)
Mutation (%)
Mutation type Saito Band
transition transition(%)
Ⅰ Ⅱ Ⅲ IV cut Miss Sense (P) Miss Sense (D) Inflammation M0 M1 ARFGEF1 2 4 8 One 15 0.572 4 12 3 0 0 8q13 15 0 0 KIF16B One One 4 0 6 0.456 One 3 3 0 0 20p11.23 6 0 0 RTN3 0 0 2 One 3 0.188 One 0 3 0 0 11q13 2 One 33.3 ARAP3 3 8 4 One 16 0.047 3.8 15 One 0 0 5q31.3 16 One 5.88 ATG7 0 3 0 0 3 0.378 0.7 3 0 0 0 3p25.3 3 0 0 DHX35 One 3 3 0 7 0.922 1.7 5 2 0 0 20q11.23-q12 7 0 0 ERBB4 0 0 One 4 5 0.015 1.2 0 5 0 0 2q34 5 0 0 F8 0 One One 3 5 0.049 1.2 3 2 0 0 Xq28 5 0 0 KIAA1551 0 0 2 One 3 0.283 0.7 0 3 0 0 12p11.21 3 One 25 LAMC3 One 2 2 0 5 0.393 1.2 2 3 0 0 9q34.12 5 0 0 RNF40 3 0 0 0 3 0.012 0.7 0 3 0 0 16p11.2 3 0 0 SCN2A One 0 0 3 4 0.08 One One 3 0 0 2q24.3 4 One 20 SLC25A13 0 0 3 0 3 0.739 0.7 0 3 0 0 7q21.3 3 One 25 SLC4A2 0 0 0 2 2 0.049 0.5 One One 0 0 7q36.1 2 One 33.3 DDX20 0 0 3 One 4 0.435 One One 3 0 0 1p21.1-p13.2 2 2 50 SCAF1 2 2 0 0 4 0.05 One 4 0 0 0 19q13.3-q13.4 3 One 25 GXYLT1 3 0 0 0 3 0.012 One 0 3 0 0 12q12 One 2 66

　
Age group
(Number of patients whose mutations in the gene were confirmed) Total number of patients whose mutations in the gene were identified
Anova (P-value)
Mutation (%)
Mutation type Saito Band
transition transition
(%)
Ⅰ Ⅱ Ⅲ IV cut Miss Sense (P) Miss Sense (D) Inflammation M0 M1 AGAP7P 0 0 2 One 3 0.188 0.72% 3 0 0 0 10q11.22 3 0 0.00% 7q11.23 ARHGAP26 One 0 3 2 6 0.093 1.44% 3 3 0 0 5q31.3 6 0 0.00% CEP295 3 0 0 0 3 0.012 0.72% 0 3 0 0 11q21 3 0 0.00% GABRE 0 0 2 One 3 0.188 0.72% One 2 0 0 Xq28 3 0 0.00% IPO7 0 0 3 0 3 0.739 0.72% 0 3 0 0 11p15.4 2 One 33.30% PCDHA6 3 0 0 0 3 0.012 0.72% 0 3 0 0 5q31.3 2 One 33.30% PDE4C One 0 5 0 6 0.997 1.44% One 5 0 0 19p13.11 3 3 50.00% PRKCQ One 0 3 0 4 0.949 0.96% 2 2 0 0 10p15.1 2 2 50.00% ZNF844 4 0 0 0 4 0.005 0.96% 0 4 0 0 19p13.2 3 One 25.00%

As a result of the analysis, genes with mutations in each age group were found to have a P-value of 0.05 or more when compared to other groups, while those with a mutation and a P-value of less than 0.05 were identified. Mutagenic genes with a P-value of less than 0.05 when compared to other groups are age-specific, as they are more likely to be associated with specific age groups than other groups. For example, ARFGEF1, KIF16B, and RTN3 had a higher total number of mutated patients, but higher P-values of 0.05, indicating that mutations in these genes were not correlated with age. In contrast, the P-values of ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6 and ZNF844 were less than 0.05, indicating that mutations in these genes were correlated with age .

Figure 1 shows the results according to test set 1. As shown in FIG. 1, ARAP3 has a higher number of patients having mutated genes in group II than the other groups. ERBB4, F8, and SLC4A2 have more mutated genes in group IV than the other groups, and RNF40, SCAF1, GXYLT1, CEP295, PCDHA6 and ZNF844 were found to be more mutated in group I than in other groups.

From the above results, it can be seen that the mutation of ARAP3 can be used as a marker specific to the age group of 51 to 60 years old, which is a group II, and the mutation of ERBB4, F8 and SLC4A2 is a marker specific to the age group 71 or more It was found that it could be used. It was also found that the mutations of RNF40, SCAF1, GXYLT1, CEP295, PCDHA6, and ZNF844 can be used as markers specific for the age group of 50 years old or younger.

 [2-2] Comparative analysis before and after 50 years (test set 2)

In Table 2, we confirmed the association between the mutation of the candidate genes and the age of patients with kidney cancer for the Ⅰ group and the Ⅱ + Ⅲ + Ⅳ group among the age-classified groups. Table 9 and Table 10 show the information of candidate genes related to test set 2. A P-value less than 0.05 was considered statistically significant.

　
Age group
(Number of patients whose mutations in the gene were confirmed) Total number of patients whose mutations in the gene were identified
Anova (P-value)
Mutation (%)
Mutation type Saito Band
transition transition(%)
Ⅰ Ⅱ Ⅲ IV cut Miss Sense (P) Miss Sense (D) Inflammation M0 M1 CCM2 One 0 0 0 One 0.211 0.2 0 One 0 0 7p13 One 0 0 CDH19 One One One One 4 One One One 2 0 One 18q22.1 4 0 0 CHD8 2 One 0 0 3 0.114 0.7 One 2 0 0 14q11.2 3 0 0 DIAPH3 2 0 One 0 3 0.114 0.7 3 0 0 0 13q21.2 3 0 0 DPYSL2 3 2 0 One 6 0.111 1.4 6 0 0 0 8p21.2 6 0 0 GPSM1 One 0 One 0 2 0.378 0.5 0 2 0 0 9q34.3 2 0 0 LRP11 One 2 0 0 3 0.51 0.7 One 2 0 0 6q25.1 3 0 0 MAFA 2 0 0 0 2 0.044 0.5 0 0 0 2 8q24.3 2 0 0 MAP1B 5 One 5 2 13 0.159 3.1 13 0 0 0 5q13.2 13 0 0 MCM3AP 4 4 4 2 14 0.506 3.4 10 4 0 0 21q22.3 13 One 7.1 MYH1 4 One 0 0 5 0.008 1.2 2 3 0 0 17p13.1 4 One 20 MYNN 2 2 0 0 4 0.197 One One 3 0 0 3q26.2 4 0 0 NDUFAF3 2 0 0 0 2 0.044 0.5 0 2 0 0 3p21.31 2 0 0 NKAIN3 3 0 0 0 3 0.009 0.7 0 3 0 0 8q12.3 2 One 33

　
Age group
(Number of patients whose mutations in the gene were confirmed) Total number of patients whose mutations in the gene were identified
Anova (P-value)
Mutation (%)
Mutation type Saito Band
transition transition(%)
Ⅰ Ⅱ Ⅲ IV cut Miss Sense (P) Miss Sense (D) Inflammation M0 M1 PNLIP 2 0 0 One 3 0.114 0.7 One 2 0 0 10q25.3 3 0 0 PRSS38 2 One 0 0 3 0.114 0.7 2 One 0 0 1q42.13 One 2 66 PTBP2 0 0 One 0 One One 0.2 0 One 0 0 1p21.3 One 0 0 PTPRR One One 0 0 2 0.378 0.5 0 2 0 0 12q15 One One 50 RNF40 3 0 0 0 3 0.009 0.7 0 3 0 0 16p11.2 3 0 0 SCAF1 2 2 0 0 4 0.197 One 4 0 0 0 19q13.33 3 One 25 SERPINI2 2 0 0 0 2 0.044 0.5 0 2 0 0 3q26.1 One One 50 SLC44A3 One 2 0 0 3 0.51 0.7 0 3 0 0 1p21.3 3 0 0 SPECC1 One One 0 One 3 0.114 0.7 0 3 0 0 17p11.2 3 0 0 TMEM39B One 0 0 0 One 0.378 0.2 0 One 0 0 1p35.2 One 0 0 UHRF1 null 19p13.3 null ZBTB41 3 One 0 0 4 0.031 One One 3 0 0 1q31.3 4 0 0

The results of Tables 9 and 10 show that a mutant gene with a P-value of 0.05 or more and a mutant gene with a P-value of less than 0.05 were identified when comparing groups 50 years or younger and groups 51 and older. When comparing the two groups, the mutant genes with a P-value of less than 0.05 were correlated with specific groups, and therefore, they were defined as age-specific genes for each group. For example, CCM2, CDH19, and CHD8 were mutated, but the P-value was higher than 0.05, indicating that there was no correlation between mutations in these genes and age of kidney cancer patients. In contrast, MAFA, MYH1, NDUFAF3, NKAIN3, RNF40, SERPINI2, and ZBTB41 showed a P-value of less than 0.05, indicating that mutations in these genes correlate with age in renal cancer patients.

Figure 2 shows the results according to test set 2. As shown in FIG. 2, MAFA, NDUFAF3, NKAIN3, RNF40 and SERPINI2 were found to be mutated at the age of 50 years or less in the Ⅰ group, and MYH1 and ZBTB41 were mutated in patients I and II,

From the above results, it can be seen that mutations of MAFA, NDUFAF3, NKAIN3, RNF40 and SERPINI2 can be used as specific markers in the age group of 50 years or less. Mutations of MYH1 and ZBTB41 can be used as specific markers It can be seen that it can be used.

 [2-3] Comparative analysis before and after 60 years (test set 3)

In Table 2, we confirmed the association between the mutation of candidate genes and the age of patients with renal cancer in the group I + II and III + IV among the age-grouped groups. Table 11 and Table 12 below show the information of candidate genes related to test set 3. A P-value less than 0.05 was considered statistically significant.

　
Age group
(Number of patients whose mutations in the gene were confirmed) Total number of patients whose mutations in the gene were identified
Anova (P-value)
Mutation (%)
Mutation type Saito Band
transition transition(%)
Ⅰ Ⅱ Ⅲ IV cut Miss Sense (P) Miss Sense (D) Inflammation M0 M1 ADAMTS20 0 2 One 4 7 0.449 1.7 3 3 One 0 12q12 4 3 42.8 AKAP13 2 0 2 0 4 One One 0 4 0 0 15q25.3 4 0 0 BRCA2 One 3 0 3 7 0.723 1.7 0 4 0 0 13q13.1 7 0 0 BTNL3 0 0 One 3 4 0.123 One 0 3 0 One 5q35.3 4 0 0 CIT One 2 0 2 5 0.684 1.2 2 3 0 0 12q24.23 5 0 0 COL5A2 2 2 0 0 4 0.06 One One 3 0 0 2q32.2 4 0 0 DNAH1 2 2 0 0 4 0.06 One One 3 0 0 3p21.1 3 One 25 DNAH5 2 0 3 6 11 0.062 2.6 3 8 0 0 5p15.2 9 2 18.1 EPHA8 One 2 0 0 3 0.121 0.7 One 2 0 0 1p36.12 3 0 0 GABRQ 2 One One 2 6 One 1.4 2 4 0 0 Xq28 5 One 16.6 KANK4 2 2 0 0 4 0.06 One 0 4 0 0 1p31.3 3 One 25 MDN1 One One 2 4 8 0.284 1.9 2 5 0 One 6q15 7 One 12.5 MUC6 0 0 5 6 11 0.001 2.6 2 9 0 0 11p15.5 10 One 9 MYO15A One 0 One 2 4 0.623 One One 3 0 0 17p11.2 4 0 0

　
Age group
(Number of patients whose mutations in the gene were confirmed) Total number of patients whose mutations in the gene were identified
Anova (P-value)
Mutation (%)
Mutation type Saito Band
transition transition(%)
Ⅰ Ⅱ Ⅲ IV cut Miss Sense (P) Miss Sense (D) Inflammation M0 M1 MYO3A 3 2 One 2 8 0.501 1.9 One 6 One 0 10p12.1 8 0 0 NOL6 0 0 2 3 5 0.061 1.2 One 4 0 0 9p13.3 3 2 40 ODZ4 0 0 2 2 4 0.123 One One 3 0 0 11q14.1 2 2 50 PDE3A 0 0 3 0 3 0.248 0.7 One 2 0 0 12p12.2 3 0 0 PLEC One One 2 3 7 0.449 1.7 One 6 0 0 8q24.3 5 2 28.5 PSD3 2 2 2 3 9 One 2.2 5 4 0 0 8p22 8 One 11.1 SCN3A 0 One One 3 5 0.372 1.2 One 4 0 0 2q24.3 3 2 40 SLC27A6 2 4 0 0 6 0.014 1.4 0 6 0 0 5q23.3 4 2 33.3 STK11IP 0 0 2 2 4 0.123 One 0 4 0 0 2q35 2 2 50 TAF1 0 One 0 4 5 0.372 1.2 0 5 0 0 Xq13.1 5 0 0 TMEM184C 0 0 0 4 4 0.123 One 0 4 0 0 4q31.23 4 0 0 ZEB2 One 3 0 0 4 0.06 One 0 4 0 0 2q22.3 4 0 0

According to the results of Table 11 and Table 12, it was found that a mutation was present in a specific gene by age group in patients with kidney cancer. A mutant gene with a P-value of 0.05 or greater and a P-value of less than 0.05 were identified when comparing groups 60 years or younger and those older than 61 years. When comparing the two groups, the mutant genes with a P-value of less than 0.05 were correlated with specific groups, and therefore, they were defined as age-specific genes for each group. For example, ADAMTS20 and AKAP13 were mutated and the number of mutated patients was high, but the P-value was higher than 0.05 when the groups were compared. There was no correlation between the mutations of these genes and the age of patients with kidney cancer And it was found. On the other hand, MUC6 and SLC27A6 have a P-value of less than 0.05 when compared to those aged 60 years or less and those aged 61 years or older. Therefore, mutations in these genes are correlated with age of kidney cancer patients.

 Figure 3 shows the results according to test set 3. As shown in FIG. 3, mutations were found in MUC6 over 61 years of age, and SLC27A6 mutations were found in patients under 60 years of age.

From the above results, it can be seen that the mutation of MUC6 can be used as a marker specific to the age group of 61 years or older, and the mutation of SLC27A6 can be used as a marker specific to the age group of 60 years or younger.

 [2-4] Comparative analysis before and after 70 years (test set 4)

In Table 2, we confirmed the association between the mutation of the candidate genes and the age of patients with renal cancer in the group I + II + III and IV, respectively, by age group. Table 13 shows the information of the genes related to test set 4. A P-value less than 0.05 was considered statistically significant.

　
Age group
(Number of patients whose mutations in the gene were confirmed) Total number of patients whose mutations in the gene were identified
Anova (P-value)
Mutation (%)
Mutation type Saito Band
transition transition(%)
Ⅰ Ⅱ Ⅲ IV cut Miss Sense (P) Miss Sense (D) Inflammation M0 M1 BTNL3 0 0 One 3 4 0.048 One 0 3 0 One 5q35.3 4 0 0 CADPS One One 0 4 6 0.035 1.4 4 2 0 0 3p14.2 5 One 16.6 CCDC173 0 0 0 3 3 0.015 0.7 One 2 0 0 2q31.1 3 0 0 LPAL2 Null 6q25.3 Null MAPK9 0 0 0 2 2 0.061 0.5 0 2 0 0 5q35.3 2 0 0 PCED1B One 0 0 2 3 0.152 0.7 One 2 0 0 12q13.11 3 0 0 PPIL4 0 One 0 3 4 0.048 One 0 4 0 0 6q25.1 3 One 25 RIMKLA 0 0 0 2 2 0.061 0.5 0 2 0 0 1p34.2 One One 50 SCN7A 0 0 0 2 2 0.061 0.5 0 2 0 0 2q24.3 2 0 0 SHMT2 0 0 0 3 3 0.015 0.7 One 2 0 0 12q13.3 3 0 0 SLC47A2 0 0 0 4 4 0.004 One 2 2 0 0 17p11.2 4 0 0 STL Null 6q22.31 Null TMEM169 0 One 0 3 4 0.048 One 2 2 0 0 2q35 4 0 0 TMEM184C 0 0 0 4 4 0.004 One 0 4 0 0 4q31.23 4 0 0 WDR62 0 One 0 3 4 0.048 One 2 2 0 0 19q13.12 4 0 0

According to the results in Table 13, a mutation gene with a P-value of 0.05 or more and a mutation gene with a P-value of less than 0.05 were identified when comparing a group of 70 years or less and a group of 71 years or older. Mutagenic genes with a P-value of less than 0.05 when compared to the two groups were correlated with a specific group (group of 71 years or older), so the age-specific gene for a group of 71 years or older was defined. For example, mutations in MAPK9 and PCED1B were identified, but when compared between groups, the P-value was higher than 0.05, indicating that there was no correlation between mutations in these genes and age of kidney cancer patients. On the other hand, the P-value is less than 0.05 for BTNL3, CADPS, CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, TMEM184C and WDR62.

 Figure 4 shows the results according to test set 4. As shown in FIG. 4, mutations were confirmed at the age of 71 years or over in the IV group, BTNL3, CADPS, CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, TMEM184C and WDR62.

From the above results, it can be seen that the mutations of BTNL3, CADPS, CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, TMEM184C and WDR62 can be used as markers specific to the age group of 71 years or older.

Identification of applicability as a survival-specific marker according to age

Among the candidate genes, the existence of a mutation gene specific for survival was confirmed by age. The test sets 1 to 4 were analyzed in the same manner as in Example 2. [ The mutated positions of the respective genes are shown in Tables 14 to 16.

Gene Accession No. AA change Type Copy # COSMIC Mutation
Assessor Chr Start Pos End Pos Ref Yes DDX20


NM_007204.4


S172P Missense Diploid One Neutral chrl 112302139 112302139 T C F403L Missense Diploid One Low chrl 112305403 112305403 T A S685Y Missense ShallowDel One Low chrl 112309100 112309100 C A X438_splice Splice ShallowDel chrl 112308358 112308358 G A RTN3

NM_001265589.1

E622K Missense Diploid Low chr11 63487838 63487838 G A E260D Missense Diploid Low chr11 63486754 63486754 A C S312N Missense Diploid Neutral chr11 63486909 63486909 G A PRSS38

NM_183062.2

S314Qfs * 21 FS ins Diploid chrl 228033865 228033866 - T V315I Missense Diploid One Neutral chrl 228033871 228033871 G A X104_splice Splice Diploid chrl 228004909 228004909 G T ADAMTS20





NM_025003.4





X1741_splice Splice Diploid chr12 43769952 43769952 C T R1630W Missense Diploid 5 Neutral chr12 43771275 43771275 G A V1383I Missense Diploid One Medium chr12 43819454 43819454 C T X205_splice Splice Diploid chr12 43896209 43896209 C T W1085 * Nonsense Diploid One chr12 43825141 43825141 C T S1546L Missense Gain Low chr12 43777521 43777521 G A G1209V Missense Gain One Medium chr12 43822466 43822466 C A ODZ4
(TENM4)


NM_001098816.2


V2177L Missense Diploid Low chr11 78380861 78380861 C G K619Efs * 4 FS ins Diploid chr11 78523290 78523291 - C L697F Missense Diploid Neutral chr11 78516425 78516425 T G M2761T Missense Diploid Low chr11 78369131 78369131 A G

Gene Accession No. AA change Type Copy # COSMIC Mutation
Assessor Chr Start Pos End Pos Ref Yes PLEC





NM_201380.3





K1427R Missense Diploid One Neutral chr8 145001221 145001221 T C P3986Q Missense Diploid One Medium chr8 144992443 144992443 G T T2862M Missense Gain 2 Medium chr8 144995815 144995815 G A R609C Missense Diploid One Medium chr8 145007369 145007369 G A A2774G Missense Diploid One Low chr8 144996079 144996079 G C E4243 * Nonsense Diploid One chr8 144991673 144991673 C A A1713V Missense Diploid One Neutral chr8 144999370 144999370 G A ARHGAP26




NM_001135608.2




N621Y Missense Diploid One Low chr5 142526819 142526819 A T K566N Missense Gain One Medium chr5 142500712 142500712 G C R19L Missense Gain One Medium chr5 142150382 142150382 G T N666Efs * 79 FS ins Diploid chr5 142586762 142586763 - C N666Efs * 79 FS ins Gain chr5 142586762 142586763 - C N666Efs * 79 FS ins Gain chr5 142586762 142586763 - C SCN2A


NM_001040142.1


G899S Missense Diploid One High chr2 166201197 166201197 G A D693E Missense Diploid 2 Low chr2 166183424 166183424 T G E44G Missense Diploid 2 Low chr2 166152464 166152464 A G G59Vfs * 30 FS ins Diploid chr2 166152508 166152509 - T SLC25A13

NM_001160210.1

G482R Missense Diploid Medium chr7 95775879 95775879 C T S426P Missense Diploid Neutral chr7 95799395 95799395 A G G441S Missense Gain Low chr7 95776002 95776002 C T SLC4A2
NM_001199692.2
R793C Missense Gain 2 High chr7 150769065 150769065 C T P928Sfs * 28 FS ins Diploid chr7 150771368 150771369 - T AGAP7P



Unregistered



K547 * Nonsense Diploid chr10 51464817 51464817 T A E71Rfs * 29 FS del Diploid chr10 51485991 51485991 C - E71Rfs * 29 FS del ShallowDel chr10 51485991 51485991 C -

Gene Accession No. AA change Type Copy # COSMIC Mutation
Assessor Chr Start Pos End Pos Ref Yes GABRE

NM_004961.3

R472H Missense Gain Low chr23 151123279 151123279 C T I234Nfs * 3 FS ins Gain chr23 151128394 151128395 - T Y478N Missense Diploid Neutral chr23 151123262 151123262 A T IPO7

NM_006391.2

N34H Missense Diploid One Low chr11 9424852 9424852 A C R427Q Missense Gain One Medium chr11 9446754 9446754 G A M781I Missense Diploid One Medium chr11 9459375 9459375 G A PDE4C




NM_000923.5




S254F Missense Diploid 2 Medium chr19 18331077 18331077 G A D429N Missense Diploid One High chr19 18329004 18329004 C T T561M Missense Gain 3 Low chr19 18322678 18322678 G A L488Q Missense Diploid 2 Medium chr19 18327573 18327573 A T N437K Missense Diploid One High chr19 18328978 18328978 G T Y557Lfs * 21 FS ins Gain chr19 18322690 18322691 - A PRKCQ


NM_001242413.2


Q43Rfs * 32 FS del Diploid chr10 6553149 6553149 C - F448V Missense Diploid One Medium chr10 6520965 6520965 A C L350V Missense Diploid One Neutral chr10 6525533 6525533 A C V457Cfs * 31 FS ins Diploid chr10 6506351 6506352 - A

Overall survival kaplan-meier estimates and disease-free survival kaplan-meier estimates were obtained by Kaplan-Meier survival analysis (Spss 21). The 417 patients obtained in Example 1 were classified into survivors (270 patients) and death patients (147 patients), and comparative analyzes were performed. The total survival or disease-free survival time was calculated using Kaplan-Meier survival analysis based on the clinical information (event (death or recurrence), observation time) obtained in Example 1. In the total survival period, the case was defined as death, and in disease free survival, the event was defined as recurrence of renal cancer. Based on the event time of each group obtained in the Kaplan-Meier survival analysis, the mutation occurrence in each of the above genes was compared with that of mutation occurrence and kidney cancer The association of total survival and the association of mutagenesis with disease free survival was confirmed by log rank test. A P-value less than 0.05 was considered statistically significant. In the experimental group, the genes of the present invention were mutated (case with alterations in the query gene), and as the control group, the genes of the present invention were not mutated. Median months survival means the median survival time of the patients in the group. The slope of survival curves by Kaplan-Meier survival analysis is determined by survival time.

 [3-1] Comparison between groups (test set 1)

In order to confirm whether the mutation occurrence in each of the candidate genes is related to the survival rate of a patient of a certain age (Ⅰ vs Ⅱ vs Ⅲ vs Ⅳ) kidney cancer patients (null hypothesis), 417 kidney cancer The genetic information of the patient was analyzed. Table 17 shows the age of patients in which mutations of RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C and PRKCQ genes were confirmed.

Age group
(Number of patients whose mutations in the gene were confirmed) Total number of patients whose mutations in the gene were identified Ⅰ Ⅱ Ⅲ IV RTN3 2 4 8 One 15 SCN2A One 0 0 3 4 SLC25A13 0 0 3 0 3 SLC4A2 0 0 0 2 2 DDX20 0 0 3 One 4 AGAP7P 0 0 2 One 3 ARHGAP26 One 0 3 2 6 GABRE 0 0 2 One 3 IPO7 0 0 3 0 3 PDE4C One 0 5 0 6 PRKCQ One 0 3 0 4

As shown in FIGS. 5 to 15, mutation of RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C and PRKCQ genes in comparison between the groups The probability that the null hypothesis is related to the survival rate is more than 99.5%, that is, the probability that the null hypothesis is wrong is less than 0.5%. Therefore, RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, It is shown that the mutation of PRKCQ genes and the survival rate of patients with renal cancer at specific ages are related.

When the mutation occurred only in relation to age in Example 1, some mutant genes determined to be insignificant by a P-value of 0.05 or more were confirmed to be associated with mutation and survival rate of kidney cancer patients of a specific age P-value <0.05 was found to be significant. For example, in the case of RTN3, it was confirmed that there was no significance in confirming the association between mutation occurrence and age in Example 1. However, when the relation between mutation of RTN3 and survival rate was compared according to age group in the present example, (See P-values in Table 7 and Table 8).

The survival analysis results of patients with kidney cancer having the mutant gene are shown in FIGS. 5 to 15. FIG.

As shown in FIG. 5 (A), in RTN3, more than 50% of the patients with kidney cancer who did not mutate in the RTN3 gene survived for more than 80 months (blue) More than 50% of patients with kidney cancer who were mutated died before 20 months of age, so the survival rate was lower than that of kidney cancer patients without mutation (red). According to Figure 5 (B), 50% or more of the RTN3 mutation-free kidney cancer patients did not recur more than 120 months (blue), but the mutation in the RTN3 gene was less than 40 months, Kidney cancer recurred in more than 50% of patients (red). Therefore, mutation in RTN3 gene and the age of 61 ~ 70 years of kidney cancer patients will increase the probability of death or recurrence by renal cancer. Therefore, the mutation of RTN3 gene is predicted by the survival rate of kidney cancer patients or the recurrence prediction marker of kidney cancer As shown in Fig.

As can be seen from FIG. 6 (A), SCN2A shows that more than 50% of the patients with kidney cancer who did not mutate in the SCN2A gene survived for more than 80 months (blue), while the SCN2A gene mutated Renal cancer patients were found to have a lower survival rate than red kidney cancer patients who did not develop mutations (red) because more than 50% of kidney cancer patients died before 40 months. According to FIG. 6 (B), 50% or more of the SCN2A mutation-free kidney cancer patients did not recur more than 120 months (blue), but the SCN2A mutation was less than 40 months, Kidney cancer recurred in more than 50% of patients (red). Therefore, when the SCN2A gene is mutated and the age of the renal cancer patient is 71 years or older, the probability of death or recurrence of renal cancer increases, so that the mutation of the SCN2A gene is a marker of renal cancer survival rate or renal cancer recurrence marker .

As can be seen from FIG. 7 (A), SLC25A13 shows that 50% or more of the SLC25A13 gene was not survived for more than 80 months in a kidney cancer patient without mutation in the SLC25A13 gene (blue), whereas the SLC25A13 gene was mutated Renal cancer patients were found to have a lower survival rate compared to patients with renal cancer who did not develop mutations (red) because more than 50% of renal cancer patients died before 10 months. 7B shows that 50% or more of the SLC25A13 mutation-free kidney cancer patients did not recur more than 120 months (blue), but when the SLC25A13 gene mutated, the mutation was less than 20 months, Kidney cancer recurred in more than 50% of patients (red). Therefore, when the SLC25A13 gene is mutated and the age of the kidney cancer patient is 61 to 70 years old, the probability of death or recurrence due to kidney cancer increases, so that the mutation of the SLC25A13 gene is associated with the survival rate of kidney cancer patients or the recurrence prediction marker of kidney cancer As shown in Fig.

As can be seen from FIG. 8, in SLC4A2, 50% or more of the SLC4A2 gene was not survived for more than 80 months (blue), and the kidney cancer patients mutated in the SLC4A2 gene Since more than 50% of patients with kidney cancer died before 30 months, the survival rate was lower than that of kidney cancer patients without mutation (red). Therefore, the mutation of the SLC4A2 gene is significant as a predictor of survival rate of kidney cancer patients because mutation in the SLC4A2 gene and the age of the kidney cancer patient 71 years or older increases the probability of death from kidney cancer.

According to FIG. 9, in DDX20 gene, 50% or more of the patients without kidney cancer mutation did not recur more than 120 months (blue), but when the DDX20 gene was mutated, it was less than 30 months, Renal cancer recurred more than 1% (red). Therefore, when the DDX20 gene is mutated and the age of the patient is 61 to 70 years old, the probability of relapse due to renal cancer increases, so that the mutation of the DDX20 gene is significant as a predictor of renal cancer recurrence.

According to FIG. 10 (B), in AGAP7P, 50% or more of the AGAP7P gene was not recurred for 100 months or more (blue) in the kidney cancer patients without mutation, but when the AGAP7P gene was mutated, Renal cancer recurred in over 50% of cancer patients (red). Thus, the AGAP7P gene mutation is a predictor of kidney cancer recurrence, since mutations in the AGAP7P gene and the age of patients with renal cancer between 61 and 70 years are associated with a higher risk of recurrence by renal cancer.

According to Fig. 11 (B), ARHGAP26 showed no recurrence of more than 50% (blue) in patients with renal cancer in which ARHGAP26 gene was not mutated, but when the mutation was found in ARHGAP26 gene, Renal cancer recurred in over 50% of cancer patients (red). Therefore, the mutation of ARHGAP26 gene is predictive of renal cancer recurrence because renal cancer mutation occurs and the age of patients with renal cancer is between 61 and 70 years.

According to FIG. 12 (B), GABRE was found to have no recurrence of more than 100 months (blue) in more than 50% of the patients with no GABRE gene mutation, but less than 20 months in the presence of mutations in GABRE gene Renal cancer recurred in over 50% of cancer patients (red). Therefore, the mutation of the GABRE gene is significant as a predictor of renal cancer recurrence, because the mutation in the GABRE gene and the age of the kidney cancer patients are 61 to 70 years old.

According to FIG. 13 (B), IPO7 shows that 50% or more of the IPO7 gene mutation did not recur more than 120 months (blue) in the kidney cancer patients but the mutation in the IPO7 gene was less than 20 months Renal cancer recurred in over 50% of cancer patients (red). Therefore, the IPO7 gene mutation is predictive of kidney cancer recurrence because renal cancer mutation is present and the age of patients with renal cancer is between 61 and 70 years.

In PDE4C, 50% or more of the PDE4C gene was not recurred for 100 months or more (blue) in the case of the kidney cancer in which the PDE4C gene was not mutated, but when there is a mutation in the PDE4C gene, Renal cancer recurred in over 50% of cancer patients (red). Thus, the PDE4C gene mutation is a predictor of kidney cancer recurrence, since mutations in the PDE4C gene and the age of patients with renal cancer between the ages of 61 and 70 will increase the chance of recurrence by renal cancer.

According to FIG. 15 (B), PRKCQ shows that 50% or more of the PRKCQ gene has not recurred for 100 months or more (blue) in the kidney cancer patients without mutation, Renal cancer recurred in over 50% of cancer patients (red). Therefore, the mutation of PRKCQ gene is significant as renal cancer recurrence rate when the age of patients with renal cancer is between 61 and 70 years. Therefore, it can be seen that mutation of PRKCQ gene is a predictor of renal cancer recurrence marker.

 [3-2] Comparison around 50 years (test set 2)

To confirm whether the mutation in each of the candidate genes is related to the survival rate of the renal cancer patients aged 50 years or older (Ⅰvs Ⅱ + Ⅲ + Ⅳ) (null hypothesis), in Example 1 Genetic information of 417 patients with kidney cancer was analyzed. As shown in Fig. 16, in comparison between the two groups of about 50 years old, the probability that the mutation occurrence of the PRSS38 gene is related to the survival rate of patients with renal cancer less than 50 years old is more than 99.5% The probability of false hypothesis is less than 0.5%, indicating that the PRSS38 gene mutation is associated with the survival rate of renal cancer patients under 50 years of age. Table 18 shows the age of patients with mutations in the PRSS38 gene.

Age group
(Number of patients whose mutations in the gene were confirmed) Total number of patients whose mutations in the gene were identified
Ⅰ Ⅱ Ⅲ IV PRSS38 2 One 0 0 3

According to FIG. 16 (B), PRSS38 was found to have no recurrence for more than 100 months (blue) in more than 50% of renal cancer patients without a mutation in the PRSS38 gene (blue) Renal cancer recurred in over 50% of cancer patients (red). Therefore, the mutation of the PRSS38 gene is significant as a predictor of renal cancer recurrence because the probability of recurrence by renal cancer is high when the PRSS38 gene is mutated and the age of patients with renal cancer is 50 years or less.

 [3-3] Around 60 years old (Test Set 3)

To confirm whether the mutation in each of the candidate genes is related to the survival rate of renal cancer patients aged 60 years or older (Ⅰ + Ⅱ vs Ⅲ + Ⅳ) (null hypothesis), in Example 1 Genetic information of 417 patients with kidney cancer was analyzed. As shown in Figs. 17 to 19, the probability that the mutation occurrence of the ADAMTS20, ODZ4, and PLEC genes is related to the survival rate of patients with renal cancer at the age of 61 or more at the time of comparison between two groups around 60 years is 99.5 %, That is, the probability that the null hypothesis is wrong is less than 0.5%. Therefore, it can be seen that the mutation of ADAMTS20, ODZ4, PLEC gene and the survival rate of patients with 61 or more years old kidney cancer are related. Table 19 shows the age of patients with mutations in the ADAMTS20, ODZ4, and PLEC genes.

Age group
(Number of patients whose mutations in the gene were confirmed)
Total number of patients whose mutations in the gene were identified Ⅰ Ⅱ Ⅲ IV ADAMTS20 0 2 One 4 7 ODZ4 0 0 2 2 4 PLEC One One 2 3 7

As shown in FIG. 17, ADAMTS20 shows that 50% or more of the ADAMTS20 gene mutations did not occur in the kidney cancer patients without mutation in the ADAMTS20 gene (blue color), but the mutation in the ADAMTS20 gene did not occur in 50 months Renal cancer recurred more than 1% (red). Therefore, the mutation in ADAMTS20 gene is more likely to be recurred by renal cancer if the age of the patient is 61 years or older. Therefore, the mutation of ADAMTS20 gene is significant as a predictor of renal cancer recurrence.

As can be seen from FIG. 18 (A), ODZ4 shows that in the kidney cancer patients not mutated in the ODZ4 gene, 50% or more survived for 80 months or more (blue), whereas the ODZ4 gene mutated Patients with renal cancer were found to have a lower survival rate than patients with renal cancer who did not develop mutations (red) because more than 50% of renal cancer patients died before 30 months of age. According to FIG. 18 (B), 50% or more of the ODZ4 mutation-free kidney cancer patients did not recur more than 100 months (blue), but the mutation in the ODZ4 gene was less than 20 months, Kidney cancer recurred in more than 50% of patients (red). Therefore, the mutation of the ODZ4 gene increases the probability of death or recurrence due to renal cancer when the mutation is present in the ODZ4 gene and the age of the patient is 61 years or more. Therefore, the mutation of the ODZ4 gene is a marker of the survival rate of renal cancer patients or a predictor of renal cancer recurrence .

As can be seen in FIG. 19 (A), PLEC is a mutation in the PLEC gene, while 50% or more of the PLEC gene is not survived for more than 80 months in a kidney cancer patient without mutation (blue) Renal cancer patients were found to have a lower survival rate than red kidney cancer patients who did not develop mutations (red) because more than 50% of kidney cancer patients died before 40 months. According to FIG. 19 (B), 50% or more of the PLEC gene mutation was not found in the kidney cancer patients without mutation, but the PLEC gene mutation was less than 40 months, Kidney cancer recurred in more than 50% of patients (red). Therefore, when the PLEC gene is mutated and the age of the patient is 61 years or older, the probability of death or recurrence of renal cancer increases, so that the mutation of the PLEC gene is a predictor of the survival rate of renal cancer patients or the recurrence marker of renal cancer. .

 [3-4] Comparison around 70 years (Test Set 4)

At around 70 years of age, no genes were found to be associated with the survival rate of patients with renal cancer at any age among the candidate gene families.

When the mutation is present in any one of the genes selected from the group consisting of RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ, PRSS38, ADAMTS20, ODZ4 and PLEC, The survival rate of renal cancer patients is significantly lowered or the recurrence rate is increased. Therefore, the presence or absence of mutation in the genes of the present invention is compared with the age of the patient to determine the prognosis of renal cancer, Can be predicted.

Production of chips capable of detecting mutations of the genes of Examples 2 and 3

A set of primers for mutation detection of the genes of Examples 2 and 3 was prepared as Ion AmpliSeq ™ Custom and Community Panels of Thermo fisher by referring to https://tools.thermofisher.com/content/sfs/manuals/MAN0006735_AmpliSeq_DNA_RNA_LibPrep_UG.pdf . In order to detect the mutation easily, the chip type was selected and the depth was increased. Specifically, panel information to be produced on Ampliseq.com was input, feedback was received on the input information, and a panel having a primer set capable of detecting mutations was produced by discussing related matters. Table 20 to Table 20 show primer sets capable of detecting mutations of the gene of the present invention.

Lineitem_Name Chr SEQ ID NO: Ion_AmpliSeq_Fwd_Primer * SEQ ID NO: Ion_AmpliSeq_Rev_Primer * Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop ARAP3 chr5 41 CCCGCTTACTGATCTCCTGT 42 GTCTCTGGCTGTCAGGGTTT 141045982 141046002 141046090 141046110 ARAP3 chr5 43 GGACAAGGAAAGCATGAGATGCT 44 TGACCTCATCTTCTCTCCAGGTT 141049229 141049252 141049375 141049398 ARAP3 chr5 45 GCTGGAGGTTGGGAAGAGAAAAG 46 TGGAAATGTTTGCATCGGAAAACAG 141049433 141049456 141049569 141049594 ARAP3 chr5 47 TCATAGGTTGGGTCTGAGAATTCCT 48 CAAGACCCAACCTGCTGAAGAA 141050774 141050799 141050926 141050948 ARAP3 chr5 49 GGTACCCTGAGCCCTCTAGT 50 CTGAGAAGATCTGGTCTAATCGGG 141051605 141051625 141051755 141051779 ARAP3 chr5 51 GCAAACACTTGGCCTTGT 52 CCACTGACCTGCTTCTCCATC 141052351 141052370 141052500 141052521 ERBB4 chr2 53 GAAGGTTGATTGTGAAATACTTACTCCTGA 54 CATGTGGCTTTTCTTTTTCGTTTCTTTTT 212252646 212252676 212252779 212252808 ERBB4 chr2 55 ATCTGGACACACCAGTTAAGCAG 56 TCTGATCATGGCAAGTATGGATCATC 212426635 212426658 212426782 212426808 ERBB4 chr2 57 GCCAGCAAGAATGCTTACCCTT 58 AGGGTCCTGACAACTGTACAAAG 212530030 212530052 212530181 212530204 ERBB4 chr2 59 TTGCACAAAAATTTAATACTGACCCATGAA 60 CTAACTCTGAGTCTTGTTTCTACAGCT 212576752 212576782 212576899 212576926 ERBB4 chr2 61 GGGCAATAGTATCTATACCCAAAGTACTT 62 TGCAAAGTACACATATGGAGCATTCT 212586987 212587016 212587135 212587161 F8 chrX 63 AGATATAATCAGCCCAGGTTCTTGGA 64 TTCCACCCGTTTCATTTCAGAGT 154129600 154129626 154129714 154129737 F8 chrX 65 GTGACTGAATTTGTGGCACTTGT 66 CTTCTCATCTTCCAGCAGCATCT 154157596 154157619 154157747 154157770 F8 chrX 67 CTTCTTGGCAACTGAGCGAATT 68 AAGCTTATGTCAAAGTAGACAGCTGT 154194784 154194806 154194927 154194953 RNF40 chr16 69 GTATCATGTTGGAAAGCACTAAGGGA 70 GGAGAGGAGTCCCATCACATGT 30774681 30774707 30774831 30774853 RNF40 chr16 71 AGCATCTGCTCCCTCATTGTTC 72 CCTCTGCCAGGTGCTTATTGAG 30776476 30776498 30776615 30776637 RNF40 chr16 73 CGTATGGCAGAGCTGGAGAAAC 74 TGGGATCAGCAACAGGATTCAG 30777535 30777557 30777657 30777679

Lineitem_Name Chr SEQ ID NO: Ion_AmpliSeq_Fwd_Primer * SEQ ID NO: Ion_AmpliSeq_Rev_Primer * Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop CEP295; SLC4A2 chr7 75 CCCTCCCTCCAGTTCTGTAG 76 AGATCAAGAAGGCGAAGATCTCCT 150769017 150769037 150769158 150769182 SCAF1 chr19 77 CCATGTGTCCCATTGGCTTCT 78 GGGTTCGTGAGCAAAGGAGG 50145305 50145326 50145424 50145444 SCAF1 chr19 79 CGCTTTAGCTCCGCCTCTC 80 ACTAGCGACCCAACTCCGC 50145405 50145424 50145555 50145574 SCAF1 chr19 81 GGGACCTCCACTCCAAACTCT 82 CTCACCAGGATAAAGGCAGAAGGA 50148240 50148261 50148372 50148396 SCAF1 chr19 83 ATGGTCCGCCAGACAGAGA 84 GTGCTTCAAGGGAGCCAAGAGT 50148342 50148361 50148484 50148506 SCAF1 chr19 85 GCACTTGAGTCTAGCTGTCAGT 86 CCGCCATACCTTTATCATTGGG 50148503 50148525 50148655 50148677 GXYLT1 chr12 87 AAAAGGAAAGGCAAATCTTACATTTCTCA 88 CAAGAAGCAGAAGAAGGAGGAATCTT 42491223 42491252 42491322 42491348 GXYLT1 chr12 89 CTGGAATTATATGTAACTCTTCAGAGACTCATG 90 AAAAACTCTTTAAACCATGTGCTTCG 42503271 42503304 42503385 42503411 GXYLT1 chr12 91 CAAAAATATGGAATTGAAGAGGTTTGATGC 92 AACTGTTGAAAAATGTGGTTTTCTTTCCT 42512837 42512867 42512978 42513007 CEP295; SLC4A2 chr7 93 CCCTCCCTCCAGTTCTGTAG 94 AGATCAAGAAGGCGAAGATCTCCT 150769017 150769037 150769158 150769182 PCDHA6 chr5 95 TCACGCTACTGCTGTACACAG 96 GCCATGAGATCCATCTTGGGTG 140209814 140209835 140209966 140209988 ZNF844 chr19 97 CACAGAAGTCTTCTGGGAGAGAGA 98 GCCTATTAAGGGAAGAATGACCCA 12186122 12186146 12186272 12186296 ZNF844 chr19 99 CTTATACATGAACGAGTTCACACTGGA 100 GACTACCGAATGCTTTCCCACA 12186572 12186599 12186706 12186728 ZNF844 chr19 101 CAAGAGAAACCCTATGAATGTAAGCAGT 102 GCTTTCCAGTGTGAGTCCTTTCA 12187348 12187376 12187499 12187522 MAFA chr8 103 GCCCTCCTCTTCCTTCAATTCAG 104 TTTGTTGTGTAGTTGGTTTTCGTTGAG 144510157 144510180 144510302 144510329 MAFA chr8 105 TTTTTCTTTTTCTCAGTTTCGTAGCAAA 106 GGATCTGCCCGTTTTCGGAG 144510264 144510292 144510417 144510437 MAFA chr8 107 CGGCTGGAATCCCACTGATG 108 TTGTGTTTCGTTTTGTTTGTGGAATCT 144510386 144510406 144510529 144510556 MAFA chr8 109 GCTAGTCCAAAGAGCGACGAA 110 AAAAAGTAATGCACAGTATTTCTAGCAGA 144510498 144510519 144510639 144510668 MAFA chr8 111 GGCCCAAGCCTCCTCTTAAAAA 112 TCTCTATGCACCAGAACATATCTGTAACT 144510609 144510631 144510713 144510742 MYH1 chr17 113 GCGCATTTTCTGGAACTCAGC 114 CTGGAGGAGGAAATCGAGGCAG 10404628 10404649 10404779 10404801 MYH1 chr17 115 TCTCCTTCTCTGTCTCTGCACTTT 116 ATTCTGCTTCTTATTATAATCTGATTTGGACA 10408261 10408285 10408400 10408432 MYH1 chr17 117 TGGTCTATCACACACACACTGG 118 CATGGTTCCACAGGAGAATTTGAATAAG 10409278 10409300 10409401 10409429 MYH1 chr17 119 GTCAAACAAGAGAGGCCAGATCA 120 GGTGGACCCTAAGGAGTCCTTT 10419667 10419690 10419818 10419840 MYH1 chr17 121 GGGCTTCAATTCGCTCCCTTT 122 CAGCCAGGGTCCTTAACTGG 10419878 10419899 10419982 10420002

Lineitem_Name Chr SEQ ID NO: Ion_AmpliSeq_Fwd_Primer * SEQ ID NO: Ion_AmpliSeq_Rev_Primer * Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop NDUFAF3 chr3 123 GCGGCTTCATGATAAACGGAAA 124 CAGAGGAAAGCCAAGTTTGCAG 49059898 49059920 49060036 49060058 NKAIN3 chr8 125 GCTTGGATTCAATGCTAATGAACTTTCT 126 ATTATGTATCGAGGTCTGTACTGAATGG 63492057 63492085 63492203 63492231 NKAIN3 chr8 127 AGTATGGAAACTTGGCATAGATTCTTAAGG 128 GTTTTGGAAGCTGTATCTCATTCAAAAGG 63830959 63830989 63831103 63831132 NKAIN3 chr8 129 ATTCTCAGATTCATGTGATCTGCAAGT 130 CACATGAGGCTTGACTGATGTGA 63902719 63902746 63902820 63902843 SERPINI2 chr3 131 ACTTCAAAAGGGTCAGCACCAT 132 TGTATGTTTCCCAAGTGACGCAA 167167025 167167047 167167155 167167178 SERPINI2 chr3 133 CCTTTGCATCTTGAAAATCCACCA 134 TGTACTGAAGTCATTTTTCTCTGCCAT 167184888 167184912 167185033 167185060 ZBTB41 chrl 135 CTCTTACATCACATTTCCAACTTTCACTC 136 GTACTTGATCCTGGTAATTACTGTCAACAT 197159885 197159914 197160029 197160059 ZBTB41 chrl 137 CGGTCAAATGTTTTATCACATTTAGGACA 138 AGTACTCTGACATTGAAGAACAAAGTGAAA 197168489 197168518 197168627 197168657 ZBTB41 chrl 139 ACAAAAAGATGGTTGCTTCTGCCTA 140 CCAAGTGACCTATACTCATTCTCA 197169340 197169365 197169483 197169508 MUC6 chr11 141 GAGTGGACAATGAGGAGTGTGA 142 CTCCTCATTTTCTCCCAGTCCTT 1016245 1016267 1016394 1016417 MUC6 chr11 143 GGTGCCTGTACTGGTGTGTT 144 CCCAAGCTCATTTAGCACGG 1016960 1016980 1017066 1017086 MUC6 chr11 145 GGTGTGTTGAGGAAGTGTGGT 146 CTCCACCGACCACGATCAAG 1017022 1017043 1017148 1017168 MUC6 chr11 147 CACTGGTGGTCGGTGTCATT 148 TACTCACACGGTCATCATCCCT 1017100 1017120 1017226 1017248 MUC6 chr11 149 TCTTGAAGGATGTTGCCGTCAT 150 ACTTCTACTACCACGATTACTCCCAA 1018009 1018031 1018157 1018183 MUC6 chr11 151 GGTTCTGGTGCGTGTACTAGTG 152 TCATTCAGCACAAACAAAACACCTAC 1018133 1018155 1018232 1018258 MUC6 chr11 153 CGTTGTTGGTGGAGGAATGGT 154 ATCACACCCTGAGACCACACT 1018334 1018355 1018472 1018493 MUC6 chr11 155 GATAGGTAGTGGTGGCATGGAA 156 ACAAGAACGACTACTGAATACACAACG 1018501 1018523 1018603 1018630 MUC6 chr11 157 CTCTCTCCCTTGTTTGTGGGAT 158 CACCCTAGGCTGCTACAACTG 1021128 1021150 1021264 1021285 MUC6 chr11 159 ACCTGGCACCTTCGATGTTG 160 GCCATCTACTGCGGCTTCTA 1023500 1023520 1023633 1023653

Lineitem_Name Chr SEQ ID NO: Ion_AmpliSeq_Fwd_Primer * SEQ ID NO: Ion_AmpliSeq_Rev_Primer * Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop SLC27A6 chr5 161 TGCAGAAACTCCTGTTCCCTTAC 162 ACTCAAGAATTTATCCAGCACAGTCA 128301886 128301909 128301990 128302016 SLC27A6 chr5 163 GCTGGTGACTGTGCTGGATAAA 164 AGAGAGGAATGGTTCAGGAAGACAT 128301986 128302008 128302110 128302135 SLC27A6 chr5 165 GCCCATGTCTTCCTGAACCATT 166 GGATGCAATTCAGGAGGGAGTT 128302107 128302129 128302253 128302275 SLC27A6 chr5 167 AGACAGATTTGGAAATATAAAGGTGTGTGA 168 CGCACCGATGTATTTCTTTAATAAGGAAAA 128351655 128351685 128351784 128351814 SLC27A6 chr5 169 AATGATTCTACTCATCCTGGTAATTGCTTT 170 GTAAAGTGGTTCAGAAATTTTCAGTGGATT 128368765 128368795 128368861 128368891 SLC27A6 chr5 171 GGATTTAATCCACTGAAAATTTCTGAACCA 172 CCCTCTCACTCTTCCTAAGAAAGC 128368856 128368886 128369001 128369025 BTNL3 chr5 173 GGAAGTGCGGTTCTTCAGGAAT 174 GATGTCCGAGGGAGTGATGTTT 180419916 180419938 180420068 180420090 BTNL3 chr5 175 GTCCACAAGGACAGGATTTGTCTT 176 AAGGTGGATGGAACACAATATGCT 180424321 180424345 180424421 180424445 BTNL3 chr5 177 ACTAAGGGTCTGTGGGACTGTT 178 CCATGCTTCTCTCTCTCACTTACC 180429644 180429666 180429784 180429808 BTNL3 chr5 179 GGACCATCTCCTTCTTCAATACAAATGA 180 TAAGCAGGGTCTTCTCTGTCTCA 180432718 180432746 180432869 180432892 CADPS chr3 181 AGCAGACTCTAGGACCAAATGGT 182 GGGTCCTGGACTCCACCTTAAA 62385058 62385081 62385210 62385232 CADPS chr3 183 GCAGCTTGCCAGTGAAATATATTTCA 184 AGCAATGGTACAACAGCTCCAT 62388689 62388715 62388840 62388862 CADPS chr3 185 CTCCTTGGTTTTCAAGGAGGAGAA 186 TCGTTTTCATGTTTTCCTGTTTCTTTACAG 62423742 62423766 62423886 62423916 CADPS chr3 187 ATGACAGAAAAGAAGAAAACAAAGTCCCT 188 CGATCCCAGCCTTTATGTGGTG 62451047 62451076 62451198 62451220 CADPS chr3 189 GCATATTGACTGTGGGACTCGAA 190 TCACTGACCTCTCAGAAAATATCTCCTC 62459920 62459943 62460048 62460076 CCDC173 chr2 191 GGGAGTAGAAAACTAGCATGAATTCTGT 192 ATGAAAGCAGATCAGATTTTCTGGGA 170505616 170505644 170505764 170505790 CCDC173 chr2 193 CACAGTGGAAAGGTCCTAACTCTG 194 GATTATTGCTAGAGATATTGCAGAAGCTGA 170506779 170506803 170506923 170506953 PPIL4 chr6 195 TCTCCACATCTAAGTCTGGACATTAGAG 196 TATATTAGATGAGCAGGCCGAAGACT 149833259 149833287 149833397 149833423 PPIL4 chr6 197 TTGTGACTTTTCATAACACATCACACAG 198 ACACCAAGAGTGATTTCAAGGAGTATG 149838403 149838431 149838550 149838577 PPIL4 chr6 199 CCTGTTCTTTTTCATACTCCTTGAAATCAC 200 CTTTCTCTGTCTCTCGATATATGCCATTTA 149838539 149838569 149838678 149838708 PPIL4 chr6 201 TGAATGTACATTTAATCATAAGAGGGCTTTACT 202 TGGATTTTTTGTAAGGATAAATCATACGGT 149855778 149855811 149855895 149855927

Lineitem_Name Chr SEQ ID NO: Ion_AmpliSeq_Fwd_Primer * SEQ ID NO: Ion_AmpliSeq_Rev_Primer * Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop SHMT2 chr12 203 GAGTACTCCCGCTTTCAGCT 204 GCCAGGATAACCCTCCGAGTA 57625165 57625185 57625317 57625338 SHMT2 chr12 205 GGATATCAGCCACGTCCATCTT 206 CACTCTCCTCCTTAACCCTAAGGA 57626026 57626048 57626161 57626185 SHMT2 chr12 207 CCCATTTCTTACCCACCTTAGGT 208 GTCTCCAGGACAGGTGTTCTTG 57627511 57627534 57627631 57627653 SLC47A2 chr17 209 CCTCCTCTGGAGTCCTGAAGAA 210 GTGGTTAACCTAGGTTTCCCGAT 19582133 19582155 19582283 19582306 SLC47A2 chr17 211 GGAATGTGATAAATCTGAGGACACACT 212 GCACCTTTTGTCTCTTCCAGTTG 19606326 19606353 19606477 19606500 SLC47A2 chr17 213 CTCTTCCACGTACCCATGAGG 214 GCCTCTGTTTCCAGGTTGGTC 19609948 19609969 19610067 19610088 TMEM169 chr2 215 ATGGAAGAGCCAACAGCAGTAG 216 GTCTGAGCGGTAGATGATGATGG 216960687 216960709 216960837 216960860 TMEM169 chr2 217 CTGCCTGTGGTTTTCATCCTTTC 218 CAAGGGCAATACGAGATCTTGTG 216964873 216964896 216964974 216964997 TMEM169 chr2 219 GAAAGGACCTTCTGGCACAAGA 220 CCACAGAAGCCTTTCTCCATGT 216964960 216964982 216965110 216965132 TMEM169 chr2 221 GTCTGGAGGACTGTTCTCCCTA 222 GCCAGAGGAGGGAGTAAGTTGT 216965153 216965175 216965272 216965294 TMEM184C chr4 223 TCACTGTGGGTGATATTGCAACA 224 CAAAGAATCCTATTGGAAAAGGAAAACAGA 148545048 148545071 148545191 148545221 TMEM184C chr4 225 ATTTCTGTTTTCCTTTTCCAATAGGATTCTTTG 226 ACTTATTAATCTGACTCCTTGTCAATAACATAC 148545189 148545222 148545330 148545363 TMEM184C chr4 227 ACTAACAGAAAACTTTATATTAAAGGACGGACA 228 GGAAATTGCATCTTGTGATGATGATGATAATAA 148555295 148555328 148555390 148555423 TMEM184C chr4 229 AAAAATTGTTTCCCGAGGATCAAGATC 230 TCAGATATCTTAGCTGTGGTAGGTGTAG 148555347 148555374 148555493 148555521 WDR62 chr19 231 GTCGTGTACGTGGAGAATGACA 232 CCACTTGCCTCAGATTTCCACT 36573977 36573999 36574129 36574151 WDR62 chr19 233 CTTCATGGACGAGCTGGTCAA 234 GTCCCACCAGACACCAACTAC 36575570 36575591 36575717 36575738 WDR62 chr19 235 ATGCGCAGGTCCCACAGAAGAT 236 GGGACTCAGTCAGTGTCTCAAA 36592917 36592939 36593022 36593044 WDR62 chr19 237 CTTCAACCCACGCCTGAGTA 238 GGAAGGTATGGGTGAACCTGT 36593694 36593714 36593845 36593866

Lineitem_Name Chr SEQ ID NO: Ion_AmpliSeq_Fwd_Primer * SEQ ID NO: Ion_AmpliSeq_Rev_Primer * Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop RTN3 chr11 239 ATCCAAAGTTTCAGGAGATGATGTTATTGA 240 TGAAATGTCTTCGGATGATTCTTTATCAGT 63486664 63486694 63486808 63486838 RTN3 chr11 241 GACATTTCAGAGACTAATGACAAGCTTTTT 242 GATCCCAAGTCAGTATTTCGTTAGTAAAGT 63486830 63486860 63486974 63487004 RTN3 chr11 243 GATACGAATGTCTCCTTAGAAGATGTGA 244 GTTTAACATTTTTCCCATGTAATGACTCCA 63487733 63487761 63487877 63487907 SCN2A chr2 245 CCTGACAGCTTCCGCTTCTTTA 246 TAAATGGAAGAGATTTTCCTGCTTCCAA 166152364 166152386 166152498 166152526 SCN2A chr2 247 GGAACGCAAGGATGAGGATGAT 248 GGCAACTTGACTAAGAACTCACTTTCTTAT 166152450 166152472 166152592 166152622 SCN2A chr2 249 CATCTGAAATTCTACTTCTAGGGCACAA 250 GACTTTTAACATACCTTCCATGGTGTTG 166183341 166183369 166183480 166183508 SCN2A chr2 251 GCAAAATCTTGGCCAACTCTAAATATGC 252 CACAATCATTGGAAATCTTGCAGACA 166201083 166201111 166201231 166201257 SLC25A13 chr7 253 ATGTTGAAGAATAGTTTCTGCATTAGGAGA 254 CGTCAAGATCCGTTTGCAAGTG 95775794 95775824 95775945 95775967 SLC25A13 chr7 255 CTCGAGGACCAGTGGTGATTTC 256 TTCATCTCTTCCTGACCCACCTTA 95775918 95775940 95776051 95776075 SLC25A13 chr7 257 CTTAGTCCACACCTGTTGACCA 258 TTTTCTTCAAGGTGAACGATTTTGTGAG 95799274 95799296 95799420 95799448 CEP295; SLC4A2 chr7 259 CCCTCCCTCCAGTTCTGTAG 260 AGATCAAGAAGGCGAAGATCTCCT 150769017 150769037 150769158 150769182 DDX20 chrl 261 TTGGCTCCTACAAGAGAAATTGCT 262 GCATTGTTATCTTACCAGGAGATCCA 112302031 112302055 112302179 112302205 DDX20 chrl 263 TCGTGGGATTGATGCTGAGAAG 264 ATTCAAAGCCCACCTGTCACATTA 112305304 112305326 112305454 112305478 DDX20 chrl 265 GAAATCATTCAGAAAACAGTGGTCTAGAGT 266 CACAGCAGCTTTAACTTCCACATC 112308288 112308318 112308399 112308423 DDX20 chrl 267 CAAGAACCTCTTCCCAGAGCAA 268 CCAGGTGATTCTTGATATTTCTCTGGATTG 112309028 112309050 112309163 112309193 ARHGAP26 chr5 269 CGACTGCTGCCTCGATAGTC 270 CTCGGGACACTCACTCTTGAG 142150353 142150373 142150473 142150494 ARHGAP26 chr5 271 GAGGCCTCAGGAAGAAACAGTAG 272 GCAAATCTGAGCCAACTCTGAAG 142500625 142500648 142500776 142500799 ARHGAP26 chr5 273 TGTAGCAATAGACTGTCCCTATGCA 274 GGGTCACTGGAGTTCATGTTGG 142526733 142526758 142526885 142526907 ARHGAP26 chr5 275 CCTCCTGTGCTCCCATTGTG 276 CGTGGATGAGGTGGGCATA 142586698 142586718 142586831 142586850

Lineitem_Name Chr SEQ ID NO: Ion_AmpliSeq_Fwd_Primer * SEQ ID NO: Ion_AmpliSeq_Rev_Primer * Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop GABRE chrX 277 TTAAGGCAAACAAGCCAGTAGAGCA 278 GTGAGTGGTGCAAGCGTTTTAA 151123180 151123205 151123332 151123354 GABRE chrX 279 GGGTTGTGATTATTTCAGTTTTGTTGC 280 CCTCTTTCTCACATTCCTTTCCAGTTT 151128317 151128344 151128445 151128472 IPO7 chr11 281 TTTTTCTTTGTAGGCACACAAGTCTC 282 ACACTTCTGCTATTCGATTATGAACCTTTT 9424824 9424850 9424961 9424991 IPO7 chr11 283 TCTAGGTACTGCAAAAGACTATGGGA 284 ACAAACACACTAAAGAATACCTTCAGAAGT 9446688 9446714 9446799 9446829 IPO7 chr11 285 TTTTTGTAGTGCATTCCCTTATTCGTG 286 GGGAAGCGAAGATTTTCTAAGGTATTGA 9459292 9459319 9459424 9459452 PDE4C chr19 287 TGTCACACATGGGACTGATGTC 288 CCAAGCCTCGATCTCTGTAGGT 18322598 18322620 18322749 18322771 PDE4C chr19 289 TGGCCTCACCATGTCAATGAC 290 CTGGCGCTTATGTACAACGAC 18327542 18327563 18327676 18327697 PDE4C chr19 291 ACCCACTTCCCACTCCTACTTA 292 TCAGGCTGTGTTCACAGACTTG 18328936 18328958 18329040 18329062 PDE4C chr19 293 GGCAGTGACTCAACAAAGCTCA 294 TCATCACGGTCTTCACCTTCTCT 18331013 18331035 18331138 18331161 PRKCQ chr10 295 GCTCTGGAAAGGTCGAACTTGT 296 TGAGACCCTGTCTTGGACAAAATAAATAAA 6506278 6506300 6506413 6506443 PRKCQ chr10 297 GCGCCATTGAAGGTATCATGCT 298 TGTTGAGTGCACGATGGTAGAG 6520886 6520908 6521022 6521044 PRKCQ chr10 299 AGTTTAATCTGCAGAGATGGTCTTTCTTT 300 CCTCCATTACTCCATGTTCATTTTTAACC 6525457 6525486 6525580 6525609 PRKCQ chr10 301 CTTCCCTTGTTGATATGGGCATCA 302 GTGCTACTGTTGAGTTGAACTGAATTATTT 6553072 6553096 6553204 6553234 PRSS38 chrl 303 CAGGAAGAAACTGGCTTTTCAATCC 304 TGAGGTTTACGAGGCCTACGTA 228004785 228004810 228004937 228004959 PRSS38 chrl 305 GCCAGTGTTTCCTATTTCTCAAAATGG 306 GAGAATCCTAGAGTGGGTATCCTGA 228033763 228033790 228033911 228033936

Lineitem_Name Chr SEQ ID NO: Ion_AmpliSeq_Fwd_Primer * SEQ ID NO: Ion_AmpliSeq_Rev_Primer * Amplicon_Start Insert_Start Insert_Stop Amplicon_Stop ADAMTS20 chr12 307 AAATATTCCTTAGGGTTCTCCAAGTACATG 308 GATGGTGACTATTACCTTAACATTAAGGGA 43769908 43769938 43770050 43770080 ADAMTS20 chr12 309 CCAAGTGGCCAAATGCAAACAG 310 TGCAAACAACTGTGGATTTAGTTACAGA 43771189 43771211 43771335 43771363 ADAMTS20 chr12 311 AGACTATTTCATTCACTTGTCTGATTTGGT 312 CGACATGTAAATTTTCAAAGACACTGCATA 43777447 43777477 43777568 43777598 ADAMTS20 chr12 313 GGCAAGCATGCATATGACACTG 314 TCTTGTTTTTAGTGTTCACAAACATGTGG 43819355 43819377 43819476 43819505 ADAMTS20 chr12 315 TCTCATAAGAATACTTACGGGTGACCAA 316 GATGCTCTTGATAGAATAGCAGATGAATCA 43822420 43822448 43822521 43822551 ADAMTS20 chr12 317 GGAGGAGTAAATATAACACAACTTTTGTGC 318 GGCTTCTGTAATTCAAGTACCAAACCT 43825056 43825086 43825197 43825224 ADAMTS20 chr12 319 TTTTTGATGTGTGTCCTAAAACTCTTTCTT 320 TTTTTGCGATATTTTTCGTCACATCCA 43896107 43896137 43896247 43896274 (ODZ4) TENM4 chr11 321 GGCCACAAAAGAGTAGCTGTCT 322 CTACGACGGCTTTTTCGTGATC 78369054 78369076 78369183 78369205 (ODZ4) TENM5 chr11 323 GGCCGTCAGCATCATACTCATA 324 GAAGGAAGTGCAGTATGAGATCTTCC 78380789 78380811 78380911 78380937 (ODZ4) TENM6 chr11 325 GCATTTACCGATAGAACAGTCGTGT 326 GTCTGCGTGAGAGGCGAAT 78516329 78516354 78516483 78516502 (ODZ4) TENM7 chr11 327 CCACATCGATACACTGGTTGGT 328 TGGACATTGATTCATGCCAGACT 78523245 78523267 78523379 78523402 PLEC chr8 329 CTCCTTCAGCGGCAAGAGACA 330 ATGAGGAGATGAACGAGATCCTGA 144991620 144991641 144991747 144991771 PLEC chr8 331 CCTACCTCCTGGATGACACTCT 332 AGTGCATTGCCACAGGACTATG 145001140 145001162 145001242 145001264 PLEC chr8 333 GCAGAGGACTCAGGTAGGTGTT 334 GGACAAGGCGGATAGCATGATC 145007288 145007310 145007435 145007457

In order to confirm mutation detection by the prepared primer set, gene mutations identified in Example 2 and samples derived from wild type kidney cancer cells were subjected to gene mutation as a sample, After amplification with a primer set, the chip was scanned using a scanner and application program, and analyzed using quantitative analysis software.

As a result, the mutation of the genes of Examples 2 and 3 could be detected with the primer set prepared in Example 4. [ On the other hand, mutations were not detected in samples derived from control kidney cancer cells. As shown in Table 20 to Table 27, ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, MYH1, NDUFAF3, NKAIN3, SERPINI2, ZBTB41, MUC6, SLC27A6, BTNL3 , CADPS, CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, TMEM184C, WDR62, RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ, PRSS38, ADAMTS20, ODZ4, PLEC , It is possible to predict the total survival period and the disease free survival period of the kidney cancer patients showing the mutation of the genes and thus the treatment strategy can be efficiently designed.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the scope of the invention is not limited to the disclosed exemplary embodiments. It will be possible to change it appropriately.

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRYACADEMIC COOPERATION FOUNDATION <120> Age-specific markers for diagnosing prognosis and determining          treatment strategies of patients with clear cell renal cell          carcinoma <130> 2017-DPA-1794 <160> 334 <170> KoPatentin 3.0 <210> 1 <211> 1544 <212> PRT <213> Homo sapiens <400> 1 Met Ala Ala Pro Gln Asp Leu Asp Ile Ala Val Trp Leu Ala Thr Val   1 5 10 15 His Leu Glu Gln Tyr Ala Asp Thr Phe Arg Arg His Gly Leu Ala Thr              20 25 30 Ala Gly Ala Ala Arg Gly Leu Gly His Glu Glu Leu Lys Gln Leu Gly          35 40 45 Ile Ser Ala Thr Gly His Arg Lys Arg Ile Leu Arg Leu Leu Gln Thr      50 55 60 Gly Thr Glu Glu Gly Ser Leu Asp Pro Lys Ser Asp Ser Ala Met Glu  65 70 75 80 Pro Ser Pro Ser Pro Ala Pro Gln Ala Gln Pro Pro Lys Pro Val Pro                  85 90 95 Lys Pro Arg Thr Val Phe Gly Gly Leu Ser Gly Pro Ala Thr Thr Gln             100 105 110 Arg Pro Gly Leu Ser Pro Ala Leu Gly Gly Pro Gly Val Ser Ser Ser         115 120 125 Pro Glu Pro Ser Pro Arg Pro Pro Pro Leu Pro Thr Ser Ser Glu     130 135 140 Gln Ser Ser Ala Leu Asn Thr Val Glu Met Met Pro Asn Ser Ile Tyr 145 150 155 160 Phe Gly Leu Asp Ser Arg Gly Arg Ala Gln Ala Ala Gln Asp Lys Ala                 165 170 175 Pro Asp Ser Ser Gln Ile Ser Ala Pro Thr Pro Ala Leu Arg Pro Thr             180 185 190 Thr Gly Thr Val His Ile Met Asp Pro Gly Cys Leu Tyr Tyr Gly Val         195 200 205 Gln Pro Val Gly Thr Pro Gly Ala Pro Asp Arg Arg Gly Ser Arg Gly     210 215 220 Val Cys Gln Gly Arg Ala Glu His Arg Leu Ser Arg Gln Asp Leu Glu 225 230 235 240 Ala Arg Glu Asp Ala Gly Tyr Ala Ser Leu Glu Leu Pro Gly Asp Ser                 245 250 255 Thr Leu Leu Ser Pro Thr Leu Glu Thr Glu Glu Thr Ser Asp Asp Leu             260 265 270 Ile Ser Pro Tyr Ala Ser Phe Ser Phe Thr Ala Asp Arg Leu Thr Pro         275 280 285 Leu Leu Ser Gly Trp Leu Asp Lys Leu Ser Pro Gln Gly Asn Tyr Val     290 295 300 Phe Gln Arg Arg Phe Val Gln Phe Asn Gly Arg Ser Leu Met Tyr Phe 305 310 315 320 Gly Ser Asp Lys Asp Pro Phe Pro Lys Gly Val Ile Pro Leu Thr Ala                 325 330 335 Ile Glu Met Thr Arg Ser Ser Lys Asp Asn Lys Phe Gln Val Ile Thr             340 345 350 Gly Gln Arg Val Phe Val Phe Arg Thr Glu Ser Glu Ala Gln Arg Asp         355 360 365 Met Trp Cys Ser Thr Leu Gln Ser Cys Leu Lys Glu Gln Arg Leu Leu     370 375 380 Gly His Pro Arg Pro Pro Gln Pro Pro Arg Pro Leu Arg Thr Gly Met 385 390 395 400 Leu Glu Leu Arg Gly His Lys Ala Lys Val Phe Ala Ala Leu Ser Pro                 405 410 415 Gly Glu Leu Ala Leu Tyr Lys Ser Glu Gln Ala Phe Ser Leu Gly Ile             420 425 430 Gly Ile Cys Phe Ile Glu Leu Gln Gly Cys Ser Val Arg Glu Thr Lys         435 440 445 Ser Arg Ser Phe Asp Leu Leu Thr Pro His Arg Cys Phe Ser Phe Thr     450 455 460 Ala Glu Ser Gly Gly Ala Arg Gln Ser Trp Ala Ala Ala Leu Gln Glu 465 470 475 480 Ala Val Thr Glu Thr Leu Ser Asp Tyr Glu Val Ala Glu Lys Ile Trp                 485 490 495 Ser Asn Arg Ala Asn Arg Gln Cys Ala Asp Cys Gly Ser Ser Arg Pro             500 505 510 Asp Trp Ala Ala Val Asn Leu Gly Val Val Ile Cys Lys Gln Cys Ala         515 520 525 Gly Gln His Arg Ala Leu Gly Ser Gly Ile Ser Lys Val Gln Ser Leu     530 535 540 Lys Leu Asp Thr Ser Val Trp Ser Asn Glu Ile Val Gln Leu Phe Ile 545 550 555 560 Val Leu Gly Asn Asp Arg Ala Asn Arg Phe Trp Ala Gly Thr Leu Pro                 565 570 575 Pro Gly Glu Gly Leu His Pro Asp Ala Thr Pro Gly Pro Arg Gly Glu             580 585 590 Phe Ile Ser Arg Lys Tyr Arg Leu Gly Leu Phe Arg Lys Pro His Pro         595 600 605 Gln Tyr Pro Asp His Ser Gln Leu Leu Gln Ala Leu Cys Ala Ala Val     610 615 620 Ala Arg Pro Asn Leu Leu Lys Asn Met Thr Gln Leu Leu Cys Val Glu 625 630 635 640 Ala Phe Glu Gly Glu Glu Pro Trp Phe Pro Pro Ala Pro Asp Gly Ser                 645 650 655 Cys Pro Gly Leu Leu Pro Ser Asp Pro Ser Pro Gly Val Tyr Asn Glu             660 665 670 Val Val Val Arg Ala Thr Tyr Ser Gly Phe Leu Tyr Cys Ser Pro Val         675 680 685 Ser Asn Lys Ala Gly Pro Ser Pro Pro Arg Arg Gly Arg Asp Ala Pro     690 695 700 Pro Arg Leu Trp Cys Val Leu Gly Ala Ala Leu Glu Met Phe Ala Ser 705 710 715 720 Glu Asn Ser Pro Glu Pro Leu Ser Leu Ile Gln Pro Gln Asp Ile Val                 725 730 735 Cys Leu Gly Val Ser Pro Pro Pro Thr Asp Pro Gly Asp Arg Phe Pro             740 745 750 Phe Ser Phe Glu Leu Ile Leu Ala Gly Gly Arg Ile Gln His Phe Gly         755 760 765 Thr Asp Gly Ala Asp Ser Leu Glu Ala Trp Thr Ser Ala Val Gly Lys     770 775 780 Trp Phe Ser Pro Leu Ser Cys His Gln Leu Leu Gly Pro Gly Leu Leu 785 790 795 800 Arg Leu Gly Arg Leu Trp Leu Arg Ser Ser Ser His Thr Ala Pro Ala                 805 810 815 Pro Gly Leu Trp Leu Ser Gly Phe Gly Leu Leu Arg Gly Asp His Leu             820 825 830 Phe Leu Cys Ser Ala Pro Gly Pro Gly Pro Pro Ala Pro Glu Asp Met         835 840 845 Val His Leu Arg Arg Leu Gln Glu Ile Ser Val Val Ser Ala Ala Asp     850 855 860 Thr Pro Asp Lys Lys Glu His Leu Val Leu Val Glu Thr Gly Arg Thr 865 870 875 880 Leu Tyr Leu Gln Gly Glu Gly Arg Leu Asp Phe Thr Ala Trp Asn Ala                 885 890 895 Ala Ile Gly Gly Ala Ala Gly Gly Gly Gly             900 905 910 Gln Met Ser Arg Gly Asp Ile Pro Ile Ile Val Asp Ala Cys Ile Ser         915 920 925 Phe Val Thr Gln His Gly Leu Arg Leu Glu Gly Val Tyr Arg Lys Gly     930 935 940 Gly Ala Arg Ala Arg Ser Leu Arg Leu Leu Ala Glu Phe Arg Arg Asp 945 950 955 960 Ala Arg Ser Val Lys Leu Arg Pro Gly Glu His Phe Val Glu Asp Val                 965 970 975 Thr Asp Thr Leu Lys Arg Phe Phe Arg Glu Leu Asp Asp Pro Val Thr             980 985 990 Ser Ala Arg Leu Leu Pro Arg Trp Arg Glu Ala Ala Glu Leu Pro Gln         995 1000 1005 Lys Asn Gln Arg Leu Glu Lys Tyr Lys Asp Val Ile Gly Cys Leu Pro    1010 1015 1020 Arg Val Asn Arg Arg Thr Leu Ala Thr Leu Ile Gly His Leu Tyr Arg 1025 1030 1035 1040 Val Gln Lys Cys Ala Ala Leu Asn Gln Met Cys Thr Arg Asn Leu Ala                1045 1050 1055 Leu Leu Phe Ala Pro Ser Val Phe Gln Thr Asp Gly Arg Gly Glu His            1060 1065 1070 Glu Val Arg Leu Glu Glu Leu Ile Asp Gly Tyr Ile Ser Val Phe        1075 1080 1085 Asp Ile Asp Ser Asp Gln Val Ala Gln Ile Asp Leu Glu Val Ser Leu    1090 1095 1100 Ile Thr Thr Trp Lys Asp Val Gln Leu Ser Gln Ala Gly Asp Leu Ile 1105 1110 1115 1120 Met Glu Val Tyr Ile Glu Gln Gln Leu Pro Asp Asn Cys Val Thr Leu                1125 1130 1135 Lys Val Ser Pro Thr Leu Thr Ala Glu Glu Leu Thr Asn Gln Val Leu            1140 1145 1150 Glu Met Arg Gly Thr Ala Ala Gly Met Asp Leu Trp Val Thr Phe Glu        1155 1160 1165 Ile Arg Glu His Gly Glu Leu Glu Arg Pro Leu His Pro Lys Glu Lys    1170 1175 1180 Val Leu Glu Gln Ala Leu Gln Trp Cys Gln Leu Pro Glu Pro Cys Ser 1185 1190 1195 1200 Ala Ser Leu Leu Leu Lys Lys Val Pro Leu Ala Gln Ala Gly Cys Leu                1205 1210 1215 Phe Thr Gly Ile Arg Arg Glu Ser Pro Arg Val Gly Leu Leu Arg Cys            1220 1225 1230 Arg Glu Glu Pro Pro Arg Leu Leu Gly Ser Arg Phe Gln Glu Arg Phe        1235 1240 1245 Phe Leu Leu Arg Gly Arg Cys Leu Leu Leu Leu Lys Glu Lys Lys Ser    1250 1255 1260 Ser Lys Pro Glu Arg Glu Trp Pro Leu Glu Gly Ala Lys Val Tyr Leu 1265 1270 1275 1280 Gly Ile Arg Lys Lys Leu Lys Pro Pro Thr Pro Trp Gly Phe Thr Leu                1285 1290 1295 Ile Leu Glu Lys Met His Leu Tyr Leu Ser Cys Thr Asp Glu Asp Glu            1300 1305 1310 Met Trp Asp Trp Thr Thr Ser Ile Leu Lys Ala Gln His Asp Asp Gln        1315 1320 1325 Gln Pro Val Val Leu Arg Arg His Ser Ser Ser Asp Leu Ala Arg Gln    1330 1335 1340 Lys Phe Gly Thr Met Pro Leu Leu Pro Ile Arg Gly Asp Asp Ser Gly 1345 1350 1355 1360 Ala Thr Leu Leu Ser Ala Asn Gln Thr Leu Arg Arg Leu His Asn Arg                1365 1370 1375 Arg Thr Leu Ser Met Phe Phe Pro Met Lys Ser Ser Gln Gly Ser Val            1380 1385 1390 Glu Glu Glu Glu Glu Leu Glu Glu Pro Val Tyr Glu Glu Pro Val Tyr        1395 1400 1405 Glu Glu Val Gly Ala Phe Pro Glu Leu Ile Gln Asp Thr Ser Thr Ser    1410 1415 1420 Phe Ser Thr Thr Arg Glu Trp Thr Val Lys Pro Glu Asn Pro Leu Thr 1425 1430 1435 1440 Ser Gln Lys Ser Leu Asp Gln Pro Phe Leu Ser Lys Ser Ser Thr Leu                1445 1450 1455 Gly Gln Glu Glu Arg Pro Pro Glu Pro Pro Pro Gly Pro Pro Ser Lys            1460 1465 1470 Ser Ser Pro Gln Ala Arg Gly Ser Leu Glu Glu Gln Leu Leu Gln Glu        1475 1480 1485 Leu Ser Ser Leu Ile Leu Arg Lys Gly Glu Thr Thr Ala Gly Leu Gly    1490 1495 1500 Ser Pro Ser Gln Pro Ser Ser Pro Gln Ser Ser Pro Thr Gly Leu 1505 1510 1515 1520 Pro Thr Gln Thr Pro Gly Phe Pro Thr Gln Pro Pro Cys Thr Ser Ser                1525 1530 1535 Pro Pro Ser Ser Gln Pro Leu Thr            1540 <210> 2 <211> 1292 <212> PRT <213> Homo sapiens <400> 2 Met Lys Pro Ala Thr Gly Leu Trp Val Trp Val Ser Leu Leu Val Ala   1 5 10 15 Ala Gly Thr Val Gln Pro Ser Asp Ser Gln Ser Val Cys Ala Gly Thr              20 25 30 Glu Asn Lys Leu Ser Ser Leu Ser Asp Leu Glu Gln Gln Tyr Arg Ala          35 40 45 Leu Arg Lys Tyr Tyr Glu Asn Cys Glu Val Val Met Gly Asn Leu Glu      50 55 60 Ile Thr Ser Ile Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val  65 70 75 80 Arg Glu Val Thr Gly Tyr Val Leu Val Ala Leu Asn Gln Phe Arg Tyr                  85 90 95 Leu Pro Leu Glu Asn Leu Arg Ile Ile Arg Gly Thr Lys Leu Tyr Glu             100 105 110 Asp Arg Tyr Ala Leu Ala Ile Phe Leu Asn Tyr Arg Lys Asp Gly Asn         115 120 125 Phe Gly Leu Gln Glu Leu Gly Leu Lys Asn Leu Thr Glu Ile Leu Asn     130 135 140 Gly Gly Val Tyr Val Asp Gln Asn Lys Phe Leu Cys Tyr Ala Asp Thr 145 150 155 160 Ile His Trp Gln Asp Ile Val Arg Asn Pro Trp Pro Ser Asn Leu Thr                 165 170 175 Leu Val Ser Thr Asn Gly Ser Ser Gly Cys Gly Arg Cys His Lys Ser             180 185 190 Cys Thr Gly Arg Cys Trp Gly Pro Thr Glu Asn His Cys Gln Thr Leu         195 200 205 Thr Arg Thr Val Cys Ala Glu Gln Cys Asp Gly Arg Cys Tyr Gly Pro     210 215 220 Tyr Val Ser Asp Cys Cys His Arg Glu Cys Ala Gly Gly Cys Ser Gly 225 230 235 240 Pro Lys Asp Thr Asp Cys Phe Ala Cys Met Asn Phe Asn Asp Ser Gly                 245 250 255 Ala Cys Val Thr Gln Cys Pro Gln Thr Phe Val Tyr Asn Pro Thr Thr             260 265 270 Phe Gln Leu Glu His Asn Phe Asn Ala Lys Tyr Thr Tyr Gly Ala Phe         275 280 285 Cys Val Lys Lys Cys Pro His Asn Phe Val Val Asp Ser Ser Ser Cys     290 295 300 Val Arg Ala Cys Pro Ser Ser Lys Met Glu Val Glu Glu Asn Gly Ile 305 310 315 320 Lys Met Cys Lys Pro Cys Thr Asp Ile Cys Pro Lys Ala Cys Asp Gly                 325 330 335 Ile Gly Thr Gly Ser Leu Met Ser Ala Gln Thr Val Asp Ser Ser Asn             340 345 350 Ile Asp Lys Phe Ile Asn Cys Thr Lys Ile Asn Gly Asn Leu Ile Phe         355 360 365 Leu Val Thr Gly Ile His Gly Asp Pro Tyr Asn Ala Ile Glu Ala Ile     370 375 380 Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu Ile Thr Gly 385 390 395 400 Phe Leu Asn Ile Gln Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val                 405 410 415 Phe Ser Asn Leu Val Thr Ile Gly Gly Arg Val Leu Tyr Ser Gly Leu             420 425 430 Ser Leu Leu Ile Leu Lys Gln Gln Gly Ile Thr Ser Leu Gln Phe Gln         435 440 445 Ser Leu Lys Glu Ile Ser Ala Gly Asn Ile Tyr Ile Thr Asp Asn Ser     450 455 460 Asn Leu Cys Tyr Tyr His Thr Ile Asn Trp Thr Thr Leu Phe Ser Thr 465 470 475 480 Ile Asn Gln Arg Ile Val Ile Arg Asp Asn Arg Lys Ala Glu Asn Cys                 485 490 495 Thr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp Gly Cys             500 505 510 Trp Gly Pro Gly Pro Asp Gln Cys Leu Ser Cys Arg Arg Phe Ser Arg         515 520 525 Gly Arg Ile Cys Ile Glu Ser Cys Asn Leu Tyr Asp Gly Glu Phe Arg     530 535 540 Glu Phe Glu Asn Gly Ser Ile Cys Val Glu Cys Asp Pro Gln Cys Glu 545 550 555 560 Lys Met Glu Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn                 565 570 575 Cys Thr Lys Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu Lys             580 585 590 Cys Pro Asp Gly Leu Gln Gly Ala Asn Ser Phe Ile Phe Lys Tyr Ala         595 600 605 Asp Pro Asp Arg Glu Cys His Pro Cys His Pro Asn Cys Thr Gln Gly     610 615 620 Cys Asn Gly Pro Thr Ser His Asp Cys Ile Tyr Tyr Pro Trp Thr Gly 625 630 635 640 His Ser Thr Leu Pro Gln His Ala Arg Thr Pro Leu Ile Ala Ala Gly                 645 650 655 Val Ile Gly Gly Leu Phe Ile Leu Val Ile Val Gly Leu Thr Phe Ala             660 665 670 Val Tyr Val Arg Arg Lys Ser Ile Lys Lys Lys Arg Ala Leu Arg Arg         675 680 685 Phe Leu Glu Thr Glu Leu Val Glu Pro Leu Thr Pro Ser Gly Thr Ala     690 695 700 Pro Asn Gln Ala Gln Leu Arg Ile Leu Lys Glu Thr Glu Leu Lys Arg 705 710 715 720 Val Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys Gly Ile                 725 730 735 Trp Val Pro Glu Gly Glu Thr Val Lys Ile Pro Val Ala Ile Lys Ile             740 745 750 Leu Asn Glu Thr Thr Gly Pro Lys Ala Asn Val Glu Phe Met Asp Glu         755 760 765 Ala Leu Ile Met Ala Ser Met Asp His Pro His Leu Val Arg Leu Leu     770 775 780 Gly Val Cys Leu Ser Pro Thr Ile Gln Leu Val Thr Gln Leu Met Pro 785 790 795 800 His Gly Cys Leu Leu Glu Tyr Val His Glu His Lys Asp Asn Ile Gly                 805 810 815 Ser Gln Leu Leu Leu Asn Trp Cys Val Gln Ile Ala Lys Gly Met Met             820 825 830 Tyr Leu Glu Glu Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn         835 840 845 Val Leu Val Lys Ser Pro Asn His Val Lys Ile Thr Asp Phe Gly Leu     850 855 860 Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly Gly 865 870 875 880 Lys Met Pro Ile Lys Trp Met Ala Leu Glu Cys Ile His Tyr Arg Lys                 885 890 895 Phe Thr His Gln Ser Asp Val Trp Ser Tyr Gly Val Thr Ile Trp Glu             900 905 910 Leu Met Thr Phe Gly Gly Lys Pro Tyr Asp Gly Ile Pro Thr Arg Glu         915 920 925 Ile Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile     930 935 940 Cys Thr Ile Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile Asp 945 950 955 960 Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg                 965 970 975 Met Ala Arg Asp Pro Gln Arg Tyr Leu Val Ile Gln Gly Asp Asp Arg             980 985 990 Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gln Asn Leu Leu         995 1000 1005 Asp Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr Leu Val    1010 1015 1020 Pro Gln Ala Phe Asn Ile Pro Pro Ile Tyr Thr Ser Arg Ala Arg 1025 1030 1035 1040 Ile Asp Ser Asn Arg Asn Gln Phe Val Tyr Arg Asp Gly Gly Phe Ala                1045 1050 1055 Ala Glu Gln Gly Val Ser Val Pro Tyr Arg Ala Pro Thr Ser Thr Ile            1060 1065 1070 Pro Glu Ala Pro Val Ala Gln Gly Ala Thr Ala Glu Ile Phe Asp Asp        1075 1080 1085 Ser Cys Cys Asn Gly Thr Leu Arg Lys Pro Val Ala Pro His Val Gln    1090 1095 1100 Glu Asp Ser Ser Thr Gln Arg Tyr Ser Ala Asp Pro Thr Val Phe Ala 1105 1110 1115 1120 Pro Glu Arg Ser Pro Arg Gly Glu Leu Asp Glu Glu Gly Tyr Met Thr                1125 1130 1135 Pro Met Arg Asp Lys Pro Lys Gln Glu Tyr Leu Asn Pro Val Glu Glu            1140 1145 1150 Asn Pro Phe Val Ser Arg Arg Lys Asn Gly Asp Leu Gln Ala Leu Asp        1155 1160 1165 Asn Pro Glu Tyr His Asn Ala Ser Asn Gly Pro Pro Lys Ala Glu Asp    1170 1175 1180 Glu Tyr Val Asn Glu Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr Leu 1185 1190 1195 1200 Gly Lys Ala Glu Tyr Leu Lys Asn Asn Ile Leu Ser Met Pro Glu Lys                1205 1210 1215 Ala Lys Lys Ala Phe Asp Asn Pro Asp Tyr Trp Asn His Ser Leu Pro            1220 1225 1230 Pro Arg Ser Thr Leu Gln His Pro Asp Tyr Leu Gln Glu Tyr Ser Thr        1235 1240 1245 Lys Tyr Phe Tyr Lys Gln Asn Gly Arg Ile Arg Pro Ile Val Ala Glu    1250 1255 1260 Asn Pro Glu Tyr Leu Ser Glu Phe Ser Leu Lys Pro Gly Thr Val Leu 1265 1270 1275 1280 Pro Pro Pro Tyr Arg His Arg Asn Thr Val Val                1285 1290 <210> 3 <211> 2351 <212> PRT <213> Homo sapiens <400> 3 Met Gln Ile Glu Leu Ser Thr Cys Phe Phe Leu Cys Leu Leu Arg Phe   1 5 10 15 Cys Phe Ser Ala Thr Arg Arg Tyr Tyr Leu Gly Ala Val Glu Leu Ser              20 25 30 Trp Asp Tyr Met Gln Ser Asp Leu Gly Glu Leu Pro Val Asp Ala Arg          35 40 45 Phe Pro Pro Arg Val Pro Lys Ser Phe Pro Phe Asn Thr Ser Val Val      50 55 60 Tyr Lys Lys Thr Leu Phe Val Glu Phe Thr Asp His Leu Phe Asn Ile  65 70 75 80 Ala Lys Pro Arg Pro Pro Trp Met Gly Leu Leu Gly Pro Thr Ile Gln                  85 90 95 Ala Glu Val Tyr Asp Thr Val Valle Thr Leu Lys Asn Met Ala Ser             100 105 110 His Pro Val Ser Leu His Ala Val Gly Val Ser Tyr Trp Lys Ala Ser         115 120 125 Glu Gly Ala Glu Tyr Asp Asp Gln Thr Ser Gln Arg Glu Lys Glu Asp     130 135 140 Asp Lys Val Phe Pro Gly Gly Ser His Thr Tyr Val Trp Gln Val Leu 145 150 155 160 Lys Glu Asn Gly Pro Met Ala Ser Asp Pro Leu Cys Leu Thr Tyr Ser                 165 170 175 Tyr Leu Ser His Val Asp Leu Val Lys Asp Leu Asn Ser Gly Leu Ile             180 185 190 Gly Ala Leu Leu Val Cys Arg Glu Gly Ser Leu Ala Lys Glu Lys Thr         195 200 205 Gln Thr Leu His Lys Phe Ile Leu Leu Phe Ala Val Phe Asp Glu Gly     210 215 220 Lys Ser Trp His Ser Glu Thr Lys Asn Ser Leu Met Gln Asp Arg Asp 225 230 235 240 Ala Ala Ser Ala Arg Ala Trp Pro Lys Met His Thr Val Asn Gly Tyr                 245 250 255 Val Asn Arg Ser Leu Pro Gly Leu Ile Gly Cys His Arg Lys Ser Val             260 265 270 Tyr Trp His Val Ile Gly Met Gly Thr Thr Pro Glu Val His Ser Ile         275 280 285 Phe Leu Glu Gly His Thr Phe Leu Val Arg Asn His Arg Gln Ala Ser     290 295 300 Leu Glu Ile Ser Pro Ile Thr Phe Leu Thr Ala Gln Thr Leu Leu Met 305 310 315 320 Asp Leu Gly Gln Phe Leu Leu Phe Cys His Ile Ser Ser His Gln His                 325 330 335 Asp Gly Met Glu Ala Tyr Val Lys Val Asp Ser Cys Pro Glu Glu Pro             340 345 350 Gln Leu Arg Met Lys Asn Asn Glu Glu Ala Glu Asp Tyr Asp Asp Asp         355 360 365 Leu Thr Asp Ser Glu Met Asp Val Val Arg Phe Asp Asp Asp Asn Ser     370 375 380 Pro Ser Phe Ile Gln Ile Arg Ser Val Ala Lys Lys His Pro Lys Thr 385 390 395 400 Trp Val His Tyr Ile Ala Ala Glu Glu Glu Asp Trp Asp Tyr Ala Pro                 405 410 415 Leu Val Leu Ala Pro Asp Asp Arg Ser Tyr Lys Ser Gln Tyr Leu Asn             420 425 430 Asn Gly Pro Gln Arg Ile Gly Arg Lys Tyr Lys Lys Val Arg Phe Met         435 440 445 Ala Tyr Thr Asp Glu Thr Phe Lys Thr Arg Glu Ala Ile Gln His Glu     450 455 460 Ser Gly Ile Leu Gly Pro Leu Leu Tyr Gly Glu Val Gly Asp Thr Leu 465 470 475 480 Leu Ile Ile Phe Lys Asn Gln Ala Ser Arg Pro Tyr Asn Ile Tyr Pro                 485 490 495 His Gly Ile Thr Asp Val Arg Pro Leu Tyr Ser Arg Arg Leu Pro Lys             500 505 510 Gly Val Lys His Leu Lys Asp Phe Pro Ile Leu Pro Gly Glu Ile Phe         515 520 525 Lys Tyr Lys Trp Thr Val Thr Val Glu Asp Gly Pro Thr Lys Ser Asp     530 535 540 Pro Arg Cys Leu Thr Arg Tyr Tyr Ser Ser Phe Val Asn Met Glu Arg 545 550 555 560 Asp Leu Ala Ser Gly Leu Ile Gly Pro Leu Leu Ile Cys Tyr Lys Glu                 565 570 575 Ser Val Asp Gln Arg Gly Asn Gln Ile Met Ser Asp Lys Arg Asn Val             580 585 590 Ile Leu Phe Ser Val Phe Asp Glu Asn Arg Ser Trp Tyr Leu Thr Glu         595 600 605 Asn Ile Gln Arg Phe Leu Pro Asn Pro Ala Gly Val Gln Leu Glu Asp     610 615 620 Pro Glu Phe Gln Ala Ser Asn Ile Met His Ser Ile Asn Gly Tyr Val 625 630 635 640 Phe Asp Ser Leu Gln Leu Ser Val Cys Leu His Glu Val Ala Tyr Trp                 645 650 655 Tyr Ile Leu Ser Ile Gly Ala Gln Thr Asp Phe Leu Ser Val Phe Phe             660 665 670 Ser Gly Tyr Thr Phe Lys His Lys Met Val Tyr Glu Asp Thr Leu Thr         675 680 685 Leu Phe Pro Phe Ser Gly Glu Thr Val Phe Met Ser Met Glu Asn Pro     690 695 700 Gly Leu Trp Ile Leu Gly Cys His Asn Ser Asp Phe Arg Asn Arg Gly 705 710 715 720 Met Thr Ala Leu Leu Lys Val Ser Ser Cys Asp Lys Asn Thr Gly Asp                 725 730 735 Tyr Tyr Glu Asp Ser Tyr Glu Asp Ile Ser Ala Tyr Leu Leu Ser Lys             740 745 750 Asn Asn Ale Ile Glu Pro Arg Ser Ser Phe Ser Gln Asn Ser Arg His Pro         755 760 765 Ser Thr Arg Gln Lys Gln Phe Asn Ala Thr Thr Ile Pro Glu Asn Asp     770 775 780 Ile Glu Lys Thr Asp Pro Trp Phe Ala His Arg Thr Pro Met Pro Lys 785 790 795 800 Ile Gln Asn Val Ser Ser Asp Leu Leu Met Leu Leu Arg Gln Ser                 805 810 815 Pro Thr Pro His Gly Leu Ser Leu Ser Asp Leu Gln Glu Ala Lys Tyr             820 825 830 Glu Thr Phe Ser Asp Asp Pro Ser Pro Gly Ala Ile Asp Ser Asn Asn         835 840 845 Ser Leu Ser Glu Met Thr His Phe Arg Pro Gln Leu His His Ser Gly     850 855 860 Asp Met Val Phe Thr Pro Glu Ser Gly Leu Gln Leu Arg Leu Asn Glu 865 870 875 880 Lys Leu Gly Thr Thr Ala Ala Thr Glu Leu Lys Lys Leu Asp Phe Lys                 885 890 895 Val Ser Ser Thr Ser Asn Asn Leu Ile Ser Thr Ile Pro Ser Asp Asn             900 905 910 Leu Ala Ala Gly Thr Asp Asn Thr Ser Ser Leu Gly Pro Pro Ser Met         915 920 925 Pro Val His Tyr Asp Ser Gln Leu Asp Thr Thr Leu Phe Gly Lys Lys     930 935 940 Ser Ser Pro Leu Thr Glu Ser Gly Gly Pro Leu Ser Leu Ser Glu Glu 945 950 955 960 Asn Asn Asp Ser Lys Leu Leu Glu Ser Gly Leu Met Asn Ser Gln Glu                 965 970 975 Ser Ser Trp Gly Lys Asn Val Ser Ser Thr Glu Ser Gly Arg Leu Phe             980 985 990 Lys Gly Lys Arg Ala His Gly Pro Ala Leu Leu Thr Lys Asp Asn Ala         995 1000 1005 Leu Phe Lys Val Ser Ile Ser Leu Leu Lys Thr Asn Lys Thr Ser Asn    1010 1015 1020 Asn Ser Ala Thr Asn Arg Lys Thr His Ile Asp Gly Pro Ser Leu Leu 1025 1030 1035 1040 Ile Glu Asn Ser Pro Ser Val Trp Gln Asn Ile Leu Glu Ser Asp Thr                1045 1050 1055 Glu Phe Lys Lys Val Thr Pro Leu Ile His Asp Arg Met Leu Met Asp            1060 1065 1070 Lys Asn Ala Thr Ala Leu Arg Leu Asn His Met Ser Asn Lys Thr Thr        1075 1080 1085 Ser Ser Lys Asn Met Glu Met Val Gln Gln Lys Lys Glu Gly Pro Ile    1090 1095 1100 Pro Pro Asp Ala Gln Asn Pro Asp Met Ser Phe Phe Lys Met Leu Phe 1105 1110 1115 1120 Leu Pro Glu Ser Ala Arg Trp Ile Gln Arg Thr His Gly Lys Asn Ser                1125 1130 1135 Leu Asn Ser Gly Gln Gly Pro Ser Pro Lys Gln Leu Val Ser Leu Gly            1140 1145 1150 Pro Glu Lys Ser Val Glu Gly Gln Asn Phe Leu Ser Glu Lys Asn Lys        1155 1160 1165 Val Val Val Gly Lys Gly Glu Phe Thr Lys Asp Val Gly Leu Lys Glu    1170 1175 1180 Met Val Phe Pro Ser Ser Arg Asn Leu Phe Leu Thr Asn Leu Asp Asn 1185 1190 1195 1200 Leu His Glu Asn Asn Thr His Asn Gln Glu Lys Lys Ile Gln Glu Glu                1205 1210 1215 Ile Glu Lys Lys Glu Thr Leu Ile Gln Glu Asn Val Val Leu Pro Gln            1220 1225 1230 Ile His Thr Val Thr Gly Thr Lys Asn Phe Met Lys Asn Leu Phe Leu        1235 1240 1245 Leu Ser Thr Arg Gln Asn Val Glu Gly Ser Tyr Asp Gly Ala Tyr Ala    1250 1255 1260 Pro Val Leu Gln Asp Phe Arg Ser Leu Asn Asp Ser Thr Asn Arg Thr 1265 1270 1275 1280 Lys Lys His Thr Ala His Phe Ser Lys Lys Gly Glu Glu Glu Asn Leu                1285 1290 1295 Glu Gly Leu Gly Asn Gln Thr Lys Gln Ile Val Glu Lys Tyr Ala Cys            1300 1305 1310 Thr Thr Arg Ile Ser Pro Asn Thr Ser Gln Gln Asn Phe Val Thr Gln        1315 1320 1325 Arg Ser Lys Arg Ala Leu Lys Gln Phe Arg Leu Pro Leu Glu Glu Thr    1330 1335 1340 Glu Leu Glu Lys Arg Ile Ile Val Asp Asp Thr Ser Thr Gln Trp Ser 1345 1350 1355 1360 Lys Asn Met Lys His Leu Thr Pro Ser Thr Leu Thr Gln Ile Asp Tyr                1365 1370 1375 Asn Glu Lys Glu Lys Gly Ala Ile Thr Gln Ser Pro Leu Ser Asp Cys            1380 1385 1390 Leu Thr Arg Ser His Ser Ile Pro Gln Ala Asn Arg Ser Pro Leu Pro        1395 1400 1405 Ile Ala Lys Val Ser Ser Phe Pro Ser Ile Arg Pro Ile Tyr Leu Thr    1410 1415 1420 Arg Val Leu Phe Gln Asp Asn Ser Ser His Leu Pro Ala Ala Ser Tyr 1425 1430 1435 1440 Arg Lys Lys Asp Ser Gly Val Gln Glu Ser Ser His Phe Leu Gln Gly                1445 1450 1455 Ala Lys Lys Asn Asn Leu Ser Leu Ala Ile Leu Thr Leu Glu Met Thr            1460 1465 1470 Gly Asp Gln Arg Glu Val Gly Ser Leu Gly Thr Ser Ala Thr Asn Ser        1475 1480 1485 Val Thr Tyr Lys Lys Val Glu Asn Thr Val Leu Pro Lys Pro Asp Leu    1490 1495 1500 Pro Lys Thr Ser Gly Lys Val Glu Leu Leu Pro Lys Val His Ile Tyr 1505 1510 1515 1520 Gln Lys Asp Leu Phe Pro Thr Glu Thr Ser Asn Gly Ser Pro Gly His                1525 1530 1535 Leu Asp Leu Val Glu Gly Ser Leu Leu Gln Gly Thr Glu Gly Ala Ile            1540 1545 1550 Lys Trp Asn Glu Ala Asn Arg Pro Gly Lys Val Pro Phe Leu Arg Val        1555 1560 1565 Ala Thr Glu Ser Ser Ala Lys Thr Ser Ser Leys Leu Leu Asp Pro Leu    1570 1575 1580 Ala Trp Asp His Tyr Gly Thr Gln Ile Pro Lys Glu Glu Trp Lys 1585 1590 1595 1600 Ser Gln Glu Lys Ser Pro Glu Lys Thr Ala Phe Lys Lys Lys Asp Thr                1605 1610 1615 Ile Leu Ser Leu Asn Ala Cys Glu Ser Asn His Ala Ile Ala Ala Ile            1620 1625 1630 Asn Glu Gly Gln Asn Lys Pro Glu Ile Glu Val Thr Trp Ala Lys Gln        1635 1640 1645 Gly Arg Thr Glu Arg Leu Cys Ser Gln Asn Pro Pro Val Leu Lys Arg    1650 1655 1660 His Gln Arg Glu Ile Thr Arg Thr Thr Leu Gln Ser Asp Gln Glu Glu 1665 1670 1675 1680 Ile Asp Tyr Asp Asp Thr Ile Ser Val Glu Met Lys Lys Glu Asp Phe                1685 1690 1695 Asp Ile Tyr Asp Glu Asp Glu Asn Gln Ser Pro Arg Ser Phe Gln Lys            1700 1705 1710 Lys Thr Arg His Tyr Phe Ile Ala Ala Val Glu Arg Leu Trp Asp Tyr        1715 1720 1725 Gly Met Ser Ser Ser Pro His Val Leu Arg Asn Arg Ala Gln Ser Gly    1730 1735 1740 Ser Val Pro Gln Phe Lys Lys Val Val Phe Gln Glu Phe Thr Asp Gly 1745 1750 1755 1760 Ser Phe Thr Gln Pro Leu Tyr Arg Gly Glu Leu Asn Glu His Leu Gly                1765 1770 1775 Leu Leu Gly Pro Tyr Ile Arg Ala Glu Val Glu Asp Asn Ile Met Val            1780 1785 1790 Thr Phe Arg Asn Gln Ala Ser Arg Pro Tyr Ser Phe Tyr Ser Ser Leu        1795 1800 1805 Ile Ser Tyr Glu Glu Asp Gln Arg Gln Gly Ala Glu Pro Arg Lys Asn    1810 1815 1820 Phe Val Lys Pro Asn Glu Thr Lys Thr Tyr Phe Trp Lys Val Gln His 1825 1830 1835 1840 His Met Ala Pro Thr Lys Asp Glu Phe Asp Cys Lys Ala Trp Ala Tyr                1845 1850 1855 Phe Ser Asp Val Asp Leu Glu Lys Asp Val His Ser Gly Leu Ile Gly            1860 1865 1870 Pro Leu Leu Val Cys His Thr Asn Thr Leu Asn Pro Ala His Gly Arg        1875 1880 1885 Gln Val Thr Val Gln Glu Phe Ala Leu Phe Phe Thr Ile Phe Asp Glu    1890 1895 1900 Thr Lys Ser Trp Tyr Phe Thr Glu Asn Met Glu Arg Asn Cys Arg Ala 1905 1910 1915 1920 Pro Cys Asn Ile Gln Met Glu Asp Pro Thr Phe Lys Glu Asn Tyr Arg                1925 1930 1935 Phe His Ala Ile Asn Gly Tyr Ile Met Asp Thr Leu Pro Gly Leu Val            1940 1945 1950 Met Ala Gln Asp Gln Arg Ile Arg Trp Tyr Leu Leu Ser Met Gly Ser        1955 1960 1965 Asn Glu Asn Ile His Ser Ile His Phe Ser Gly His Val Phe Thr Val    1970 1975 1980 Arg Lys Lys Glu Glu Tyr Lys Met Ala Leu Tyr Asn Leu Tyr Pro Gly 1985 1990 1995 2000 Val Phe Glu Thr Val Glu Met Leu Pro Ser Lys Ala Gly Ile Trp Arg                2005 2010 2015 Val Glu Cys Leu Ile Gly Glu His Leu His Ala Gly Met Ser Thr Leu            2020 2025 2030 Phe Leu Val Tyr Ser Asn Lys Cys Gln Thr Pro Leu Gly Met Ala Ser        2035 2040 2045 Gly His Ile Arg Asp Phe Gln Ile Thr Ala Ser Gly Gln Tyr Gly Gln    2050 2055 2060 Trp Ala Pro Lys Leu Ala Arg Leu His Tyr Ser Gly Ser Ile Asn Ala 2065 2070 2075 2080 Trp Ser Thr Lys Glu Pro Phe Ser Trp Ile Lys Val Asp Leu Leu Ala                2085 2090 2095 Pro Met Ile Ile His Gly Ile Lys Thr Gln Gly Ala Arg Gln Lys Phe            2100 2105 2110 Ser Ser Leu Tyr Ile Ser Gln Phe Ile Ile Met Tyr Ser Leu Asp Gly        2115 2120 2125 Lys Lys Trp Gln Thr Tyr Arg Gly Asn Ser Thr Gly Thr Leu Met Val    2130 2135 2140 Phe Phe Gly Asn Val Asp Ser Ser Gly Ile Lys His Asn Ile Phe Asn 2145 2150 2155 2160 Pro Pro Ile Ile Ala Arg Tyr Ile Arg Leu His Pro Thr His Tyr Ser                2165 2170 2175 Ile Arg Ser Thr Leu Arg Met Glu Leu Met Gly Cys Asp Leu Asn Ser            2180 2185 2190 Cys Ser Met Pro Leu Gly Met Glu Ser Lys Ala Ile Ser Asp Ala Gln        2195 2200 2205 Ile Thr Ala Ser Ser Tyr Phe Thr Asn Met Phe Ala Thr Trp Ser Pro    2210 2215 2220 Ser Lys Ala Arg Leu His Leu Gln Gly Arg Ser Ser An Ala Trp Arg Pro 2225 2230 2235 2240 Gln Val Asn Asn Pro Lys Glu Trp Leu Gln Val Asp Phe Gln Lys Thr                2245 2250 2255 Met Lys Val Thr Gly Val Thr Thr Gln Gly Val Lys Ser Leu Leu Thr            2260 2265 2270 Ser Met Tyr Val Lys Glu Phe Leu Ile Ser Ser Ser Gln Asp Gly His        2275 2280 2285 Gln Trp Thr Leu Phe Phe Gln Asn Gly Lys Val Lys Val Phe Gln Gly    2290 2295 2300 Asn Gln Asp Ser Phe Thr Pro Val Val Asn Ser Leu Asp Pro Pro Leu 2305 2310 2315 2320 Leu Thr Arg Tyr Leu Arg Ile His Pro Gln Ser Trp Val His Gln Ile                2325 2330 2335 Ala Leu Arg Met Glu Val Leu Gly Cys Glu Ala Gln Asp Leu Tyr            2340 2345 2350 <210> 4 <211> 1000 <212> PRT <213> Homo sapiens <400> 4 Met Ser Gly Pro Gly Asn Lys Arg Ala Ala Gly Asp Gly Gly Ser Gly   1 5 10 15 Pro Pro Glu Lys Lys Leu Ser Arg Glu Glu Lys Thr Thr Thr Thr Leu              20 25 30 Ile Glu Pro Ile Arg Leu Gly Gly Ile Ser Ser Thr Glu Glu Met Asp          35 40 45 Leu Lys Val Leu Gln Phe Lys Asn Lys Lys Leu Ala Glu Arg Leu Glu      50 55 60 Gln Arg Gln Ala Cys Glu Asp Glu Leu Arg Glu Arg Ile Glu Lys Leu  65 70 75 80 Glu Lys Arg Gln Ala Thr Asp Asp Ala Thr Leu Leu Ile Val Asn Arg                  85 90 95 Tyr Trp Ala Gln Leu Asp Glu Thr Val Glu Ala Leu Leu Arg Cys His             100 105 110 Glu Ser Gln Gly Glu Leu Ser Ser Ala Pro Glu Ala Pro Gly Thr Gln         115 120 125 Glu Gly Pro Thr Cys Asp Gly Thr Pro Leu Pro Glu Pro Gly Thr Ser     130 135 140 Glu Leu Arg Asp Pro Leu Leu Met Gln Leu Arg Pro Pro Leu Ser Glu 145 150 155 160 Pro Ala Leu Ala Phe Val Ala Leu Gly Ala Ser Ser Ser Glu Glu                 165 170 175 Val Glu Leu Glu Leu Gln Gly Arg Met Glu Phe Ser Lys Ala Ala Val             180 185 190 Ser Arg Val Val Glu Ala Ser Asp Arg Leu Gln Arg Arg Val Glu Glu         195 200 205 Leu Cys Gln Arg Val Tyr Ser Arg Gly Asp Ser Glu Pro Leu Ser Glu     210 215 220 Ala Ala Gln Ala His Thr Arg Glu Leu Gly Arg Glu Asn Arg Arg Leu 225 230 235 240 Gln Asp Leu Ala Thr Gln Leu Gln Glu Lys His His Arg Ile Ser Leu                 245 250 255 Glu Tyr Ser Glu Leu Gln Asp Lys Val Thr Ser Ala Glu Thr Lys Val             260 265 270 Leu Glu Met Glu Thr Thr Val Glu Asp Leu Gln Trp Asp Ile Glu Lys         275 280 285 Leu Arg Lys Arg Glu Gln Lys Leu Asn Lys His Leu Ala Glu Ala Leu     290 295 300 Glu Gln Leu Asn Ser Gly Tyr Tyr Val Ser Gly Ser Ser Ser Gly Phe 305 310 315 320 Gln Gly Gly Gln Ile Thr Leu Ser Met Gln Lys Phe Glu Met Leu Asn                 325 330 335 Ala Glu Leu Glu Glu Asn Glu Glu Leu Ala Asn Ser Arg Ala Glu             340 345 350 Leu Glu Lys Leu Gln Ala Glu Leu Gln Gly Ala Val Arg Thr Asn Glu         355 360 365 Arg Leu Lys Val Ala Leu Arg Ser Leu Pro Glu Glu Val Val Arg Glu     370 375 380 Thr Gly Glu Tyr Arg Met Leu Gln Ala Gln Phe Ser Leu Leu Tyr Asn 385 390 395 400 Glu Ser Leu Gln Val Lys Thr Gln Leu Asp Glu Ala Arg Gly Leu Leu                 405 410 415 Leu Ala Thr Lys Asn Ser His Leu Arg His Ile Glu His Met Glu Ser             420 425 430 Asp Glu Leu Gly Leu Gln Lys Lys Leu Arg Thr Glu Val Ile Gln Leu         435 440 445 Glu Asp Thr Leu Ala Gln Val Arg Lys Glu Tyr Glu Met Leu Arg Ile     450 455 460 Glu Phe Glu Gln Asn Leu Ala Ala Asn Glu Gln Ala Gly Pro Ile Asn 465 470 475 480 Arg Glu Met Arg His Leu Ile Ser Ser Leu Gln Asn His Asn His Gln                 485 490 495 Leu Lys Gly Asp Ala Gln Arg Tyr Lys Arg Lys Leu Arg Glu Val Gln             500 505 510 Ala Glu Ile Gly Lys Leu Arg Ala Gln Ala Ser Gly Ser Ala His Ser         515 520 525 Thr Pro Asn Leu Gly His Pro Glu Asp Ser Gly Val Ser Ala Pro Ala     530 535 540 Pro Gly Lys Glu Glu Gly Gly Pro Gly Pro Val Ser Thr Pro Asp Asn 545 550 555 560 Arg Lys Glu Met Ala Pro Val Gly Thr Thr Thr Thr Thr Thr Ser                 565 570 575 Val Lys Lys Glu Glu Leu Val Pro Ser Glu Glu Asp Phe Gln Gly Ile             580 585 590 Thr Pro Gly Ala Gln Gly Pro Ser Ser Arg Gly Arg Glu Pro Glu Ala         595 600 605 Arg Pro Lys Arg Glu Leu Arg Glu Arg Glu Gly Pro Ser Leu Gly Pro     610 615 620 Pro Pro Val Ala Ser Ala Leu Ser Arg Ala Asp Arg Glu Lys Ala Lys 625 630 635 640 Val Glu Glu Thr Lys Arg Lys Glu Ser Glu Leu Leu Lys Gly Leu Arg                 645 650 655 Ala Glu Leu Lys Lys Ala Gln Glu Ser Gln Lys Glu Met Lys Leu Leu             660 665 670 Leu Asp Met Tyr Lys Ser Ala Pro Lys Glu Gln Arg Asp Lys Val Gln         675 680 685 Leu Met Ala Ala Glu Arg Lys Ala Lys Ala Glu Val Asp Glu Leu Arg     690 695 700 Ser Arg Ile Arg Glu Leu Glu Glu Arg Asp Arg Arg Glu Ser Lys Lys 705 710 715 720 Ile Ala Asp Glu Asp Ala Leu Arg Arg Ile Arg Gln Ala Glu Glu Gln                 725 730 735 Ile Glu His Leu Gln Arg Lys Leu Gly Ala Thr Lys Gln Glu Glu Glu             740 745 750 Ala Leu Leu Ser Glu Met Asp Val Thr Gly Gln Ala Phe Glu Asp Met         755 760 765 Gln Glu Gln Asn Gly Arg Leu Leu Gln Gln Leu Arg Glu Lys Asp Asp     770 775 780 Ala Asn Phe Lys Leu Met Ser Glu Arg Ile Lys Ala Asn Gln Ile His 785 790 795 800 Lys Leu Leu Arg Glu Glu Lys Asp Glu Leu Gly Glu Gln Val Leu Gly                 805 810 815 Leu Lys Ser Gln Val Asp Gln Leu Leu Thr Val Gln Lys Leu Glu             820 825 830 Glu Lys Glu Arg Ala Leu Gln Gly Ser Leu Gly Gly Val Glu Lys Glu         835 840 845 Leu Thr Leu Arg Ser Gln Ala Leu Glu Leu Asn Lys Arg Lys Ala Val     850 855 860 Glu Ala Ala Gln Leu Ala Glu Asp Leu Lys Val Gln Leu Glu His Val 865 870 875 880 Gln Thr Arg Leu Arg Glu Ile Gln Pro Cys Leu Ala Glu Ser Arg Ala                 885 890 895 Ala Arg Glu Lys Glu Ser Phe Asn Leu Lys Arg Ala Gln Asp Ile Ser             900 905 910 Arg Leu Arg Arg Lys Leu Glu Lys Gln Arg Lys Val Glu Val Tyr Ala         915 920 925 Asp Ala Asp Glu Ile Leu Gln Glu Glu Ile Lys Glu Tyr Lys Ala Arg     930 935 940 Leu Thr Cys Pro Cys Cys Asn Thr Arg Lys Lys Asp Ala Val Leu Thr 945 950 955 960 Lys Cys Phe His Val Phe Cys Phe Glu Cys Val Arg Gly Arg Tyr Glu                 965 970 975 Ala Arg Gln Arg Lys Cys Pro Lys Cys Asn Ala Ala Phe Gly Ala His             980 985 990 Asp Phe His Arg Ile Tyr Ile Ser         995 1000 <210> 5 <211> 1241 <212> PRT <213> Homo sapiens <400> 5 Met Ser Ser Ala Pro Arg Arg Pro Ala Lys Gly Ala Asp Ser Phe Cys   1 5 10 15 Thr Pro Glu Pro Glu Ser Leu Gly Pro Gly Thr Pro Gly Phe Pro Glu              20 25 30 Glu Glu Glu Asp Glu Leu His Arg Thr Leu Gly Val Glu Arg Phe Glu          35 40 45 Glu Ile Leu Gln Glu Ala Gly Ser Arg Gly Gly Glu Glu Pro Gly Arg      50 55 60 Ser Tyr Gly Glu Glu Asp Phe Glu Tyr His Arg Gln Ser Ser His His  65 70 75 80 Ile His His Pro Leu Ser Thr His Leu Pro Pro Asp Ala Arg Arg Arg                  85 90 95 Lys Thr Pro Gln Gly Pro Gly Arg Lys Pro Arg Arg Arg Pro Gly Ala             100 105 110 Ser Pro Thr Gly Glu Thr Pro Thr Ile Glu Glu Gly Glu Glu Asp Glu         115 120 125 Asp Glu Ala Ser Glu Ala Glu Gly Ala Arg Ala Leu Thr Gln Pro Ser     130 135 140 Pro Val Ser Thr Pro Ser Ser Val Gln Phe Leu Glu Glu Asp Asp 145 150 155 160 Ser Ala Asp Arg Lys Ala Glu Arg Thr Ser Pro Ser Ser Pro Ala Pro                 165 170 175 Leu Pro His Gln Glu Ala Thr Pro Arg Ala Ser Lys Gly Ala Gln Ala             180 185 190 Gly Thr Gln Val Glu Glu Glu Ala Glu Ala Glu Ala Val Ala Val Ala Ser         195 200 205 Gly Thr Ala Gly Gly Asp Asp Gly Gly Ala Ser Gly Arg Pro Leu Pro     210 215 220 Lys Ala Gln Pro Gly His Arg Ser Tyr Asn Leu Gln Glu Arg Arg Arg 225 230 235 240 Ile Gly Ser Met Thr Gly Ala Glu Gln Ala Leu Leu Pro Arg Val Pro                 245 250 255 Thr Asp Glu Ile Glu Ala Gln Thr Leu Ala Thr Ala Asp Leu Asp Leu             260 265 270 Met Lys Ser His Arg Phe Glu Asp Val Pro Gly Val Arg Arg His Leu         275 280 285 Val Arg Lys Asn Ala Lys Gly Ser Thr Gln Ser Gly Arg Glu Gly Arg     290 295 300 Glu Pro Gly Pro Thr Pro Arg Ala Arg Pro Arg Ala Pro His Lys Pro 305 310 315 320 His Glu Val Phe Val Glu Leu Asn Glu Leu Leu Leu Asp Lys Asn Gln                 325 330 335 Glu Pro Gln Trp Arg Glu Thr Ala Arg Trp Ile Lys Phe Glu Glu Asp             340 345 350 Val Glu Glu Glu Thr Glu Arg Trp Gly Lys Pro His Val Ala Ser Leu         355 360 365 Ser Phe Arg Ser Leu Leu Glu Leu Arg Arg Thr Leu Ala His Gly Ala     370 375 380 Val Leu Leu Asp Leu Asp Gln Gln Thr Leu Pro Gly Val Ala His Gln 385 390 395 400 Val Val Glu Gln Met Val Ile Ser Asp Gln Ile Lys Ala Glu Asp Arg                 405 410 415 Ala Asn Val Leu Arg Ala Leu Leu Leu Lys His Ser His Pro Ser Asp             420 425 430 Glu Lys Asp Phe Ser Phe Pro Arg Asn Ile Ser Ala Gly Ser Leu Gly         435 440 445 Ser Leu Leu Gly His His His Gly Gln Gly Ala Glu Ser Asp Pro His     450 455 460 Val Thr Glu Pro Leu Met Gly Gly Val Pro Glu Thr Arg Leu Glu Val 465 470 475 480 Glu Arg Glu Arg Glu Leu Pro Pro Ala Pro Pro Ala Gly Ile Thr                 485 490 495 Arg Ser Lys Ser Lys His Glu Leu Lys Leu Leu Glu Lys Ile Pro Glu             500 505 510 Asn Ala Glu Ala Thr Val Val Leu Val Gly Cys Val Glu Phe Leu Ser         515 520 525 Arg Pro Thr Met Ala Phe Val Arg Leu Arg Glu Ala Val Glu Leu Asp     530 535 540 Ala Val Leu Glu Val Le Val Le Val Leu Leu Leu 545 550 555 560 Gly Pro Ser Ser Ala Asn Met Asp Tyr His Glu Ile Gly Arg Ser Ile                 565 570 575 Ser Thr Leu Met Ser Asp Lys Gln Phe His Glu Ala Ala Tyr Leu Ala             580 585 590 Asp Glu Arg Glu Asp Leu Leu Thr Ala Ile Asn Ala Phe Leu Asp Cys         595 600 605 Ser Val Val Leu Pro Pro Ser Glu Val Gln Gly Glu Glu Leu Leu Arg     610 615 620 Ser Val Ala His Phe Gln Arg Gln Met Leu Lys Lys Arg Glu Glu Gln 625 630 635 640 Gly Arg Leu Leu Pro Thr Gly Ala Gly Leu Glu Pro Lys Ser Ala Gln                 645 650 655 Asp Lys Ala Leu Leu Gln Met Val Glu Ala Ala Gly Ala Ala Glu Asp             660 665 670 Asp Pro Leu Arg Arg Thr Gly Arg Pro Phe Gly Gly Leu Ile Arg Asp         675 680 685 Val Arg Arg Arg Tyr Pro His Tyr Leu Ser Asp Phe Arg Asp Ala Leu     690 695 700 Asp Pro Gln Cys Leu Ala Ala Ala Leu 705 710 715 720 Ser Pro Ala Ile Thr Phe Gly Gly Leu Leu Gly Glu Lys Thr Gln Asp                 725 730 735 Leu Ile Gly Val Ser Glu Leu Ile Met Ser Thr Ala Leu Gln Gly Val             740 745 750 Val Phe Cys Leu Leu Gly Ala Gln Pro Leu Leu Val Ile Gly Phe Ser         755 760 765 Gly Pro Leu Leu Val Phe Glu Glu Ala Phe Phe Ser Phe Cys Ser Ser     770 775 780 Asn His Leu Glu Tyr Leu Val Gly Arg Val Trp Ile Gly Phe Trp Leu 785 790 795 800 Val Phe Leu Ala Leu Leu Met Val Ala Leu Glu Gly Ser Phe Leu Val                 805 810 815 Arg Phe Val Ser Arg Phe Thr Gln Glu Ile Phe Ala Phe Leu Ile Ser             820 825 830 Leu Ile Phe Ile Tyr Glu Thr Phe Tyr Lys Leu Val Lys Ile Phe Gln         835 840 845 Glu His Pro Leu His Gly Cys Ser Ala Ser Asn Ser Ser Glu Val Asp     850 855 860 Gly Gly Glu Asn Met Thr Trp Ala Gly Ala Arg Pro Thr Leu Gly Pro 865 870 875 880 Gly Asn Arg Ser Leu Ala Gly Gln Ser Gly Gln Gly Lys Pro Arg Gly                 885 890 895 Gln Pro Asn Thr Ala Leu Leu Ser Leu Val Leu Met Ala Gly Thr Phe             900 905 910 Phe Ile Ala Phe Phe Leu Arg Lys Phe Lys Asn Ser Arg Phe Phe Pro         915 920 925 Gly Arg Ile Arg Arg Val Ile Gly Asp Phe Gly Val Pro Ile Ala Ile     930 935 940 Leu Ile Met Val Leu Val Asp Tyr Ser Ile Glu Asp Thr Tyr Thr Gln 945 950 955 960 Lys Leu Ser Val Pro Ser Gly Phe Ser Val Thr Ala Pro Glu Lys Arg                 965 970 975 Gly Trp Val Ile Asn Pro Leu Gly Glu Lys Ser Pro Phe Pro Val Trp             980 985 990 Met Met Val Ala Le Le Leu Ala Le Le Val Ile Leu Ile         995 1000 1005 Phe Met Glu Thr Gln Ile Thr Thr Leu Ile Ile Ser Lys Lys Glu Arg    1010 1015 1020 Met Leu Gln Lys Gly Ser Gly Phe His Leu Asp Leu Leu Leu Ile Val 1025 1030 1035 1040 Ala Met Gly Gly Ile Cys Ala Leu Phe Gly Leu Pro Trp Leu Ala Ala                1045 1050 1055 Ala Thr Val Arg Ser Val Thr His Ala Asn Ala Leu Thr Val Met Ser            1060 1065 1070 Lys Ala Val Ala Pro Gly Asp Lys Pro Lys Ile Gln Glu Val Lys Glu        1075 1080 1085 Gln Arg Val Thr Gly Leu Leu Val Ala Leu Leu Val Gly Leu Ser Ile    1090 1095 1100 Val Ile Gly Asp Leu Leu Arg Gln Ile Pro Leu Ala Val Leu Phe Gly 1105 1110 1115 1120 Ile Phe Leu Tyr Met Gly Val Thr Ser Leu Asn Gly Ile Gln Phe Tyr                1125 1130 1135 Glu Arg Leu His Leu Leu Leu Met Pro Pro Lys His His Pro Asp Val            1140 1145 1150 Thr Tyr Val Lys Lys Val Arg Thr Leu Arg Met His Leu Phe Thr Ala        1155 1160 1165 Leu Gln Leu Leu Cys Leu Ala Leu Leu Trp Ala Val Met Ser Thr Ala    1170 1175 1180 Ala Ser Leu Ala Phe Pro Phe Ile Leu Ile Leu Thr Val Pro Leu Arg 1185 1190 1195 1200 Met Val Val Leu Thr Arg Ile Phe Thr Asp Arg Glu Met Lys Cys Leu                1205 1210 1215 Asp Ala Asn Glu Ala Glu Pro Val Phe Asp Glu Arg Glu Gly Val Asp            1220 1225 1230 Glu Tyr Asn Glu Met Pro Met Met Pro Val        1235 1240 <210> 6 <211> 1312 <212> PRT <213> Homo sapiens <400> 6 Met Glu Glu Glu Asp Glu Ser Arg Gly Lys Thr Glu Glu Ser Gly Glu   1 5 10 15 Asp Arg Gly Asp Gly Pro Pro Asp Arg Asp Pro Thr Leu Ser Pro Ser              20 25 30 Ala Phe Ile Leu Arg Ala Ile Gln Gln Ala Val Gly Ser Ser Leu Gln          35 40 45 Gly Asp Leu Pro Asn Asp Lys Asp Gly Ser Arg Cys His Gly Leu Arg      50 55 60 Trp Arg Arg Cys Arg Ser Pro Arg Ser Glu Pro Arg Ser Gln Glu Ser  65 70 75 80 Gly Gly Thr Asp Thr Ala Thr Val Leu Asp Met Ala Thr Asp Ser Phe                  85 90 95 Leu Ala Gly Leu Val Ser Val Leu Asp Pro Pro Asp Thr Trp Val Pro             100 105 110 Ser Arg Leu Asp Leu Arg Pro Gly Glu Ser Glu Asp Met Leu Glu Leu         115 120 125 Val Ala Glu Val Arg Ile Gly Asp Arg Asp Pro Ile Pro Leu Pro Val     130 135 140 Pro Ser Leu Leu Pro Arg Leu Arg Ala Trp Arg Thr Gly Lys Thr Val 145 150 155 160 Ser Pro Gln Ser Asn Ser Ser Arg Pro Thr Cys Ala Arg His Leu Thr                 165 170 175 Leu Gly Thr Gly Asp Gly Gly Pro Ala Pro Pro Ala Pro Ser Ser             180 185 190 Ala Ser Ser Ser Ser Pro Ser Ser Ser Ser Ser Ser Ser Pro         195 200 205 Pro Pro Pro Pro Pro Pro Ala Pro Pro Ala Pro Pro Ala Pro Arg     210 215 220 Phe Asp Ile Tyr Asp Pro Phe His Pro Thr Asp Glu Ala Tyr Ser Pro 225 230 235 240 Pro Pro Ala Pro Glu Gln Lys Tyr Asp Pro Phe Glu Pro Thr Gly Ser                 245 250 255 Asn Pro Ser Ser Ala Gly Thr Pro Ser Pro Glu Glu Glu Glu Glu             260 265 270 Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Asp Glu Glu Glu Glu Glu         275 280 285 Gly Leu Ser Gln Ser Ile Ser Arg Ile Ser Glu Thr Leu Ala Gly Ile     290 295 300 Tyr Asp Asp Asn Ser Leu Ser Gln Asp Phe Pro Gly Asp Glu Ser Pro 305 310 315 320 Arg Pro Asp Ala Gln Pro Thr Gln Pro Thr Pro Ala Pro Gly Thr Pro                 325 330 335 Pro Gln Val Asp Ser Thr Arg Ala Asp Gly Ala Met Arg Arg Arg Val             340 345 350 Phe Val Val Gly Thr Glu Ala Glu Ala Cys Arg Glu Gly Lys Val Ser         355 360 365 Val Glu Val Val Thr Ala Gly Gly Ala Ala Leu Pro Pro Pro Leu Leu     370 375 380 Pro Pro Gly Asp Ser Glu Ile Glu Glu Gly Glu Ile Val Gln Pro Glu 385 390 395 400 Glu Glu Pro Arg Leu Ala Leu Ser Leu Phe Arg Pro Gly Gly Arg Ala                 405 410 415 Ala Arg Pro Thr Pro Ala Ala Ser Ala Thr Pro Thr Ala Gln Pro Leu             420 425 430 Pro Gln Pro Pro Ala Pro Arg Ala Pro Glu Gly Asp Asp Phe Leu Ser         435 440 445 Leu His Ala Glu Ser Asp Gly Glu Gly Ala Leu Gln Val Asp Leu Gly     450 455 460 Glu Pro Ala Pro Ala Pro Pro Ala Ala Asp Ser Arg Trp Gly Gly Leu 465 470 475 480 Asp Leu Arg Arg Lys Ile Leu Thr Gln Arg Arg Glu Arg Tyr Arg Gln                 485 490 495 Arg Ser Pro Ser Pro Ala Pro Ala Pro Ala Pro Ala Ala Ala Gly             500 505 510 Pro Pro Thr Arg Lys Lys Ser Arg Arg Glu Arg Lys Arg Ser Gly Glu         515 520 525 Ala Lys Glu Ala Ala Ser Ser Ser Gly Thr Gln Pro Ala Pro Pro     530 535 540 Ala Pro Ala Ser Pro Trp Asp Ser Lys Lys His Arg Ser Ser Arg Asp Arg 545 550 555 560 Lys Pro Gly Ser His Ala Ser Ser Ala Arg Arg Arg Ser Ser Arg                 565 570 575 Arg Ser Arg Ser Ser Thr Arg Arg Arg Ser Ser Arg Thr Asp Arg             580 585 590 Arg Arg Gly Gly Ser Arg Arg Ser Ser Arg Ser Glu Lys Arg Arg Arg         595 600 605 Arg Arg Arg Ser Ala Ser Pro Pro Ala Thr Ser Ser Ser Ser     610 615 620 Ser Arg Arg Gly Arg His Arg Gly Lys His Arg Asp Gly Gly Gly Ser 625 630 635 640 Lys Lys Lys Lys Lys Arg Ser Ser Arg Gly Glu Lys Arg Ser Gly                 645 650 655 Asp Gly Ser Glu Lys Ala Pro Ala Pro Ala Pro Pro Pro Ser Gly Ser             660 665 670 Thr Ser Cys Gly Asp Arg Asp Ser Arg Arg Gly Ala Val Pro Pro         675 680 685 Ser Ile Gln Asp Leu Thr Asp His Asp Leu Phe Ala Ile Lys Arg Thr     690 695 700 Ile Thr Val Gly Arg Leu Asp Lys Ser Asp Pro Arg Gly Pro Ser Pro 705 710 715 720 Ala Pro Ala Ser Ser Pro Lys Arg Glu Val Leu Tyr Asp Ser Glu Gly                 725 730 735 Leu Ser Gly Glu Glu Arg Gly Gly Lys Ser Ser Gln Lys Asp Arg Arg             740 745 750 Arg Ser Gly Ala Ser Ser Ser Ser Ser Ser Ser Glu Lys Gly Ser         755 760 765 Arg Arg Lys Ala Leu Asp Gly Gly Asp Arg Asp Arg Asp Arg Asp Arg     770 775 780 Asp Arg Asp Arg Asp Arg Ser Ser Lys Lys Ala Arg Pro Pro Lys Glu 785 790 795 800 Ser Ala Pro Ser Ser Gly Pro Pro Lys Pro Ser Val Ser Ser Gly                 805 810 815 Ser Gly Ser Ser Ser Ser Ser Ser Cys Ser Ser Arg Lys Val Lys             820 825 830 Leu Gln Ser Lys Val Ala Val Leu Ile Arg Glu Gly Val Ser Ser Thr         835 840 845 Thr Pro Ala Lys Asp Ala Ala Ser Ala Gly Leu Gly Ser Ile Gly Val     850 855 860 Lys Phe Ser Arg Asp Arg Glu Ser Arg Ser Pro Phe Leu Lys Pro Asp 865 870 875 880 Glu Arg Ala Pro Thr Glu Met Ala Lys Ala Ala Pro Gly Ser Thr Lys                 885 890 895 Pro Lys Lys Thr Lys Val Lys Ala Lys Ala Gly Ala Lys Lys Thr Lys             900 905 910 Gly Thr Lys Gly Lys Thr Lys Pro Ser Lys Thr Arg Lys Lys Val Arg         915 920 925 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Gln Val Ser Leu Lys Lys     930 935 940 Ser Lys Ala Asp Ser Cys Ser Gln Ala Ala Gly Thr Lys Gly Ala Glu 945 950 955 960 Glu Thr Ser Trp Ser Gly Glu Glu Arg Ala Ala Lys Val Pro Ser Thr                 965 970 975 Pro Pro Pro Lys Pro Pro Pro Pro Ala Leu Thr Pro Asp Ser             980 985 990 Gln Thr Val Asp Ser Ser Cys Lys Thr Pro Glu Val Ser Phe Leu Pro         995 1000 1005 Glu Glu Ala Thr Glu Glu Ala Gly Val Gly Gly Gly Ala Glu Glu Glu    1010 1015 1020 Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Gln 1025 1030 1035 1040 Gln Pro Ala Thr Thr Thr Ala Thr Ser Thr Ala Ala Ala Ala Pro Ser                1045 1050 1055 Thr Ala Pro Ser Ala Gly Ser Thr Ala Gly Asp Ser Gly Ala Glu Asp            1060 1065 1070 Gly Pro Ala Ser Arg Val Ser Gln Leu Pro Thr Leu Pro Pro Pro Met        1075 1080 1085 Pro Trp Asn Leu Pro Ala Gly Val Asp Cys Thr Thr Ser Gly Val Leu    1090 1095 1100 Ala Leu Thr Ala Leu Leu Phe Lys Met Glu Glu Ala Asn Leu Ala Ser 1105 1110 1115 1120 Arg Ala Lys Ala Gln Glu Leu Ile Gln Ala Thr Asn Gln Ile Leu Ser                1125 1130 1135 His Arg Lys Pro Pro Ser Ser Leu Gly Met Thr Pro Ala Pro Val Pro            1140 1145 1150 Thr Ser Leu Gly Leu Pro Pro Gly Pro Ser Ser Tyr Leu Leu Pro Gly        1155 1160 1165 Ser Leu Pro Leu Gly Gly Cys Gly Ser Thr Pro Pro Thr Pro Thr Gly    1170 1175 1180 Leu Ala Ala Thr Ser Asp Lys Arg Glu Gly Ser Ser Ser Ser Glu Gly 1185 1190 1195 1200 Arg Gly Asp Thr Asp Lys Tyr Leu Lys Lys Leu His Thr Gln Glu Arg                1205 1210 1215 Ala Val Glu Glu Val Lys Leu Ala Ile Lys Pro Tyr Tyr Gln Lys Lys            1220 1225 1230 Asp Ile Thr Lys Glu Glu Tyr Lys Asp Ile Leu Arg Lys Ala Val His        1235 1240 1245 Lys Ile Cys His Ser Lys Ser Gly Glu Ile Asn Pro Val Lys Val Ser    1250 1255 1260 Asn Leu Val Arg Ala Tyr Val Gln Arg Tyr Arg Tyr Phe Arg Lys His 1265 1270 1275 1280 Gly Arg Lys Pro Gly Asp Pro Pro Gly Pro Pro Arg Pro Pro Lys Glu                1285 1290 1295 Pro Gly Pro Pro Asp Lys Gly Gly Pro Gly Leu Pro Leu Pro Pro Leu            1300 1305 1310 <210> 7 <211> 440 <212> PRT <213> Homo sapiens <400> 7 Met Arg Arg Tyr Leu Arg Val Val Val Leu Cys Val Ala Cys Gly Phe   1 5 10 15 Cys Ser Leu Leu Tyr Ala Phe Ser Gln Leu Ala Val Ser Leu Glu Glu              20 25 30 Gly Thr Gly Gly Gly Gly Gly Lys Pro Gln Ala Ala Val Ala Ser Trp          35 40 45 Leu Ala Gly Gly Aly Gly Aly Gly Aly Val Aly Gly Aly Gly Aly Gly Aly Gly      50 55 60 Pro Ala Ala His Pro Gly Val Ser Asp Arg Cys Lys Asp Phe Ser Leu  65 70 75 80 Cys Tyr Trp Asn Pro Tyr Trp Met Leu Pro Ser Asp Val Cys Gly Met                  85 90 95 Asn Cys Phe Trp Glu Ala Ala Phe Arg Tyr Ser Leu Lys Ile Gln Pro             100 105 110 Val Glu Lys Met His Leu Ala Val Val Ala Cys Gly Glu Arg Leu Glu         115 120 125 Glu Thr Met Thr Met Leu Lys Ser Ala Ile Ile Phe Ser Ile Lys Pro     130 135 140 Leu Gln Phe His Ile Phe Ala Glu Asp Gln Leu His His Ser Phe Lys 145 150 155 160 Gly Arg Leu Asp Asn Trp Ser Phe Leu Gln Thr Phe Asn Tyr Thr Leu                 165 170 175 Tyr Pro Ile Thr Phe Pro Ser Glu Asn Ala Ala Glu Trp Lys Lys Leu             180 185 190 Phe Lys Pro Cys Ala Ser Gln Arg Leu Phe Leu Pro Leu Ile Leu Lys         195 200 205 Glu Val Asp Ser Leu Leu Tyr Val Asp Thr Asp Ile Leu Phe Leu Arg     210 215 220 Pro Val Asp Ile Trp Ser Leu Leu Lys Lys Phe Asn Ser Thr Gln 225 230 235 240 Ile Ala Met Ala Pro Glu His Glu Glu Pro Arg Ile Gly Trp Tyr                 245 250 255 Asn Arg Phe Ala Arg His Pro Tyr Tyr Gly Lys Thr Gly Val Asn Ser             260 265 270 Gly Val Met Leu Met Asn Met Thr Arg Met Arg Arg Lys Tyr Phe Lys         275 280 285 Asn Asp Met Thr Thr Val Arg Leu Gln Trp Gly Asp Ile Leu Met Pro     290 295 300 Leu Leu Lys Lys Tyr Lys Leu Asn Ile Thr Trp Gly Asp Gln Asp Leu 305 310 315 320 Leu Asn Ile Val Phe Phe His Asn Pro Glu Ser Leu Phe Val Phe Pro                 325 330 335 Cys Gln Trp Asn Tyr Arg Pro Asp His Cys Ile Tyr Gly Ser Asn Cys             340 345 350 Gln Glu Ala Glu Glu Gly Gly Ile Phe Ile Leu His Gly Asn Arg Gly         355 360 365 Val Tyr His Asp Asp Lys Gln Pro Ala Phe Arg Ala Val Tyr Glu Ala     370 375 380 Leu Arg Asn Cys Ser Phe Glu Asp Asp Asn Ile Arg Ser Leu Leu Lys 385 390 395 400 Pro Leu Glu Leu Glu Leu Gln Lys Thr Val His Thr Tyr Cys Gly Lys                 405 410 415 Ile Tyr Lys Ile Phe Ile Lys Gln Leu Ala Lys Ser Val Arg Asp Arg             420 425 430 Tyr Ala Arg Ser Pro Lys Glu Lys         435 440 <210> 8 <211> 2601 <212> PRT <213> Homo sapiens <400> 8 Met Lys Arg Lys Val Val Asn Thr His Lys Leu Arg Leu Ser Pro Asn   1 5 10 15 Glu Glu Ala Phe Ile Leu Lys Glu Asp Tyr Glu Arg Arg Arg Lys Leu              20 25 30 Arg Leu Leu Gln Val Arg Glu Glu Glu Arg Asp Ile Ala Leu Gln Ile          35 40 45 Arg Glu Asp Ile Lys Gln Arg Arg Asn Gln Gln Phe Thr Arg Leu Ala      50 55 60 Glu Glu Leu Arg Ala Glu Trp Glu Glu Ser Gln Thr Gln Lys Ile Gln  65 70 75 80 Asn Leu Glu Lys Leu Tyr Leu Ala Ser Leu Arg Ser Met Gly Glu Gly                  85 90 95 His Arg Gln Ala Lys Glu Asn Glu Pro Asp Leu Asp Ala Leu Ala Gln             100 105 110 Arg Ala Ala Glu Arg Lys Arg Lys Ala Asp Leu Arg His Lys Glu Ala         115 120 125 Leu Lys Val Gln Lys Asn Gln Lys Glu Ile Leu Leu Lys Gln Lys Thr     130 135 140 Trp His Ile Lys Ala Arg Lys Glu Ala Leu Leu Val Glu Lys Glu Arg 145 150 155 160 Ser Ala Lys Ile Thr Ser Leu Pro Pro Pro Pro Thr Leu Phe Glu                 165 170 175 Asn Ile Glu Val Lys Arg Ile Ser Ala Val Lys Thr Asn Ser Ser Thr             180 185 190 Tyr His His Leu His Thr Phe Val Asn Arg Glu Thr Asp Thr Lys Arg         195 200 205 Pro Asp Ala Arg Leu Ala Glu Glu Glu Glu Ala Lys Arg Leu Glu Glu     210 215 220 Leu Gln Lys Gln Ala Ala Gln Glu Arg Met Glu Arg Phe Glu Lys Ala 225 230 235 240 His Val Arg Gly Phe Gln Ala Met Lys Lys Ile His Leu Ala Gln Asn                 245 250 255 Gln Glu Lys Leu Met Lys Glu Leu Lys Gln Leu Gln Gln Glu Asp Leu             260 265 270 Ala Arg Arg Arg Gln Thr Val Ala Gln Met Pro Pro Gln Leu Val Glu         275 280 285 Leu Pro Tyr Lys Arg Ser Glu Met Lys Glu Asp Trp Gln Arg Glu Leu     290 295 300 Glu Phe Ala Phe Glu Asp Met Tyr Asn Ala Asp Arg Lys Val Lys Gly 305 310 315 320 Asn Leu Ile Leu His Leu Glu Pro Glu Pro Leu Pro Thr Val Thr Asn                 325 330 335 Glu Ile Gln Asp Glu Glu Leu Asp Leu Ser Met Glu Gln Glu Asn Leu             340 345 350 Gly Ala Ala Glu Asp Leu Pro Val Thr Glu Ala Glu Ile Cys Ser Ser         355 360 365 Glu Thr Asp Val Pro Leu Val Met Lys Thr Gln Gln Ile Pro Ser Lys     370 375 380 Val Leu Phe Lys Lys Leu Leu Asn Lys Ile Arg Ser Gln Lys Ser Leu 385 390 395 400 Trp Thr Ile Lys Ser Met Ser Glu Asp Glu Ser Glu Met Ile Thr Thr                 405 410 415 Val Ser Glu Ile Glu Ser Lys Ala Pro Thr Val Glu Ser Gly Thr Ile             420 425 430 Ala Ser Lys Glu Arg Thr Leu Ser Ser Gly Gln Glu Gln Val Val Glu         435 440 445 Ser Asp Thr Leu Thr Ile Glu Ser Gly Pro Leu Ala Ser Glu Asp Lys     450 455 460 Pro Leu Ser Cys Gly Thr Asn Ser Gly Lys Glu Gln Glu Ile Asn Glu 465 470 475 480 Thr Leu Pro Ile Thr Thr Val Ala Gln Ser Ser Val Leu Leu His Pro                 485 490 495 Gln Glu Ala Ala Ala Arg Ile Arg Met Ser Ala Arg Gln Lys Gln Ile             500 505 510 Met Glu Ile Glu Glu Gln Lys Gln Lys Gln Leu Glu Leu Leu Glu Gln         515 520 525 Ile Glu Gln Gln Lys Leu Arg Leu Glu Thr Asp Cys Phe Arg Ala Gln     530 535 540 Leu Glu Glu Glu Lys Arg Lys Lys Thr Gln Pro Thr Gly Val Gly Ile 545 550 555 560 Ala Pro Ala Ser Cys Pro Val Ile Ser Asp Glu Asp Ser His Arg Gln                 565 570 575 Met Ile Arg Asn Tyr Gln His Gln Leu Leu Gln Gln Asn Arg Leu His             580 585 590 Arg Gln Ser Val Glu Thr Ala Arg Lys Gln Leu Leu Glu Tyr Gln Thr         595 600 605 Met Leu Lys Gly Arg Cys Pro Ser Val Ser Ala Pro Ser Leu Ile Thr     610 615 620 Asp Ser Val Ile Ser Val Pro Ser Trp Lys Ser Glu Arg Pro Thr Ala 625 630 635 640 Ile Ser Glu His Trp Asp Gln Gly Gln Arg Leu Lys Leu Ser Pro Asn                 645 650 655 Lys Tyr Gln Pro Ile Gln Pro Ile Gln Thr Ser Lys Leu Glu Gln Asp             660 665 670 His Phe Gln Val Ala Arg Gln Asn His Phe Pro Gln Arg Gln Val Glu         675 680 685 Thr Thr Glu Thr Leu Arg Ala Ser Asp Ile Leu Thr Asn Gln Ala Leu     690 695 700 Glu Ser Gln Glu His Leu Arg Gln Phe Ser Gln Thr Glu Thr Gln Gln 705 710 715 720 Arg Asp Tyr Lys Leu Val Pro Lys Asp Ser Glu Thr Leu Ser Arg Ala                 725 730 735 Leu Ser His Asp Arg Gln Leu Ile Ser Gln Asp Ala Arg Lys Ile Ser             740 745 750 Glu Thr Phe Gly Ala Thr Thr Phe Gln Ser Leu Glu Ser Gln Gln Leu         755 760 765 Phe Ser Glu Asn Ser Glu Asn Ile Ser Tyr His Leu Thr Glu Pro Ser     770 775 780 Ser Phe Val Pro Leu Val Pro Gln His Ser Phe Ser Ser Leu Pro Val 785 790 795 800 Lys Val Glu Ser Gly Lys Ile Gln Glu Pro Phe Ser Ala Met Ser Lys                 805 810 815 Ser Thr Ser Ser Thr Ser His Ser Ile Ser Ser Gln Met His Asp Arg             820 825 830 Pro Leu Leu Pro Ser Glu Asn Ile Thr Ala Gln Gln Gly Asn Met Lys         835 840 845 Ala Leu Gln Glu Gln Leu Asp Leu Gln Lys Lys Val Leu Gln Ala Thr     850 855 860 Gln Glu Ala Gln Glu Gln Leu Leu Leu Cys Lys Gln Lys Glu Val Glu 865 870 875 880 Gln Gln Thr Gly Leu Ser Val Phe Leu Pro Leu Val Thr Pro Asp Ser                 885 890 895 Ser Ala Leu Pro Ser Ala Lys Ala Asp Leu Gly Arg Ile Gln Glu             900 905 910 Ser Ser Pro Thr Lys Asn Asn Ile Ala Val Ser Ser Asp His His Val         915 920 925 Ile Ser Gln Leu Gln Asp Lys Arg Leu Ser Leu Ser Gln Pro Ile Leu     930 935 940 Ser Gln Gln Asn Asn Phe Lys Phe Leu Gln Glu Gln Leu Asn Ile Gln 945 950 955 960 Lys Asp Ser Leu Gln Ala Arg Arg Glu Ala Gln Glu Val Leu Tyr Val                 965 970 975 His Lys Gln Ser Glu Leu Asp Arg Arg Val Cys Ser Glu Gln Ala Glu             980 985 990 Pro Ser Phe Pro Phe Gln Val Ala Gln His Thr Phe Thr Ser Leu Pro         995 1000 1005 Ser Ala Asp Thr Lys Ser Gly Lys Ile Gln Glu Gln His Ser Ser Lys    1010 1015 1020 Ser Glu Lys Gly Leu Val Ser Cys Gln Ser Asp Ile Pro Ile Ser Gln 1025 1030 1035 1040 Asp Gly Ser Leu Ser Phe Leu Gln Gln Phe Leu Pro Leu His Asp Ser                1045 1050 1055 Leu Lys Leu Leu Gln Glu Gln Leu Thr Lys Gln Arg Asp Thr Leu Gln            1060 1065 1070 Ala Arg His Glu Ala Gln Val Glu Leu Leu Leu His Arg Gln Arg Asp        1075 1080 1085 Leu Gly Asp Ser Lys Ser Gly Leu Val Ser Ser Ser Ser Ser Pro Val    1090 1095 1100 Val Val Gln His Ser Val Ala Ser Gln Ala Ser Ala Lys Ala Glu Pro 1105 1110 1115 1120 Arg Arg Ile Gln Glu Leu Tyr Leu Ser Glu Lys Glu Asn Val Gly Pro                1125 1130 1135 Ser Cys His Leu Ile Ile Pro Thr Phe Gln Asp Lys Ser Leu Ser Phe            1140 1145 1150 Pro Gln His Ser Leu Ala Gln Gln Glu Asn Leu Thr Ile Leu Gln Glu        1155 1160 1165 Gln Ser Gln Ile Gln Arg Val Ile Leu Gly Ala Lys Glu Gly Thr Gln    1170 1175 1180 Glu Phe Val His Thr Glu Ser Glu Leu Glu Lys Arg Ile Ser Ser Glu 1185 1190 1195 1200 Gln Thr Gly Thr Ser Ser Ser Ser Ser Ser Gln Val Asp Ser Ser Glu Arg                1205 1210 1215 Phe Gln Glu Cys Ile Ser Ile Lys Ser Asp Ser Thr Ile Pro Leu Ser            1220 1225 1230 His Pro Lys Ile Pro Arg Cys Gln Glu Arg Leu Leu Arg Val Ser Gln        1235 1240 1245 His Met Leu Pro Leu Gln Asp Asn Leu Glu Glu His Gln Ala Trp Leu    1250 1255 1260 Asp Thr Glu Lys Glu Ala Phe His Phe Ser Gln Lys Thr Gln Glu Asn 1265 1270 1275 1280 Thr Ser Ser Glu Gln Thr Gly Ser Ser Ser Phe Ile Pro Gln Leu Val                1285 1290 1295 Gln Leu Ser Phe Thr Ser Leu Ala Ser Ala Glu Ser Gly Thr Ile Leu            1300 1305 1310 Glu Pro Leu Phe Thr Glu Ser Glu Ser Lys Ile Phe Ser Ser His Leu        1315 1320 1325 Gln Ile Pro Gln Leu Gln Asp Arg Leu Leu Arg Ile Ser Gln Leu Ile    1330 1335 1340 Gln Pro Gln Gln Asp Asn Leu Lys Ala Leu Gln Glu Gln Leu Ala Thr 1345 1350 1355 1360 Gln Arg Glu Ala Ile Ile Leu Ala Arg Gln Glu Ala Arg Glu Glu Leu                1365 1370 1375 Leu Leu His Gln Ser Glu Trp Glu Gly Arg Ile Ser Pro Glu Gln Val            1380 1385 1390 Asp Thr Ser Leu Pro Leu Val Pro Gln His Ser Phe Ala Ser Leu        1395 1400 1405 Pro Leu Asn Glu Ser Glu Arg Asn Gln Glu Pro Cys Ser Ile Asn Ser    1410 1415 1420 Asp Asn Ile Val Ser Ser Gly His Ser Glu Ile Pro Thr Leu Pro Asp 1425 1430 1435 1440 Gly Leu Leu Gly Leu Ser His Leu Val Leu Pro Gln Gln Asp Asn Leu                1445 1450 1455 Ile Ala Leu Glu Glu His Leu His Ala Gln Thr Asp Phe Leu Pro Ser            1460 1465 1470 Ile Glu Lys Thr Gln Lys Glu Leu Val Leu Ser Lys Pro Cys Lys Phe        1475 1480 1485 Glu Glu Lys Val Ser Ser Glu His Phe Ile Gln Ser His His Gly Asp    1490 1495 1500 Leu Gln Ala Leu Gln Gln Gln Leu Asp Thr Gln Lys Lys Ala Ile Arg 1505 1510 1515 1520 Ser Ile Gln Glu Val Gln Glu Glu Leu Leu Leu Gln Arg Leu Ser Glu                1525 1530 1535 Leu Glu Lys Arg Val Ser Ser Glu Gln Val Cys Ser Ser Ser Phe Val            1540 1545 1550 Ser Gln Val Pro Val Ala Asp Ser Glu Arg Thr Gln Lys Ser Phe Pro        1555 1560 1565 Thr Lys Ser Asn Asp Thr Leu Pro Ser Ser His Arg Glu Ile Pro Arg    1570 1575 1580 Leu Gln Asp Arg Leu Leu Ser Leu Ser Lys Pro Ile Leu Pro Gln Gln 1585 1590 1595 1600 Asp Asn Met Thr Ala Gln Leu Asp Ala Gln Arg Glu Val Met Tyr Ser                1605 1610 1615 Tyr Glu Lys Pro Gln Glu Glu Leu Ser Leu Asn Lys Gln Arg Lys Leu            1620 1625 1630 Asn Lys Ser Glu Ser Ala Glu His Thr Ile Pro Ser Leu Phe Leu Pro        1635 1640 1645 Lys Glu Thr Glu His Ser Phe Ile Pro Leu Pro Phe Ala Glu Ala Lys    1650 1655 1660 Pro Lys Ser Thr Cys Glu Leu Tyr Ser Ser Gln Asn Glu His Ala Ala 1665 1670 1675 1680 Pro Pro Ser Asn Pro Val Ile Pro Gly Phe Gln Asp Arg Leu Leu Ser                1685 1690 1695 Phe Ser Gln Ser Val Leu Thr Gln Gln Asp Asn Leu Gly Leu Gln Lys            1700 1705 1710 Gln Leu Asp Leu Gln Arg Glu Val Leu His Tyr Ser Gln Lys Ala Gln        1715 1720 1725 Glu Lys Leu Leu Val Gln Arg Gln Thr Ala Leu Gln Gln Gln Ile Gln    1730 1735 1740 Lys His Glu Glu Thr Leu Lys Asp Phe Phe Lys Asp Ser Gln Ile Ser 1745 1750 1755 1760 Lys Pro Thr Val Glu Asn Asp Leu Lys Thr Gln Lys Met Gly Gln Leu                1765 1770 1775 Arg Asp Trp Phe Pro Asn Thr Gln Asp Leu Ala Gly Asn Asp Gln Glu            1780 1785 1790 Asn Ile Arg His Ala Asp Arg Asn Asn Ser Asp Asp Asn His Leu Ala        1795 1800 1805 Ser Glu Asp Thr Ser Ala Lys Gln Ser Gly Glu His Leu Glu Lys Asp    1810 1815 1820 Leu Gly Arg Arg Ser Ser Lys Pro Pro Val Ala Lys Val Lys Cys Gly 1825 1830 1835 1840 Leu Asp Leu Asn Gln His Glu Leu Ser Ala Ile Gln Glu Val Glu Ser                1845 1850 1855 Pro Ala Ile Gly Arg Thr Ser Ile Leu Gly Lys Pro Gly Ile Tyr Glu            1860 1865 1870 Asp Arg Asp Pro Leu Arg Val Ser Ile Ser Arg Glu Gln Ser Phe Phe        1875 1880 1885 Gly Ser Pro Leu Ala His Asp Pro Phe Ser Cys Leu Gln Leu Val Gly    1890 1895 1900 Gln Glu Asn Val Cys Gly Asp Asp Tyr Asp Glu Ala Val Lys Leu Lys 1905 1910 1915 1920 Glu Ser Val Val Glu Asn His Ala Val Leu Ser Tyr Ala Val Glu Glu                1925 1930 1935 Glu His Ala Tyr Leu Gly Pro Thr Val Lys Pro Asp Asp Lys Ala Lys            1940 1945 1950 Thr Leu Ser Tyr Glu Pro Leu Ser Ser Ala Thr Val Ser Thr Gly Ser        1955 1960 1965 Leu Leu Ser Tyr Glu Asn Thr Asp Leu Ser Leu Thr Asp Pro Glu Ser    1970 1975 1980 Phe Ser Glu His Met Asp Asp Ser Lys Gln Glu Ser Thr Thr Ser Lys 1985 1990 1995 2000 Glu Glu Glu Thr Asn Ile Ser Ser Ile Val Ser Ser Thr Gln Asp                2005 2010 2015 Ile Tyr Gln Arg Gln Asn Ser Ser Asp Val His Lys Ser Leu Leu Pro            2020 2025 2030 Ala Val Asp Glu Thr Thr Cys Gly His Thr His Phe Gln Gln Met Ile        2035 2040 2045 Asp Lys Tyr Ile Asn Glu Ala Asn Leu Ile Pro Glu Lys Thr Asp Leu    2050 2055 2060 Gln Glu Leu Glu His Ile Phe Pro Asn Leu His His Gln Leu Phe Lys 2065 2070 2075 2080 Pro Leu Glu Pro His Pro Asp Phe Asp Leu Ser Ser Ser Ser Ser Gly                2085 2090 2095 Ile Ser Pro Asp Asn Arg Asp Phe Tyr Gln Arg Ser Asp Ser Ser Ser            2100 2105 2110 Glu Ser His Cys Ala Thr Gly Leu Ser Lys Ser Thr Val Tyr Phe Thr        2115 2120 2125 Ala Leu Arg Arg Thr Ser Met His Ser Ser Leu Asn Thr Ser Pro Asn    2130 2135 2140 Gln Gln Pro Asp Thr Asn Leu Ala His Val Gly Ala His Ser Phe Ala 2145 2150 2155 2160 Thr Glu Asn Ile Ile Gly Gly Ser Glu Gln Cys Phe Glu Gln Leu Gln                2165 2170 2175 Pro Glu Tyr Ser Ser Glu Glu Glu Ser Gln His Ala Asp Leu Pro Ser            2180 2185 2190 Ile Phe Ser Ile Glu Ala Arg Asp Ser Ser Gln Gly Met Lys Asn Gln        2195 2200 2205 Asn Tyr Pro Ser Glu Glu His Thr Glu Ile Leu Gln Asn Lys Lys Lys    2210 2215 2220 Ile Val His Phe Gln Leu Ser Ile Gly Asn Leu Ser Ser Val Tyr Ser 2225 2230 2235 2240 Ser Ser Asp Glu Ala Asn Val Phe Asp Gln Leu Asn Val Gln His Ser                2245 2250 2255 Thr Pro Cys Gly Ser Asn Ser Ser Glu Cys Ser Thr Lys His Gln Leu            2260 2265 2270 Glu Ser Arg Lys Glu Ser Met Gly Phe Glu Glu Leu Ser Lys Arg Gly        2275 2280 2285 Val Val Thr Met Leu Gln Ser Gln Gly Leu Ile Glu Asp Asn Lys Asn    2290 2295 2300 Glu Thr Cys Arg Val Leu Asp Ile Asn Pro Gln Val Glu Glu Thr Asp 2305 2310 2315 2320 Ser Arg Leu Cys Val Arg Thr Val Glu Met Gly Thr Ser Ile Gln Ala                2325 2330 2335 Pro Tyr Ser Leu Thr Thr Gln Asn Glu Lys Tyr Phe Glu Asn Ser Ala            2340 2345 2350 Glu Thr Asp Ile Pro Lys Ile Thr Lys Lys Leu Ser Gln Leu Gly Glu        2355 2360 2365 Ser Glu Leu Phe Ala Ser Ser Gly Ser Ser Ser Ile Ser Ser Ile    2370 2375 2380 Pro Val Trp Glu Thr Glu Thr Gly His Gly Ile Met Glu Glu Pro Glu 2385 2390 2395 2400 Leu Thr Leu Ile Ser Thr Thr Asp Thr Ser Ile Glu Met Asp Phe                2405 2410 2415 Ala Asn Leu Thr Leu Glu Glu Lys Ser Glu Asn Glu Ala Lys Cys Phe            2420 2425 2430 Phe Gln Val Ser Glu Phe Leu Pro Leu Val Ser Ala Thr Glu Ala Ser        2435 2440 2445 Asp Tyr Pro Ala Val Ser Glu Leu Ser Ile Glu Lys Pro Arg Thr Ala    2450 2455 2460 Ser Thr Glu Thr Pro Arg Arg Leu Thr Pro Val Gly Ser Leu Gln 2465 2470 2475 2480 Glu Ala Phe Ile Lys Arg Lys Lys Ser Phe Met Glu Arg Ser His Gln                2485 2490 2495 Arg Gln Lys Glu Ile Arg Asn Lys Ile His Val Ser Glu Asn Ser Gln            2500 2505 2510 Ile Lys Thr Val Lys Glu Lys Pro Ser Ile Ser Ser Ser Val Ser Arg        2515 2520 2525 Leu Lys Gly Val Asn Lys Val Arg Ala Ser Phe Pro Glu Asp Arg Lys    2530 2535 2540 Thr Gln Ala Leu Arg His Gln Arg Gly Leu Arg Leu Tyr Asn Gln 2545 2550 2555 2560 Leu Ala Glu Val Lys Gln Gln Lys Glu Glu Lys Thr Lys Gln Glu Ala                2565 2570 2575 Tyr Ala Gln Asn Arg Ala Arg Ala Lys Glu Phe His Lys Lys Thr Leu            2580 2585 2590 Glu Lys Leu Arg Ala Lys Asn Thr Cys        2595 2600 <210> 9 <211> 950 <212> PRT <213> Homo sapiens <400> 9 Met Val Phe Thr Pro Glu Asp Arg Leu Gly Lys Gln Cys Leu Leu Leu   1 5 10 15 Pro Leu Leu Leu Leu Ala Ala Trp Lys Val Gly Ser Gly Gln Leu His              20 25 30 Tyr Ser Val Pro Glu Glu Ala Lys His Gly Thr Phe Val Gly Arg Ile          35 40 45 Ala Gln Asp Leu Gly Leu Glu Leu Ala Glu Leu Val Pro Arg Leu Phe      50 55 60 Arg Met Ala Ser Lys Asp Arg Glu Asp Leu Leu Glu Val Asn Leu Gln  65 70 75 80 Asn Gly Ile Leu Phe Val Asn Ser Arg Ile Asp Arg Glu Glu Leu Cys                  85 90 95 Gly Arg Ser Ala Glu Cys Ser Ile His Leu Glu Val Ile Val Asp Arg             100 105 110 Pro Leu Gln Val Phe His Val Asp Val Glu Val Arg Asp Ile Asn Asp         115 120 125 Asn Pro Pro Leu Phe Pro Val Glu Glu Gln Arg Val Leu Ile Tyr Glu     130 135 140 Ser Arg Leu Pro Asp Ser Val Phe Pro Leu Glu Gly Ala Ser Asp Ala 145 150 155 160 Asp Val Gly Ser Asn Ser Ile Leu Thr Tyr Lys Leu Ser Ser Ser Glu                 165 170 175 Tyr Phe Gly Leu Asp Val Lys Ile Asn Ser Asp Asp Asn Lys Gln Ile             180 185 190 Gly Leu Leu Leu Lys Lys Ser Leu Asp Arg Glu Glu Ala Pro Ala His         195 200 205 Asn Leu Phe Leu Thr Ala Thr Asp Gly Gly Lys Pro Glu Leu Thr Gly     210 215 220 Thr Val Gln Leu Leu Val Thr Val Leu Asp Val Asn Asp Asn Ala Pro 225 230 235 240 Thr Phe Glu Gln Ser Glu Tyr Glu Val Arg Ile Phe Glu Asn Ala Asp                 245 250 255 Asn Gly Thr Thr Val Ile Arg Leu Asn Ala Ser Asp Arg Asp Glu Gly             260 265 270 Ala Asn Gly Ala Ile Ser Tyr Ser Phe Asn Ser Leu Val Ala Ala Met         275 280 285 Val Ile Asp His Phe Ser Ile Asp Arg Asn Thr Gly Glu Ile Val Ile     290 295 300 Arg Gly Asn Leu Asp Phe Glu Gln Glu Asn Leu Tyr Lys Ile Leu Ile 305 310 315 320 Asp Ala Thr Asp Lys Gly His Pro Met Ala Gly His Cys Thr Val                 325 330 335 Leu Val Arg Ile Leu Asp Lys Asn Asp Asn Val Pro Glu Ile Ala Leu             340 345 350 Thr Ser Leu Ser Leu Pro Val Arg Glu Asp Ala Gln Phe Gly Thr Val         355 360 365 Ile Ala Leu Ile Ser Val Asn Asp Leu Asp Ser Gly Ala Asn Gly Gln     370 375 380 Val Asn Cys Ser Leu Thr Pro His Val Pro Phe Lys Leu Val Ser Thr 385 390 395 400 Phe Lys Asn Tyr Tyr Ser Leu Val Leu Asp Ser Ala Leu Asp Arg Glu                 405 410 415 Ser Val Ser Ala Tyr Glu Leu Val Val Thr Ala Arg Asp Gly Gly Ser             420 425 430 Pro Ser Leu Trp Ala Thr Ala Ser Leu Ser Val Glu Val Ala Asp Met         435 440 445 Asn Asp Asn Pro Ala Phe Ala Gln Pro Glu Tyr Thr Val Phe Val     450 455 460 Lys Glu Asn Asn Pro Pro Gly Cys His Ile Phe Thr Val Ser Ala Arg 465 470 475 480 Asp Ala Asp Ala Gln Glu Asn Ala Leu Val Ser Tyr Ser Leu Val Glu                 485 490 495 Arg Arg Val Gly Glu Arg Ala Leu Ser Ser Tyr Ile Ser Val His Ala             500 505 510 Glu Ser Gly Lys Val Tyr Ala Leu Gln Pro Leu Asp His Glu Glu Leu         515 520 525 Glu Leu Gln Phe Gln Val Ser Ala Arg Asp Ala Gly Val Pro Pro     530 535 540 Leu Gly Ser Asn Val Thr Leu Gln Val Phe Val Leu Asp Glu Asn Asp 545 550 555 560 Asn Ala Pro Ala Leu Ala Pro Arg Val Gly Gly Thr Gly Gly Ala                 565 570 575 Val Ser Glu Leu Val Pro Arg Ser Leu Gly Ala Gly Gln Val Val Ala             580 585 590 Lys Val Arg Ala Val Asp Ala Asp Ser Gly Tyr Asn Ala Trp Leu Ser         595 600 605 Tyr Glu Leu Gln Pro Pro Ala Ser Ser Ala Arg Phe Pro Phe Arg Val     610 615 620 Gly Leu Tyr Thr Gly Glu Ile Ser Thr Thr Arg Val Leu Asp Glu Ala 625 630 635 640 Asp Ser Pro Arg His Arg Leu Leu Val Leu Val Lys Asp His Gly Glu                 645 650 655 Pro Ala Leu Thr Ala Thr Ala Thr Val Leu Val Ser Leu Val Glu Ser             660 665 670 Gly Gln Ala Pro Lys Ala Ser Ser Arg Ala Ser Val Gly Ala Ala Gly         675 680 685 Pro Glu Ala Ala Leu Val Asp Val Asn Val Tyr Leu Ile Ile Ala Ile     690 695 700 Cys Ala Val Ser Ser Leu Leu Val Leu Thr Leu Leu Leu Tyr Thr Ala 705 710 715 720 Leu Arg Cys Ser Ala Pro Pro Thr Glu Gly Ala Cys Thr Ala Asp Lys                 725 730 735 Pro Thr Leu Val Cys Ser Ser Ala Val Gly Ser Trp Ser Tyr Ser Gln             740 745 750 Gln Arg Arg Gln Arg Val Cys Ser Gly Glu Gly Pro Pro Lys Met Asp         755 760 765 Leu Met Ala Phe Ser Pro Ser Leu Ser Pro Cys Pro Ile Met Met Gly     770 775 780 Lys Ala Glu Asn Gln Asp Leu Asn Glu Asp His Asp Ala Lys Pro Arg 785 790 795 800 Gln Pro Asn Pro Asp Trp Arg Tyr Ser Ala Ser Leu Arg Ala Gly Met                 805 810 815 His Ser Ser Val His Leu Glu Glu Ala Gly Ile Leu Arg Ala Gly Pro             820 825 830 Gly Gly Pro Asp Gln Gln Trp Pro Thr Val Ser Ser Ala Thr Pro Glu         835 840 845 Pro Glu Ala Gly Glu Val Ser Pro Pro Val Gly Ala Gly Val Asn Ser     850 855 860 Asn Ser Trp Thr Phe Lys Tyr Gly Pro Gly Asn Pro Lys Gln Ser Gly 865 870 875 880 Pro Gly Glu Leu Pro Asp Lys Phe Ile Ile Pro Gly Ser Pro Ala Ile                 885 890 895 Ile Ser Ile Arg Gln Glu Pro Thr Asn Ser Gln Ile Asp Lys Ser Asp             900 905 910 Phe Ile Thr Phe Gly Lys Lys Glu Glu Thr Lys Lys Lys Lys Lys Lys Lys         915 920 925 Lys Lys Gly Asn Lys Thr Gln Glu Lys Lys Glu Lys Gly Asn Ser Thr     930 935 940 Thr Asp Asn Ser Asp Gln 945 950 <210> 10 <211> 666 <212> PRT <213> Homo sapiens <400> 10 Met Asp Leu Val Ala Phe Glu Asp Val Ala Val Asn Phe Thr Gln Glu   1 5 10 15 Glu Trp Ser Leu Leu Asp Pro Ser Gln Lys Asn Leu Tyr Arg Glu Val              20 25 30 Met Gln Glu Thr Leu Arg Asn Leu Ala Ser Ile Gly Glu Lys Trp Lys          35 40 45 Asp Gln Asn Ile Glu Asp Gln Tyr Lys Asn Pro Arg Asn Asn Leu Arg      50 55 60 Ser Leu Leu Gly Glu Arg Val Asp Glu Asn Thr Glu Glu Asn His Cys  65 70 75 80 Gly Glu Thr Ser Ser Gln Ile Pro Asp Asp Thr Leu Asn Lys Lys Thr                  85 90 95 Ser Pro Gly Val Lys Ser Cys Glu Ser Ser Val Cys Gly Glu Val Phe             100 105 110 Val Gly His Ser Ser Leu Asn Arg His Ile Arg Ala Asp Thr Ala His         115 120 125 Lys Pro Ser Glu Tyr Gln Glu Tyr Gly Gln Glu Pro Tyr Lys Cys Gln     130 135 140 Gln Arg Lys Lys Ala Phe Arg Cys His Pro Ser Phe Gln Met Gln Glu 145 150 155 160 Lys Ala His Thr Gly Glu Lys Leu Tyr Asp Cys Lys Glu Cys Gly Lys                 165 170 175 Thr Phe Ile Ser His Ser Ser Ile Gln Arg His Met Ile Met His Asn             180 185 190 Gly Asp Gly Thr Tyr Lys Cys Lys Phe Cys Gly Lys Ala Cys Pro Cys         195 200 205 Leu Ser Ile Tyr Leu Ile His Glu Arg Val His Thr Gly Glu Lys Pro     210 215 220 Tyr Lys Cys Lys Gln Cys Gly Lys Ala Phe Ser Tyr Ser Thr Ser Leu 225 230 235 240 Gln Ile His Glu Arg Thr His Thr Gly Glu Lys Pro Tyr Glu Cys Lys                 245 250 255 Glu Cys Gly Lys Ala Phe Gly Ser Pro Asn Ser Leu Tyr Glu His Arg             260 265 270 Arg Thr His Thr Gly Glu Lys Pro Tyr Glu Cys Lys Gln Cys Gly Lys         275 280 285 Ala Phe Arg Trp Phe His Ser Phe Gln Ile His Glu Arg Thr His Ser     290 295 300 Glu Glu Lys Ala Tyr Glu Cys Thr Lys Cys Gly Lys Ala Phe Lys Cys 305 310 315 320 Pro Ser Tyr Leu Cys Arg His Glu Val Thr His Ser Gly Lys Lys Pro                 325 330 335 Cys Glu Cys Lys Gln Cys Gly Lys Ala Leu Ser Tyr Leu Asn Phe Gln             340 345 350 Arg His Met Lys Met His Thr Arg Met Arg Pro Tyr Lys Cys Lys Thr         355 360 365 Val Glu Lys Pro Leu Ile Leu Pro Val Arg Phe Glu Asp Met Lys Glu     370 375 380 Leu Thr Leu Glu Arg Asn Leu Met Asn Ala Ser Thr Val Val Lys Pro 385 390 395 400 Ser Ile Val Pro Val Phe Thr Ile Met Lys Gly Leu Thr Leu Glu                 405 410 415 Arg Asn Pro Met Asn Val Ser Ser Val Val Lys Pro Ser Phe Leu Pro             420 425 430 Leu Pro Phe Asp Ile Met Lys Gly Leu Thr Leu Glu Arg Asn Arg Met         435 440 445 Ser Val Ser Asn Val Gly Lys Ser Ser Asp Leu Pro His Thr Phe Lys     450 455 460 Cys Met Glu Gly Leu Thr Leu Lys Arg Asn Pro Met Asn Val Ser Ser 465 470 475 480 Val Val Lys Pro Ser Phe Phe Pro Leu Pro Phe Asp Ile Met Lys Gly                 485 490 495 Leu Thr Leu Glu Arg Asn Pro Met Ser Val Ser Asn Val Gly Lys Pro             500 505 510 Ser His Leu Pro His Thr Phe Lys Cys Met Lys Gly Leu Thr Leu Glu         515 520 525 Ser Asn Cys Met Asn Leu Asn Asn Val Lys Lys Pro Leu Asp Leu Ser     530 535 540 Glu Thr Phe Lys Phe Met Lys Arg His Thr Leu Glu Arg Asn Pro Ile 545 550 555 560 Arg Asn Met Glu Lys His Ser Thr Ile Ser Leu Pro Phe Lys Tyr Met                 565 570 575 Gln Gln Cys Thr Glu Asp Arg Met Met Met Asn Val Lys Ser Val Thr             580 585 590 Lys His Ser Tyr Leu Pro Arg Ser Phe Glu Tyr Met Gln Glu His Thr         595 600 605 Leu Glu Arg Asn Pro Met Asn Val Arg Asn Ala Glu Lys Arg Ser Ile     610 615 620 Ile Phe Leu Leu Cys Val Tyr Thr Lys Gly Cys Thr Leu Glu Arg Asn 625 630 635 640 His Ile Asn Val Arg Ile Val Gly Lys His Ser Val Cys Leu Val Pro                 645 650 655 Phe Val Asp Ile Lys Gly Leu Thr Leu Glu             660 665 <210> 11 <211> 353 <212> PRT <213> Homo sapiens <400> 11 Met Ala Ala Glu Leu Ala Met Gly Ala Glu Leu Pro Ser Ser Pro Leu   1 5 10 15 Ala Ile Glu Tyr Val Asn Asp Phe Asp Leu Met Lys Phe Glu Val Lys              20 25 30 Lys Glu Pro Pro Glu Ala Glu Arg Phe Cys His Arg Leu Pro Pro Gly          35 40 45 Ser Leu Ser Ser Thr Pro Leu Ser Thr Pro Cys Ser Ser Val Ser Ser      50 55 60 Ser Pro Ser Phe Cys Ala Pro Ser Pro Gly Thr Gly Gly Gly Gly Gly  65 70 75 80 Ala Gly Gly Gly Gly Gly Ser Ser Gln Ala Gly Gly Ala Pro Gly Pro                  85 90 95 Pro Ser Gly Gly Pro Gly Ala Val Gly Gly Thr Ser Gly Lys Pro Ala             100 105 110 Leu Glu Asp Leu Tyr Trp Met Ser Gly Tyr Gln His His Leu Asn Pro         115 120 125 Glu Ala Leu Asn Leu Thr Pro Glu Asp Ala Val Glu Ala Leu Ile Gly     130 135 140 Ser Gly His His Gly Ala His His Gly Ala His His Pro Ala Ala Ala 145 150 155 160 Ala Ala Tyr Glu Ala Phe Arg Gly Pro Gly Phe Ala Gly Gly Gly Gly                 165 170 175 Ala Asp Asp Met Gly Ala Gly His His His Gly Ala His His Ala Ala             180 185 190 His His His His Ala Ala His His His His His His His His His His         195 200 205 Gly Gly Ala Gly His Gly Gly Gly Ala Gly His His Val Arg Leu Glu     210 215 220 Glu Arg Phe Ser Asp Asp Gln Leu Val Ser Met Ser Val Arg Glu Leu 225 230 235 240 Asn Arg Gln Leu Arg Gly Phe Ser Lys Glu Glu Val Ile Arg Leu Lys                 245 250 255 Gln Lys Arg Arg Thr Leu Lys Asn Arg Gly Tyr Ala Gln Ser Cys Arg             260 265 270 Phe Lys Arg Val Gln Gln Arg His Ile Leu Glu Ser Glu Lys Cys Gln         275 280 285 Leu Gln Ser Gln Val Glu Gln Leu Lys Leu Glu Val Gly Arg Leu Ala     290 295 300 Lys Glu Arg Asp Leu Tyr Lys Glu Lys Tyr Glu Lys Leu Ala Gly Arg 305 310 315 320 Gly Gly Pro Gly Ser Ala Gly Gly Ala Gly Phe Pro Arg Glu Pro Ser                 325 330 335 Pro Pro Gln Ala Gly Pro Gly Gly Ala Lys Gly Thr Ala Asp Phe Phe             340 345 350 Leu     <210> 12 <211> 1939 <212> PRT <213> Homo sapiens <400> 12 Met Ser Ser Asp Ser Glu Met Ala Ile Phe Gly Glu Ala Ala Pro Phe   1 5 10 15 Leu Arg Lys Ser Glu Arg Glu Arg Ile Glu Ala Gln Asn Lys Pro Phe              20 25 30 Asp Ala Lys Thr Ser Val Phe Val Val Asp Pro Lys Glu Ser Phe Val          35 40 45 Lys Ala Thr Val Gln Ser Arg Glu Gly Gly Lys Val Thr Ala Lys Thr      50 55 60 Glu Ala Gly Ala Thr Val Thr Val Lys Asp Asp Gln Val Phe Pro Met  65 70 75 80 Asn Pro Pro Lys Tyr Asp Lys Ile Glu Asp Met Ala Met Met Thr His                  85 90 95 Leu His Glu Pro Ala Val Leu Tyr Asn Leu Lys Glu Arg Tyr Ala Ala             100 105 110 Trp Met Ile Tyr Thr Tyr Ser Gly Leu Phe Cys Val Thr Val Asn Pro         115 120 125 Tyr Lys Trp Leu Pro Val Tyr Asn Ala Glu Val Val Thr Ala Tyr Arg     130 135 140 Gly Lys Lys Arg Gln Glu Ala Pro Pro His Ile Phe Ser Ile Ser Asp 145 150 155 160 Asn Ala Tyr Gln Phe Met Leu Thr Asp Arg Glu Asn Gln Ser Ile Leu                 165 170 175 Ile Thr Gly Glu Ser Gly Ala Gly Lys Thr Val Asn Thr Lys Arg Val             180 185 190 Ile Gln Tyr Phe Ala Thr Ile Ala Val Thr Gly Glu Lys Lys Lys Glu         195 200 205 Glu Val Thr Ser Gly Lys Met Gln Gly Thr Leu Glu Asp Gln Ile Ile     210 215 220 Ser Ala Asn Pro Leu Leu Glu Ala Phe Gly Asn Ala Lys Thr Val Arg 225 230 235 240 Asn Asp Asn Ser Ser Arg Phe Gly Lys Phe Ile Arg Ile His Phe Gly                 245 250 255 Thr Thr Gly Lys Leu Ala Ser Ala Asp Ile Glu Thr Tyr Leu Leu Glu             260 265 270 Lys Ser Arg Val Thr Phe Gln Leu Lys Ala Glu Arg Ser Tyr His Ile         275 280 285 Phe Tyr Gln Ile Met Ser Asn Lys Lys Pro Asp Leu Ile Glu Met Leu     290 295 300 Leu Ile Thr Thr Asn Pro Tyr Asp Tyr Ala Phe Val Ser Gln Gly Glu 305 310 315 320 Ile Thr Val Ser Ile Asp Asp Glu Glu Glu Leu Met Ala Thr Asp                 325 330 335 Ser Ala Ile Glu Ile Leu Gly Phe Thr Ser Asp Glu Arg Val Ser Ile             340 345 350 Tyr Lys Leu Thr Gly Ala Val Met His Tyr Gly Asn Met Lys Phe Lys         355 360 365 Gln Lys Gln Arg Glu Glu Gln Ala Glu Pro Asp Gly Thr Glu Val Ala     370 375 380 Asp Lys Ala Ala Tyr Leu Gln Asn Leu Asn Ser Ala Asp Leu Leu Lys 385 390 395 400 Ala Leu Cys Tyr Pro Arg Val Lys Val Gly Asn Glu Tyr Val Thr Lys                 405 410 415 Gly Gln Thr Val Gln Gln Val Tyr Asn Ala Val Gly Ala Leu Ala Lys             420 425 430 Ala Val Tyr Asp Lys Met Phe Leu Trp Met Val Thr Arg Ile Asn Gln         435 440 445 Gln Leu Asp Thr Lys Gln Pro Arg Gln Tyr Phe Ile Gly Val Leu Asp     450 455 460 Ile Ala Gly Phe Glu Ile Phe Asp Phe Asn Ser Leu Glu Gln Leu Cys 465 470 475 480 Ile Asn Phe Thr Asn Glu Lys Leu Gln Gln Phe Phe Asn His Met                 485 490 495 Phe Val Leu Glu Gln Glu Glu Tyr Lys Lys Glu Gly Ile Glu Trp Thr             500 505 510 Phe Ile Asp Phe Gly Met Asp Leu Ala Ala Cys Ile Glu Leu Ile Glu         515 520 525 Lys Pro Met Gly Ile Phe Ser Ile Leu Glu Glu Glu Cys Met Phe Pro     530 535 540 Lys Ala Thr Asp Thr Ser Phe Lys Asn Lys Leu Tyr Glu Gln His Leu 545 550 555 560 Gly Lys Ser Asn Asn Phe Gln Lys Pro Lys Pro Ala Lys Gly Lys Pro                 565 570 575 Glu Ala His Phe Ser Leu Ile His Tyr Ala Gly Thr Val Asp Tyr Asn             580 585 590 Ile Ala Gly Trp Leu Asp Lys Asn Lys Asp Pro Leu Asn Glu Thr Val         595 600 605 Val Gly Leu Tyr Gln Lys Ser Ala Met Lys Thr Leu Ala Leu Leu Phe     610 615 620 Val Gly Ala Thr Gly Ala Gly Aly Gly Aly Gly Gly Gly Lys Lys Gly 625 630 635 640 Gly Lys Lys Lys Gly Ser Ser Phe Gln Thr Val Ser Ala Leu Phe Arg                 645 650 655 Glu Asn Leu Asn Lys Leu Met Thr Asn Leu Arg Ser Thr His Pro His             660 665 670 Phe Val Arg Cys Ile Ile Pro Asn Glu Thr Lys Thr Pro Gly Ala Met         675 680 685 Glu His Glu Leu Val Leu His Gln Leu Arg Cys Asn Gly Val Leu Glu     690 695 700 Gly Ile Arg Ile Cys Arg Lys Gly Phe Pro Ser Arg Ile Leu Tyr Ala 705 710 715 720 Asp Phe Lys Gln Arg Tyr Lys Val Leu Asn Ala Ser Ala Ile Pro Glu                 725 730 735 Gly Gln Phe Ile Asp Ser Lys Lys Ala Ser Glu Lys Leu Leu Gly Ser             740 745 750 Ile Asp Ile Asp His Thr Gln Tyr Lys Phe Gly His Thr Lys Val Phe         755 760 765 Phe Lys Ala Gly Leu Leu Gly Leu Leu Glu Glu Met Arg Asp Glu Lys     770 775 780 Leu Ala Gln Leu Ile Thr Arg Thr Gln Ala Met Cys Arg Gly Phe Leu 785 790 795 800 Ala Arg Val Glu Tyr Gln Lys Met Val Glu Arg Arg Glu Ser Ile Phe                 805 810 815 Cys Ile Gln Tyr Asn Val Arg Ala Phe Met Asn Val Lys His Trp Pro             820 825 830 Trp Met Lys Leu Tyr Phe Lys Ile Lys Pro Leu Leu Lys Ser Ala Glu         835 840 845 Thr Glu Lys Glu Met Ala Asn Met Lys Glu Glu Phe Glu Lys Thr Lys     850 855 860 Glu Glu Leu Ala Lys Thr Glu Ala Lys Arg Lys Glu Leu Glu Glu Lys 865 870 875 880 Met Val Thr Leu Met Gln Glu Lys Asn Asp Leu Gln Leu Gln Val Gln                 885 890 895 Ala Glu Ala Asp Ser Leu Ala Asp Ala Glu Glu Arg Cys Asp Gln Leu             900 905 910 Ile Lys Thr Lys Ile Gln Leu Glu Ala Lys Ile Lys Glu Val Thr Glu         915 920 925 Arg Ala Glu Asp Glu Glu Glu Ile Asn Ala Glu Leu Thr Ala Lys Lys     930 935 940 Arg Lys Leu Glu Asp Glu Cys Ser Glu Leu Lys Lys Asp Ile Asp Asp 945 950 955 960 Leu Glu Leu Thr Leu Ala Lys Val Glu Lys Glu Lys His Ala Thr Glu                 965 970 975 Asn Lys Val Lys Asn Leu Thr Glu Glu Met Ala Gly Leu Asp Glu Thr             980 985 990 Ile Ala Lys Leu Thr Lys Glu Lys Lys Ala Leu Gln Glu Ala His Gln         995 1000 1005 Gln Thr Leu Asp Asp Leu Gln Ala Glu Glu Asp Lys Val Asn Thr Leu    1010 1015 1020 Thr Lys Ala Lys Ile Lys Leu Glu Gln Gln Val Asp Asp Leu Glu Gly 1025 1030 1035 1040 Ser Leu Glu Gln Glu Lys Lys Ile Arg Met Asp Leu Glu Arg Ala Lys                1045 1050 1055 Arg Lys Leu Glu Gly Asp Leu Lys Leu Ala Gln Glu Ser Thr Met Asp            1060 1065 1070 Ile Glu Asn Asp Lys Gln Gln Leu Asp Glu Lys Leu Lys Lys Lys Glu        1075 1080 1085 Phe Glu Met Ser Gly Leu Gln Ser Lys Ile Glu Asp Glu Gln Ala Leu    1090 1095 1100 Gly Met Gln Leu Gln Lys Lys Ile Lys Glu Leu Gln Ala Arg Ile Glu 1105 1110 1115 1120 Glu Leu Glu Glu Glu Ile Glu Ala Glu Arg Ala Ser Arg Ala Lys Ala                1125 1130 1135 Glu Lys Gln Arg Ser Asp Leu Ser Arg Glu Leu Glu Glu Ile Ser Glu            1140 1145 1150 Arg Leu Glu Glu Glu Aly Gly Ala Thr Ser Ala Gln Ile Glu Met Asn        1155 1160 1165 Lys Lys Arg Glu Ala Glu Phe Gln Lys Met Arg Arg Asp Leu Glu Glu    1170 1175 1180 Ala Thr Leu Gln His Glu Ala Thr Ala Ala Thr Leu Arg Lys Lys His 1185 1190 1195 1200 Ala Asp Ser Val Ala Glu Leu Gly Glu Gln Ile Asp Asn Leu Gln Arg                1205 1210 1215 Val Lys Gln Lys Leu Glu Lys Glu Lys Ser Glu Met Lys Met Glu Ile            1220 1225 1230 Asp Asp Leu Ala Ser Asn Met Glu Thr Val Ser Lys Ala Lys Gly Asn        1235 1240 1245 Leu Glu Lys Met Cys Arg Ala Leu Glu Asp Gln Leu Ser Glu Ile Lys    1250 1255 1260 Thr Lys Glu Glu Glu Gln Gln Arg Leu Ile Asn Asp Leu Thr Ala Gln 1265 1270 1275 1280 Arg Ala Arg Leu Gln Thr Glu Ser Gly Glu Tyr Ser Arg Gln Leu Asp                1285 1290 1295 Glu Lys Asp Thr Leu Val Ser Gln Leu Ser Arg Gly Lys Gln Ala Phe            1300 1305 1310 Thr Gln Gln Ile Glu Glu Leu Lys Arg Gln Leu Glu Glu Glu Ile Lys        1315 1320 1325 Ala Lys Ser Ala Leu Ala His Ala Leu Gln Ser Ser Arg His Asp Cys    1330 1335 1340 Asp Leu Leu Arg Glu Gln Tyr Glu Glu Glu Gln Glu Ala Lys Ala Glu 1345 1350 1355 1360 Leu Gln Arg Ala Met Ser Lys Ala Asn Ser Glu Val Ala Gln Trp Arg                1365 1370 1375 Thr Lys Tyr Glu Thr Asp Ala Ile Gln Arg Thr Glu Glu Leu Glu Glu            1380 1385 1390 Ala Lys Lys Lys Leu Ala Gln Arg Leu Gln Asp Ala Glu Glu His Val        1395 1400 1405 Glu Ala Val Asn Ala Lys Cys Ala Ser Leu Glu Lys Thr Lys Gln Arg    1410 1415 1420 Leu Gln Asn Glu Val Glu Asp Leu Met Ile Asp Val Glu Arg Thr Asn 1425 1430 1435 1440 Ala Ala Cys Ala Ala Leu Asp Lys Lys Gln Arg Asn Phe Asp Lys Ile                1445 1450 1455 Leu Ala Glu Trp Lys Gln Lys Cys Glu Glu Thr His Ala Glu Leu Glu            1460 1465 1470 Ala Ser Gln Lys Glu Ser Ser Ser Ser Ser Glu Leu Phe Lys Ile        1475 1480 1485 Lys Asn Ala Tyr Glu Glu Ser Leu Asp Gln Leu Glu Thr Leu Lys Arg    1490 1495 1500 Glu Asn Lys Asn Leu Gln Gln Glu Ile Ser Asp Leu Thr Glu Gln Ile 1505 1510 1515 1520 Ala Glu Gly Gly Lys Arg Ile His Glu Leu Glu Lys Ile Lys Lys Gln                1525 1530 1535 Val Glu Glu Glu Lys Ser Glu Leu Glu Ala Ala Leu Glu Glu Ala Glu            1540 1545 1550 Ala Ser Leu Glu His Glu Glu Gly Lys Ile Leu Arg Ile Gln Leu Glu        1555 1560 1565 Leu Asn Gln Val Lys Ser Glu Val Asp Arg Lys Ile Ala Glu Lys Asp    1570 1575 1580 Glu Ile Asp Gln Met Lys Arg Asn His Ile Arg Ile Val Glu Ser 1585 1590 1595 1600 Met Gln Ser Thr Leu Asp Ala Glu Ile Arg Ser Ser Asn Asp Ala Ile                1605 1610 1615 Arg Leu Lys Lys Lys Met Glu Gly Asp Leu Asn Glu Met Glu Ile Gln            1620 1625 1630 Leu Asn His Ala Asn Arg Met Ala Ala Glu Ala Leu Arg Asn Tyr Arg        1635 1640 1645 Asn Thr Gln Ala Ile Leu Lys Asp Thr Gln Leu His Leu Asp Asp Ala    1650 1655 1660 Leu Arg Ser Gln Glu Asp Leu Lys Glu Gln Leu Ala Met Val Glu Arg 1665 1670 1675 1680 Arg Ala Asn Leu Leu Glu Ala Glu Ile Glu Glu Leu Arg Ala Thr Leu                1685 1690 1695 Glu Gln Thr Glu Arg Ser Ser Lys Ile Ala Glu Gln Glu Leu Leu Asp            1700 1705 1710 Ala Ser Glu Arg Val Gln Leu Leu His Thr Gln Asn Thr Ser Leu Ile        1715 1720 1725 Asn Thr Lys Lys Lys Leu Glu Thr Asp Ile Ser Gln Ile Gln Gly Glu    1730 1735 1740 Met Glu Asp Ile Ile Gln Glu Ala Arg Asn Ala Glu Glu Lys Ala Lys 1745 1750 1755 1760 Lys Ala Ile Thr Asp Ala Met Met Ala Glu Glu Leu Lys Lys Glu                1765 1770 1775 Gln Asp Thr Ser Ala His Leu Glu Arg Met Lys Lys Asn Leu Glu Gln            1780 1785 1790 Thr Val Lys Asp Leu Gln His Arg Leu Asp Glu Ala Glu Gln Leu Ala        1795 1800 1805 Leu Lys Gly Gly Lys Lys Gln Ile Gln Lys Leu Glu Ala Arg Val Arg    1810 1815 1820 Glu Leu Glu Gly Glu Val Glu Ser Glu Gln Lys Arg Asn Val Glu Ala 1825 1830 1835 1840 Val Lys Gly Leu Arg Lys His Glu Arg Lys Val Lys Glu Leu Thr Tyr                1845 1850 1855 Gln Thr Glu Glu Asp Arg Lys Asn Ile Leu Arg Leu Gln Asp Leu Val            1860 1865 1870 Asp Lys Leu Gln Ala Lys Val Lys Ser Tyr Lys Arg Gln Ala Glu Glu        1875 1880 1885 Ala Glu Glu Gln Ser Asn Val Asn Leu Ser Lys Phe Arg Arg Ile Gln    1890 1895 1900 His Glu Leu Glu Glu Ala Glu Glu Arg Ala Asp Ile Ala Glu Ser Gln 1905 1910 1915 1920 Val Asn Lys Leu Arg Val Lys Ser Arg Glu Val His Thr Lys Ile Ile                1925 1930 1935 Ser Glu Glu             <210> 13 <211> 184 <212> PRT <213> Homo sapiens <400> 13 Met Ala Thr Ala Leu Ala Leu Arg Ser Leu Tyr Arg Ala Arg Pro Ser   1 5 10 15 Leu Arg Cys Pro Pro Val Glu Leu Pro Trp Ala Pro Arg Arg Gly His              20 25 30 Arg Leu Ser Pro Ala Asp Asp Glu Leu Tyr Gln Arg Thr Arg Ile Ser          35 40 45 Leu Leu Gln Arg Glu Ala Ala Gln Ala Met Tyr Ile Asp Ser Tyr Asn      50 55 60 Ser Arg Gly Phe Met Ile Asn Gly Asn Arg Val Leu Gly Pro Cys Ala  65 70 75 80 Leu Leu Pro His Ser Val Val Gln Trp Asn Val Gly Ser His Gln Asp                  85 90 95 Ile Thr Glu Asp Ser Phe Ser Leu Phe Trp Leu Leu Glu Pro Arg Ile             100 105 110 Glu Ile Val Val Gly Thr Gly Asp Arg Thr Glu Arg Leu Gln Ser         115 120 125 Gln Val Leu Gln Ala Met Arg Gln Arg Gly Ile Ala Val Glu Val Gln     130 135 140 Asp Thr Pro Asn Ala Cys Ala Thr Phe Asn Phe Leu Cys His Glu Gly 145 150 155 160 Arg Val Thr Gly Ala Leu Ile Pro Pro Gly Gly Thr Ser Leu                 165 170 175 Thr Ser Leu Gly Gln Ala Ala Gln             180 <210> 14 <211> 218 <212> PRT <213> Homo sapiens <400> 14 Met Gly Cys Cys Thr Gly Arg Cys Ser Leu Ile Cys Leu Cys Ala Leu   1 5 10 15 Gln Leu Val Ser Ala Leu Glu Arg Gln Ile Phe Asp Phe Leu Gly Phe              20 25 30 Gln Trp Ala Pro Ile Leu Gly Asn Phe Leu His Ile Ile Val Val Ile          35 40 45 Leu Gly Leu Phe Gly Thr Ile Gln Tyr Arg Pro Arg Tyr Ile Met Val      50 55 60 Tyr Thr Val Trp Thr Ala Leu Trp Val Thr Trp Asn Val Phe Ile Ile  65 70 75 80 Cys Phe Tyr Leu Glu Val Gly Gly Leu Ser Lys Asp Thr Asp Leu Met                  85 90 95 Thr Phe Asn Ile Ser Val His Arg Ser Trp Trp Arg Glu His Gly Pro             100 105 110 Gly Cys Val Arg Arg Val Leu Pro Pro Ser Ala His Gly Met Met Asp         115 120 125 Asp Tyr Thr Tyr Val Ser Val Thr Gly Cys Ile Val Asp Phe Gln Tyr     130 135 140 Leu Glu Val Ile His Ser Ala Val Gln Ile Leu Leu Ser Leu Val Gly 145 150 155 160 Phe Val Tyr Ala Cys Tyr Val Ile Ser Ile Ser Met Glu Glu Glu Asp                 165 170 175 Thr Phe Asp Phe Ile Gly Gly Leu Asp Thr His Ser Tyr Tyr Gln Asp             180 185 190 His Val Glu Leu Lys Pro Val Lys Pro Val Glu Ile Ser Asn Asp Ile         195 200 205 Glu Pro Glu Met Arg Leu Leu Asn Leu Thr     210 215 <210> 15 <211> 405 <212> PRT <213> Homo sapiens <400> 15 Met Asp Thr Ile Phe Leu Trp Ser Leu Leu Leu Leu Phe Phe Gly Ser   1 5 10 15 Gln Ala Ser Arg Cys Ser Ala Gln Lys Asn Thr Glu Phe Ala Val Asp              20 25 30 Leu Tyr Gln Glu Val Ser Leu Ser His Lys Asp Asn Ile Ile Phe Ser          35 40 45 Pro Leu Gly Ile Thr Leu Val Leu Glu Met Val Gln Leu Gly Ala Lys      50 55 60 Gly Lys Ala Gln Gln Gln Ile Arg Gln Thr Leu Lys Gln Gln Glu Thr  65 70 75 80 Ser Ala Gly Glu Glu Phe Phe Val Leu Lys Ser Phe Phe Ser Ala Ile                  85 90 95 Ser Glu Lys Lys Gln Glu Phe Thr Phe Asn Leu Ala Asn Ala Leu Tyr             100 105 110 Leu Gln Glu Gly Phe Thr Val Lys Glu Gln Tyr Leu His Gly Asn Lys         115 120 125 Glu Phe Phe Gln Ser Ala Ile Lys Leu Val Asp Phe Gln Asp Ala Lys     130 135 140 Ala Cys Ala Glu Met Ile Ser Thr Trp Val Glu Arg Lys Thr Asp Gly 145 150 155 160 Lys Ile Lys Asp Met Phe Ser Gly Glu Glu Phe Gly Pro Leu Thr Arg                 165 170 175 Leu Val Leu Val Asn Ale Ile Tyr Phe Lys Gly Asp Trp Lys Gln Lys             180 185 190 Phe Arg Lys Glu Asp Thr Gln Leu Ile Asn Phe Thr Lys Lys Asn Gly         195 200 205 Ser Thr Val Lys Ile Pro Met Met Lys Ala Leu Leu Arg Thr Lys Tyr     210 215 220 Gly Tyr Phe Ser Glu Ser Ser Leu Asn Tyr Gln Val Leu Glu Leu Ser 225 230 235 240 Tyr Lys Gly Asp Glu Phe Ser Leu Ile Ile Leu Pro Ala Glu Gly                 245 250 255 Met Asp Ile Glu Glu Glu Glu Lys Leu Ile Thr Ala Gln Gln Ile Leu             260 265 270 Lys Trp Leu Ser Glu Met Gln Glu Glu Glu Val Glu Ile Ser Leu Pro         275 280 285 Arg Phe Lys Val Glu Gln Lys Val Asp Phe Lys Asp Val Leu Tyr Ser     290 295 300 Leu Asn Ile Thr Glu Ile Phe Ser Gly Gly Cys Asp Leu Ser Gly Ile 305 310 315 320 Thr Asp Ser Ser Glu Val Ser Val Ser Ser Gln Val Thr Gln Lys Val Phe                 325 330 335 Phe Glu Ile Asn Glu Asp Gly Ser Glu Ala Ala Thr Ser Thr Gly Ile             340 345 350 His Ile Pro Val Ile Met Ser Leu Ala Gln Ser Gln Phe Ile Ala Asn         355 360 365 His Pro Phe Leu Phe Ile Met Lys His Asn Pro Thr Glu Ser Ile Leu     370 375 380 Phe Met Gly Arg Val Thr Asn Pro Asp Thr Gln Glu Ile Lys Gly Arg 385 390 395 400 Asp Leu Asp Ser Leu                 405 <210> 16 <211> 909 <212> PRT <213> Homo sapiens <400> 16 Met Lys Lys Arg Arg Lys Val Thr Ser Asn Leu Glu Lys Ile His Leu   1 5 10 15 Gly Tyr His Lys Asp Ser Ser Glu Gly Asn Val Ala Val Glu Cys Asp              20 25 30 Gln Val Thr Tyr Thr His Ser Ala Gly Arg Pro Thr Pro Glu Ala Leu          35 40 45 His Cys Tyr Gln Glu Leu Pro Pro Ser Pro Asp Gln Arg Lys Leu Leu      50 55 60 Ser Ser Leu Gln Tyr Asn Lys Asn Leu Leu Lys Tyr Leu Asn Asp Asp  65 70 75 80 Arg Gln Lys Gln Pro Ser Phe Cys Asp Leu Leu Ile Ile Val Glu Gly                  85 90 95 Lys Glu Phe Ser Ala His Lys Val Val Val Ala Val Gly Ser Ser Tyr             100 105 110 Phe His Ala Cys Leu Ser Lys Asn Pro Ser Thr Asp Val Val Thr Leu         115 120 125 Asp His Val Thr His Ser Val Phe Gln His Leu Leu Glu Phe Leu Tyr     130 135 140 Thr Ser Glu Phe Phe Val Tyr Lys Tyr Glu Ile Pro Leu Val Leu Glu 145 150 155 160 Ala Ala Lys Phe Leu Asp Ile Asp Ala Val Lys Leu Leu Asn Asn                 165 170 175 Glu Asn Val Ala Pro Phe His Ser Glu Leu Thr Glu Lys Ser Ser Pro             180 185 190 Glu Glu Thr Leu Asn Glu Leu Thr Gly Arg Leu Ser Asn Asn His Gln         195 200 205 Cys Lys Phe Cys Ser Arg His Phe Cys Tyr Lys Lys Ser Leu Glu Asn     210 215 220 His Leu Ala Lys Thr His Arg Ser Leu Leu Leu Gly Lys Lys His Gly 225 230 235 240 Leu Lys Met Leu Glu Arg Ser Ser Ser Arg Arg Ser Ser Lys Arg Asn                 245 250 255 Arg Lys Cys Pro Val Lys Phe Asp Asp Thr Ser Asp Asp Glu Gln Glu             260 265 270 Ser Gly Asp Gly Ser Asp Asn Leu Asn Gln Glu Asn Phe Asp Lys Glu         275 280 285 Lys Ser Asp Arg Asn Asp Ser Glu Asp Pro Gly Ser Glu Tyr Asn Ala     290 295 300 Glu Glu Asp Glu Leu Glu Glu Glu Met Ser Asp Glu Tyr Ser Asp Ile 305 310 315 320 Glu Glu Glu Ser Glu Lys Asp His Asn Asp Ala Glu Glu Glu Pro Glu                 325 330 335 Ala Gly Asp Ser Val Gly Asn Val His Glu Gly Leu Thr Pro Val Val             340 345 350 Ile Gln Asn Ser Asn Lys Lys Ile Leu Gln Cys Pro Lys Cys Asp Lys         355 360 365 Thr Phe Asp Arg Ile Gly Lys Tyr Glu Ser His Thr Arg Val His Thr     370 375 380 Gly Glu Lys Pro Phe Glu Cys Asp Ile Cys His Gln Arg Tyr Ser Thr 385 390 395 400 Lys Ser Asn Leu Thr Val His Arg Lys Lys His Ser Asn Glu Thr Glu                 405 410 415 Phe His Lys Lys Glu His Lys Cys Pro Tyr Cys Asn Lys Leu His Ala             420 425 430 Ser Lys Lys Thr Leu Ala Lys His Val Lys Arg Phe His Pro Glu Asn         435 440 445 Ala Gln Glu Phe Ile Ser Ile Lys Lys Thr Lys Ser Glu Ser Trp Lys     450 455 460 Cys Asp Ile Cys Lys Lys Ser Phe Thr Arg Arg Pro His Leu Glu Glu 465 470 475 480 His Met Ile Leu His Ser Gln Asp Lys Pro Phe Lys Cys Thr Tyr Cys                 485 490 495 Glu Glu His Phe Lys Ser Arg Phe Ala Arg Leu Lys His Gln Glu Lys             500 505 510 Phe His Leu Gly Pro Phe Pro Cys Asp Ile Cys Gly Arg Gln Phe Asn         515 520 525 Asp Thr Gly Asn Leu Lys Arg His Ile Glu Cys Thr His Gly Gly Lys     530 535 540 Arg Lys Trp Thr Cys Phe Ile Cys Gly Lys Ser Val Arg Glu Arg Thr 545 550 555 560 Thr Leu Lys Glu His Leu Arg Ile His Ser Gly Glu Lys Pro His Leu                 565 570 575 Cys Ser Ile Cys Gly Gln Ser Phe Arg His Gly Ser Ser Tyr Arg Leu             580 585 590 His Leu Arg Val His His Asp Asp Lys Arg Tyr Glu Cys Asp Glu Cys         595 600 605 Gly Lys Thr Phe Ile Arg His Hisp His Leu Thr Lys His Lys Lys Ile     610 615 620 His Ser Gly Glu Lys Ala His Gln Cys Glu Glu Cys Gly Lys Cys Phe 625 630 635 640 Gly Arg Arg Asp His Leu Thr Val His Tyr Lys Ser Val His Leu Gly                 645 650 655 Glu Lys Val Trp Gln Lys Tyr Lys Ala Thr Phe His Gln Cys Asp Val             660 665 670 Cys Lys Lys Ile Phe Lys Gly Lys Ser Ser Leu Glu Met His Phe Arg         675 680 685 Thr His Ser Gly Glu Lys Pro Tyr Lys Cys Gln Ile Cys Asn Gln Ser     690 695 700 Phe Arg Ile Lys Lys Thr Leu Thr Lys His Leu Val Ile His Ser Asp 705 710 715 720 Ala Arg Pro Phe Asn Cys Gln His Cys Asn Ala Thr Phe Lys Arg Lys                 725 730 735 Asp Lys Leu Lys Tyr His Ile Asp His Val His Glu Ile Lys Ser Pro             740 745 750 Asp Asp Pro Leu Ser Thr Ser Glu Glu Lys Leu Val Ser Leu Pro Val         755 760 765 Glu Tyr Ser Ser Asp Asp Lys Ile Phe Gln Thr Glu Thr Lys Gln Tyr     770 775 780 Met Asp Gln Pro Lys Val Tyr Gln Ser Glu Ala Lys Thr Met Leu Gln 785 790 795 800 Asn Val Ser Ala Glu Val Cys Val Pro Val Thr Leu Val Pro Val Gln                 805 810 815 Met Pro Asp Thr Pro Ser Asp Leu Val Arg His Thr Thr Thr Leu Pro             820 825 830 Pro Ser Ser His Glu Ile Leu Ser Pro Gln Pro Gln Ser Thr Asp Tyr         835 840 845 Pro Arg Ala Ala Asp Leu Ala Phe Leu Glu Lys Tyr Thr Leu Thr Pro     850 855 860 Gln Pro Ala Asn Ile Val His Pro Val Arg Pro Glu Gln Met Leu Asp 865 870 875 880 Pro Arg Glu Gln Ser Tyr Leu Gly Thr Leu Leu Gly Leu Asp Ser Thr                 885 890 895 Thr Gly Val Gln Asn Ile Ser Thr Asn Glu His His Ser             900 905 <210> 17 <211> 2439 <212> PRT <213> Homo sapiens <400> 17 Met Val Gln Arg Trp Leu Leu Leu Ser Cys Cys Gly Ala Leu Leu Ser   1 5 10 15 Ala Gly Leu Ala Asn Thr Ser Tyr Thr Ser Pro Gly Leu Gln Arg Leu              20 25 30 Lys Asp Ser Pro Gln Thr Ala Pro Asp Lys Gly Gln Cys Ser Thr Trp          35 40 45 Gly Ala Gly His Phe Ser Thr Phe Asp His His Val Tyr Asp Phe Ser      50 55 60 Gly Thr Cys Asn Tyr Ile Phe Ala Ala Thr Cys Lys Asp Ala Phe Pro  65 70 75 80 Thr Phe Ser Val Gln Leu Arg Arg Gly Pro Asp Gly Ser Ile Ser Arg                  85 90 95 Ile Ile Val Glu Leu Gly Ala Ser Val Val Thr Val Ser Glu Ala Ile             100 105 110 Ile Ser Val Lys Asp Ile Gly Val Ile Ser Leu Pro Tyr Thr Ser Asn         115 120 125 Gly Leu Gln Ile Thr Pro Phe Gly Gln Ser Val Arg Leu Val Ala Lys     130 135 140 Gln Leu Glu Leu Glu Leu Glu Val Val Trp Gly Pro Asp Ser His Leu 145 150 155 160 Met Val Leu Val Glu Arg Lys Tyr Met Gly Gln Met Cys Gly Leu Cys                 165 170 175 Gly Asn Phe Asp Gly Lys Val Thr Asn Glu Phe Val Ser Glu Glu Gly             180 185 190 Lys Phe Leu Glu Pro His Lys Phe Ala Ala Leu Gln Lys Leu Asp Asp         195 200 205 Pro Gly Glu Ile Cys Thr Phe Gln Asp Ile Pro Ser Thr His Val Arg     210 215 220 Gln Ala Gln His Ala Arg Ile Cys Thr Gln Leu Leu Thr Leu Val Ala 225 230 235 240 Pro Glu Cys Ser Val Ser Lys Glu Pro Phe Val Leu Ser Cys Gln Ala                 245 250 255 Asp Val Ala Ala Ala Pro Gln Pro Gly Pro Gln Asn Ser Ser Cys Ala             260 265 270 Thr Leu Ser Glu Tyr Ser Arg Gln Cys Ser Met Val Gly Gln Pro Val         275 280 285 Arg Arg Trp Arg Ser Pro Gly Leu Cys Ser Val Gly Gln Cys Pro Ala     290 295 300 Asn Gln Val Tyr Gln Glu Cys Gly Ser Ala Cys Val Lys Thr Cys Ser 305 310 315 320 Asn Pro Gln His Ser Cys Ser Ser Ser Cys Thr Phe Gly Cys Phe Cys                 325 330 335 Pro Glu Gly Thr Val Leu Asn Asp Leu Ser Asn Asn His Thr Cys Val             340 345 350 Pro Val Thr Gln Cys Pro Cys Val Leu His Gly Ala Met Tyr Ala Pro         355 360 365 Gly Glu Val Thr Ile Ala Ala Cys Gln Thr Cys Arg Cys Thr Leu Gly     370 375 380 Arg Trp Val Cys Thr Glu Arg Pro Cys Pro Gly His Cys Ser Leu Glu 385 390 395 400 Gly Gly Ser Phe Val Thr Thr Phe Asp Ala Arg Pro Tyr Arg Phe His                 405 410 415 Gly Thr Cys Thr Tyr Ile Leu Leu Gln Ser Pro Gln Leu Pro Glu Asp             420 425 430 Gly Ala Leu Met Ala Val Tyr Asp Lys Ser Gly Val Ser His Ser Glu         435 440 445 Thr Ser Leu Val Ala Val Val Tyr Leu Ser Arg Gln Asp Lys Ile Val     450 455 460 Ile Ser Gln Asp Glu Val Val Thr Asn Asn Gly Glu Ala Lys Trp Leu 465 470 475 480 Pro Tyr Lys Thr Arg Asn Ile Thr Val Phe Arg Gln Thr Ser Thr His                 485 490 495 Leu Gln Met Ala Thr Ser Phe Gly Leu Glu Leu Val Val Gln Leu Arg             500 505 510 Pro Ile Phe Gln Ala Tyr Val Thr Val Gly Pro Gln Phe Arg Gly Gln         515 520 525 Thr Arg Gly Leu Cys Gly Asn Phe Asn Gly Asp Thr Thr Asp Asp Phe     530 535 540 Thr Thr Ser Met Gly Ile Ala Glu Gly Thr Ala Ser Leu Phe Val Asp 545 550 555 560 Ser Trp Arg Ala Gly Asn Cys Pro Ala Ala Leu Glu Arg Glu Thr Asp                 565 570 575 Pro Cys Ser Met Ser Gln Leu Asn Lys Val Cys Ala Glu Thr His Cys             580 585 590 Ser Met Leu Leu Arg Thr Gly Thr Val Phe Glu Arg Cys His Ala Thr         595 600 605 Val Asn Pro Ala Pro Phe Tyr Lys Arg Cys Val Tyr Gln Ala Cys Asn     610 615 620 Tyr Glu Glu Thr Phe Pro His Ile Cys Ala Ala Leu Gly Asp Tyr Val 625 630 635 640 His Ala Cys Ser Leu Arg Gly Val Leu Leu Trp Gly Trp Arg Ser Ser                 645 650 655 Val Asp Asn Cys Thr Ile Pro Cys Thr Gly Asn Thr Thr Phe Ser Tyr             660 665 670 Asn Ser Gln Ala Cys Glu Arg Thr Cys Leu Ser Leu Ser Asp Arg Ala         675 680 685 Thr Glu Cys His His Ser Ala Val Pro Val Asp Gly Cys Asn Cys Pro     690 695 700 Asp Gly Thr Tyr Leu Asn Gln Lys Gly Glu Cys Val Arg Lys Ala Gln 705 710 715 720 Cys Pro Cys Ile Leu Glu Gly Tyr Lys Phe Ile Leu Ala Glu Gln Ser                 725 730 735 Thr Val Ile Asn Gly Ile Thr Cys His Cys Ile Asn Gly Arg Leu Ser             740 745 750 Cys Pro Gln Arg Pro Gln Met Phe Leu Ala Ser Cys Gln Ala Pro Lys         755 760 765 Thr Phe Lys Ser Cys Ser Gln Ser Ser Glu Asn Lys Phe Gly Ala Ala     770 775 780 Cys Ala Pro Thr Cys Gln Met Leu Ala Thr Gly Val Ala Cys Val Pro 785 790 795 800 Thr Lys Cys Glu Pro Gly Cys Val Cys Ala Glu Gly Leu Tyr Glu Asn                 805 810 815 Ala Asp Gly Gln Cys Val Pro Pro Glu Glu Cys Pro Cys Glu Phe Ser             820 825 830 Gly Val Ser Tyr Pro Gly Gly Ala Glu Leu His Thr Asp Cys Arg Thr         835 840 845 Cys Ser Cys Ser Arg Gly Arg Trp Ala Cys Gln Gln Gly Thr His Cys     850 855 860 Pro Ser Thr Cys Thr Leu Tyr Gly Glu Gly His Val Ile Thr Phe Asp 865 870 875 880 Gly Gln Arg Phe Val Phe Asp Gly Asn Cys Glu Tyr Ile Leu Ala Thr                 885 890 895 Asp Val Cys Gly Val Asn Asp Ser Gln Pro Thr Phe Lys Ile Leu Thr             900 905 910 Glu Asn Val Ile Cys Gly Asn Ser Gly Val Thr Cys Ser Arg Ala Ile         915 920 925 Lys Ile Phe Leu Gly Gly Leu Ser Val Val Leu Ala Asp Arg Asn Tyr     930 935 940 Thr Val Thr Gly Glu Glu Pro His Val Gln Leu Gly Val Thr Pro Gly 945 950 955 960 Ala Leu Ser Leu Val Val Asp Ile Ser Ile Pro Gly Arg Tyr Asn Leu                 965 970 975 Thr Leu Ile Trp Asn Arg His Met Thr Ile Leu Ile Arg Ile Ala Arg             980 985 990 Ala Ser Gln Asp Pro Leu Cys Gly Leu Cys Gly Asn Phe Asn Gly Asn         995 1000 1005 Met Lys Asp Asp Phe Glu Thr Arg Ser Ser Tyr Val Ala Ser Ser Glu    1010 1015 1020 Leu Glu Leu Val Asn Ser Trp Lys Glu Ser Pro Leu Cys Gly Asp Val 1025 1030 1035 1040 Ser Phe Val Thr Asp Pro Cys Ser Leu Asn Ala Phe Arg Arg Ser Trp                1045 1050 1055 Ala Glu Arg Lys Cys Ser Val Ile Asn Ser Gln Thr Phe Ala Thr Cys            1060 1065 1070 His Ser Lys Val Tyr His Leu Pro Tyr Tyr Glu Ala Cys Val Arg Asp        1075 1080 1085 Ala Cys Gly Cys Asp Ser Gly Gly Asp Cys Glu Cys Leu Cys Asp Ala    1090 1095 1100 Val Ala Tyr Ala Gln Ala Cys Leu Asp Lys Gly Val Cys Val Asp 1105 1110 1115 1120 Trp Arg Thr Pro Ala Phe Cys Pro Ile Tyr Cys Gly Phe Tyr Asn Thr                1125 1130 1135 His Thr Gln Asp Gly His Gly Glu Tyr Gln Tyr Thr Gln Glu Ala Asn            1140 1145 1150 Cys Thr Trp His Tyr Gln Pro Cys Leu Cys Pro Ser Gln Pro Gln Ser        1155 1160 1165 Val Pro Gly Ser Asn Ile Glu Gly Cys Tyr Asn Cys Ser Gln Asp Glu    1170 1175 1180 Tyr Phe Asp His Glu Glu Gly Val Cys Val Pro Cys Met Pro Pro Thr 1185 1190 1195 1200 Thr Pro Gln Pro Pro Thr Thr Pro Gln Leu Pro Thr Thr Gly Ser Arg                1205 1210 1215 Pro Thr Gln Val Trp Pro Met Thr Gly Thr Ser Thr Thr Ile Gly Leu            1220 1225 1230 Leu Ser Ser Thr Gly Pro Ser Ser Ser Ser Asn His Thr Pro Ala Ser        1235 1240 1245 Pro Thr Gln Thr Pro Leu Leu Pro Ala Thr Leu Thr Ser Ser Lys Pro    1250 1255 1260 Thr Ala Ser Ser Gly Glu Pro Pro Arg Pro Thr Thr Ala Val Thr Pro 1265 1270 1275 1280 Gln Ala Thr Ser Gly Le Pro Pro Thr Ala Thr Leu Arg Ser Thr Ala                1285 1290 1295 Thr Lys Pro Thr Val Thr Gln Ala Thr Thr Arg Ala Thr Ala Ser Thr            1300 1305 1310 Ala Ser Pro Ala Thr Thr Ser Thr Ala Gln Ser Thr Thr Arg Thr Thr        1315 1320 1325 Met Thr Leu Pro Thr Pro Ala Thr Ser Gly Thr Ser Pro Thr Leu Pro    1330 1335 1340 Lys Ser Thr Asn Gln Glu Leu Pro Gly Thr Thr Ala Thr Gln Thr Thr 1345 1350 1355 1360 Gly Pro Arg Pro Thr Pro Ala Ser Thr Thr Gly Pro Thr Thr Pro Gln                1365 1370 1375 Pro Gly Gln Pro Thr Arg Pro Thr Ala Thr Glu Thr Thr Gln Thr Arg            1380 1385 1390 Thr Thr Thr Glu Tyr Thr Thr Pro Gln Thr Pro His Thr Thr His Ser        1395 1400 1405 Pro Pro Thr Ala Gly Ser Pro Val Ser Ser Thr Gly Pro Val Thr Ala    1410 1415 1420 Thr Ser Phe His Ala Thr Thr Thr Tyr Pro Thr Pro Ser Ser Pro Glu 1425 1430 1435 1440 Thr Thr Leu Pro Thr His Val Pro Pro Phe Ser Thr Ser Leu Val Thr                1445 1450 1455 Pro Ser Thr His Thr Val Ile Thr Pro Thr His Ala Gln Met Ala Thr            1460 1465 1470 Ser Ala Ser Asn His Ser Ala Pro Thr Gly Thr Ile Pro Pro Thr        1475 1480 1485 Thr Leu Lys Ala Thr Gly Ser Thr His Thr Ala Pro Pro Ile Thr Pro    1490 1495 1500 Thr Thr Ser Gly Thr Ser Gln Ala His Ser Ser Phe Ser Thr Asn Lys 1505 1510 1515 1520 Thr Pro Thr Ser Leu His Ser His Thr Ser Ser Thr His His Pro Glu                1525 1530 1535 Val Thr Pro Thr Ser Thr Thr Thr Ile Thr Pro Asn Pro Thr Ser Thr            1540 1545 1550 Arg Thr Arg Thr Pro Val Ala His Thr Asn Ser Ala Thr Ser Ser Arg        1555 1560 1565 Pro Pro Pro Phe Thr Thr His Ser Pro Thr Gly Ser Ser Pro    1570 1575 1580 Phe Ser Ser Thr Gly Pro Met Thr Ala Thr Ser Phe Lys Thr Thr Thr 1585 1590 1595 1600 Thr Tyr Pro Thr Pro Ser His Pro Gln Thr Thr Leu Pro Thr His Val                1605 1610 1615 Pro Pro Phe Ser Thr Ser Leu Val Thr Pro Ser Thr His Thr Val Ile            1620 1625 1630 Thr Pro Thr His Ala Gln Met Ala Thr Ser Ala Ser Ile His Ser Met        1635 1640 1645 Pro Thr Gly Thr Ile Pro Pro Thr Thr Leu Lys Ala Thr Gly Ser    1650 1655 1660 Thr His Thr Ala Pro Thr Met Thr Leu Thr Thr Ser Gly Thr Ser Gln 1665 1670 1675 1680 Ala Leu Ser Ser Leu Asn Thr Ala Lys Thr Ser Thr Ser Leu His Ser                1685 1690 1695 His Thr Ser Thr His His Ala Glu Ala Thr Ser Thr Ser Thr Thr            1700 1705 1710 Asn Ile Thr Pro Asn Pro Thr Ser Thr Gly Thr Pro Pro Met Thr Val        1715 1720 1725 Thr Thr Ser Gly Thr Ser Gln Ser Arg Ser Ser Phe Ser Thr Ala Lys    1730 1735 1740 Thr Ser Thr Ser Leu His Ser His Thr Ser Ser Thr His His Pro Glu 1745 1750 1755 1760 Val Thr Ser Thr Ser Thr Thr Ser Ile Thr Pro Asn His Thr Ser Thr                1765 1770 1775 Gly Thr Arg Thr Pro Val Ala His Thr Thr Ser Ala Thr Ser Ser Arg            1780 1785 1790 Leu Pro Thr Pro Phe Thr Thr His Ser Pro Thr Gly Thr Thr Pro        1795 1800 1805 Ile Ser Ser Thr Gly Pro Thr Thr Ser Thr Ser Thr Thr Thr    1810 1815 1820 Thr Tyr Pro Thr Pro Ser His Pro His Thr Thr Leu Pro Thr His Val 1825 1830 1835 1840 Pro Ser Phe Ser Thr Ser Leu Val Thr Pro Ser Thr His Thr Val Ile                1845 1850 1855 Ile Pro Thr His Thr Gln Met Ala Thr Ser Ala Ser Ile His Ser Met            1860 1865 1870 Pro Thr Gly Thr Ile Pro Pro Thr Thr Ile Lys Ala Thr Gly Ser        1875 1880 1885 Thr His Thr Ala Pro Pro Met Thr Pro Thr Thr Ser Gly Thr Ser Gln    1890 1895 1900 Ser Ser Ser Ser Pro Th Ser 1905 1910 1915 1920 His Thr Ser Thr His His Pro Glu Val Thr Pro Thr Ser Thr Thr                1925 1930 1935 Asn Ile Thr Pro Lys His Thr Ser Thr Gly Thr Arg Thr Pro Val Ala            1940 1945 1950 His Thr Thr Ser Ala Ser Ser Ser Leu Pro Thr Pro Phe Thr Thr        1955 1960 1965 His Ser Pro Thr Gly Ser Ser Pro Phe Ser Ser Thr Gly Pro Met    1970 1975 1980 Thr Ala Thr Ser Phe Gln Thr Thr Thr Thr Tyr Pro Thr Pro Ser His 1985 1990 1995 2000 Pro Gln Thr Thr Leu Pro Thr His Val Pro Pro Phe Ser Thr Ser Leu                2005 2010 2015 Val Thr Pro Ser Thr His Thr Val Ile Ile Thr Thr His Thr Gln Met            2020 2025 2030 Ala Thr Ser Ala Ser Ile His Ser Thr Pro Thr Gly Thr Val Pro Pro        2035 2040 2045 Pro Thr Thr Leu Lys Ala Thr Gly Ser Thr His Thr Ala Pro Pro Met    2050 2055 2060 Thr Val Thr Thr Ser Gly Thr Ser Gln Thr His Ser Ser Phe Ser Thr 2065 2070 2075 2080 Ala Thr Ala Ser Ser Phe Ile Ser Ser Ser Serp Leu Pro Gln                2085 2090 2095 Asn Ser Ser Ser Pro Pro Ser Ser Pro Ile Thr Thr Gln Leu Pro            2100 2105 2110 His Leu Ser Ser Ala Thr Thr Pro Val Ser Thr Thr Asn Gln Leu Ser        2115 2120 2125 Ser Ser Phe Ser Ser Ser Ser Ser Ser Tyr    2130 2135 2140 Val Ser Ser Ser His Ser Ser Pro Gln Thr Ser Ser Ser Ser Val Gly 2145 2150 2155 2160 Thr Ser Ser Phe Val Ser Ala Pro Val His Ser Thr Thr Leu Ser                2165 2170 2175 Ser Gly Ser His Ser Ser Leu Ser Thr His Pro Thr Thr Ala Ser Val            2180 2185 2190 Ser Ala Ser Pro Leu Phe Pro Ser Ser Pro Ala Ala Ser Thr Thr Ile        2195 2200 2205 Arg Ala Thr Leu Pro His Thr Ile Ser Ser Pro Phe Thr Leu Ser Ala    2210 2215 2220 Leu Leu Pro Ile Ser Thr Val Thr Val Ser Pro Thr Pro Ser Ser His 2225 2230 2235 2240 Leu Ala Ser Ser Thr Ile Ala Phe Pro Ser Thr Pro Arg Thr Thr Ala                2245 2250 2255 Ser Thr His Thr Ala Pro Ala Phe Ser Ser Gln Ser Thr Thr Ser Arg            2260 2265 2270 Ser Thr Ser Leu Thr Thr Arg Val Pro Thr Ser Gly Phe Val Ser Leu        2275 2280 2285 Thr Ser Gly Val Thr Gly Ile Pro Thr Ser Pro Val Thr Asn Leu Thr    2290 2295 2300 Thr Arg His Pro Gly Pro Thr Leu Ser Pro Thr Thr Arg Phe Leu Thr 2305 2310 2315 2320 Ser Ser Leu Thr Ala His Gly Ser Thr Pro Ala Ser Ala Pro Val Ser                2325 2330 2335 Ser Leu Gly Thr Pro Thr Pro Thr Ser Pro Gly Val Cys Ser Val Arg            2340 2345 2350 Glu Gln Gln Glu Glu Ile Thr Phe Lys Gly Cys Met Ala Asn Val Thr        2355 2360 2365 Val Thr Arg Cys Glu Gly Ala Cys Ile Ser Ala Ala Ser Phe Asn Ile    2370 2375 2380 Ile Thr Gln Gln Val Asp Ala Arg Cys Ser Cys Cys Arg Pro Leu His 2385 2390 2395 2400 Ser Tyr Glu Gln Gln Leu Glu Leu Pro Cys Pro Asp Pro Ser Thr Pro                2405 2410 2415 Gly Arg Arg Leu Val Leu Thr Leu Gln Val Phe Ser His Cys Val Cys            2420 2425 2430 Ser Ser Val Ala Cys Gly Asp        2435 <210> 18 <211> 619 <212> PRT <213> Homo sapiens <400> 18 Met Leu Leu Ser Trp Leu Thr Val Leu Gly Ala Gly Met Val Val Leu   1 5 10 15 His Phe Leu Gln Lys Leu Leu Phe Pro Tyr Phe Trp Asp Asp Phe Trp              20 25 30 Phe Val Leu Lys Val Val Leu Ile Ile Ile Arg Leu Lys Lys Tyr Glu          35 40 45 Lys Arg Gly Glu Leu Val Thr Val Leu Asp Lys Phe Leu Ser His Ala      50 55 60 Lys Arg Gln Pro Arg Lys Pro Phe Ile Ile Tyr Glu Gly Asp Ile Tyr  65 70 75 80 Thr Tyr Gln Asp Val Asp Lys Arg Ser Ser Arg Val Ala His Val Phe                  85 90 95 Leu Asn His Ser Ser Leu Lys Lys Gly Asp Thr Val Ala Leu Leu Met             100 105 110 Ser Asn Glu Pro Asp Phe Val His Val Trp Phe Gly Leu Ala Lys Leu         115 120 125 Gly Cys Val Val Ala Phe Leu Asn Thr Asn Ile Arg Ser Asn Ser Leu     130 135 140 Leu Asn Cys Ile Arg Ala Cys Gly Pro Arg Ala Leu Val Val Gly Ala 145 150 155 160 Asp Leu Leu Gly Thr Val Glu Glu Ile Leu Pro Ser Leu Ser Glu Asn                 165 170 175 Ile Ser Val Trp Gly Met Lys Asp Ser Val Pro Gln Gly Val Ile Ser             180 185 190 Leu Lys Glu Lys Leu Ser Thr Ser Pro Asp Glu Pro Val Pro Arg Ser         195 200 205 His His Val Ser Leu Leu Lys Ser Thr Cys Leu Tyr Ile Phe Thr     210 215 220 Ser Gly Thr Thr Gly Leu Pro Lys Ala Ala Val Ile Ser Gln Leu Gln 225 230 235 240 Val Leu Arg Gly Ser Ala Val Leu Trp Ala Phe Gly Cys Thr Ala His                 245 250 255 Asp Ile Val Tyr Ile Thr Leu Pro Leu Tyr His Ser Ser Ala Ala Ile             260 265 270 Leu Gly Ile Ser Gly Cys Val Glu Leu Gly Ala Thr Cys Val Leu Lys         275 280 285 Lys Lys Phe Ser Ala Ser Gln Phe Trp Ser Asp Cys Lys Lys Tyr Asp     290 295 300 Val Thr Val Phe Gln Tyr Ile Gly Glu Leu Cys Arg Tyr Leu Cys Lys 305 310 315 320 Gln Ser Lys Arg Glu Gly Glu Lys Asp His Lys Val Arg Leu Ala Ile                 325 330 335 Gly Asn Gly Ile Arg Ser Asp Val Trp Arg Glu Phe Leu Asp Arg Phe             340 345 350 Gly Asn Ile Lys Val Cys Glu Leu Tyr Ala Ala Thr Glu Ser Ser Ile         355 360 365 Ser Phe Met Asn Tyr Thr Gly Arg Ile Gly Ala Ile Gly Arg Thr Asn     370 375 380 Leu Phe Tyr Lys Leu Leu Ser Thr Phe Asp Leu Ile Lys Tyr Asp Phe 385 390 395 400 Gln Lys Asp Glu Pro Met Arg Asn Glu Gln Gly Trp Cys Ile His Val                 405 410 415 Lys Lys Gly Glu Pro Gly Leu Leu Ile Ser Arg Val Asn Ala Lys Asn             420 425 430 Pro Phe Phe Gly Tyr Ala Gly Pro Tyr Lys His Thr Lys Asp Lys Leu         435 440 445 Leu Cys Asp Val Phe Lys Lys Gly Asp Val Tyr Leu Asn Thr Gly Asp     450 455 460 Leu Ile Val Gln Asp Gln Asp Asn Phe Leu Tyr Phe Trp Asp Arg Thr 465 470 475 480 Gly Asp Thr Phe Arg Trp Lys Gly Glu Asn Val Ala Thr Thr Glu Val                 485 490 495 Ala Asp Val Ile Gly Met Leu Asp Phe Ile Gln Glu Ala Asn Val Tyr             500 505 510 Gly Val Ala Ile Ser Gly Tyr Glu Gly Arg Ala Gly Met Ala Ser Ile         515 520 525 Ile Leu Lys Pro Asn Thr Ser Leu Asp Leu Glu Lys Val Tyr Glu Gln     530 535 540 Val Val Thr Phe Leu Pro Ala Tyr Ala Cys Pro Arg Phe Leu Arg Ile 545 550 555 560 Gln Glu Lys Met Glu Ala Thr Gly Thr Phe Lys Leu Leu Lys His Gln                 565 570 575 Leu Val Glu Asp Gly Phe Asn Pro Leu Lys Ile Ser Glu Pro Leu Tyr             580 585 590 Phe Met Asp Asn Leu Lys Lys Ser Tyr Val Leu Leu Thr Arg Glu Leu         595 600 605 Tyr Asp Gln Ile Met Leu Gly Glu Ile Lys Leu     610 615 <210> 19 <211> 466 <212> PRT <213> Homo sapiens <400> 19 Met Ala Phe Val Leu Ile Leu Val Leu Ser Phe Tyr Glu Leu Val Ser   1 5 10 15 Gly Gln Trp Gln Val Thr Gly Pro Gly Lys Phe Val Gln Ala Leu Val              20 25 30 Gly Glu Asp Ala Val Phe Ser Cys Ser Leu Phe Pro Glu Thr Ser Ala          35 40 45 Glu Ala Met Glu Val Arg Phe Phe Arg Asn Gln Phe His Ala Val Val      50 55 60 His Leu Tyr Arg Asp Gly Glu Asp Trp Glu Ser Lys Gln Met Pro Gln  65 70 75 80 Tyr Arg Gly Arg Thr Glu Phe Val Lys Asp Ser Ile Ala Gly Gly Arg                  85 90 95 Val Ser Leu Arg Leu Lys Asn Ile Thr Pro Ser Asp Ile Gly Leu Tyr             100 105 110 Gly Cys Trp Phe Ser Ser Gln Ile Tyr Asp Glu Glu Ala Thr Trp Glu         115 120 125 Leu Arg Val Ala Leu Gly Ser Leu Pro Leu Ile Ser Ile Val Gly     130 135 140 Tyr Val Asp Gly Gly Ile Gln Leu Leu Cys Leu Ser Ser Gly Trp Phe 145 150 155 160 Pro Gln Pro Thr Ala Lys Trp Lys Gly Pro Gln Gly Gln Asp Leu Ser                 165 170 175 Ser Asp Ser Arg Ala Asn Ala Asp Gly Tyr Ser Leu Tyr Asp Val Glu             180 185 190 Ile Ser Ile Ile Val Gln Glu Asn Ala Gly Ser Ile Leu Cys Ser Ile         195 200 205 His Leu Ala Glu Gln Ser His Glu Val Glu Ser Lys Val Leu Ile Gly     210 215 220 Glu Thr Phe Gln Pro Ser Pro Trp Arg Leu Ala Ser Ile Leu Leu 225 230 235 240 Gly Leu Leu Cys Gly Ala Leu Cys Gly Val Val Met Gly Met Ile Ile                 245 250 255 Val Phe Phe Lys Ser Lys Gly Lys Ile Gln Ala Glu Leu Asp Trp Arg             260 265 270 Arg Lys His Gly Gln Ala Glu Leu Arg Asp Ala Arg Lys His Ala Val         275 280 285 Glu Val Thr Leu Asp Pro Glu Thr Ala His Pro Lys Leu Cys Val Ser     290 295 300 Asp Leu Lys Thr Val Thr His Arg Lys Ala Pro Gln Glu Val Pro His 305 310 315 320 Ser Glu Lys Arg Phe Thr Arg Lys Ser Val Val Ala Ser Gln Gly Phe                 325 330 335 Gln Ala Gly Lys His Tyr Trp Glu Val Asp Val Gly Gln Asn Val Gly             340 345 350 Trp Tyr Val Gly Val Cys Arg Asp Asp Val Asp Arg Gly Lys Asn Asn         355 360 365 Val Thr Leu Ser Pro Asn Asn Gly Tyr Trp Val Leu Arg Leu Thr Thr     370 375 380 Glu His Leu Tyr Phe Thr Phe Asn Pro His Phe Ile Ser Leu Pro Pro 385 390 395 400 Ser Thr Pro Pro Thr Arg Val Gly Val Phe Leu Asp Tyr Glu Gly Gly                 405 410 415 Thr Ile Ser Phe Phe Asn Thr Asn Asp Gln Ser Leu Ile Tyr Thr Leu             420 425 430 Leu Thr Cys Gln Phe Glu Gly Leu Leu Arg Pro Tyr Ile Gln His Ala         435 440 445 Met Tyr Asp Glu Glu Lys Gly Thr Pro Ile Phe Ile Cys Pro Val Ser     450 455 460 Trp Gly 465 <210> 20 <211> 1353 <212> PRT <213> Homo sapiens <400> 20 Met Leu Asp Pro Ser Ser Glu Glu Glu Ser Asp Glu Ile Val Glu   1 5 10 15 Glu Glu Ser Gly Lys Glu Val Leu Gly Ser Ala Pro Ser Gly Ala Arg              20 25 30 Leu Ser Pro Ser Arg Thr Ser Glu Gly Ser Ala Gly Ser Ala Gly Leu          35 40 45 Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Aly Gly Gly Gly      50 55 60 Gly Gly Ser Gly Ala Ser Ser Gly Gly Gly Ala Gly Gly Leu Gln Pro  65 70 75 80 Ser Ser Arg Ala Gly Gly Gly Arg Pro Ser Ser Ser Ser Ser Ser Ser                  85 90 95 Val Ser Glu Lys Glu Lys Glu Glu Leu Glu Arg Leu Gln Lys Glu Glu             100 105 110 Glu Glu Arg Lys Lys Arg Leu Gln Leu Tyr Val Phe Val Met Arg Cys         115 120 125 Ile Ala Tyr Pro Phe Asn Ala Lys Gln Pro Thr Asp Met Ala Arg Arg     130 135 140 Gln Gln Lys Ile Ser Lys Gln Gln Leu Gln Thr Val Lys Asp Arg Phe 145 150 155 160 Gln Ala Phe Leu Asn Gly Glu Thr Gln Ile Met Ala Asp Glu Ala Phe                 165 170 175 Met Asn Ala Val Gln Ser Tyr Tyr Glu Val Phe Leu Lys Ser Asp Arg             180 185 190 Val Ala Arg Met Met Gln Ser Gly Gly Cys Ser Ala Asn Asp Ser Arg         195 200 205 Glu Val Phe Lys Lys His Ile Glu Lys Arg Val Val Arg Ser Ser Pro Pro Glu     210 215 220 Ile Asp Gly Leu Ser Lys Glu Thr Val Leu Ser Ser Trp Met Ala Lys 225 230 235 240 Phe Asp Ala Ile Tyr Arg Gly Glu Glu Asp Pro Arg Lys Gln Gln Ala                 245 250 255 Arg Met Thr Ala Ser Ala Ala Ser Glu Leu Ile Leu Ser Lys Glu Gln             260 265 270 Leu Tyr Glu Met Phe Gln Asn Ile Leu Gly Ile Lys Lys Phe Glu His         275 280 285 Gln Leu Leu Tyr Asn Ala Cys Gln Leu Asp Asn Pro Asp Glu Gln Ala     290 295 300 Ala Gln Ile Arg Arg Glu Leu Asp Gly Arg Leu Gln Met Ala Asp Gln 305 310 315 320 Ile Ala Arg Glu Arg Lys Phe Pro Lys Phe Val Ser Lys Glu Met Glu                 325 330 335 Asn Met Tyr Ile Glu Glu Leu Lys Ser Ser Val Asn Leu Leu Met Ala             340 345 350 Asn Leu Glu Ser Met Pro Val Ser Lys Gly Gly Glu Phe Lys Leu Gln         355 360 365 Lys Leu Lys Arg Ser His Asn Ala Ser Ile Ile Asp Met Gly Glu Glu     370 375 380 Ser Glu Asn Gln Leu Ser Lys Ser Asp Val Val Leu Ser Phe Ser Leu 385 390 395 400 Glu Val Val Ile Met Glu Val Gln Gly Leu Lys Ser Leu Ala Pro Asn                 405 410 415 Arg Ile Val Tyr Cys Thr Met Glu Val Glu Gly Gly Glu Lys Leu Gln             420 425 430 Thr Asp Gln Ala Glu Ala Ser Lys Pro Thr Trp Gly Thr Gln Gly Asp         435 440 445 Phe Ser Thr Thr His Ala Leu Pro Ala Val Lys Val Lys Leu Phe Thr     450 455 460 Glu Ser Thr Gly Val Leu Ala Leu Glu Asp Lys Glu Leu Gly Arg Val 465 470 475 480 Ile Leu His Pro Thr Pro Asn Ser Pro Lys Gln Ser Glu Trp His Lys                 485 490 495 Met Thr Val Ser Lys Asn Cys Pro Asp Gln Asp Leu Lys Ile Lys Leu             500 505 510 Ala Val Arg Met Asp Lys Pro Gln Asn Met Lys His Ser Gly Tyr Leu         515 520 525 Trp Ala Ile Gly Lys Asn Val Trp Lys Arg Trp Lys Lys Arg Phe Phe     530 535 540 Val Leu Val Gln Val Ser Gln Tyr Thr Phe Ala Met Cys Ser Tyr Arg 545 550 555 560 Glu Lys Lys Ala Glu Pro Gln Glu Leu Leu Gln Leu Asp Gly Tyr Thr                 565 570 575 Val Asp Tyr Thr Asp Pro Gln Pro Gly Leu Glu Gly Gly Arg Ala Phe             580 585 590 Phe Asn Ala Val Lys Glu Gly Asp Thr Val Ile Phe Ala Ser Asp Asp         595 600 605 Glu Gln Asp Arg Ile Leu Trp Val Gln Ala Met Tyr Arg Ala Thr Gly     610 615 620 Gln Ser His Lys Pro Val Pro Pro Thr Gln Val Gln Lys Leu Asn Ala 625 630 635 640 Lys Gly Gly Asn Val Pro Gln Leu Asp Ala Pro Ile Ser Gln Phe Tyr                 645 650 655 Ala Asp Arg Ala Gln Lys His Gly Met Asp Glu Phe Ile Ser Ser Asn             660 665 670 Pro Cys Asn Phe Asp His Ala Ser Leu Phe Glu Met Val Gln Arg Leu         675 680 685 Thr Leu Asp His Arg Leu Asn Asp Ser Tyr Ser Cys Leu Gly Trp Phe     690 695 700 Ser Pro Gly Gln Val Phe Val Leu Asp Glu Tyr Cys Ala Arg Asn Gly 705 710 715 720 Val Arg Gly Cys His Arg His Leu Cys Tyr Leu Arg Asp Leu Leu Glu                 725 730 735 Arg Ala Glu Asn Gly Ala Met Ile Asp Pro Thr Leu Leu His Tyr Ser             740 745 750 Phe Ala Phe Cys Ala Ser His Val His Gly Asn Arg Pro Asp Gly Ile         755 760 765 Gly Thr Val Thr Val Glu Glu Lys Glu Arg Phe Glu Glu Ile Lys Glu     770 775 780 Arg Leu Arg Val Leu Leu Glu Asn Gln Ile Thr His Phe Arg Tyr Cys 785 790 795 800 Phe Pro Phe Gly Arg Pro Glu Gly Ala Leu Lys Ala Thr Leu Ser Leu                 805 810 815 Leu Glu Arg Val Leu Met Lys Asp Ile Val Thr Pro Val Gln Glu             820 825 830 Glu Val Lys Thr Val Ile Arg Lys Cys Leu Glu Gln Ala Ala Leu Val         835 840 845 Asn Tyr Ser Arg Leu Ser Glu Tyr Ala Lys Ile Glu Glu Asn Gln Lys     850 855 860 Asp Ala Glu Asn Val Gly Arg Leu Ile Thr Pro Ala Lys Lys Leu Glu 865 870 875 880 Asp Thr Ile Arg Leu Ala Glu Leu Val Ile Glu Val Leu Gln Gln Asn                 885 890 895 Glu Glu His His Ala Glu Pro His Val Asp Lys Gly Glu Ala Phe Ala             900 905 910 Trp Trp Ser Asp Leu Met Val Glu His Ala Glu Thr Phe Leu Ser Leu         915 920 925 Phe Ala Val Asp Met Asp Ala Ala Leu Glu Val Gln Pro Pro Asp Thr     930 935 940 Trp Asp Ser Phe Pro Leu Phe Gln Leu Leu Asn Asp Phe Leu Arg Thr 945 950 955 960 Asp Tyr Asn Leu Cys Asn Gly Lys Phe His Lys His Leu Gln Asp Leu                 965 970 975 Phe Ala Pro Leu Val Val Arg Tyr Val Asp Leu Met Glu Ser Ser Ile             980 985 990 Ala Gln Ser Ile His Arg Gly Phe Glu Arg Glu Ser Trp Glu Pro Val         995 1000 1005 Lys Ser Leu Thr Ser Asn Leu Pro Asn Val Asn Leu Pro Asn Val Asn    1010 1015 1020 Leu Pro Lys Val Pro Asn Leu Pro Val Asn Pro Pro Leu Gly Ile Pro 1025 1030 1035 1040 Gln Met Pro Thr Phe Ser Ala Pro Ser Trp Met Ala Ala Ile Tyr Asp                1045 1050 1055 Ala Asp Asn Gly Ser Gly Thr Ser Glu Asp Leu Phe Trp Lys Leu Asp            1060 1065 1070 Ala Leu Gln Thr Phe Ile Arg Asp Leu His Trp Pro Glu Glu Glu Phe        1075 1080 1085 Gly Lys His Leu Glu Gln Arg Leu Lys Leu Met Ala Ser Asp Met Ile    1090 1095 1100 Glu Ser Cys Val Lys Arg Thr Arg Ile Ala Phe Glu Val Lys Leu Gln 1105 1110 1115 1120 Lys Thr Ser Arg Ser Thr Asp Phe Arg Val Pro Gln Ser Ile Cys Thr                1125 1130 1135 Met Phe Asn Val Met Val Asp Ala Lys Ala Gln Ser Thr Lys Leu Cys            1140 1145 1150 Ser Met Glu Met Gly Gln Glu His Gln Tyr His Ser Lys Ile Asp Glu        1155 1160 1165 Leu Ile Glu Glu Thr Val Lys Glu Met Ile Thr Leu Leu Val Ala Lys    1170 1175 1180 Phe Val Thr Ile Leu Glu Gly Val Leu Ala Lys Leu Ser Arg Tyr Asp 1185 1190 1195 1200 Glu Gly Thr Leu Phe Ser Ser Phe Leu Ser Phe Thr Val Lys Ala Ala                1205 1210 1215 Ser Lys Tyr Val Asp Val Pro Lys Pro Gly Met Asp Val Ala Asp Ala            1220 1225 1230 Tyr Val Thr Phe Val Arg His Ser Gln Asp Val Leu Arg Asp Lys Val        1235 1240 1245 Asn Glu Glu Met Tyr Ile Glu Arg Leu Phe Asp Gln Trp Tyr Asn Ser    1250 1255 1260 Ser Met Asn Val Ile Cys Thr Trp Leu Thr Asp Arg Met Asp Leu Gln 1265 1270 1275 1280 Leu His Ile Tyr Gln Leu Lys Thr Leu Ile Arg Met Val Lys Lys Thr                1285 1290 1295 Tyr Arg Asp Phe Arg Leu Gln Gly Val Leu Asp Ser Thr Leu Asn Ser            1300 1305 1310 Lys Thr Tyr Glu Thr Ile Arg Asn Arg Leu Thr Val Glu Glu Ala Thr        1315 1320 1325 Ala Ser Val Ser Glu Gly Gly Gly Leu Gln Gly Ile Ser Met Lys Asp    1330 1335 1340 Ser Asp Glu Glu Asp Glu Glu Asp Asp 1345 1350 <210> 21 <211> 552 <212> PRT <213> Homo sapiens <400> 21 Met Asp Thr Ser Ser Glu Met Leu Val Arg Phe Gly Arg Arg Cys Gly   1 5 10 15 Arg Ala Lys Glu Ser Thr Glu Ile Arg Asn Ser Glu Glu Asp Gln Val              20 25 30 Leu Tyr Leu Pro Leu Leu Pro Ser Lys Val Asp Leu Gln Gln Val Thr          35 40 45 Ile Ile Pro His Asp Glu Trp Lys Arg Ile Gln Asp Ser Leu Asp Arg      50 55 60 Leu Thr Arg Glu Ala Ala Cys Leu Arg Ala Glu Arg Lys Ala Lys Lys  65 70 75 80 Glu Met His Leu Arg Ser Gln Glu Val Val Lys His Trp Thr Asn Thr                  85 90 95 Tyr Ala Gly Met Lys Glu Gln Lys Leu Glu Ala Lys Lys Lys Arg Asp             100 105 110 Glu Ile Glu Ala Glu Arg Glu Ile Leu Asp Leu Glu Glu Glu Ile         115 120 125 Tyr Lys Gln Gly Lys Arg Lys Lys Ala Ile Glu Asn Ala Lys Gln Tyr     130 135 140 Gln Phe Tyr Gln Thr Glu Arg Val Lys Asn Phe His Ser Gly Leu Leu 145 150 155 160 Leu Ser Arg Val Met Lys Glu Arg Asp Ala Gln Ile Glu Phe Arg Lys                 165 170 175 Ser Lys Ile Lys Ser Asp Lys Lys Trp Glu Glu Gln Leu Lys Leu Asn             180 185 190 Ile Glu Lys Ala Phe Lys Glu Glu Gln Glu Lys Ala Glu Lys Arg His         195 200 205 Arg Glu Arg Val Ala Leu Ala Lys Asp His Leu Lys Gln Ile Lys Glu     210 215 220 His Glu Glu Glu Glu Glu Arg Arg Lys Lys Tyr Glu Glu Lys Asp Ala 225 230 235 240 Glu Ile Lys Arg Gln Asn Ala Leu Tyr Glu Ile Glu Met Arg Lys                 245 250 255 Lys Leu Glu Lys Lys Arg Glu Glu Met His Glu Ser Arg Arg Arg Phe             260 265 270 Leu Glu His Met Gln Asp Lys His Ile Ile Lys Ala Val Glu Gln Gln         275 280 285 Gln Gln Glu Glu Glu Asp Glu Lys Met Arg Lys Phe Ile Lys Ala Lys     290 295 300 Lys Arg Leu Ile Gln Met Gly Lys Glu Lys Glu Ala Glu Thr His Arg 305 310 315 320 Leu Met Glu Lys Arg Arg Glu Arg Ile His Asn Phe Leu Ser Glu Leu                 325 330 335 Leu Lys Glu Lys Leu Asp Asn Glu Asp Met Ile Ile Ala Arg Asp Ile             340 345 350 Ala Glu Ala Glu Ala Glu Trp Glu Lys Arg Glu Arg Glu Lys Asp Glu         355 360 365 Lys Asn Lys Ala Glu Leu Lys Thr Ile Ala Glu Tyr Arg Ala Ile Val     370 375 380 Met Lys Asn Lys Glu Glu Glu Glu Arg Gln Arg Lys Ile Glu Ala Lys 385 390 395 400 Glu Gln Leu Leu Ala Val Met Lys Ala Asp Gln Ile Phe Trp Glu His                 405 410 415 Glu Lys Glu Lys Lys Cys Lys Ala Asp Lys Glu His Gln Glu Val Gln             420 425 430 Asp Ala His Ile Gln Gln Met Ala Lys Asn Lys Phe Asn Ala Lys Gln         435 440 445 Ala Lys Gln Ala Glu Leu Asp Tyr Cys Arg Leu Thr Glu Ala Leu Val     450 455 460 Ala Glu Lys Glu Lys Glu Phe Gln Asp Tyr Ala Arg Glu Val Ile Glu 465 470 475 480 Leu Glu Ser Glu Thr Thr Asn Lys Tyr Ile Tyr Pro Leu Val Lys Ala                 485 490 495 Val Gln Glu Gly Pro Gly Gly Gly Arg Gly Pro Val Phe Val Asp Arg             500 505 510 Gly Gly Leu Arg Pro Ser Tyr Gln Ala Asn Asp Val Thr Gly Val Gln         515 520 525 Leu Pro Phe Tyr Asn Ser Gln Gly Pro Lys Tyr Asn Phe Gln Lys Ser     530 535 540 Lys Arg Arg Leu Gly Phe Thr Trp 545 550 <210> 22 <211> 492 <212> PRT <213> Homo sapiens <400> 22 Met Ala Val Leu Leu Glu Thr Thr Leu Gly Asp Val Valle Asp Leu   1 5 10 15 Tyr Thr Glu Glu Arg Pro Arg Ala Cys Leu Asn Phe Leu Lys Leu Cys              20 25 30 Lys Ile Lys Tyr Tyr Asn Tyr Cys Leu Ile His Asn Val Gln Arg Asp          35 40 45 Phe Ile Ile Gln Thr Gly Asp Pro Thr Gly Thr Gly Arg Gly Gly Glu      50 55 60 Ser Ile Phe Gly Gln Leu Tyr Gly Asp Gln Ala Ser Phe Phe Glu Ala  65 70 75 80 Glu Lys Val Pro Arg Ile Lys His Lys Lys Lys Gly Thr Val Ser Met                  85 90 95 Val Asn Asn Gly Ser Asp Gln His Gly Ser Gln Phe Leu Ile Thr Thr             100 105 110 Gly Glu Asn Leu Asp Tyr Leu Asp Gly Val His Thr Val Phe Gly Glu         115 120 125 Val Thr Glu Gly Met Asp Ile Ile Lys Lys Ile Asn Glu Thr Phe Val     130 135 140 Asp Lys Asp Phe Val Pro Tyr Gln Asp Ile Arg Ile Asn His Thr Val 145 150 155 160 Ile Leu Asp Asp Pro Phe Asp Asp Pro Pro Asp Leu Leu Ile Pro Asp                 165 170 175 Arg Ser Pro Glu Pro Thr Arg Glu Gln Leu Asp Ser Gly Arg Ile Gly             180 185 190 Ala Asp Glu Glu Ile Asp Asp Phe Lys Gly Arg Ser Ala Glu Glu Val         195 200 205 Glu Glu Ile Lys Glu Ala Glu Ala Ile Leu Leu     210 215 220 Glu Met Val Gly Asp Leu Pro Asp Ala Asp Ile Lys Pro Pro Glu Asn 225 230 235 240 Val Leu Phe Val Cys Lys Leu Asn Pro Val Thr Thr Asp Glu Asp Leu                 245 250 255 Glu Ile Ile Phe Ser Arg Phe Gly Pro Ile Arg Ser Ser Cys Glu Val Ile             260 265 270 Arg Asp Trp Lys Thr Gly Glu Ser Leu Cys Tyr Ala Phe Ile Glu Phe         275 280 285 Glu Lys Glu Glu Asp Cys Glu Lys Ala Phe Phe Lys Met Asp Asn Val     290 295 300 Leu Ile Asp Asp Arg Arg Ile His Val Asp Phe Ser Gln Ser Val Ala 305 310 315 320 Lys Val Lys Trp Lys Gly Lys Gly Gly Lys Tyr Thr Lys Ser Asp Phe                 325 330 335 Lys Glu Tyr Glu Lys Glu Gln Asp Lys Pro Pro Asn Leu Val Leu Lys             340 345 350 Asp Lys Val Lys Pro Lys Gln Asp Thr Lys Tyr Asp Leu Ile Leu Asp         355 360 365 Glu Gln Ala Glu Asp Ser Lys Ser Ser His Ser His Thr Ser Lys Lys     370 375 380 His Lys Lys Lys Thr His His Cys Ser Glu Glu Lys Glu Asp Glu Asp 385 390 395 400 Tyr Met Pro Ile Lys Asn Thr Asn Gln Asp Ile Tyr Arg Glu Met Gly                 405 410 415 Phe Gly His Tyr Glu Glu Glu Glu Ser Cys Trp Glu Lys Gln Lys Ser             420 425 430 Glu Lys Arg Asp Arg Thr Gln Asn Arg Ser Ser Arg Ser Ser Ser Glu         435 440 445 Arg Asp Gly His Tyr Ser Asn Ser Ser His Lys Ser Lys Tyr Gln Thr Asp     450 455 460 Leu Tyr Glu Arg Glu Arg Ser Lys Lys Arg Asp Arg Ser Ser Arg Ser Pro 465 470 475 480 Lys Lys Ser Lys Asp Lys Glu Lys Ser Lys Tyr Arg                 485 490 <210> 23 <211> 494 <212> PRT <213> Homo sapiens <400> 23 Met Leu Tyr Phe Ser Leu Phe Trp Ala Ala Arg Pro Leu Gln Arg Cys   1 5 10 15 Gly Gln Leu Val Arg Met Ala Ile Arg Ala Gln His Ser Asn Ala Ala              20 25 30 Gln Thr Gln Thr Gly Glu Ala Asn Arg Gly Trp Thr Gly Gln Glu Ser          35 40 45 Leu Ser Asp Ser Asp Pro Glu Met Trp Glu Leu Leu Gln Arg Glu Lys      50 55 60 Asp Arg Gln Cys Arg Gly Leu Glu Leu Ile Ala Ser Glu Asn Phe Cys  65 70 75 80 Ser Arg Ala Leu Glu Ala Leu Gly Ser Cys Leu Asn Asn Lys Tyr                  85 90 95 Ser Glu Gly Tyr Pro Gly Lys Arg Tyr Tyr Gly Gly Ala Glu Val Val             100 105 110 Asp Glu Ile Glu Leu Leu Cys Gln Arg Arg Ala Leu Glu Ala Phe Asp         115 120 125 Leu Asp Pro Ala Gln Trp Gly Val Asn Val Gln Pro Tyr Ser Gly Ser     130 135 140 Pro Ala Asn Leu Ala Val Tyr Thr Ala Leu Leu Gln Pro His Asp Arg 145 150 155 160 Ile Met Gly Leu Asp Leu Pro Asp Gly Gly His Leu Thr His Gly Tyr                 165 170 175 Met Ser Asp Val Lys Arg Ile Ser Ala Thr Ser Ile Phe Phe Glu Ser             180 185 190 Met Pro Tyr Lys Leu Asn Leu Ala Leu Thr Ala Arg Leu Phe Arg Pro         195 200 205 Arg Leu Ile Ile Ale Gly Thr Ser Ala Tyr Ala Arg Leu Ile Asp Tyr     210 215 220 Ala Arg Met Arg Glu Val Cys Asp Glu Val Lys Ala His Leu Leu Ala 225 230 235 240 Asp Met Ala His Ile Ser Gly Leu Val Ala Ala Lys Val Ile Pro Ser                 245 250 255 Pro Phe Lys His Ala Asp Ile Val Thr Thr Thr Thr His Lys Thr Leu             260 265 270 Arg Gly Ala Arg Ser Gly Leu Ile Phe Tyr Arg Lys Gly Val Lys Ala         275 280 285 Val Asp Pro Lys Thr Gly Arg Glu Ile Pro Tyr Thr Phe Glu Asp Arg     290 295 300 Ile Asn Phe Ala Val Phe Pro Ser Leu Gln Gly Gly Pro His His As His 305 310 315 320 Ala Ile Ala Ala Val Ala Val Ala Leu Lys Gln Ala Cys Thr Pro Met                 325 330 335 Phe Arg Glu Tyr Ser Leu Gln Val Leu Lys Asn Ala Arg Ala Met Ala             340 345 350 Asp Ala Leu Leu Glu Arg Gly Tyr Ser Leu Val Ser Gly Gly Thr Asp         355 360 365 Asn His Leu Val Leu Val Asp Leu Arg Pro Lys Gly Leu Asp Gly Ala     370 375 380 Arg Ala Glu Arg Val Leu Glu Leu Val Ser Ile Thr Ala Asn Lys Asn 385 390 395 400 Thr Cys Pro Gly Asp Arg Ser Ala Ile Thr Pro Gly Gly Leu Arg Leu                 405 410 415 Gly Ala Pro Ala Leu Thr Ser Arg Gln Phe Arg Glu Asp Asp Phe Arg             420 425 430 Arg Val Val Asp Phe Ile Asp Glu Gly Val Asn Ile Gly Leu Glu Val         435 440 445 Lys Ser Lys Thr Ala Lys Leu Gln Asp Phe Lys Ser Phe Leu Leu Lys     450 455 460 Asp Ser Glu Thr Ser Gln Arg Leu Ala Asn Leu Arg Gln Arg Val Glu 465 470 475 480 Gln Phe Ala Arg Ala Phe Pro Met Pro Gly Phe Asp Glu His                 485 490 <210> 24 <211> 602 <212> PRT <213> Homo sapiens <400> 24 Met Asp Ser Leu Gln Asp Thr Val Ala Leu Asp His Gly Gly Cys Cys   1 5 10 15 Pro Ala Leu Ser Arg Leu Val Pro Arg Gly Phe Gly Thr Glu Met Trp              20 25 30 Thr Leu Phe Ala Leu Ser Gly Pro Leu Phe Leu Phe Gln Val Leu Thr          35 40 45 Phe Met Ile Tyr Ile Val Ser Thr Val Phe Cys Gly His Leu Gly Lys      50 55 60 Val Glu Leu Ala Ser Val Thr Leu Ala Val Ala Phe Val Asn Val Cys  65 70 75 80 Gly Val Ser Val Gly Val Gly Leu Ser Ser Ala Cys Asp Thr Leu Met                  85 90 95 Ser Gln Ser Phe Gly Ser Pro Asn Lys Lys His Val Gly Val Ile Leu             100 105 110 Gln Arg Gly Ala Leu Val Leu Leu Leu Cys Cys Leu Pro Cys Trp Ala         115 120 125 Leu Phe Leu Asn Thr Gln His Ile Leu Leu Leu Phe Arg Gln Asp Pro     130 135 140 Asp Val Ser Arg Leu Thr Gln Asp Tyr Val Met Ile Phe Ile Pro Gly 145 150 155 160 Leu Pro Val Ile Phe Leu Tyr Asn Leu Leu Ala Lys Tyr Leu Gln Asn                 165 170 175 Gln Gly Trp Leu Lys Gly Gln Glu Glu Glu Ser Pro Phe Gln Thr Pro             180 185 190 Gly Leu Ser Ile Leu His Pro Ser His Ser His Leu Ser Arg Ala Ser         195 200 205 Phe His Leu Phe Gln Lys Ile Thr Trp Pro Gln Val Leu Ser Gly Val     210 215 220 Val Gly Asn Cys Val Asn Gly Val Ala Asn Tyr Ala Leu Val Ser Val 225 230 235 240 Leu Asn Leu Gly Val Arg Gly Ser Ala Tyr Ala Asn Ile Ile Ser Gln                 245 250 255 Phe Ala Gln Thr Val Phe Leu Leu Leu Tyr Ile Val Leu Lys Lys Leu             260 265 270 His Leu Glu Thr Trp Ala Gly Trp Ser Ser Gln Cys Leu Gln Asp Trp         275 280 285 Gly Pro Phe Phe Ser Leu Ala Val Ser Ser Met Leu Met Ile Cys Val     290 295 300 Glu Trp Trp Ala Tyr Glu Ile Gly Ser Phe Leu Met Gly Leu Leu Ser 305 310 315 320 Val Val Asp Leu Ser Ala Gln Ala Val Ile Tyr Glu Val Ala Thr Val                 325 330 335 Thr Tyr Met Ile Pro Leu Gly Leu Ser Ile Gly Val Cys Val Val Arg             340 345 350 Gly Met Ala Leu Gly Ala Ala Asp Thr Val Gln Ala Lys Arg Ser Ala         355 360 365 Val Ser Gly Val Ser Ser Val Val Ser Ser Val Val Ser Ser Val Val Ser Ser Val Ser Ser Val     370 375 380 Leu Ile Ser Ile Leu Lys Asn Gln Leu Gly His Ile Phe Thr Asn Asp 385 390 395 400 Glu Asp Val Ile Ala Leu Val Ser Gln Val Leu Pro Val Tyr Ser Val                 405 410 415 Phe His Val Phe Glu Ala Ile Cys Cys Val Tyr Gly Gly Val Leu Arg             420 425 430 Gly Thr Gly Lys Gln Ala Phe Gly         435 440 445 Tyr Ile Gly Leu Pro Leu Gly Ile Leu Leu Thr Phe Val Val Arg     450 455 460 Met Arg Ile Met Gly Leu Trp Leu Gly Met Leu Ala Cys Val Phe Leu 465 470 475 480 Ala Thr Ala Ala Phe Val Ala Tyr Ala Arg Leu Asp Trp Lys Leu                 485 490 495 Ala Ala Glu Glu Ala Lys Lys His Ser Gly Arg Gln Gln Gln Gln Arg             500 505 510 Ala Glu Ser Thr Ala Thr Arg Pro Gly Pro Glu Lys Ala Val Leu Ser         515 520 525 Ser Val Ala Thr Gly Ser Ser Pro Gly Ile Thr Leu Thr Thr Tyr Ser     530 535 540 Arg Ser Glu Cys His Val Asp Phe Phe Arg Thr Pro Glu Glu Ala His 545 550 555 560 Ala Leu Ser Ala Pro Thr Ser Arg Leu Ser Val Lys Gln Leu Val Ile                 565 570 575 Arg Arg Gly Ala Ala Leu Gly Ala Ala Ser Ala Thr Leu Met Val Gly             580 585 590 Leu Thr Val Arg Ile Leu Ala Thr Arg His         595 600 <210> 25 <211> 297 <212> PRT <213> Homo sapiens <400> 25 Met Glu Glu Pro Thr Ala Val Glu Gly Gln Val Gln Leu Pro Ser Pro   1 5 10 15 His Gln Gly Ser Leu Arg Lys Ala Val Ala Ala Ala Leu Ala Leu Asp              20 25 30 Gly Glu Ser Thr Met Gly His Arg Lys Lys Lys Arg Lys Glu Ser Arg          35 40 45 Pro Glu Ser Ile Ile Ile Tyr Arg Ser Asp Asn Glu Lys Thr Asp Glu      50 55 60 Glu Pro Gly Glu Ser Glu Gly Gly Asp Gln Pro Lys Glu Glu Glu Gly  65 70 75 80 Asp Asp Phe Leu Asp Tyr Pro Val Asp Asp Asp Met Trp Asn Leu Pro                  85 90 95 Leu Asp Ser Arg Tyr Val Thr Leu Thr Gly Thr Ile Thr Arg Gly Lys             100 105 110 Lys Lys Gly Gln Met Val Asp Ile His Val Thr Leu Thr Glu Lys Glu         115 120 125 Leu Gln Glu Leu Thr Lys Pro Lys Glu Ser Ser Arg Glu Thr Thr Pro     130 135 140 Glu Gly Arg Met Ala Cys Gln Met Gly Ala Asp Arg Gly Pro His Val 145 150 155 160 Val Leu Trp Thr Leu Ile Cys Leu Pro Val Val Phe Ile Leu Ser Phe                 165 170 175 Val Val Ser Phe Tyr Tyr Gly Thr Ile Thr Trp Tyr Asn Ile Phe Leu             180 185 190 Val Tyr Asn Glu Glu Arg Thr Phe Trp His Lys Ile Ser Tyr Cys Pro         195 200 205 Cys Leu Val Leu Phe Tyr Pro Val Leu Ile Met Ala Met Ala Ser Ser     210 215 220 Leu Gly Leu Tyr Ala Val Val Gln Leu Ser Trp Ser Trp Glu Ala 225 230 235 240 Trp Trp Gln Ala Ala Arg Asp Met Glu Lys Gly Phe Cys Gly Trp Leu                 245 250 255 Cys Ser Lys Leu Gly Leu Glu Asp Cys Ser Pro Tyr Ser Ile Val Glu             260 265 270 Leu Leu Glu Ser Asp Asn Ile Ser Ser Thr Leu Ser Asn Lys Asp Pro         275 280 285 Ile Gln Glu Val Glu Thr Ser Thr Val     290 295 <210> 26 <211> 438 <212> PRT <213> Homo sapiens <400> 26 Met Pro Cys Thr Cys Thr Trp Arg Asn Trp Arg Gln Trp Ile Arg Pro   1 5 10 15 Leu Val Ala Val Ile Tyr Leu Val Ser Ile Val Val              20 25 30 Cys Val Trp Glu Leu Gln Lys Leu Glu Val Gly Ile His Thr Lys Ala          35 40 45 Trp Phe Ile Ala Gly Ile Phe Leu Leu Leu Thr Ile Pro Ile Ser Leu      50 55 60 Trp Val Ile Leu Gln His Leu Val His Tyr Thr Gln Pro Glu Leu Gln  65 70 75 80 Lys Pro Ile Ile Arg Ile Leu Trp Met Val Pro Ile Tyr Ser Leu Asp                  85 90 95 Ser Trp Ile Ala Leu Lys Tyr Pro Gly Ile Ala Ile Tyr Val Asp Thr             100 105 110 Cys Arg Glu Cys Tyr Glu Ala Tyr Val Ile Tyr Asn Phe Met Gly Phe         115 120 125 Leu Thr Asn Tyr Leu Thr Asn Arg Tyr Pro Asn Leu Val Leu Ile Leu     130 135 140 Glu Ala Lys Asp Gln Gln Lys His Phe Pro Pro Leu Cys Cys Cys Pro 145 150 155 160 Pro Trp Ala Met Gly Glu Val Leu Leu Phe Arg Cys Lys Leu Gly Val                 165 170 175 Leu Gln Tyr Thr Val Val Arg Pro Phe Thr Thr Ile Val Ala Leu Ile             180 185 190 Cys Glu Leu Leu Gly Ile Tyr Asp Glu Gly Asn Phe Ser Phe Ser Asn         195 200 205 Ala Trp Thr Tyr Leu Val Ile Ile Asn Asn Met Ser Gln Leu Phe Ala     210 215 220 Met Tyr Cys Leu Leu Leu Phe Tyr Lys Val Leu Lys Glu Glu Leu Ser 225 230 235 240 Pro Ile Gln Pro Val Gly Lys Phe Leu Cys Val Lys Leu Val Val Phe                 245 250 255 Val Ser Phe Trp Gln Ala Val Val Ile Ala Leu Leu Val Lys Val Gly             260 265 270 Val Ile Ser Glu Lys His Thr Trp Glu Trp Gln Thr Val Glu Ala Val         275 280 285 Ala Thr Gly Leu Gln Asp Phe Ile Ile Cys Ile Glu Met Phe Leu Ala     290 295 300 Ala Ile Ala His His Tyr Thr Phe Ser Tyr Lys Pro Tyr Val Gln Glu 305 310 315 320 Ala Glu Glu Gly Ser Cys Phe Asp Ser Phe Leu Ala Met Trp Asp Val                 325 330 335 Ser Asp Ile Arg Asp Asp Ile Ser Glu Gln Val Arg His Val Gly Arg             340 345 350 Thr Val Arg Gly His Pro Arg Lys Lys Leu Phe Pro Glu Asp Gln Asp         355 360 365 Gln Asn Glu His Thr Ser Leu Leu Ser Ser Ser Ser Gln Asp Ala Ile     370 375 380 Ser Ile Ala Ser Ser Pro Pro Ser Ser Met Gly His Tyr Gln Gly 385 390 395 400 Phe Gly His Thr Val Thr Pro Gln Thr Thr Pro Thr Thr Ala Lys Ile                 405 410 415 Ser Asp Glu Ile Leu Ser Asp Thr Ile Gly Glu Lys Lys Glu Pro Ser             420 425 430 Asp Lys Ser Val Asp Ser         435 <210> 27 <211> 1523 <212> PRT <213> Homo sapiens <400> 27 Met Ala Ala Val Gly Ser Gly Gly Tyr Ala Arg Asn Ala Gly Glu   1 5 10 15 Lys Leu Pro Ser Val Met Ala Gly Val Pro Ala Arg Arg Gly Gln Ser              20 25 30 Ser Pro Pro Pro Ala Pro Pro Ile Cys Leu Arg Arg Arg Thr Arg Leu          35 40 45 Ser Thr Ala Ser Glu Glu Thr Val Gln Asn Arg Val Ser Leu Glu Lys      50 55 60 Val Leu Gly Ile Thr Ala Gln Asn Ser Ser Gly Leu Thr Cys Asp Pro  65 70 75 80 Gly Thr Gly His Val Ala Tyr Leu Ala Gly Cys Val Val Ile Leu                  85 90 95 Asp Pro Lys Glu Asn Lys Gln Gln His Ile Phe Asn Thr Ala Arg Lys             100 105 110 Ser Leu Ser Ala Leu Ala Phe Ser Pro Asp Gly Lys Tyr Ile Val Thr         115 120 125 Gly Glu Asn Gly His Arg Pro Ala Val Arg Ile Trp Asp Val Glu Glu     130 135 140 Lys Asn Gln Val Ala Glu Met Leu Gly His Lys Tyr Gly Val Ala Cys 145 150 155 160 Val Ala Phe Ser Pro Asn Met Lys His Ile Val Ser Met Gly Tyr Gln                 165 170 175 His Asp Met Val Leu Asn Val Trp Asp Trp Lys Lys Asp Ile Val Val             180 185 190 Ala Ser Asn Lys Val Ser Cys Arg Val Ile Ala Leu Ser Phe Ser Glu         195 200 205 Asp Ser Ser Tyr Phe Val Thr Val Gly Asn Arg His Val Arg Phe Trp     210 215 220 Phe Leu Glu Val Ser Thr Glu Thr Lys Val Thr Ser Thr Val Pro Leu 225 230 235 240 Val Gly Arg Ser Gly Ile Leu Gly Glu Leu His Asn Asn Ile Phe Cys                 245 250 255 Gly Val Ala Cys Gly Arg Gly Arg Met Ala Gly Ser Thr Phe Cys Val             260 265 270 Ser Tyr Ser Gly Leu Leu Cys Gln Phe Asn Glu Lys Arg Val Leu Glu         275 280 285 Lys Trp Ile Asn Leu Lys Val Ser Leu Ser Ser Cys Leu Cys Val Ser     290 295 300 Gln Glu Leu Ile Phe Cys Gly Cys Thr Asp Gly Ile Val Arg Ile Phe 305 310 315 320 Gln Ala His Ser Leu His Tyr Leu Ala Asn Leu Pro Lys Pro His Tyr                 325 330 335 Leu Gly Val Asp Val Ala Gln Gly Leu Glu Pro Ser Phe Leu Phe His             340 345 350 Arg Lys Ala Glu Ala Val Tyr Pro Asp Thr Val Ala Leu Thr Phe Asp         355 360 365 Pro Ile His Gln Trp Leu Ser Cys Val Tyr Lys Asp His Ser Ile Tyr     370 375 380 Ile Trp Asp Val Lys Asp Ile Asn Arg Val Gly Lys Val Trp Ser Glu 385 390 395 400 Leu Phe His Ser Ser Tyr Val Trp Asn Val Glu Val Tyr Pro Glu Phe                 405 410 415 Glu Asp Gln Arg Ala Cys Leu Pro Ser Gly Ser Phe Leu Thr Cys Ser             420 425 430 Ser Asp Asn Thr Ile Arg Phe Trp Asn Leu Asp Ser Ser Pro Asp Ser         435 440 445 His Trp Gln Lys Asn Ile Phe Ser Asn Thr Leu Leu Lys Val Val Tyr     450 455 460 Val Glu Asn Asp Ile Gln His Leu Gln Asp Met Ser His Phe Pro Asp 465 470 475 480 Arg Gly Ser Glu Asn Gly Thr Pro Met Asp Val Lys Ala Gly Val Arg                 485 490 495 Val Met Gln Val Ser Pro Asp Gly Gln His Leu Ala Ser Gly Asp Arg             500 505 510 Ser Gly Asn Leu Arg Ile His Glu Leu His Phe Met Asp Glu Leu Val         515 520 525 Lys Val Glu Ala His Asp Ala Glu Val Leu Cys Leu Glu Tyr Ser Lys     530 535 540 Pro Glu Thr Gly Leu Thr Leu Leu Ala Ser Ala Ser Arg Asp Arg Leu 545 550 555 560 Ile His Val Leu Asn Val Glu Lys Asn Tyr Asn Leu Glu Gln Thr Leu                 565 570 575 Asp His Ser Ser Ser Ile Thr Ala Ile Lys Phe Ala Gly Asn Arg             580 585 590 Asp Ile Gln Met Ile Ser Cys Gly Ala Asp Lys Ser Ile Tyr Phe Arg         595 600 605 Ser Ala Gln Gln Gly Ser Asp Gly Leu His Phe Val Arg Thr His His     610 615 620 Val Ala Glu Lys Thr Thr Leu Tyr Asp Met Asp Ile Asp Ile Thr Gln 625 630 635 640 Lys Tyr Val Ala Val Ala Cys Gln Asp Arg Asn Val Arg Val Tyr Asn                 645 650 655 Thr Val Asn Gly Lys Gln Lys Lys Cys Tyr Lys Gly Ser Gln Gly Asp             660 665 670 Glu Gly Ser Leu Leu Lys Val His His Val Asp Pro Ser Gly Thr Phe Leu         675 680 685 Ala Thr Ser Cys Ser Asp Lys Ser Ile Ser Val Ile Asp Phe Tyr Ser     690 695 700 Gly Glu Cys Ile Ala Lys Met Phe Gly His Ser Glu Ile Ile Thr Ser 705 710 715 720 Met Lys Phe Thr Tyr Asp Cys His His Leu Ile Thr Val Ser Gly Asp                 725 730 735 Ser Cys Val Phe Ile Trp His Leu Gly Pro Glu Ile Thr Asn Cys Met             740 745 750 Lys Gln His Leu Leu Glu Ile Asp His Arg Gln Gln Gln Gln His Thr         755 760 765 Asn Asp Lys Lys Arg Ser Gly His Pro Arg Gln Asp Thr Tyr Val Ser     770 775 780 Thr Pro Ser Glu Ile His Ser Leu Ser Pro Gly Glu Gln Thr Glu Asp 785 790 795 800 Asp Leu Glu Glu Glu Cys Glu Pro Glu Glu Met Leu Lys Thr Pro Ser                 805 810 815 Lys Asp Ser Leu Asp Pro Asp Pro Arg Cys Leu Leu Thr Asn Gly Lys             820 825 830 Leu Pro Leu Trp Ala Lys Arg Leu Leu Gly Asp Asp Asp Val Ala Asp         835 840 845 Gly Leu Ala Phe His Ala Lys Arg Ser Tyr Gln Pro His Gly Arg Trp     850 855 860 Ala Glu Arg Ala Gly Gln Glu Pro Leu Lys Thr Ile Leu Asp Ala Gln 865 870 875 880 Asp Leu Asp Cys Tyr Phe Thr Pro Met Lys Pro Glu Ser Leu Glu Asn                 885 890 895 Ser Ile Leu Asp Ser Leu Glu Pro Gln Ser Leu Ala Ser Leu Leu Ser             900 905 910 Glu Ser Glu Ser Glu Glu Ala Gly Arg Gly His Pro Ser Phe Leu         915 920 925 Pro Gln Gln Lys Glu Ser Ser Glu Ala Ser Glu Leu Ile Leu Tyr Ser     930 935 940 Leu Glu Ala Glu Val Thr Val Thr Gly Thr Asp Ser Gln Tyr Cys Arg 945 950 955 960 Lys Glu Val Glu Ala Gly Pro Gly Asp Gln Gln Gly Asp Ser Tyr Leu                 965 970 975 Arg Val Ser Ser Asp Ser Pro Lys Asp Gln Ser Pro Pro Glu Asp Ser             980 985 990 Gly Glu Ser Glu Ala Asp Leu Glu Cys Ser Phe Ala Ala Ile His Ser         995 1000 1005 Pro Ala Pro Pro Pro Asp Pro Ala Pro Arg Phe Ala Thr Ser Leu Pro    1010 1015 1020 His Phe Pro Gly Cys Ala Gly Pro Thr Glu Asp Glu Leu Ser Leu Pro 1025 1030 1035 1040 Glu Gly Pro Ser Val Ser Ser Ser Leu Pro Gln Thr Pro Glu Gln                1045 1050 1055 Glu Lys Phe Leu Arg His His Phe Glu Thr Leu Thr Glu Ser Pro Cys            1060 1065 1070 Arg Glu Leu Phe Pro Ala Ala Leu Gly Asp Val Glu Ala Ser Glu Ala        1075 1080 1085 Glu Asp His Phe Phe Asn Pro Arg Leu Ser Ile Ser Thr Gln Phe Leu    1090 1095 1100 Ser Ser Leu Gln Lys Ala Ser Arg Phe Thr His Thr Phe Pro Pro Arg 1105 1110 1115 1120 Ala Thr Gln Cys Leu Val Lys Ser Pro Glu Val Lys Leu Met Asp Arg                1125 1130 1135 Gly Gly Ser Gln Pro Arg Ala Gly Thr Gly Tyr Ala Ser Pro Asp Arg            1140 1145 1150 Thr His Val Leu Ala Ala Gly Lys Ala Glu Glu Thr Leu Glu Ala Trp        1155 1160 1165 Arg Pro Pro Pro Cys Leu Thr Ser Leu Ala Ser Cys Val Pro Ala    1170 1175 1180 Ser Ser Val Leu Pro Thr Asp Arg Asn Leu Pro Thr Pro Thr Ser Ala 1185 1190 1195 1200 Pro Thr Pro Gly Leu Ala Gln Gly Val His Ala Pro Ser Thr Cys Ser                1205 1210 1215 Tyr Met Glu Ala Thr Ala Ser Ser Arg Ala Arg Ile Ser Arg Ser Ile            1220 1225 1230 Ser Leu Gly Asp Ser Glu Gly Pro Ile Val Ala Thr Leu Ala Gln Pro        1235 1240 1245 Leu Arg Arg Pro Ser Ser Val Gly Glu Leu Ala Ser Leu Gly Gln Glu    1250 1255 1260 Leu Gln Ala Ile Thr Thr Ala Thr Thr Pro Ser Leu Asp Ser Glu Gly 1265 1270 1275 1280 Gln Glu Pro Ala Leu Arg Ser Trp Gly Asn His Glu Ala Arg Ala Asn                1285 1290 1295 Leu Arg Leu Thr Leu Ser Ser Ala Cys Asp Gly Leu Leu Gln Pro Pro            1300 1305 1310 Val Asp Thr Gln Pro Gly Val Thr Val Pro Ala Val Ser Phe Pro Ala        1315 1320 1325 Pro Ser Pro Val Glu Glu Ser Ala Leu Arg Leu His Gly Ser Ala Phe    1330 1335 1340 Arg Pro Ser Leu Pro Ala Pro Glu Ser Pro Gly Leu Pro Ala His Pro 1345 1350 1355 1360 Ser Asn Pro Gln Leu Pro Glu Ala Arg Pro Gly Ile Pro Gly Gly Thr                1365 1370 1375 Ala Ser Leu Leu Glu Pro Thr Ser Gly Ala Leu Gly Leu Leu Gln Gly            1380 1385 1390 Ser Pro Ala Arg Trp Ser Glu Pro Trp Val Pro Glu Ala Leu Pro        1395 1400 1405 Pro Ser Pro Leu Glu Leu Ser Arg Val Gly Asn Ile Leu His Arg Leu    1410 1415 1420 Gln Thr Thr Phe Gln Glu Ala Leu Asp Leu Tyr Arg Val Leu Val Ser 1425 1430 1435 1440 Ser Gly Gln Val Asp Thr Gly Gln Gln Gln Ala Arg Thr Glu Leu Val                1445 1450 1455 Ser Thr Phe Leu Trp Ile His Ser Gln Leu Glu Ala Glu Cys Leu Val            1460 1465 1470 Gly Thr Ser Val Ala Pro Ala Gln Ala Leu Pro Ser Pro Gly Pro Pro        1475 1480 1485 Ser Pro Pro Thr Leu Tyr Pro Leu Ala Ser Pro Asp Leu Gln Ala Leu    1490 1495 1500 Leu Glu His Tyr Ser Glu Leu Leu Val Gln Ala Val Arg Arg Lys Ala 1505 1510 1515 1520 Arg Gly His             <210> 28 <211> 1032 <212> PRT <213> Homo sapiens <400> 28 Met Ala Glu Pro Ser Ala Ala Thr Gln Ser His Ser Ile Ser Ser Ser   1 5 10 15 Ser Phe Gly Ala Glu Pro Ser Ala Pro Gly Gly Gly Gly Ser Pro Gly              20 25 30 Ala Cys Pro Ala Leu Gly Thr Lys Ser Cys Ser Ser Ser Cys Ala Asp          35 40 45 Ser Phe Val Ser Ser Ser Ser Gln Pro Val Ser Leu Phe Ser Thr      50 55 60 Ser Gln Glu Gly Leu Ser Ser Leu Cys Ser Asp Glu Pro Ser Ser Glu  65 70 75 80 Ile Met Thr Ser Ser Phe Leu Ser Ser Glu Ile His Asn Thr Gly                  85 90 95 Leu Thr Ile Leu His Gly Glu Lys Ser His Val Leu Gly Ser Gln Pro             100 105 110 Ile Leu Ala Lys Glu Gly Lys Asp His Leu Asp Leu Leu Asp Met Lys         115 120 125 Lys Met Glu Lys Pro Gln Gly Thr Ser Asn Asn Val Ser Asp Ser Ser     130 135 140 Val Ser Leu Ala Ala Gly Val His Cys Asp Arg Pro Ser Ile Pro Ala 145 150 155 160 Ser Phe Pro Glu His Pro Ala Phe Leu Ser Lys Lys Ile Gly Gln Val                 165 170 175 Glu Glu Gln Ile Asp Lys Glu Thr Lys Asn Pro Asn Gly Val Ser Ser             180 185 190 Arg Glu Ala Lys Thr Ala Leu Asp Ala Asp Asp Arg Phe Thr Leu Leu         195 200 205 Thr Ala Gln Lys Pro Pro Thr Glu Tyr Ser Lys Val Glu Gly Ile Tyr     210 215 220 Thr Ser Ser Ser Ser Ser Ser Val Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser 225 230 235 240 Lys Asp Ser Pro Glu Ser Pro Phe Glu Val Ile Ile Asp Lys Ala Ala                 245 250 255 Phe Asp Lys Glu Phe Lys Asp Ser Tyr Lys Glu Ser Thr Asp Asp Phe             260 265 270 Gly Ser Trp Ser Val His Thr Asp Lys Glu Ser Ser Glu Asp Ile Ser         275 280 285 Glu Thr Asn Asp Lys Leu Phe Pro Leu Arg Asn Lys Glu Ala Gly Arg     290 295 300 Tyr Pro Met Ser Ala Leu Leu Ser Arg Gln Phe Ser His Thr Asn Ala 305 310 315 320 Ala Leu Glu Glu Val Ser Arg Cys Val Asn Asp Met His Asn Phe Thr                 325 330 335 Asn Glu Ile Leu Thr Trp Asp Leu Val Pro Gln Val Lys Gln Gln Thr             340 345 350 Asp Lys Ser Ser Asp Cys Ile Thr Lys Thr Thr Gly Leu Asp Met Ser         355 360 365 Glu Tyr Asn Ser Glu Ile Pro Val Val Asn Leu Lys Thr Ser Thr His     370 375 380 Gln Lys Thr Pro Val Cys Ser Ile Asp Gly Ser Thr Pro Ile Thr Lys 385 390 395 400 Ser Thr Gly Asp Trp Ala Glu Ala Ser Leu Gln Gln Glu Asn Ala Ile                 405 410 415 Thr Gly Lys Pro Val Pro Asp Ser Leu Asn Ser Thr Lys Glu Phe Ser             420 425 430 Ile Lys Gly Val Gln Gly Asn Met Gln Lys Gln Asp Asp Thr Leu Ala         435 440 445 Glu Leu Pro Gly Ser Pro Glu Lys Cys Asp Ser Leu Gly Ser Gly     450 455 460 Val Ala Thr Val Lys Val Val Leu Pro Asp Asp His Leu Lys Asp Glu 465 470 475 480 Met Asp Trp Gln Ser Ser Ala Leu Gly Glu Ile Thr Glu Ala Asp Ser                 485 490 495 Ser Gly Glu Ser Asp Asp Thr Val Ile Glu Asp Ile Thr Ala Asp Thr             500 505 510 Ser Phe Glu Asn Asn Lys Ile Gln Ala Glu Lys Pro Val Ser Ile Pro         515 520 525 Ser Ala Val Val Lys Thr Gly Glu Arg Glu Ile Lys Glu Ile Pro Ser     530 535 540 Cys Glu Arg Glu Glu Lys Thr Ser Lys Asn Phe Glu Glu Leu Val Ser 545 550 555 560 Asp Ser Glu Leu His Gln Asp Gln Pro Asp Ile Leu Gly Arg Ser Pro                 565 570 575 Ala Ser Glu Ala Ala Cys Ser Lys Val Pro Asp Thr Asn Val Ser Leu             580 585 590 Glu Asp Val Ser Glu Val Ala Pro Glu Lys Pro Ile Thr Thr Glu Asn         595 600 605 Pro Lys Leu Pro Ser Thr Val Ser Pro Asn Val Phe Asn Glu Thr Glu     610 615 620 Phe Ser Leu Asn Val Thr Thr Ser Ala Tyr Leu Glu Ser Leu His Gly 625 630 635 640 Lys Asn Val Lys His Ile Asp Asp Ser Ser Pro Glu Asp Leu Ile Ala                 645 650 655 Ala Phe Thr Glu Thr Arg Asp Lys Gly Ile Val Asp Ser Glu Arg Asn             660 665 670 Ala Phe Lys Ala Ile Ser Glu Lys Met Thr Asp Phe Lys Thr Thr Pro         675 680 685 Pro Val Glu Val Leu His Glu Asn Glu Ser Gly Gly Ser Glu Ile Lys     690 695 700 Asp Ile Gly Ser Lys Tyr Ser Glu Gln Ser Lys Glu Thr Asn Gly Ser 705 710 715 720 Glu Pro Leu Gly Val Phe Pro Thr Gln Gly Thr Pro Val Ala Ser Leu                 725 730 735 Asp Leu Glu Gln Glu Gln Leu Thr Ile Lys Ala Leu Lys Glu Leu Gly             740 745 750 Glu Arg Gln Val Glu Lys Ser Thr Ser Ala Gln Arg Asp Ala Glu Leu         755 760 765 Pro Ser Glu Glu Val Leu Lys Gln Thr Phe Thr Phe Ala Pro Glu Ser     770 775 780 Trp Pro Gln Arg Ser Tyr Asp Ile Leu Glu Arg Asn Val Lys Asn Gly 785 790 795 800 Ser Asp Leu Gly Ile Ser Gln Lys Pro Ile Thr Ile Arg Glu Thr Thr                 805 810 815 Arg Val Asp Ala Val Ser Ser Leu Ser Lys Thr Glu Leu Val Lys Lys             820 825 830 His Val Leu Ala Arg Leu Leu Thr Asp Phe Ser Val His Asp Leu Ile         835 840 845 Phe Trp Arg Asp Val Lys Lys Thr Gly Phe Val Phe Gly Thr Thr Leu     850 855 860 Ile Met Leu Leu Ser Leu Ala Ala Phe Ser Val Ile Ser Val Val Ser 865 870 875 880 Tyr Leu Ile Leu Ala Leu Leu Ser Val Thr Ile Ser Phe Arg Ile Tyr                 885 890 895 Lys Ser Val Ile Gln Ala Val Gln Lys Ser Glu Glu Gly His Pro Phe             900 905 910 Lys Ala Tyr Leu Asp Val Asp Ile Thr Leu Ser Ser Glu Ala Phe His         915 920 925 Asn Tyr Met Asn Ala Ala Met Val His Ile Asn Arg Ala Leu Lys Leu     930 935 940 Ile Ile Arg Leu Phe Leu Val Glu Asp Leu Val Asp Ser Leu Lys Leu 945 950 955 960 Ala Val Phe Met Trp Leu Met Thr Tyr Val Gly Ala Val Phe Asn Gly                 965 970 975 Ile Thr Leu Leu Ile Leu             980 985 990 Val Tyr Glu Lys Tyr Lys Thr Gln Ile Asp His Tyr Val Gly Ile Ala         995 1000 1005 Arg Asp Gln Thr Lys Ser Ile Val Glu Lys Ile Gln Ala Lys Leu Pro    1010 1015 1020 Gly Ile Ala Lys Lys Lys Ala Glu 1025 1030 <210> 29 <211> 2005 <212> PRT <213> Homo sapiens <400> 29 Met Ala Gln Ser Val Leu Val Pro Pro Gly Pro Asp Ser Phe Arg Phe   1 5 10 15 Phe Thr Arg Glu Ser Leu Ala Ala Ile Glu Gln Arg Ile Ala Glu Glu              20 25 30 Lys Ala Lys Arg Pro Lys Gln Glu Arg Lys Asp Glu Asp Asp Glu Asn          35 40 45 Gly Pro Lys Pro Asn Ser Asp Leu Glu Ala Gly Lys Ser Leu Pro Phe      50 55 60 Ile Tyr Gly Asp Ile Pro Pro Glu Met Val Ser Val Pro Leu Glu Asp  65 70 75 80 Leu Asp Pro Tyr Tyr Ile Asn Lys Lys Thr Phe Ile Val Leu Asn Lys                  85 90 95 Gly Lys Ala Ile Ser Arg Phe Ser Ala Thr Pro Ala Leu Tyr Ile Leu             100 105 110 Thr Pro Phe Asn Pro Ile Arg Lys Leu Ala Ile Lys Ile Leu Val His         115 120 125 Ser Leu Phe Asn Met Leu Ile Met Cys Thr Ile Leu Thr Asn Cys Val     130 135 140 Phe Met Thr Met Ser Asn Pro Pro Asp Trp Thr Lys Asn Val Glu Tyr 145 150 155 160 Thr Phe Thr Gly Ile Tyr Thr Phe Glu Ser Leu Ile Lys Ile Leu Ala                 165 170 175 Arg Gly Phe Cys Leu Glu Asp Phe Thr Phe Leu Arg Asp Pro Trp Asn             180 185 190 Trp Leu Asp Phe Thr Val Ile Thr Phe Ala Tyr Val Thr Glu Phe Val         195 200 205 Asp Leu Gly Asn Val Ser Ala Leu Arg Thr Phe Arg Val Leu Arg Ala     210 215 220 Leu Lys Thr Ile Ser Val Ile Pro Gly Leu Lys Thr Ile Val Gly Ala 225 230 235 240 Leu Ile Gln Ser Val Lys Lys Leu Ser Asp Val Met Ile Leu Thr Val                 245 250 255 Phe Cys Leu Ser Val Phe Ala Leu Ile Gly Leu Gln Leu Phe Met Gly             260 265 270 Asn Leu Arg Asn Lys Cys Leu Gln Trp Pro Pro Asp Asn Ser Ser Phe         275 280 285 Glu Ile Asn Ile Thr Ser Phe Phe Asn Asn Ser Leu Asp Gly Asn Gly     290 295 300 Thr Thr Phe Asn Arg Thr Val Ser Ile Phe Asn Trp Asp Glu Tyr Ile 305 310 315 320 Glu Asp Lys Ser His Phe Tyr Phe Leu Glu Gly Gln Asn Asp Ala Leu                 325 330 335 Leu Cys Gly Asn Ser Ser Asp Ala Gly Gln Cys Pro Glu Gly Tyr Ile             340 345 350 Cys Val Lys Ala Gly Arg Asn Pro Asn Tyr Gly Tyr Thr Ser Phe Asp         355 360 365 Thr Phe Ser Trp Ala Phe Leu Ser Leu Phe Arg Leu Met Thr Gln Asp     370 375 380 Phe Trp Glu Asn Leu Tyr Gln Leu Thr Leu Arg Ala Ala Gly Lys Thr 385 390 395 400 Tyr Met Ile Phe Phe Val Leu Val Ile Phe Leu Gly Ser Phe Tyr Leu                 405 410 415 Ile Asn Leu Ile Leu Ala Val Val Ala Met Ala Tyr Glu Glu Gln Asn             420 425 430 Gln Ala Thr Leu Glu Glu Ala Glu Gln Lys Glu Ala Glu Phe Gln Gln         435 440 445 Met Leu Glu Gln Leu Lys Lys Gln Gln Glu Glu Ala Gln Ala Ala Ala     450 455 460 Ala Ala Ala Ser Ala Glu Ser Arg Asp Phe Ser Gly Ala Gly Gly Ile 465 470 475 480 Gly Val Phe Ser Glu Ser Ser Ser Ala Ser Ser Ser Ser Ser Ser Ser                 485 490 495 Ser Glu Lys Glu Leu Lys Asn Arg Arg Lys Lys Lys Lys Gln Lys Glu             500 505 510 Gln Ser Gly Glu Glu Glu Lys Asn Asp Arg Val Arg Lys Ser Glu Ser         515 520 525 Glu Asp Ser Ile Arg Arg Lys Gly Phe Arg Phe Ser Leu Glu Gly Ser     530 535 540 Arg Leu Thr Tyr Glu Lys Arg Phe Ser Ser Pro His Gln Ser Leu Leu 545 550 555 560 Ser Ile Arg Gly Ser Leu Phe Ser Pro Arg Arg Asn Ser Arg Ala Ser                 565 570 575 Leu Phe Ser Phe Arg Gly Arg Ala Lys Asp Ile Gly Ser Glu Asn Asp             580 585 590 Phe Ala Asp Asp Glu His Ser Thr Phe Glu Asp Asn Asp Ser Arg Arg         595 600 605 Asp Ser Leu Phe Val Pro His Arg His Gly Glu Arg Arg His Ser Asn     610 615 620 Val Ser Gln Ala Ser Arg Ala Ser Arg Val Leu Pro Ile Leu Pro Met 625 630 635 640 Asn Gly Lys Met Ser Ser Ala Val Asp Cys Asn Gly Val Val Ser Leu                 645 650 655 Val Gly Gly Pro Ser Thr Leu Thr Ser Ala Gly Gln Leu Leu Pro Glu             660 665 670 Gly Thr Thr Thr Glu Thr Glu Ile Arg Lys Arg Arg Ser Ser Ser Tyr         675 680 685 His Val Ser Met Asp Leu Leu Glu Asp Pro Thr Ser Arg Gln Arg Ala     690 695 700 Met Ser Ile Ser Ile Leu Thr Asn Thr Met Glu Glu Leu Glu Glu 705 710 715 720 Ser Arg Gln Lys Cys Pro Pro Cys Trp Tyr Lys Phe Ala Asn Met Cys                 725 730 735 Leu Ile Trp Asp Cys Cys Lys Pro Trp Leu Lys Val Lys His Leu Val             740 745 750 Asn Leu Val Val Met Asp Pro Phe Val Asp Leu Ala Ile Thr Ile Cys         755 760 765 Ile Val Leu Asn Thr Leu Phe Met Ala Met Glu His Tyr Pro Met Thr     770 775 780 Glu Gln Phe Ser Ser Val Leu Ser Val Gly Asn Leu Val Phe Thr Gly 785 790 795 800 Ile Phe Thr Ala Glu Met Phe Leu Lys Ile Ile Ala Met Asp Pro Tyr                 805 810 815 Tyr Tyr Phe Gln Glu Gly Trp Asn Ile Phe Asp Gly Phe Ile Val Ser             820 825 830 Leu Ser Leu Met Glu Leu Gly Leu Ala Asn Val Glu Gly Leu Ser Val         835 840 845 Leu Arg Ser Phe Arg Leu Leu Arg Val Phe Lys Leu Ala Lys Ser Trp     850 855 860 Pro Thr Leu Asn Met Leu Ile Lys Ile Ile Gly Asn Ser Val Gly Ala 865 870 875 880 Leu Gly Asn Leu Thr Leu Val Leu Ala Ile Ile Val Phe Ile Phe Ala                 885 890 895 Val Val Gly Met Gln Leu Phe Gly Lys Ser Tyr Lys Glu Cys Val Cys             900 905 910 Lys Ile Ser Asn Asp Cys Glu Leu Pro Arg Trp His Met His Asp Phe         915 920 925 Phe His Ser Phe Leu Ile Val Phe Arg Val Leu Cys Gly Glu Trp Ile     930 935 940 Glu Thr Met Trp Asp Cys Met Glu Val Ala Gly Gln Thr Met Cys Leu 945 950 955 960 Thr Val Phe Met Met Val Met Val Gle Asn Leu Val Val Leu Asn                 965 970 975 Leu Phe Leu Ala Leu Leu Leu Ser Ser Phe Ser Ser Asp Asn Leu Ala             980 985 990 Ala Thr Asp Asp Asp Asn Glu Met Asn Asn Leu Gln Ile Ala Val Gly         995 1000 1005 Arg Met Gln Lys Gly Ile Asp Phe Val Lys Arg Lys Ile Arg Glu Phe    1010 1015 1020 Ile Gln Lys Ala Phe Val Arg Lys Gln Lys Ala Leu Asp Glu Ile Lys 1025 1030 1035 1040 Pro Leu Glu Asp Leu Asn Asn Lys Lys Asp Ser Cys Ile Ser Asn His                1045 1050 1055 Thr Ile Glu Ile Gly Lys Asp Leu Asn Tyr Leu Lys Asp Gly Asn            1060 1065 1070 Gly Thr Thr Ser Gly Ile Gly Ser Ser Val Glu Lys Tyr Val Val Asp        1075 1080 1085 Glu Ser Asp Tyr Met Ser Phe Ile Asn Asn Pro Ser Leu Thr Val Thr    1090 1095 1100 Val Pro Ile Ala Val Gly Glu Ser Asp Phe Glu Asn Leu Asn Thr Glu 1105 1110 1115 1120 Glu Phe Ser Ser Glu Ser Asp Met Glu Glu Ser Lys Glu Lys Leu Asn                1125 1130 1135 Ala Thr Ser Ser Glu Gly Ser Thr Val Asp Ile Gly Ala Pro Ala            1140 1145 1150 Glu Gly Glu Glu Pro Glu Val Glu Pro Glu Glu Ser Leu Glu Pro Glu        1155 1160 1165 Ala Cys Phe Thr Glu Asp Cys Val Arg Lys Phe Lys Cys Cys Gln Ile    1170 1175 1180 Ser Ile Glu Glu Gly Lys Gly Lys Leu Trp Trp Asn Leu Arg Lys Thr 1185 1190 1195 1200 Cys Tyr Lys Ile Val Glu His Asn Trp Phe Glu Thr Phe Ile Val Phe                1205 1210 1215 Met Ile Leu Leu Ser Ser Gly Ala Leu Ala Phe Glu Asp Ile Tyr Ile            1220 1225 1230 Glu Gln Arg Lys Thr Ile Lys Thr Met Leu Glu Tyr Ala Asp Lys Val        1235 1240 1245 Phe Thr Tyr Ile Phe Ile Leu Glu Met Leu Leu Lys Trp Val Ala Tyr    1250 1255 1260 Gly Phe Gln Val Tyr Phe Thr Asn Ala Trp Cys Trp Leu Asp Phe Leu 1265 1270 1275 1280 Ile Val Asp Val Ser Leu Val Ser Leu Thr Ala Asn Ala Leu Gly Tyr                1285 1290 1295 Ser Glu Leu Gly Ala Ile Lys Ser Leu Arg Thr Leu Arg Ala Leu Arg            1300 1305 1310 Pro Leu Arg Ala Leu Ser Arg Phe Glu Gly Met Arg Val Val Val Asn        1315 1320 1325 Ala Leu Leu Gly Ala Ile Pro Ser Ile Met Asn Val Leu Leu Val Cys    1330 1335 1340 Leu Ile Phe Trp Leu Ile Phe Ser Ile Met Gly Val Asn Leu Phe Ala 1345 1350 1355 1360 Gly Lys Phe Tyr His Cys Ile Asn Tyr Thr Thr Gly Glu Met Phe Asp                1365 1370 1375 Val Ser Val Val Asn Asn Tyr Ser Glu Cys Lys Ala Leu Ile Glu Ser            1380 1385 1390 Asn Gln Thr Ala Arg Trp Lys Asn Val Lys Val Asn Phe Asp Asn Val        1395 1400 1405 Gly Leu Gly Tyr Leu Ser Leu Leu Gln Val Ala Thr Phe Lys Gly Trp    1410 1415 1420 Met Asp Ile Met Tyr Ala Ala Val Asp Ser Arg Asn Val Glu Leu Gln 1425 1430 1435 1440 Pro Lys Tyr Glu Asp Asn Leu Tyr Met Tyr Leu Tyr Phe Val Ile Phe                1445 1450 1455 Ile Ile Phe Gly Ser Phe Phe Thr Leu Asn Leu Phe Ile Gly Val Ile            1460 1465 1470 Ile Asp Asn Phe Asn Gln Gln Lys Lys Lys Pys Gly Gly Gln Asp Ile        1475 1480 1485 Phe Met Thr Glu Glu Gln Lys Lys Tyr Tyr Asn Ala Met Lys Lys Leu    1490 1495 1500 Gly Ser Lys Lys Pro Gln Lys Pro Ile Pro Arg Pro Ala Asn Lys Phe 1505 1510 1515 1520 Gln Gly Met Val Phe Asp Phe Val Thr Lys Gln Val Phe Asp Ile Ser                1525 1530 1535 Ile Met Ile Leu Ile Cys Leu Asn Met Val Thr Met Met Val Glu Thr            1540 1545 1550 Asp Asp Gln Ser Gln Glu Met Thr Asn Ile Leu Tyr Trp Ile Asn Leu        1555 1560 1565 Val Phe Ile Val Leu Phe Thr Gly Glu Cys Val Leu Lys Leu Ile Ser    1570 1575 1580 Leu Arg Tyr Tyr Tyr Phe Thr Ile Gly Trp Asn Ile Phe Asp Phe Val 1585 1590 1595 1600 Val Ile Leu Ile Val Gly Met Phe Leu Ile Glu Leu Ile Glu                1605 1610 1615 Lys Tyr Phe Val Ser Pro Thr Leu Phe Arg Val Ile Arg Leu Ala Arg            1620 1625 1630 Ile Gly Arg Ile Leu Arg Leu Ile Lys Gly Ala Lys Gly Ile Arg Thr        1635 1640 1645 Leu Leu Phe Ala Leu Met Met Le Le Pro Ala Leu Phe Asn Ile Gly    1650 1655 1660 Leu Leu Leu Phe Leu Val Met Phe Ile Tyr Ala Ile Phe Gly Met Ser 1665 1670 1675 1680 Asn Phe Ala Tyr Val Lys Arg Glu Val Gly Ile Asp Asp Met Phe Asn                1685 1690 1695 Phe Glu Thr Phe Gly Asn Ser Met Ile Cys Leu Phe Gln Ile Thr Thr            1700 1705 1710 Ser Ala Gly Trp Asp Gly Leu Leu Ala Pro Ile Leu Asn Ser Gly Pro        1715 1720 1725 Pro Asp Cys Asp Pro Asp Lys Asp His Pro Gly Ser Ser Val Lys Gly    1730 1735 1740 Asp Cys Gly Asn Pro Ser Val Gly Ile Phe Phe Phe Val Ser Tyr Ile 1745 1750 1755 1760 Ile Ile Ser Phe Leu Val Valle Val Asn Met Tyr Ile Valle Leu                1765 1770 1775 Glu Asn Phe Ser Val Ala Thr Glu Glu Ser Ala Glu Pro Leu Ser Glu            1780 1785 1790 Asp Phe Glu Met Phe Tyr Glu Val Trp Glu Lys Phe Asp Pro Asp        1795 1800 1805 Ala Thr Gln Phe Ile Glu Phe Ala Lys Leu Ser Asp Phe Ala Asp Ala    1810 1815 1820 Leu Asp Pro Pro Leu Leu Ile Ala Lys Pro Asn Lys Val Gln Leu Ile 1825 1830 1835 1840 Ala Met Asp Leu Pro Met Val Ser Gly Asp Arg Ile His Cys Leu Asp                1845 1850 1855 Ile Leu Phe Ala Phe Thr Lys Arg Val Leu Gly Glu Ser Gly Glu Met            1860 1865 1870 Asp Ala Leu Arg Ile Gln Met Glu Glu Arg Phe Met Ala Ser Asn Pro        1875 1880 1885 Ser Lys Val Ser Tyr Glu Pro Ile Thr Thr Thr Leu Lys Arg Lys Gln    1890 1895 1900 Glu Glu Val Ser Ala Ile Ile Ile Gln Arg Ala Tyr Arg Arg Tyr Leu 1905 1910 1915 1920 Leu Lys Gln Lys Val Lys Lys Val Ser Ser Ile Tyr Lys Lys Asp Lys                1925 1930 1935 Gly Lys Glu Cys Asp Gly Thr Pro Ile Lys Glu Asp Thr Leu Ile Asp            1940 1945 1950 Lys Leu Asn Glu Asn Ser Thr Pro Glu Lys Thr Asp Met Thr Pro Ser        1955 1960 1965 Thr Thr Ser Pro Ser Tyr Asp Ser Val Thr Lys Pro Glu Lys Glu    1970 1975 1980 Lys Phe Glu Lys Asp Lys Ser Glu Lys Glu Asp Lys Gly Lys Asp Ile 1985 1990 1995 2000 Arg Glu Ser Lys Lys                2005 <210> 30 <211> 676 <212> PRT <213> Homo sapiens <400> 30 Met Ala Ala Ala Lys Val Ala Leu Thr Lys Arg Ala Asp Pro Ala Glu   1 5 10 15 Leu Arg Thr Ile Phe Leu Lys Tyr Ala Ser Ile Glu Lys Asn Gly Glu              20 25 30 Phe Phe Met Ser Pro Asn Asp Phe Val Thr Arg Tyr Leu Asn Ile Phe          35 40 45 Gly Glu Ser Gln Pro Asn Pro Lys Thr Val Glu Leu Leu Ser Gly Val      50 55 60 Val Asp Gln Thr Lys Asp Gly Leu Ile Ser Phe Gln Glu Phe Val Ala  65 70 75 80 Phe Glu Ser Val Leu Cys Ala Pro Asp Ala Leu Phe Met Val Ala Phe                  85 90 95 Gln Leu Phe Asp Lys Ala Gly Lys Gly Glu Val Thr Phe Glu Asp Val             100 105 110 Lys Gln Val Phe Gly Gln Thr Thr Ile His Gln His Ile Pro Phe Asn         115 120 125 Trp Asp Ser Glu Phe Val Gln Leu His Phe Gly Lys Glu Arg Lys Arg     130 135 140 His Leu Thr Tyr Ala Glu Phe Thr Gln Phe Leu Leu Glu Ile Gln Leu 145 150 155 160 Glu His Ala Lys Gln Ala Phe Val Gln Arg Asp Asn Ala Arg Thr Gly                 165 170 175 Arg Val Thr Ala Ile Asp Phe Arg Asp Ile Met Val Thr Ile Arg Pro             180 185 190 His Val Leu Thr Pro Phe Val Glu Glu Cys Leu Val Ala Ala Ala Gly         195 200 205 Gly Thr Thr Ser His Gln Val Ser Phe Ser Tyr Phe Asn Gly Phe Asn     210 215 220 Ser Leu Leu Asn Asn Met Glu Leu Ile Arg Lys Ile Tyr Ser Thr Leu 225 230 235 240 Ala Gly Thr Arg Lys Asp Val Glu Val Thr Lys Glu Glu Phe Val Leu                 245 250 255 Ala Ala Gln Lys Phe Gly Gln Val Thr Pro Met Glu Val Asp Ile Leu             260 265 270 Phe Gln Leu Ala Asp Leu Tyr Glu Pro Arg Gly Arg Met Thr Leu Ala         275 280 285 Asp Ile Glu Arg Ile Ala Pro Leu Glu Glu Gly Thr Leu Pro Phe Asn     290 295 300 Leu Ala Glu Ala Gln Arg Gln Gln Lys Ala Ser Gly Asp Ser Ala Arg 305 310 315 320 Pro Val Leu Leu Gln Val Ala Glu Ser Ala Tyr Arg Phe Gly Leu Gly                 325 330 335 Ser Val Ala Gly Ala Val Gly Ala Thr Ala Val Tyr Pro Ile Asp Leu             340 345 350 Val Lys Thr Arg Met Gln Asn Gln Arg Ser Thr Gly Ser Phe Val Gly         355 360 365 Glu Leu Met Tyr Lys Asn Ser Phe Asp Cys Phe Lys Lys Val Leu Arg     370 375 380 Tyr Glu Gly Phe Phe Gly Leu Tyr Arg Gly Leu Leu Pro Gln Leu Leu 385 390 395 400 Gly Val Ala Pro Glu Lys Ala Ile Lys Leu Thr Val Asn Asp Phe Val                 405 410 415 Arg Asp Lys Phe Met His Lys Asp Gly Ser Val Pro Leu Ala Ala Glu             420 425 430 Ile Leu Ala Gly Gly Cys Ala Gly Gly Ser Gln Val Ile Phe Thr Asn         435 440 445 Pro Leu Glu Ile Val Lys Ile Arg Leu Gln Val Ala Gly Glu Ile Thr     450 455 460 Thr Gly Pro Arg Val Ser Ala Leu Ser Val Val Arg Asp Leu Gly Phe 465 470 475 480 Phe Gly Ile Tyr Lys Gly Ala Lys Ala Cys Phe Leu Arg Asp Ile Pro                 485 490 495 Phe Ser Ala Ile Tyr Phe Pro Cys Tyr Ala His Val Lys Ala Ser Phe             500 505 510 Ala Asn Glu Asp Gly Gln Val Ser Pro Gly Ser Leu Leu Leu Ala Gly         515 520 525 Ala Ile Ala Gly Met Pro Ala Ala Ser Leu Val Thr Pro Ala Asp Val     530 535 540 Ile Lys Thr Arg Leu Gln Val Ala Ala Arg Ala Gly Gln Thr Thr Tyr 545 550 555 560 Ser Gly Val Ile Asp Cys Phe Arg Lys Ile Leu Arg Glu Glu Gly Pro                 565 570 575 Lys Ala Leu Trp Lys Gly Ala Gly Ala Arg Val Phe Arg Ser Ser Pro             580 585 590 Gln Phe Gly Val Thr Leu Leu Thr Tyr Glu Leu Leu Gln Arg Trp Phe         595 600 605 Tyr Ile Asp Phe Gly Gly Val Lys Pro Met Gly Ser Glu Pro Val Pro     610 615 620 Lys Ser Arg Ile Asn Leu Pro Ala Pro Asn Pro Asp His Val Gly Gly 625 630 635 640 Tyr Lys Leu Ala Val Ala Thr Phe Ala Gly Ile Glu Asn Lys Phe Gly                 645 650 655 Leu Tyr Leu Pro Leu Phe Lys Pro Ser Val Ser Thr Ser Lys Ala Ile             660 665 670 Gly Gly Gly Pro         675 <210> 31 <211> 824 <212> PRT <213> Homo sapiens <400> 31 Met Ala Ala Ala Ala Pela Gla Ala Ser Gly Ala Leu Ala Ala Ala Val Ala Thr   1 5 10 15 Ala Met Pro Ala Glu His Val Ala Val Gln Val Pro Ala Pro Glu Pro              20 25 30 Thr Pro Gly Pro Val Arg Ile Leu Arg Thr Ala Gln Asp Leu Ser Ser          35 40 45 Pro Arg Thr Arg Thr Gly Asp Val Leu Leu Ala Glu Pro Ala Asp Phe      50 55 60 Glu Ser Leu Leu Leu Ser Arg Pro Val Leu Glu Gly Leu Arg Ala Ala  65 70 75 80 Gly Phe Glu Arg Pro Ser Pro Val Gln Leu Lys Ala Ile Pro Leu Gly                  85 90 95 Arg Cys Gly Leu Asp Leu Ile Val Gln Ala Lys Ser Gly Thr Gly Lys             100 105 110 Thr Cys Val Phe Ser Thr Ile Ala Leu Asp Ser Leu Val Leu Glu Asn         115 120 125 Leu Ser Thr Gln Ile Leu Ile Leu Ala Pro Thr Arg Glu Ile Ala Val     130 135 140 Gln Ile His Ser Val Ile Thr Ala Ile Gly Ile Lys Met Glu Gly Leu 145 150 155 160 Glu Cys His Val Phe Ile Gly Gly Thr Pro Leu Ser Gln Asp Lys Thr                 165 170 175 Arg Leu Lys Lys Cys His Ile Ala Val Gly Ser Pro Gly Arg Ile Lys             180 185 190 Gln Leu Ile Glu Leu Asp Tyr Leu Asn Pro Gly Ser Ile Arg Leu Phe         195 200 205 Ile Leu Asp Glu Ala Asp Lys Leu Leu Glu Glu Gly Ser Phe Gln Glu     210 215 220 Gln Ile Asn Trp Ile Tyr Ser Ser Leu Pro Ala Ser Lys Gln Met Leu 225 230 235 240 Ala Val Ser Ala Thr Tyr Pro Glu Phe Leu Ala Asn Ala Leu Thr Lys                 245 250 255 Tyr Met Arg Asp Pro Thr Phe Val Arg Leu Asn Ser Ser Asp Pro Ser             260 265 270 Leu Ile Gly Leu Lys Gln Tyr Tyr Lys Val Val Asn Ser Tyr Pro Leu         275 280 285 Ala His Lys Val Phe Glu Glu Lys Thr Gln His Leu Gln Glu Leu Phe     290 295 300 Ser Arg Ile Pro Phe Asn Gln Ala Leu Val Phe Ser Asn Leu His Ser 305 310 315 320 Arg Ala Gln His Leu Ala Asp Ile Leu Ser Ser Lys Gly Phe Pro Ala                 325 330 335 Glu Cys Ile Ser Gly Asn Met Asn Gln Asn Gln Arg Leu Asp Ala Met             340 345 350 Ala Lys Leu Lys His Phe His Cys Arg Val Leu Ile Ser Thr Asp Leu         355 360 365 Thr Ser Arg Gly Ile Asp Ala Glu Lys Val Asn Leu Val Val Asn Leu     370 375 380 Asp Val Pro Leu Asp Trp Glu Thr Tyr Met His Arg Ile Gly Arg Ala 385 390 395 400 Gly Arg Phe Gly Thr Leu Gly Leu Thr Val Thr Tyr Cys Cys Arg Gly                 405 410 415 Glu Glu Glu Asn Met Met Met Arg Ile Ala Gln Lys Cys Asn Ile Asn             420 425 430 Leu Leu Pro Leu Pro Asp Pro Ile Pro Ser Gly Leu Met Glu Glu Cys         435 440 445 Val Asp Trp Asp Val Glu Val Lys Ala Ala Val His Thr Tyr Gly Ile     450 455 460 Ala Ser Val Pro Asn Gln Pro Leu Lys Lys Gln Ile Gln Lys Ile Glu 465 470 475 480 Arg Thr Leu Gln Ile Gln Lys Ala His Gly Asp His Met Ala Ser Ser                 485 490 495 Arg Asn Asn Ser Val Ser Gly Leu Ser Val Lys Ser Lys Asn Asn Thr             500 505 510 Lys Gln Lys Leu Pro Val Lys Ser His Ser Glu Cys Gly Ile Ile Glu         515 520 525 Lys Ala Thr Ser Pro Lys Glu Leu Gly Cys Asp Arg Gln Ser Glu Glu     530 535 540 Gln Met Lys Asn Ser Val Gln Thr Pro Val Glu Asn Ser Thr Asn Ser 545 550 555 560 Gln His Gln Val Lys Glu Ala Leu Pro Val Ser Leu Pro Gln Ile Pro                 565 570 575 Cys Leu Ser Ser Phe Lys Ile His Gln Pro Tyr Thr Leu Thr Phe Ala             580 585 590 Glu Leu Val Glu Asp Tyr Glu His Tyr Ile Lys Glu Gly Leu Glu Lys         595 600 605 Pro Val Glu Ile Ile Arg His Tyr Thr Gly Pro Gly Asp Gln Thr Val     610 615 620 Asn Pro Gln Asn Gly Phe Val Arg Asn Lys Val Ile Glu Gln Arg Val 625 630 635 640 Pro Val Leu Ala Ser Ser Ser Gln Ser Gly Asp Ser Glu Ser Asp Ser                 645 650 655 Asp Ser Tyr Ser Ser Thr Ser Ser Gln Ser Lys Gly Asn Lys Ser             660 665 670 Tyr Leu Glu Gly Ser Ser Asp Asn Gln Leu Lys Asp Ser Glu Ser Thr         675 680 685 Pro Val Asp Arg Ile Ser Leu Glu Gln Pro Pro Asn Gly Ser Asp     690 695 700 Thr Pro Asn Pro Glu Lys Tyr Gln Glu Ser Pro Gly Ile Gln Met Lys 705 710 715 720 Thr Arg Leu Lys Glu Gly Ala Ser Gln Arg Ala Lys Gln Ser Arg Arg                 725 730 735 Asn Leu Pro Arg Arg Ser Ser Phe Arg Leu Gln Thr Glu Ala Gln Glu             740 745 750 Asp Asp Trp Tyr Asp Cys His Arg Glu Ile Arg Leu Ser Phe Ser Asp         755 760 765 Thr Tyr Gln Asp Tyr Glu Glu Tyr Trp Arg Ala Tyr Tyr Arg Ala Trp     770 775 780 Gln Glu Tyr Tyr Ala Ala Ala Ser His Ser Tyr Tyr Trp Asn Ala Gln 785 790 795 800 Arg His Pro Ser Trp Met Ala Ala Tyr His Met Asn Thr Ile Tyr Leu                 805 810 815 Gln Glu Met Met His Ser Asn Gln             820 <210> 32 <211> 759 <212> PRT <213> Homo sapiens <400> 32 Met Gly Leu Pro Ala Leu Glu Phe Ser Asp Cys Cys Leu Asp Ser Pro   1 5 10 15 His Phe Arg Glu Thr Leu Lys Ser His Glu Ala Glu Leu Asp Lys Thr              20 25 30 Asn Lys Phe Ile Lys Glu Leu Ile Lys Asp Gly Lys Ser Leu Ile Ser          35 40 45 Ala Leu Lys Asn Leu Ser Ser Ala Lys Arg Lys Phe Ala Asp Ser Leu      50 55 60 Asn Glu Phe Lys Phe Gln Cys Ile Gly Asp Ala Glu Thr Asp Asp Glu  65 70 75 80 Met Cys Ile Ala Arg Ser Leu Gln Glu Phe Ala Thr Val Leu Arg Asn                  85 90 95 Leu Glu Asp Glu Arg Ile Arg Met Ile Glu Asn Ala Ser Glu Val Leu             100 105 110 Ile Thr Pro Leu Glu Lys Phe Arg Lys Glu Gln Ile Gly Ala Ala Lys         115 120 125 Glu Ala Lys Lys Lys Tyr Asp Lys Glu Thr Glu Lys Tyr Cys Gly Ile     130 135 140 Leu Glu Lys His Leu Asn Leu Ser Ser Lys Lys Lys Glu Ser Gln Leu 145 150 155 160 Gln Glu Ala Asp Ser Gln Val Asp Leu Val Arg Gln His Phe Tyr Glu                 165 170 175 Val Ser Leu Glu Tyr Val Phe Lys Val Gln Glu Val Gln Glu Arg Lys             180 185 190 Met Phe Glu Phe Val Glu Pro Leu Leu Ala Phe Leu Gln Gly Leu Phe         195 200 205 Thr Phe Tyr His His Gly Tyr Glu Leu Ala Lys Asp Phe Gly Asp Phe     210 215 220 Lys Thr Gln Leu Thr Ile Ser Ile Gln Asn Thr Arg Asn Arg Phe Glu 225 230 235 240 Gly Thr Arg Ser Glu Val Glu Ser Leu Met Lys Lys Met Lys Glu Asn                 245 250 255 Pro Leu Glu His Lys Thr Ile Ser Pro Tyr Thr Met Glu Gly Tyr Leu             260 265 270 Tyr Val Gln Glu Lys Arg His Phe Gly Thr Ser Trp Val Lys His Tyr         275 280 285 Cys Thr Tyr Gln Arg Asp Ser Lys Gln Ile Thr Met Val Pro Phe Asp     290 295 300 Gln Lys Ser Gly Gly Lys Gly Gly Glu Asp Glu Ser Val Ile Leu Lys 305 310 315 320 Ser Cys Thr Arg Arg Lys Thr Asp Ser Ile Glu Lys Arg Phe Cys Phe                 325 330 335 Asp Val Glu Ala Val Asp Arg Pro Gly Val Ile Thr Met Gln Ala Leu             340 345 350 Ser Glu Glu Asp Arg Arg Leu Trp Met Glu Ala Met Asp Gly Arg Glu         355 360 365 Pro Val Tyr Asn Ser Asn Lys Asp Ser Gln Ser Glu Gly Thr Ala Gln     370 375 380 Leu Asp Ser Ile Gly Phe Ser Ile Ile Arg Lys Cys Ile His Ala Val 385 390 395 400 Glu Thr Arg Gly Ile Asn Glu Gln Gly Leu Tyr Arg Ile Val Gly Val                 405 410 415 Asn Ser Arg Val Gln Lys Leu Leu Ser Val Leu Met Asp Pro Lys Thr             420 425 430 Ala Ser Glu Thr Glu Thr Asp Ile Cys Ala Glu Trp Glu Ile Lys Thr         435 440 445 Ile Thr Ser Ala Leu Lys Thr Tyr Leu Arg Met Leu Pro Gly Pro Leu     450 455 460 Met Met Tyr Gln Phe Gln Arg Ser Phe Ile Lys Ala Ala Lys Leu Glu 465 470 475 480 Asn Gln Glu Ser Arg Val Ser Glu Ile His Ser Leu Val His Arg Leu                 485 490 495 Pro Glu Lys Asn Arg Gln Met Leu Gln Leu Leu Met Asn His Leu Ala             500 505 510 Asn Val Ala Asn Asn His Lys Gln Asn Leu Met Thr Val Ala Asn Leu         515 520 525 Gly Val Val Phe Gly Pro Thr Leu Leu Arg Pro Gln Glu Glu Thr Val     530 535 540 Ala Ala Ile Met Asp Ile Lys Phe Gln Asn Ile Val Ile Glu Ile Leu 545 550 555 560 Ile Glu Asn His Glu Lys Ile Phe Asn Thr Val Pro Asp Met Pro Leu                 565 570 575 Thr Asn Gln Leu His Leu Ser Arg Lys Lys Ser Ser Asp Ser Lys             580 585 590 Pro Pro Ser Cys Ser Glu Arg Pro Leu Thr Leu Phe His Thr Val Gln         595 600 605 Ser Thr Glu Lys Gln Glu Gln Arg Asn Ser Ile Ile Asn Ser Ser Leu     610 615 620 Glu Ser Val Ser Ser Asn Pro Asn Ser Ile Leu Asn Ser Ser Ser Ser 625 630 635 640 Leu Gln Pro Asn Met Asn Ser Ser Asp Pro Asp Leu Ala Val Val Lys                 645 650 655 Pro Thr Arg Pro Asn Ser Leu Pro Pro Asn Pro Ser Ser Thr Ser Pro             660 665 670 Leu Ser Pro Ser Trp Pro Met Ser Ser Pro Ser Ser Pro Met Pro         675 680 685 Thr Ser Ser Thr Ser Ser Asp Ser Ser Pro Val Ser Thr Pro Phe Arg     690 695 700 Lys Ala Lys Ala Leu Tyr Ala Cys Lys Ala Glu His Asp Ser Glu Leu 705 710 715 720 Ser Phe Thr Ala Gly Thr Val Phe Asp Asn Val His Ser Ser Gln Glu                 725 730 735 Pro Gly Trp Leu Glu Gly Thr Leu Asn Gly Lys Thr Gly Leu Ile Pro             740 745 750 Glu Asn Tyr Val Glu Phe Leu         755 <210> 33 <211> 506 <212> PRT <213> Homo sapiens <400> 33 Met Leu Ser Lys Val Leu Pro Val Leu Leu Gly Ile Leu Leu Ile Leu   1 5 10 15 Gln Ser Arg Val Glu Gly Pro Gln Thr Glu Ser Lys Asn Glu Ala Ser              20 25 30 Ser Arg Asp Val Val Tyr Gly Pro Gln Pro Gln Pro Leu Glu Asn Gln          35 40 45 Leu Leu Ser Glu Glu Thr Lys Ser Thr Glu Thr Glu Thr Gly Ser Arg      50 55 60 Val Gly Lys Leu Pro Glu Ala Ser Arg Ile Leu Asn Thr Ile Leu Ser  65 70 75 80 Asn Tyr Asp His Lys Leu Arg Pro Gly Ile Gly Glu Lys Pro Thr Val                  85 90 95 Val Thr Val Glu Ile Ser Val Asn Ser Leu Gly Pro Leu Ser Ile Leu             100 105 110 Asp Met Glu Tyr Thr Ile Asp Ile Ile Phe Ser Gln Thr Trp Tyr Asp         115 120 125 Glu Arg Leu Cys Tyr Asn Asp Thr Phe Glu Ser Leu Val Leu Asn Gly     130 135 140 Asn Val Val Ser Gln Leu Trp Ile Pro Asp Thr Phe Phe Arg Asn Ser 145 150 155 160 Lys Arg Thr His Glu His Glu Ile Thr Met Pro Asn Gln Met Val Arg                 165 170 175 Ile Tyr Lys Asp Gly Lys Val Leu Tyr Thr Ile Arg Met Thr Ile Asp             180 185 190 Ala Gly Cys Ser Leu His Met Leu Arg Phe Pro Met Asp Ser His Ser         195 200 205 Cys Pro Leu Ser Phe Ser Ser Phe Ser Tyr Pro Glu Asn Glu Met Ile     210 215 220 Tyr Lys Trp Glu Asn Phe Lys Leu Glu Ile Asn Glu Lys Asn Ser Trp 225 230 235 240 Lys Leu Phe Gln Phe Asp Phe Thr Gly Val Ser Asn Lys Thr Glu Ile                 245 250 255 Ile Thr Thr Pro Val Gly Asp Phe Met Val Met Thr Ile Phe Phe Asn             260 265 270 Val Ser Arg Arg Phe Gly Tyr Val Ala Phe Gln Asn Tyr Val Ser Ser         275 280 285 Ser Val Thr Thr Met Leu Ser Trp Val Ser Phe Trp Ile Lys Thr Glu     290 295 300 Ser Ala Pro Ala Arg Thr Ser Leu Gly Ile Thr Ser Val Leu Thr Met 305 310 315 320 Thr Thr Leu Gly Thr Phe Ser Arg Lys Asn Phe Pro Arg Val Ser Tyr                 325 330 335 Ile Thr Ala Leu Asp Phe Tyr Ile Ala Ile Cys Phe Val Phe Cys Phe             340 345 350 Cys Ala Leu Leu Glu Phe Ala Val Leu Asn Phe Leu Ile Tyr Asn Gln         355 360 365 Thr Lys Ala His Ala Ser Pro Lys Leu Arg His Pro Arg Ile Asn Ser     370 375 380 Arg Ala His Ala Arg Thr Arg Ala Arg Ser Ser Ala Cys Ala Arg Gln 385 390 395 400 His Gln Glu Ala Phe Val Cys Gln Ile Val Thr Thr Glu Gly Ser Asp                 405 410 415 Gly Glu Glu Arg Pro Ser Cys Ser Ala Gln Gln Pro Pro Ser Pro Gly             420 425 430 Ser Pro Glu Gly Pro Arg Ser Leu Cys Ser Lys Leu Ala Cys Cys Glu         435 440 445 Trp Cys Lys Arg Phe Lys Lys Tyr Phe Cys Met Val Pro Asp Cys Glu     450 455 460 Gly Ser Thr Trp Gln Gln Gly Arg Leu Cys Ile His Val Tyr Arg Leu 465 470 475 480 Asp Asn Tyr Ser Arg Val Val Phe Pro Val Thr Phe Phe Phe Phe Asn                 485 490 495 Val Leu Tyr Trp Leu Val Cys Leu Asn Leu             500 505 <210> 34 <211> 1038 <212> PRT <213> Homo sapiens <400> 34 Met Asp Pro Asn Thr Ile Ile Glu Ala Leu Arg Gly Thr Met Asp Pro   1 5 10 15 Ala Leu Arg Glu Ala Ala Glu Arg Gln Leu Asn Glu Ala His Lys Ser              20 25 30 Leu Asn Phe Val Ser Thr Leu Leu Gln Ile Thr Met Ser Glu Gln Leu          35 40 45 Asp Leu Pro Val Arg Gln Ala Gly Val Ile Tyr Leu Lys Asn Met Ile      50 55 60 Thr Gln Tyr Trp Pro Asp Arg Glu Thr Ala Pro Gly Asp Ile Ser Pro  65 70 75 80 Tyr Thr Ile Pro Glu Glu Asp Arg His Cys Ile Arg Glu Asn Ile Val                  85 90 95 Glu Ala Ile His Ser Pro Glu Leu Ile Arg Val Gln Leu Thr Thr             100 105 110 Cys Ile His His Ile Ile Lys His Asp Tyr Pro Ser Arg Trp Thr Ala         115 120 125 Ile Val Asp Lys Ile Gly Phe Tyr Leu Gln Ser Asp Asn Ser Ala Cys     130 135 140 Trp Leu Gly Ile Leu Leu Cys Leu Tyr Gln Leu Val Lys Asn Tyr Glu 145 150 155 160 Tyr Lys Lys Pro Glu Glu Arg Ser Pro Leu Val Ala Ala Met Gln His                 165 170 175 Phe Leu Pro Val Leu Lys Asp Arg Phe Ile Gln Leu Leu Ser Asp Gln             180 185 190 Ser Asp Gln Ser Val Leu Ile Gln Lys Gln Ile Phe Lys Ile Phe Tyr         195 200 205 Ala Leu Val Gln Tyr Thr Leu Pro Leu Glu Leu Ile Asn Gln Gln Asn     210 215 220 Leu Thr Glu Trp Ile Glu Ile Leu Lys Thr Val Val Asn Arg Asp Val 225 230 235 240 Pro Asn Glu Thr Leu Glu Val Glu Glu Asp Asp Arg Pro Glu Leu Pro                 245 250 255 Trp Trp Lys Cys Lys Lys Trp Ala Leu His Ile Leu Ala Arg Leu Phe             260 265 270 Glu Arg Tyr Gly Ser Pro Gly Asn Val Ser Lys Glu Tyr Asn Glu Phe         275 280 285 Ala Glu Val Phe Leu Lys Ala Phe Ala Val Gly Val Gln Gln Val Leu     290 295 300 Leu Lys Val Leu Tyr Gln Tyr Lys Glu Lys Gln Tyr Met Ala Pro Arg 305 310 315 320 Val Leu Gln Gln Thr Leu Asn Tyr Ile Asn Gln Gly Val Ser His Ala                 325 330 335 Leu Thr Trp Lys Asn Leu Lys Pro His Ile Gln Gly Ile Ile Gln Asp             340 345 350 Val Ile Phe Pro Leu Met Cys Tyr Thr Asp Ala Asp Glu Glu Leu Trp         355 360 365 Gln Glu Asp Pro Tyr Glu Tyr Ile Arg Met Lys Phe Asp Val Phe Glu     370 375 380 Asp Phe Ile Ser Pro Thr Thr Ala Gln Thr Leu Leu Phe Thr Ala 385 390 395 400 Cys Ser Lys Arg Lys Glu Val Leu Gln Lys Thr Met Gly Phe Cys Tyr                 405 410 415 Gln Ile Leu Thr Glu Pro Asn Ala Asp Pro Arg Lys Lys Asp Gly Ala             420 425 430 Leu His Met Ile Gly Ser Leu Ala Glu Ile Leu Leu Lys Lys Lys Ile         435 440 445 Tyr Lys Asp Gln Met Glu Tyr Met Leu Gln Asn His Val Phe Pro Leu     450 455 460 Phe Ser Ser Glu Leu Gly Tyr Met Arg Ala Arg Ala Cys Trp Val Leu 465 470 475 480 His Tyr Phe Cys Glu Val Lys Phe Lys Ser Asp Gln Asn Leu Gln Thr                 485 490 495 Ala Leu Glu Leu Thr Arg Arg Cys Leu Ile Asp Asp Arg Glu Met Pro             500 505 510 Val Lys Val Glu Ala Ile Ala Leu         515 520 525 Glu Lys Ala Lys Glu Tyr Ile Thr Pro Phe Ile Arg Pro Val Met Gln     530 535 540 Ala Leu Leu His Ile Ile Arg Glu Thr Glu Asn Asp Asp Leu Thr Asn 545 550 555 560 Val Ile Gln Lys Met Ile Cys Glu Tyr Ser Glu Glu Val Thr Pro Ile                 565 570 575 Ala Val Glu Met Thr Gln His Leu Ala Met Thr Phe Asn Gln Val Ile             580 585 590 Gln Thr Gly Pro Asp Glu Glu Gly Ser Asp Asp Lys Ala Val Thr Ala         595 600 605 Met Gly Ile Leu Asn Thr Ile Asp Thr Leu Leu Ser Val Val Glu Asp     610 615 620 His Lys Glu Ile Thr Gln Gln Leu Glu Gly Ile Cys Leu Gln Val Ile 625 630 635 640 Gly Thr Val Leu Gln Gln His Val Leu Glu Phe Tyr Glu Glu Ile Phe                 645 650 655 Ser Leu Ala His Ser Leu Thr Cys Gln Gln Val Ser Pro Gln Met Trp             660 665 670 Gln Leu Leu Pro Leu Val Phe Glu Val Phe Gln Gln Asp Gly Phe Asp         675 680 685 Tyr Phe Thr Asp Met Met Pro Leu Leu His Asn Tyr Val Thr Val Asp     690 695 700 Thr Asp Thr Leu Leu Ser Asp Thr Lys Tyr Leu Glu Met Ile Tyr Ser 705 710 715 720 Met Cys Lys Lys Val Leu Thr Gly Val Ala Gly Glu Asp Ala Glu Cys                 725 730 735 His Ala Ala Lys Leu Leu Glu Val Ile Ile Leu Gln Cys Lys Gly Arg             740 745 750 Gly Ile Asp Gln Cys Ile Pro Leu Phe Val Glu Ala Ala Leu Glu Arg         755 760 765 Leu Thr Arg Glu Val Lys Thr Ser Glu Leu Arg Thr Met Cys Leu Gln     770 775 780 Val Ala Ile Ala Ala Leu Tyr Tyr Asn Pro 785 790 795 800 Leu Glu Asn Leu Arg Phe Pro Asn Asn Val Glu Pro Val Thr Asn His                 805 810 815 Phe Ile Thr Gln Trp Leu Asn Asp Val Asp Cys Phe Leu Gly Leu His             820 825 830 Asp Arg Lys Met Cys Val Leu Gly Leu Cys Ala Leu Ile Asp Met Glu         835 840 845 Gln Ile Pro Gln Val Leu Asn Gln Val Ser Gly Gln Ile Leu Pro Ala     850 855 860 Phe Ile Leu Leu Phe Asn Gly Leu Lys Arg Ala Tyr Ala Cys His Ala 865 870 875 880 Glu His Glu Asn Asp Ser Asp Asp Asp Asp Glu Ala Glu Asp Asp Asp                 885 890 895 Glu Thr Glu Glu Leu Gly Ser Asp Glu Asp Asp Ile Asp Glu Asp Gly             900 905 910 Gln Glu Tyr Leu Glu Ile Leu Ala Lys Gln Ala Gly Glu Asp Gly Asp         915 920 925 Asp Glu Asp Trp Glu Glu Asp Asp Ala Glu Glu Thr Ala Leu Glu Gly     930 935 940 Tyr Ser Thr Ile Ile Asp Asp Glu Asp Asn Pro Val Asp Glu Tyr Gln 945 950 955 960 Ile Phe Lys Ala Ile Phe Gln Thr Ile Gln Asn Arg Asn Pro Val Trp                 965 970 975 Tyr Gln Ala Leu Thr His Gly Leu Asn Glu Glu Gln Arg Lys Gln Leu             980 985 990 Gln Asp Ile Ala Thr Leu Ala Asp Gln Arg Arg Ala Ala His Glu Ser         995 1000 1005 Lys Met Ile Glu Lys His Gly Gly Tyr Lys Phe Ser Ala Pro Val Val    1010 1015 1020 Pro Ser Ser Phe Asn Phe Gly Gly Pro Ala Pro Gly Met Asn 1025 1030 1035 <210> 35 <211> 712 <212> PRT <213> Homo sapiens <400> 35 Met Glu Asn Leu Gly Val Gly Glu Gly Ala Glu Ala Cys Ser Arg Leu   1 5 10 15 Ser Arg Ser Ser Arg Gly Arg His Ser Met Thr Arg Ala Pro Lys His Leu              20 25 30 Trp Arg Gln Pro Arg Arg Pro Ile Arg Ile Gln Gln Arg Phe Tyr Ser          35 40 45 Asp Pro Asp Lys Ser Ala Gly Cys Arg Glu Arg Asp Leu Ser Pro Arg      50 55 60 Pro Glu Leu Arg Lys Ser Arg Leu Ser Trp Pro Val Ser Ser Cys Arg  65 70 75 80 Arg Phe Asp Leu Glu Asn Gly Leu Ser Cys Gly Arg Arg Ala Leu Asp                  85 90 95 Pro Gln Ser Ser Pro Gly Leu Gly Arg Ile Met Gln Ala Pro Val Pro             100 105 110 His Ser Gln Arg Arg Glu Ser Phe Leu Tyr Arg Ser Asp Ser Asp Tyr         115 120 125 Glu Leu Ser Pro Lys Ala Met Ser Arg Asn Ser Ser Val Ala Ser Asp     130 135 140 Leu His Gly Glu Asp Met Ile Val Thr Pro Phe Ala Gln Val Leu Ala 145 150 155 160 Ser Leu Arg Thr Val Arg Ser Ser Val Val Ala Leu Ala Arg Gl Gln                 165 170 175 Cys Leu Gly Ala Ala Lys Gln Gly Pro Val Gly Asn Pro Ser Ser Ser             180 185 190 Asn Gln Leu Pro Pro Ala Glu Asp Thr Gly Gln Lys Leu Ala Leu Glu         195 200 205 Thr Leu Asp Glu Leu Asp Trp Cys Leu Asp Gln Leu Glu Thr Leu Gln     210 215 220 Thr Arg His Ser Val Gly Glu Met Ala Ser Asn Lys Phe Lys Arg Ile 225 230 235 240 Leu Asn Arg Glu Leu Thr His Leu Ser Glu Thr Ser Arg Ser Gly Asn                 245 250 255 Gln Val Ser Glu Tyr Ile Ser Arg Thr Phe Leu Asp Gln Gln Thr Glu             260 265 270 Val Glu Leu Pro Lys Val Thr Ala Glu Glu Ala Pro Gln Pro Met Ser         275 280 285 Arg Ile Ser Gly Leu His Gly Leu Cys His Ser Ala Ser Leu Ser Ser     290 295 300 Ala Thr Val Pro Arg Phe Gly Val Gln Thr Asp Gln Glu Glu Gln Leu 305 310 315 320 Ala Lys Glu Leu Glu Asp Thr Asn Lys Trp Gly Leu Asp Val Phe Lys                 325 330 335 Val Ala Glu Leu Ser Gly Asn Arg Pro Leu Thr Ala Ile Ile Phe Ser             340 345 350 Ile Phe Gln Glu Arg Asp Leu Leu Lys Thr Phe Gln Ile Pro Ala Asp         355 360 365 Thr Leu Ala Thr Tyr Leu Leu Met Leu Glu Gly His Tyr His Ala Asn     370 375 380 Val Ala Tyr His Asn Ser Leu His Ala Ala Asp Val Ala Gln Ser Thr 385 390 395 400 His Val Leu Leu Ala Thr Pro Ala Leu Glu Ala Val Phe Thr Asp Leu                 405 410 415 Glu Ile Leu Ala Ala Leu Phe Ala Ser Ala Ile His Asp Val Asp His             420 425 430 Pro Gly Val Ser Asn Gln Phe Leu Ile Asn Thr Asn Ser Glu Leu Ala         435 440 445 Leu Met Tyr Asn Asp Ala Ser Val Leu Glu Asn His His Leu Ala Val     450 455 460 Gly Phe Lys Leu Leu Gln Ala Glu Asn Cys Asp Ile Phe Gln Asn Leu 465 470 475 480 Ser Ala Lys Gln Arg Leu Ser Leu Arg Arg Met Val Ile Asp Met Val                 485 490 495 Leu Ala Thr Asp Met Ser Lys His Met Asn Leu Leu Ala Asp Leu Lys             500 505 510 Thr Met Val Glu Thr Lys Lys Val Thr Ser Leu Gly Val Leu Leu Leu         515 520 525 Asp Asn Tyr Ser Asp Arg Ile Gln Val Leu Gln Asn Leu Val His Cys     530 535 540 Ala Asp Leu Ser Asn Pro Thr Lys Pro Leu Pro Leu Tyr Arg Gln Trp 545 550 555 560 Thr Asp Arg Ile Met Ala Glu Phe Phe Gln Gln Gly Asp Arg Glu Arg                 565 570 575 Glu Ser Gly Leu Asp Ile Ser Pro Met Cys Asp Lys His Thr Ala Ser             580 585 590 Val Glu Lys Ser Gln Val Gly Phe Ile Asp Tyr Ile Ala His Pro Leu         595 600 605 Trp Glu Thr Trp Ala Asp Leu Val His Pro Asp Ala Gln Asp Leu Leu     610 615 620 Asp Thr Leu Glu Asp Asn Arg Glu Trp Tyr Gln Ser Lys Ile Pro Arg 625 630 635 640 Ser Pro Ser Asp Leu Thr Asn Pro Glu Arg Asp Gly Pro Asp Arg Phe                 645 650 655 Gln Phe Glu Leu Thr Leu Glu Glu Ala Glu Glu Glu Glu Asp Glu Glu Glu             660 665 670 Glu Glu Glu Glu Glu Glu Glu Thu Ala Leu Ala Lys Glu Ala Leu Glu Leu         675 680 685 Pro Asp Thr Glu Leu Leu Ser Pro Glu Ala Gly Pro Asp Pro Gly Asp     690 695 700 Leu Pro Leu Asp Asn Gln Arg Thr 705 710 <210> 36 <211> 643 <212> PRT <213> Homo sapiens <400> 36 Met Ser Pro Phe Leu Arg Ile Gly Leu Ser Asn Phe Asp Cys Gly Ser   1 5 10 15 Cys Gln Ser Cys Gln Gly Glu Ala Val Asn Pro Tyr Cys Ala Val Leu              20 25 30 Val Lys Glu Tyr Val Glu Ser Glu Asn Gly Gln Met Tyr Ile Gln Lys          35 40 45 Lys Pro Thr Met Tyr Pro Pro Trp Asp Ser Thr Phe Asp Ala His Ile      50 55 60 Asn Lys Gly Arg Val Met Gln Ile Ile Val Lys Gly Lys Asn Val Asp  65 70 75 80 Leu Ile Ser Glu Thr Thr Val Glu Leu Tyr Ser Leu Ala Glu Arg Cys                  85 90 95 Arg Lys Asn Asn Gly Lys Thr Glu Ile Trp Leu Glu Leu Lys Pro Gln             100 105 110 Gly Arg Met Leu Met Asn Ala Arg Tyr Phe Leu Glu Met Ser Asp Thr         115 120 125 Lys Asp Met Asn Glu Phe Glu Thr Glu Gly Phe Phe Ala Leu His Gln     130 135 140 Arg Arg Gly Ala Ile Lys Gln Ala Lys Val His His Val Lys Cys His 145 150 155 160 Glu Phe Thr Ala Thr Phe Phe Pro Gln Pro Thr Phe Cys Ser Val Cys                 165 170 175 His Glu Phe Val Trp Gly Leu Asn Lys Gln Gly Tyr Gln Cys Arg Gln             180 185 190 Cys Asn Ala Ala Ile His Lys Lys Cys Ile Asp Lys Val Ile Ala Lys         195 200 205 Cys Thr Gly Ser Ala Ile Asn Ser Arg Glu Thr Met Phe His Lys Glu     210 215 220 Arg Phe Lys Ile Asp Met Pro His Arg Phe Lys Val Tyr Asn Tyr Lys 225 230 235 240 Ser Pro Thr Phe Cys Glu His Cys Gly Thr Leu Leu Trp Gly Leu Ala                 245 250 255 Arg Gln Gly Leu Lys Cys Asp Ala Cys Gly Met Asn Val His His Arg             260 265 270 Cys Gln Thr Lys Val Ala Asn Leu Cys Gly Ile Asn Gln Lys Leu Met         275 280 285 Ala Glu Ala Leu Ala Met Ile Glu Ser Thr Gln Gln Ala Arg Cys Leu     290 295 300 Arg Asp Thr Glu Gln Ile Phe Arg Glu Gly Pro Val Glu Ile Gly Leu 305 310 315 320 Pro Cys Ser Ile Lys Asn Glu Ala Arg Pro Pro Cys Leu Pro Thr Pro                 325 330 335 Gly Lys Arg Glu Pro Gln Gly Ile Ser Trp Glu Ser Pro Leu Asp Glu             340 345 350 Val Asp Lys Met Cys His Leu Pro Glu Pro Glu Leu Asn Lys Glu Arg         355 360 365 Pro Ser Leu Gln Ile Lys Leu Lys Ile Glu Asp Phe Ile Leu His Lys     370 375 380 Met Leu Gly Lys Gly Ser Phe Gly Lys Val Phe Leu Ala Glu Phe Lys 385 390 395 400 Lys Thr Asn Gln Phe Phe Ala Ile Lys Ala Leu Lys Lys Asp Val Val                 405 410 415 Leu Met Asp Asp Asp Val Glu Cys Thr Met Val Glu Lys Arg Val Leu             420 425 430 Ser Leu Ala Trp Glu His Pro Phe Leu Thr His Met Phe Cys Thr Phe         435 440 445 Gln Thr Lys Glu Asn Leu Phe Phe Val Met Glu Tyr Leu Asn Gly Gly     450 455 460 Asp Leu Met Tyr His Ile Gln Ser Cys His Lys Phe Asp Leu Ser Arg 465 470 475 480 Ala Thr Phe Tyr Ala Ala Glu Ile Ile Leu Gly Leu Gln Phe Leu His                 485 490 495 Ser Lys Gly Ile Val Tyr Arg Asp Leu Lys Leu Asp Asn Ile Leu Leu             500 505 510 Asp Lys Asp Gly His Ile Lys Ile Ala Asp Phe Gly Met Cys Lys Glu         515 520 525 Asn Met Leu Gly Asp Ala Lys Thr Asn Thr Phe Cys Gly Thr Pro Asp     530 535 540 Tyr Ile Ala Pro Glu Leu Phe Val Arg Glu Pro Glu Lys Arg Leu Gly 545 550 555 560 Val Arg Gly Asp Ile Arg Gln His Pro Leu Phe Arg Glu Ile Asn Trp                 565 570 575 Glu Glu Leu Glu Arg Lys Glu Ile Asp Pro Pro Phe Arg Pro Lys Val             580 585 590 Lys Ser Pro Phe Asp Cys Ser Asn Phe Asp Lys Glu Phe Leu Asn Glu         595 600 605 Lys Pro Arg Leu Ser Phe Ala Asp Arg Ala Leu Ile Asn Ser Met Asp     610 615 620 Gln Asn Met Phe Arg Asn Phe Ser Phe Met Asn Pro Gly Met Glu Arg 625 630 635 640 Leu Ile Ser             <210> 37 <211> 326 <212> PRT <213> Homo sapiens <400> 37 Met Ala Ala Pro Ala Ser Val Met Gly Pro Ala Leu   1 5 10 15 Gly Leu Leu Leu Leu Leu Leu Val Val Ala Pro Pro Arg Val Ala              20 25 30 Leu Val His Arg Gln Pro Glu Asn Gln Gly Ile Ser Leu Thr Gly Ser          35 40 45 Val Ala Cys Gly Arg Pro Ser Met Glu Gly Lys Ile Leu Gly Gly Val      50 55 60 Pro Ala Pro Glu Arg Lys Trp Pro Trp Gln Val Ser Val His Tyr Ala  65 70 75 80 Gly Leu His Val Cys Gly Gly Ser Ile Leu Asn Glu Tyr Trp Val Leu                  85 90 95 Ser Ala Ala His Cys Phe His Arg Asp Lys Asn Ile Lys Ile Tyr Asp             100 105 110 Met Tyr Val Gly Leu Val Asn Leu Arg Val Ala Gly Asn His Thr Gln         115 120 125 Trp Tyr Glu Val Asn Arg Val Ile Leu His Pro Thr Tyr Glu Met Tyr     130 135 140 His Pro Ile Gly Gly Asp Val Ala Leu Val Gln Leu Lys Thr Arg Ile 145 150 155 160 Val Phe Ser Glu Ser Val Leu Pro Val Cys Leu Ala Thr Pro Glu Val                 165 170 175 Asn Leu Thr Ser Ala Asn Cys Trp Ala Thr Gly Trp Gly Leu Val Ser             180 185 190 Lys Gln Gly Glu Thr Ser Asp Glu Leu Gln Glu Met Gln Leu Pro Leu         195 200 205 Ile Leu Glu Pro Trp Cys His Leu Leu Tyr Gly His Met Ser Tyr Ile     210 215 220 Met Pro Asp Met Leu Cys Ala Gly Asp Ile Leu Asn Ala Lys Thr Val 225 230 235 240 Cys Glu Gly Asp Ser Gly Gly Pro Leu Val Cys Glu Phe Asn Arg Ser                 245 250 255 Trp Leu Gln Ile Gly Ile Val Ser Trp Gly Arg Gly Cys Ser Asn Pro             260 265 270 Leu Tyr Pro Gly Val Tyr Ala Ser Val Ser Tyr Phe Ser Lys Trp Ile         275 280 285 Cys Asp Asn Ile Glu Ile Thr Pro Thr Pro Ala Gln Pro Ala Pro Ala     290 295 300 Leu Ser Pro Ala Leu Gly Pro Thr Leu Ser Val Leu Met Ala Met Leu 305 310 315 320 Ala Gly Trp Ser Val Leu                 325 <210> 38 <211> 1910 <212> PRT <213> Homo sapiens <400> 38 Met Trp Val Ala Lys Trp Leu Thr Gly Leu Leu Tyr His Leu Ser Leu   1 5 10 15 Phe Ile Thr Arg Ser Trp Glu Val Asp Phe His Pro Arg Gln Glu Ala              20 25 30 Leu Val Arg Thr Leu Thr Ser Tyr Glu Val Valle Pro Glu Arg Val          35 40 45 Asn Glu Phe Gly Glu Val Phe Pro Gln Ser His His His Ser Ser Gln      50 55 60 Lys Arg Ser Ser Glu Ala Leu Glu Pro Met Pro Phe Arg Thr His Tyr  65 70 75 80 Arg Phe Thr Ala Tyr Gly Gln Leu Phe Gln Leu Asn Leu Thr Ala Asp                  85 90 95 Ala Ser Phe Leu Ala Ala Gly Tyr Thr Glu Val His Leu Gly Thr Pro             100 105 110 Glu Arg Gly Ala Trp Glu Ser Asp Ala Gly Pro Ser Asp Leu Arg His         115 120 125 Cys Phe Tyr Arg Gly Gln Val Asn Ser Gln Glu Asp Tyr Lys Ala Val     130 135 140 Val Ser Leu Cys Gly Gly Leu Thr Gly Thr Phe Lys Gly Gln Asn Gly 145 150 155 160 Glu Tyr Phe Leu Glu Pro Ile Met Lys Ala Asp Gly Asn Glu Tyr Glu                 165 170 175 Asp Gly His Asn Lys Pro His Leu Ile Tyr Arg Gln Asp Leu Asn Asn             180 185 190 Ser Phe Leu Gln Thr Leu Lys Tyr Cys Ser Val Ser Glu Ser Gln Ile         195 200 205 Lys Glu Thr Ser Leu Pro Phe His Thr Tyr Ser Asn Met Asn Glu Asp     210 215 220 Leu Asn Val Met Lys Glu Arg Val Leu Gly His Thr Ser Lys Asn Val 225 230 235 240 Pro Leu Lys Asp Glu Arg Arg His Ser Arg Lys Lys Arg Leu Ile Ser                 245 250 255 Tyr Pro Arg Tyr Ile Glu Ile Met Val Thr Ala Asp Ala Lys Val Val             260 265 270 Ser Ala His Gly Ser Asn Leu Gln Asn Tyr Ile Leu Thr Leu Met Ser         275 280 285 Ile Val Ala Thr Ile Tyr Lys Asp Pro Ser Ile Gly Asn Leu Ile His     290 295 300 Ile Val Val Lys Leu Val Met Ile His Arg Glu Glu Glu Gly Pro 305 310 315 320 Val Ile Asn Phe Asp Gly Ala Thr Thr Leu Lys Asn Phe Cys Ser Trp                 325 330 335 Gln Gln Thr Gln Asn Asp Leu Asp Asp Val His Pro Ser His His Asp             340 345 350 Thr Ala Val Leu Ile Thr Arg Glu Asp Ile Cys Ser Ser Lys Glu Lys         355 360 365 Cys Asn Met Leu Gly Leu Ser Tyr Leu Gly Thr Ile Cys Asp Pro Leu     370 375 380 Gln Ser Cys Phe Ile Asn Glu Glu Lys Gly Leu Ile Ser Ala Phe Thr 385 390 395 400 Ile Ala His Glu Leu Gly His Thr Leu Gly Val Gln His Asp Asp Asn                 405 410 415 Pro Arg Cys Lys Glu Met Lys Val Thr Lys Tyr His Val Met Ala Pro             420 425 430 Ala Leu Ser Phe His Met Ser Pro Trp Ser Trp Ser Asn Cys Ser Arg         435 440 445 Lys Tyr Val Thr Glu Phe Leu Asp Thr Gly Tyr Gly Glu Cys Leu Leu     450 455 460 Asp Lys Pro Asp Glu Glu Ile Tyr Asn Leu Pro Ser Glu Leu Pro Gly 465 470 475 480 Ser Arg Tyr Asp Gly Asn Lys Gln Cys Glu Leu Ala Phe Gly Pro Gly                 485 490 495 Ser Gln Met Cys Pro His Ile Asn Ile Cys Met His Leu Trp Cys Thr             500 505 510 Ser Thr Glu Lys Leu His Lys Gly Cys Phe Thr Gln His Val Pro Pro         515 520 525 Ala Asp Gly Thr Asp Cys Gly Pro Gly Met His Cys Arg His Gly Leu     530 535 540 Cys Val Asn Lys Glu Thr Glu Thr Arg Pro Val Asn Gly Glu Trp Gly 545 550 555 560 Pro Trp Glu Pro Tyr Ser Ser Cys Ser Arg Thr Cys Gly Gly Gly Ile                 565 570 575 Glu Ser Ala Thr Arg Arg Cys Asn Arg Pro Glu Pro Arg Asn Gly Gly             580 585 590 Asn Tyr Cys Val Gly Arg Arg Met Lys Phe Arg Ser Cys Asn Thr Asp         595 600 605 Ser Cys Pro Lys Gly Thr Gln Asp Phe Arg Glu Lys Gln Cys Ser Asp     610 615 620 Phe Asn Gly Lys His Leu Asp Ile Ser Gly Ile Pro Ser Asn Val Arg 625 630 635 640 Trp Leu Pro Arg Tyr Ser Gly Ile Gly Thr Lys Asp Arg Cys Lys Leu                 645 650 655 Tyr Cys Gln Val Ala Gly Thr Asn Tyr Phe Tyr Leu Leu Lys Asp Met             660 665 670 Val Glu Asp Gly Thr Pro Cys Gly Thr Glu Thr His Asp Ile Cys Val         675 680 685 Gln Gly Gln Cys Met Ala Ala Gly Cys Asp His Val Leu Asn Ser Ser     690 695 700 Ala Lys Ile Asp Lys Cys Gly Val Cys Gly Gly Asp Asn Ser Ser Cys 705 710 715 720 Lys Thr Ile Thr Gly Val Phe Asn Ser Ser His Tyr Gly Tyr Asn Val                 725 730 735 Val Val Lys Ile Pro Ala Gly Ala Thr Asn Val Asp Ile Arg Gln Tyr             740 745 750 Ser Tyr Ser Gly Gln Pro Asp Asp Ser Tyr Leu Ala Leu Ser Asp Ala         755 760 765 Glu Gly Asn Phe Leu Phe Asn Gly Asn Phe Leu Leu Ser Thr Ser Lys     770 775 780 Lys Glu Ile Asn Val Gln Gly Thr Arg Thr Val Ile Glu Tyr Ser Gly 785 790 795 800 Ser Asn Asn Ala Val Glu Arg Ile Asn Ser Thr Asn Arg Gln Glu Lys                 805 810 815 Glu Leu Ile Leu Gln Val Leu Cys Val Gly Asn Leu Tyr Asn Pro Asp             820 825 830 Val His Tyr Ser Phe Asn Ile Pro Leu Glu Glu Arg Ser Asp Met Phe         835 840 845 Thr Trp Asp Pro Tyr Gly Pro Trp Glu Gly Cys Thr Lys Met Cys Gln     850 855 860 Gly Leu Gln Arg Arg Asn Ile Thr Cys Ile His Lys Ser Asp His Ser 865 870 875 880 Val Val Ser Asp Lys Glu Cys Asp His Leu Pro Leu Pro Ser Phe Val                 885 890 895 Thr Gln Ser Cys Asn Thr Asp Cys Glu Leu Arg Trp His Val Ile Gly             900 905 910 Lys Ser Glu Cys Ser Ser Gln Cys Gly Gln Gly Tyr Arg Thr Leu Asp         915 920 925 Ile His Cys Met Lys Tyr Ser Ile His Glu Gly Gln Thr Val Gln Val     930 935 940 Asp Asp His Tyr Cys Gly Asp Gln Leu Lys Pro Pro Thr Gln Glu Leu 945 950 955 960 Cys His Gly Asn Cys Val Phe Thr Arg Trp His Tyr Ser Glu Trp Ser                 965 970 975 Gln Cys Ser Arg Ser Cys Gly Gly Gly Glu Arg Ser Ser Glu Ser Tyr             980 985 990 Cys Met Asn Asn Phe Gly His Arg Leu Ala Asp Asn Glu Cys Gln Glu         995 1000 1005 Leu Ser Arg Val Thr Arg Glu Asn Cys Asn Glu Phe Ser Cys Pro Ser    1010 1015 1020 Trp Ala Ala Ser Glu Trp Ser Glu Cys Leu Val Thr Cys Gly Lys Gly 1025 1030 1035 1040 Thr Lys Gln Arg Gln Val Trp Cys Gln Leu Asn Val Asp His Leu Ser                1045 1050 1055 Asp Gly Phe Cys Asn Ser Ser Thr Lys Pro Glu Ser Leu Ser Pro Cys            1060 1065 1070 Glu Leu His Thr Cys Ala Ser Trp Gln Val Gly Pro Trp Gly Pro Cys        1075 1080 1085 Thr Thr Cys Gly His Gly Tyr Gln Met Arg Asp Val Lys Cys Val    1090 1095 1100 Asn Glu Leu Ala Ser Ala Val Leu Glu Asp Thr Glu Cys His Glu Ala 1105 1110 1115 1120 Ser Arg Pro Ser Asp Arg Gln Ser Cys Val Leu Thr Pro Cys Ser Phe                1125 1130 1135 Ile Ser Lys Leu Glu Thr Ala Leu Leu Pro Thr Val Leu Ile Lys Lys            1140 1145 1150 Met Ala Gln Trp Arg His Gly Ser Trp Thr Pro Cys Ser Val Ser Cys        1155 1160 1165 Gly Arg Gly Thr Gln Ala Arg Tyr Val Ser Cys Arg Asp Ala Leu Asp    1170 1175 1180 Arg Ile Ala Asp Glu Ser Tyr Cys Ala His Leu Pro Arg Pro Ala Glu 1185 1190 1195 1200 Ile Trp Asp Cys Phe Thr Pro Cys Gly Glu Trp Gln Ala Gly Asp Trp                1205 1210 1215 Ser Pro Cys Ser Ala Ser Cys Gly His Gly Lys Thr Thr Arg Gln Val            1220 1225 1230 Leu Cys Met Asn Tyr His Gln Pro Ile Asp Glu Asn Tyr Cys Asp Pro        1235 1240 1245 Glu Val Arg Pro Leu Met Glu Gln Glu Cys Ser Leu Ala Ala Cys Pro    1250 1255 1260 Pro Ala His Ser His Phe Pro Ser Ser Pro Val Gln Pro Ser Tyr Tyr 1265 1270 1275 1280 Leu Ser Thr Asn Leu Pro Leu Thr Gln Lys Leu Glu Asp Asn Glu Asn                1285 1290 1295 Gln Val Val His Pro Ser Val Arg Gly Asn Gln Trp Arg Thr Gly Pro            1300 1305 1310 Trp Gly Ser Cys Ser Ser Ser Cys Ser Gly Gly Leu Gln His Arg Ala        1315 1320 1325 Val Val Cys Gln Asp Glu Asn Gly Gln Ser Ala Ser Tyr Cys Asp Ala    1330 1335 1340 Ala Ser Lys Pro Pro Glu Leu Gln Gln Cys Gly Pro Gly Pro Cys Pro 1345 1350 1355 1360 Gln Trp Asn Tyr Gly Asn Trp Gly Glu Cys Ser Gln Thr Cys Gly Gly                1365 1370 1375 Gly Ile Lys Ser Arg Leu Val Ile Cys Gln Phe Pro Asn Gly Gln Ile            1380 1385 1390 Leu Glu Asp His Asn Cys Glu Ile Val Asn Lys Pro Pro Ser Val Ile        1395 1400 1405 Gln Cys His Met His Ala Cys Pro Ala Asp Val Ser Trp His Gln Glu    1410 1415 1420 Pro Trp Thr Ser Cys Ser Ala Ser Cys Gly Lys Gly Arg Lys Tyr Arg 1425 1430 1435 1440 Glu Val Phe Cys Ile Asp Gln Phe Gln Arg Lys Leu Glu Asp Thr Asn                1445 1450 1455 Cys Ser Gln Val Gln Lys Pro Pro Thr His Lys Ala Cys Arg Ser Val            1460 1465 1470 Arg Cys Pro Ser Trp Lys Ala Asn Ser Trp Asn Glu Cys Ser Val Thr        1475 1480 1485 Cys Gly Ser Gly Val Gln Gln Arg Asp Val Tyr Cys Arg Leu Lys Gly    1490 1495 1500 Val Gly Gln Val Val Glu Glu Met Cys Asp Gln Ser Thr Arg Pro Cys 1505 1510 1515 1520 Ser Gln Arg Arg Cys Trp Ser Gln Asp Cys Val Gln His Lys Gly Met                1525 1530 1535 Glu Arg Gly Arg Leu Asn Cys Ser Thr Ser Cys Glu Arg Lys Asp Ser            1540 1545 1550 His Gln Arg Met Glu Cys Thr Asp Asn Gln Ile Arg Gln Val Asn Glu        1555 1560 1565 Ile Val Tyr Asn Ser Ser Thr Ile Ser Leu Thr Ser Lys Asn Cys Arg    1570 1575 1580 Asn Pro Pro Cys Asn Tyr Ile Val Val Thr Ala Asp Ser Ser Gln Cys 1585 1590 1595 1600 Ala Asn Asn Cys Gly Phe Ser Tyr Arg Gln Arg Ile Thr Tyr Cys Thr                1605 1610 1615 Glu Ile Pro Ser Thr Lys Lys His Lys Leu His Arg Leu Arg Pro Ile            1620 1625 1630 Val Tyr Gln Glu Cys Pro Val Val Ser Ser Gln Val Tyr Gln Cys        1635 1640 1645 Ile Asn Ser Cys Leu His Leu Ala Thr Trp Lys Val Gly Lys Trp Ser    1650 1655 1660 Lys Cys Ser Val Thr Cys Gly Ile Gly Ile Met Lys Arg Gln Val Lys 1665 1670 1675 1680 Cys Ile Thr Lys His Gly Leu Ser Ser Asp Leu Cys Leu Asn His Leu                1685 1690 1695 Lys Pro Gly Ala Gln Lys Lys Cys Tyr Ala Asn Asp Cys Lys Ser Phe            1700 1705 1710 Thr Cys Lys Glu Ile Gln Val Lys Asn His Ile Arg Lys Asp Gly        1715 1720 1725 Asp Tyr Tyr Leu Asn Ile Lys Gly Arg Ile Ile Lys Ile Tyr Cys Ala    1730 1735 1740 Asp Met Tyr Leu Glu Asn Pro Lys Glu Tyr Leu Thr Leu Val Gln Gly 1745 1750 1755 1760 Glu Glu Asn Phe Ser Glu Val Tyr Gly Phe Arg Leu Lys Asn Pro Tyr                1765 1770 1775 Gln Cys Pro Phe Asn Gly Ser Arg Arg Glu Asp Cys Glu Cys Asp Asn            1780 1785 1790 Gly His Leu Ala Ala Gly Tyr Thr Val Phe Ser Lys Ile Arg Ile Asp        1795 1800 1805 Leu Thr Ser Met Gln Ile Lys Thr Thr Asp Leu Leu Phe Ser Lys Thr    1810 1815 1820 Ile Phe Gly Asn Ala Val Pro Phe Ala Thr Ala Gly Asp Cys Tyr Ser 1825 1830 1835 1840 Ala Phe Arg Cys Pro Gln Gly Gln Phe Ser Ile Asn Leu Ser Gly Thr                1845 1850 1855 Gly Met Lys Ile Ser Ser Thr Ala Lys Trp Leu Thr Gln Gly Ser Tyr            1860 1865 1870 Thr Ser Val Ser Ile Arg Ser Ser Glu Asp Gly Thr Arg Phe Phe Gly        1875 1880 1885 Lys Cys Gly Gly Tyr Cys Gly Lys Cys Leu Pro His Met Thr Thr Gly    1890 1895 1900 Leu Pro Ile Gln Val Ile 1905 1910 <210> 39 <211> 2769 <212> PRT <213> Homo sapiens <400> 39 Met Asp Val Lys Glu Arg Lys Pro Tyr Arg Ser Leu Thr Arg Arg Arg   1 5 10 15 Asp Ala Glu Arg Arg Tyr Thr Ser Ser Ala Asp Ser Glu Glu Gly              20 25 30 Lys Ala Pro Gln Lys Ser Tyr Ser Ser Ser Glu Thr Leu Lys Ala Tyr          35 40 45 Asp Gln Asp Ala Arg Leu Ala Tyr Gly Ser Arg Val Lys Asp Ile Val      50 55 60 Pro Gln Glu Ala Glu Glu Phe Cys Arg Thr Gly Ala Asn Phe Thr Leu  65 70 75 80 Arg Glu Leu Gly Leu Glu Glu Val Thr Pro Pro His Gly Thr Leu Tyr                  85 90 95 Arg Thr Asp Ile Gly Leu Pro His Cys Gly Tyr Ser Met Gly Ala Gly             100 105 110 Ser Asp Ala Asp Met Glu Ala Asp Thr Val Leu Ser Pro Glu His Pro         115 120 125 Val Arg Leu Trp Gly Arg Ser Thr Arg Ser Gly Arg Ser Ser Cys Leu     130 135 140 Ser Ser Arg Ala Asn Ser Asn Leu Thr Leu Thr Asp Thr Glu His Glu 145 150 155 160 Asn Thr Glu Thr Asp His Pro Gly Gly Leu Gln Asn His Ala Arg Leu                 165 170 175 Arg Thr Pro Pro Pro Pro Leu Ser His Ala His Thr Pro Asn Gln His             180 185 190 His Ala Ala Ser Ile Asn Ser Leu Asn Arg Gly Asn Phe Thr Pro Arg         195 200 205 Ser Asn Pro Ser Pro Ala Pro Thr Asp His Ser Leu Ser Gly Glu Pro     210 215 220 Pro Ala Gly Gly Ala Gln Glu Pro Ala His Ala Gln Glu Asn Trp Leu 225 230 235 240 Leu Asn Ser Asn Ile Pro Leu Glu Thr Arg Asn Leu Gly Lys Gln Pro                 245 250 255 Phe Leu Gly Thr Leu Gln Asp Asn Leu Ile Glu Met Asp Ile Leu Gly             260 265 270 Ala Ser Arg His Asp Gly Ala Tyr Ser Asp Gly His Phe Leu Phe Lys         275 280 285 Pro Gly Gly Thr Ser Pro Leu Phe Cys Thr Thr Ser Pro Gly Tyr Pro     290 295 300 Leu Thr Ser Ser Thr Val Tyr Ser Pro Pro Pro Arg Pro Leu Pro Arg 305 310 315 320 Ser Thr Phe Ala Arg Pro Ala Phe Asn Leu Lys Lys Pro Ser Lys Tyr                 325 330 335 Cys Asn Trp Lys Cys Ala Ala Leu Ser Ala Ile Val Ile Ser Ala Thr             340 345 350 Leu Val Ile Leu Leu Ala Tyr Phe Val         355 360 365 Asn Trp His Leu Gln Pro Met Glu Gly Gln Met Tyr Glu Ile Thr Glu     370 375 380 Asp Thr Ala Ser Ser Trp Pro Val Pro Thr Asp Val Ser Leu Tyr Pro 385 390 395 400 Ser Gly Gly Thr Gly Leu Glu Thr Pro Asp Arg Lys Gly Lys Gly Thr                 405 410 415 Thr Glu Gly Lys Pro Ser Ser Phe Phe Pro Glu Asp Ser Phe Ile Asp             420 425 430 Ser Gly Glu Ile Asp Val Gly Arg Arg Ala Ser Gln Lys Ile Pro Pro         435 440 445 Gly Thr Phe Trp Arg Ser Gln Val Phe Ile Asp His Pro Val His Leu     450 455 460 Lys Phe Asn Val Ser Leu Gly Lys Ala Ala Leu Val Gly Ile Tyr Gly 465 470 475 480 Arg Lys Gly Leu Pro Pro Ser His Thr Gln Phe Asp Phe Val Glu Leu                 485 490 495 Leu Asp Gly Arg Arg Leu Leu Thr Gln Glu Ala Arg Ser Leu Glu Gly             500 505 510 Thr Pro Arg Gln Ser Arg Gly Thr Val Pro Ser Ser His Glu Thr         515 520 525 Gly Phe Ile Gln Tyr Leu Asp Ser Gly Ile Trp His Leu Ala Phe Tyr     530 535 540 Asn Asp Gly Lys Glu Ser Glu Val Val Ser Phe Leu Thr Thr Ala Ile 545 550 555 560 Glu Ser Val Asp Asn Cys Pro Ser Asn Cys Tyr Gly Asn Gly Asp Cys                 565 570 575 Ile Ser Gly Thr Cys His Cys Phe Leu Gly Phe Leu Gly Pro Asp Cys             580 585 590 Gly Arg Ala Ser Cys Pro Val Leu Cys Ser Gly Asn Gly Gln Tyr Met         595 600 605 Lys Gly Arg Cys Leu Cys His Ser Gly Trp Lys Gly Ala Glu Cys Asp     610 615 620 Val Pro Thr Asn Gln Cys Ile Asp Val Ala Cys Ser Asn His Gly Thr 625 630 635 640 Cys Ile Thr Gly Thr Cys Ile Cys Asn Pro Gly Tyr Lys Gly Glu Ser                 645 650 655 Cys Glu Glu Val Asp Cys Met Asp Pro Thr Cys Ser Gly Arg Gly Val             660 665 670 Cys Val Arg Gly Glu Cys His Cys Ser Val Gly Trp Gly Gly Thr Asn         675 680 685 Cys Glu Thr Pro Arg Ala Thr Cys Leu Asp Gln Cys Ser Gly His Gly     690 695 700 Thr Phe Leu Pro Asp Thr Gly Leu Cys Ser Cys Asp Pro Ser Trp Thr 705 710 715 720 Gly His Asp Cys Ser Ile Glu Ile Cys Ala Ala Asp Cys Gly Gly His                 725 730 735 Gly Val Cys Val Gly Gly Thr Cys Arg Cys Glu Asp Gly Trp Met Gly             740 745 750 Ala Ala Cys Asp Gln Arg Ala Cys His Pro Arg Cys Ala Glu His Gly         755 760 765 Thr Cys Arg Asp Gly Lys Cys Glu Cys Ser Pro Gly Trp Asn Gly Glu     770 775 780 His Cys Thr Ile Ala His Tyr Leu Asp Arg Val Val Lys Glu Gly Cys 785 790 795 800 Pro Gly Leu Cys Asn Gly Asn Gly Arg Cys Thr Leu Asp Leu Asn Gly                 805 810 815 Trp His Cys Val Cys Gln Leu Gly Trp Arg Gly Ala Gly Cys Asp Thr             820 825 830 Ser Met Glu Thr Ala Cys Gly Asp Ser Lys Asp Asn Asp Gly Asp Gly         835 840 845 Leu Val Asp Cys Met Asp Pro Asp Cys Cys Leu Gln Pro Leu Cys His     850 855 860 Ile Asn Pro Leu Cys Leu Gly Ser Pro Asn Pro Leu Asp Ile Ile Gln 865 870 875 880 Glu Thr Gln Val Ser Ser Gln Gln Asn Leu His Ser Phe Tyr Asp                 885 890 895 Arg Ile Lys Phe Leu Val Gly Arg Asp Ser Thr His Ile Ile Pro Gly             900 905 910 Glu Asn Pro Phe Asp Gly Gly His Ala Cys Val Ile Arg Gly Gln Val         915 920 925 Met Thr Ser Asp Gly Thr Pro Leu Val Gly Val Asn Ile Ser Phe Val     930 935 940 Asn Asn Pro Leu Phe Gly Tyr Thr Ile Ser Arg Gln Asp Gly Ser Phe 945 950 955 960 Asp Leu Val Thr Asn Gly Gly Ile Ser Ile Ile Leu Arg Phe Glu Arg                 965 970 975 Ala Pro Phe Ile Thr Gln Glu His Thr Leu Trp Leu Pro Trp Asp Arg             980 985 990 Phe Phe Val Met Glu Thr Ile Ile Met Arg His Glu Glu Asn Glu Ile         995 1000 1005 Pro Ser Cys Asp Leu Ser Asn Phe Ala Arg Pro Asn Pro Val Val Ser    1010 1015 1020 Pro Ser Pro Leu Thr Ser Phe Ala Ser Ser Cys Ala Glu Lys Gly Pro 1025 1030 1035 1040 Ile Val Pro Glu Ile Gln Ala Leu Gln Glu Glu Ile Ser Ile Ser Gly                1045 1050 1055 Cys Lys Met Arg Leu Ser Tyr Leu Ser Ser Arg Thr Pro Gly Tyr Lys            1060 1065 1070 Ser Val Leu Arg Ile Ser Leu Thr His Pro Thr Ile Pro Phe Asn Leu        1075 1080 1085 Met Lys Val His Leu Met Val Ala Val Glu Gly Arg Leu Phe Arg Lys    1090 1095 1100 Trp Phe Ala Ala Ala Pro Asp Leu Ser Tyr Tyr Phe Ile Trp Asp Lys 1105 1110 1115 1120 Thr Asp Val Tyr Asn Gln Lys Val Phe Gly Leu Ser Glu Ala Phe Val                1125 1130 1135 Ser Val Gly Tyr Glu Tyr Glu Ser Cys Pro Asp Leu Ile Leu Trp Glu            1140 1145 1150 Lys Arg Thr Thr Val Leu Gln Gly Tyr Glu Ile Asp Ala Ser Lys Leu        1155 1160 1165 Gly Gly Trp Ser Leu Asp Lys His His Ala Leu Asn Ile Gln Ser Gly    1170 1175 1180 Ile Leu His Lys Gly Asn Gly Glu Asn Gln Phe Val Ser Gln Gln Pro 1185 1190 1195 1200 Pro Val Ile Gly Ser Ile Met Gly Asn Gly Arg Arg Arg Ser Ser Ser                1205 1210 1215 Cys Pro Ser Cys Asn Gly Leu Ala Asp Gly Asn Lys Leu Leu Ala Pro            1220 1225 1230 Val Ala Leu Thr Cys Gly Ser Asp Gly Ser Leu Tyr Val Gly Asp Phe        1235 1240 1245 Asn Tyr Ile Arg Arg Ile Phe Pro Ser Gly Asn Val Thr Asn Ile Leu    1250 1255 1260 Glu Leu Arg Asn Lys Asp Phe Arg His Ser Ser Ser Ala His Lys 1265 1270 1275 1280 Tyr Tyr Leu Ala Thr Asp Pro Met Ser Gly Ala Val Phe Leu Ser Asp                1285 1290 1295 Ser Asn Ser Arg Arg Val Phe Lys Ile Lys Ser Thr Val Val Val Lys            1300 1305 1310 Asp Leu Val Lys Asn Ser Glu Val Val Ala Gly Thr Gly Asp Gln Cys        1315 1320 1325 Leu Pro Phe Asp Asp Thr Arg Cys Gly Asp Gly Gly Lys Ala Thr Glu    1330 1335 1340 Ala Thr Leu Thr Asn Pro Arg Gly Ile Thr Val Asp Lys Phe Gly Leu 1345 1350 1355 1360 Ile Tyr Phe Val Asp Gly Thr Met Ile Arg Arg Ile Asp Gln Asn Gly                1365 1370 1375 Ile Ile Ser Thr Leu Leu Gly Ser Asn Asp Leu Thr Ser Ala Arg Pro            1380 1385 1390 Leu Ser Cys Asp Ser Val Met Asp Ile Ser Gln Val His Leu Glu Trp        1395 1400 1405 Pro Thr Asp Leu Ala Ile Asn Pro Met Asp Asn Ser Leu Tyr Val Leu    1410 1415 1420 Asp Asn Val Val Leu Gln Ile Ser Glu Asn His Gln Val Arg Ile 1425 1430 1435 1440 Val Ala Gly Arg Pro Met His Cys Gln Val Pro Gly Ile Asp His Phe                1445 1450 1455 Leu Leu Ser Lys Val Ala Ile His Ala Thr Leu Glu Ser Ala Thr Ala            1460 1465 1470 Leu Ala Val Ser As Asn Gly Val Leu Tyr Ile Ala Glu Thr Asp Glu        1475 1480 1485 Lys Lys Ile Asn Arg Ile Arg Gln Val Thr Thr Ser Gly Glu Ile Ser    1490 1495 1500 Leu Val Ala Gly Ala Pro Ser Gly Cys Asp Cys Lys Asn Asp Ala Asn 1505 1510 1515 1520 Cys Asp Cys Phe Ser Gly Asp Asp Gly Tyr Ala Lys Asp Ala Lys Leu                1525 1530 1535 Asn Thr Pro Ser Ser Leu Ala Val Cys Ala Asp Gly Glu Leu Tyr Val            1540 1545 1550 Ala Asp Leu Gly Asn Ile Arg Ile Arg Phe Ile Arg Lys Asn Lys Pro        1555 1560 1565 Phe Leu Asn Thr Gln Asn Met Tyr Glu Leu Ser Ser Pro Ile Asp Gln    1570 1575 1580 Glu Leu Tyr Leu Phe Asp Thr Thr Gly Lys His Leu Tyr Thr Gln Ser 1585 1590 1595 1600 Leu Pro Thr Gly Asp Tyr Leu Tyr Asn Phe Thr Tyr Thr Gly Asp Gly                1605 1610 1615 Asp Ile Thr Leu Ile Thr Asp Asn Asn Gly Asn Met Val Asn Val Arg            1620 1625 1630 Arg Asp Ser Thr Gly Met Pro Leu Trp Leu Val Val Pro Asp Gly Gln        1635 1640 1645 Val Tyr Trp Val Thr Met Gly Thr Asn Ser Ala Leu Lys Ser Val Thr    1650 1655 1660 Thr Gln Gly His Glu Leu Ala Met Met Thr Tyr His Gly Asn Ser Gly 1665 1670 1675 1680 Leu Leu Ala Thr Lys Ser Asn Glu Asn Gly Trp Thr Thr Phe Tyr Glu                1685 1690 1695 Tyr Asp Ser Phe Gly Arg Leu Thr Asn Val Thr Phe Pro Thr Gly Gln            1700 1705 1710 Val Ser Ser Phe Arg Ser Asp Thr Asp Ser Val Val His Val Gln Val        1715 1720 1725 Glu Thr Ser Ser Lys Asp Asp Val Thr Ile Thr Thr Asn Leu Ser Ala    1730 1735 1740 Ser Gly Ala Phe Tyr Thr Leu Leu Gln Asp Gln Val Arg Asn Ser Tyr 1745 1750 1755 1760 Tyr Ile Gly Ala Asp Gly Ser Leu Arg Leu Leu Leu Ala Asn Gly Met                1765 1770 1775 Glu Val Ala Leu Gln Thr Glu Pro His Leu Leu Ala Gly Thr Val Asn            1780 1785 1790 Pro Thr Val Gly Lys Arg Asn Val Thr Leu Pro Ile Asp Asn Gly Leu        1795 1800 1805 Asn Leu Val Glu Trp Arg Gln Arg Lys Glu Gln Ala Arg Gly Gln Val    1810 1815 1820 Thr Val Phe Gly Arg Arg Leu Arg Val His Asn Arg Asn Leu Leu Ser 1825 1830 1835 1840 Leu Asp Phe Asp Arg Val Thr Arg Thr Glu Lys Ile Tyr Asp Asp His                1845 1850 1855 Arg Lys Phe Thr Leu Arg Ile Leu Tyr Asp Gln Ala Gly Arg Pro Ser            1860 1865 1870 Leu Trp Ser Ser Ser Ser Leu Asn Gly Val Asn Val Thr Tyr Ser        1875 1880 1885 Pro Gly Gly Tyr Ile Ala Gly Ile Gln Arg Gly Ile Met Ser Glu Arg    1890 1895 1900 Met Glu Tyr Asp Gln Ala Gly Arg Ile Thr Ser Arg Ile Phe Ala Asp 1905 1910 1915 1920 Gly Lys Thr Trp Ser Tyr Thr Tyr Leu Glu Lys Ser Met Val Leu Leu                1925 1930 1935 Leu His Ser Gln Arg Gln Tyr Ile Phe Glu Phe Asp Lys Asn Asp Arg            1940 1945 1950 Leu Ser Ser Val Thr Met Pro Asn Val Ala Arg Gln Thr Leu Glu Thr        1955 1960 1965 Ile Arg Ser Val Gly Tyr Tyr Arg Asn Ile Tyr Gln Pro Pro Glu Gly    1970 1975 1980 Asn Ala Ser Val Ile Gln Asp Phe Thr Glu Asp Gly His Leu Leu His 1985 1990 1995 2000 Thr Phe Tyr Leu Gly Thr Gly Arg Arg Val Ile Tyr Lys Tyr Gly Lys                2005 2010 2015 Leu Ser Lys Leu Ala Glu Thr Leu Tyr Asp Thr Thr Lys Val Ser Phe            2020 2025 2030 Thr Tyr Asp Glu Thr Ala Gly Met Leu Lys Thr Ile Asn Leu Gln Asn        2035 2040 2045 Glu Gly Phe Thr Cys Thr Ile Arg Tyr Arg Gln Ile Gly Pro Leu Ile    2050 2055 2060 Asp Arg Gln Ile Phe Arg Phe Thr Glu Glu Gly Met Val Asn Ala Arg 2065 2070 2075 2080 Phe Asp Tyr Asn Tyr Asp Asn Ser Phe Arg Val Thr Ser Met Gln Ala                2085 2090 2095 Val Ile Asn Glu Thr Pro Leu Pro Ile Asp Leu Tyr Arg Tyr Asp Asp            2100 2105 2110 Val Ser Gly Lys Thr Glu Gln Phe Gly Lys Phe Gly Val Ile Tyr Tyr        2115 2120 2125 Asp Ile Asn Gln Ile Ile Thr Thr Ala Val Met Thr His Thr Lys His    2130 2135 2140 Phe Asp Ala Tyr Gly Arg Met Lys Glu Val Gln Tyr Glu Ile Phe Arg 2145 2150 2155 2160 Ser Leu Met Tyr Trp Met Thr Val Gln Tyr Asp Asn Met Gly Arg Val                2165 2170 2175 Val Lys Lys Glu Leu Lys Val Gly Pro Tyr Ala Asn Thr Thr Arg Tyr            2180 2185 2190 Ser Tyr Glu Tyr Asp Ala Asp Gly Gln Leu Gln Thr Val Ser Ile Asn        2195 2200 2205 Asp Lys Pro Leu Trp Arg Tyr Ser Tyr Asp Leu Asn Gly Asn Leu His    2210 2215 2220 Leu Leu Ser Pro Gly Asn Ser Ala Arg Leu Thr Pro Leu Arg Tyr Asp 2225 2230 2235 2240 Ile Arg Asp Arg Ile Thr Arg Leu Gly Asp Val Gln Tyr Lys Met Asp                2245 2250 2255 Glu Asp Gly Phe Leu Arg Gln Arg Gly Gly Asp Ile Phe Glu Tyr Asn            2260 2265 2270 Ser Ala Gly Leu Leu Ile Lys Ala Tyr Asn Arg Ala Gly Ser Trp Ser        2275 2280 2285 Val Arg Tyr Arg Tyr Asp Gly Leu Gly Arg Arg Val Ser Ser Ser Ser Ser    2290 2295 2300 Ser His His His Leu Gln Phe Phe Tyr Ala Asp Leu Thr Asn Pro 2305 2310 2315 2320 Thr Lys Val Thr His Leu Tyr Asn His Ser Ser Ser Glu Ile Thr Ser                2325 2330 2335 Leu Tyr Tyr Asp Leu Gln Gly His Leu Phe Ala Met Glu Leu Ser Ser            2340 2345 2350 Gly Asp Glu Phe Tyr Ile Ala Cys Asp Asn Ile Gly Thr Pro Leu Ala        2355 2360 2365 Val Phe Ser Gly Thr Gly Leu Met Ile Lys Gln Ile Leu Tyr Thr Ala    2370 2375 2380 Tyr Gly Glu Ile Tyr Met Asp Thr Asn Pro Asn Phe Gln Ile Ile Ile 2385 2390 2395 2400 Gly Tyr His Gly Gly Leu Tyr Asp Pro Leu Thr Lys Leu Val His Met                2405 2410 2415 Gly Arg Arg Asp Tyr Asp Val Leu Ala Gly Arg Trp Thr Ser Pro Asp            2420 2425 2430 His Glu Leu Trp Lys His Leu Ser Ser Ser Asn Val Met Pro Phe Asn        2435 2440 2445 Leu Tyr Met Phe Lys Asn Asn Asn Pro Ile Ser Asn Ser Gln Asp Ile    2450 2455 2460 Lys Cys Phe Met Thr Asp Val Asn Ser Trp Leu Leu Thr Phe Gly Phe 2465 2470 2475 2480 Gln Leu His Asn Val Ile Pro Gly Tyr Pro Lys Pro Asp Met Asp Ala                2485 2490 2495 Met Glu Pro Ser Tyr Glu Leu Ile His Thr Gln Met Lys Thr Gln Glu            2500 2505 2510 Trp Asp Ser Ser Ser Le Le Gly Val Gln Cys Glu Val Gln Lys        2515 2520 2525 Gln Leu Lys Ala Phe Val Thr Leu Glu Arg Phe Asp Gln Leu Tyr Gly    2530 2535 2540 Ser Thr Ile Thr Ser Cys Gln Gln Ala Pro Lys Thr Lys Lys Phe Ala 2545 2550 2555 2560 Ser Ser Gly Ser Val Phe Gly Lys Gly Val Lys Phe Ala Leu Lys Asp                2565 2570 2575 Gly Arg Val Thr Thr Asp Ile Ile Ser Val Ala Asn Glu Asp Gly Arg            2580 2585 2590 Arg Val Ala Ile Leu Asn His Ala His Tyr Leu Glu Asn Leu His        2595 2600 2605 Phe Thr Ile Asp Gly Val Asp Thr His Tyr Phe Val Lys Pro Gly Pro    2610 2615 2620 Ser Glu Gly Asp Leu Ala Ile Leu Gly Leu Ser Gly Gly Arg Arg Thr 2625 2630 2635 2640 Leu Glu Asn Gly Val Asn Val Thr Val Ser Gln Ile Asn Thr Val Leu                2645 2650 2655 Asn Gly Arg Thr Arg Arg Tyr Thr Asp Ile Gln Leu Gln Tyr Gly Ala            2660 2665 2670 Leu Cys Leu Asn Thr Arg Tyr Gly Thr Thr Leu Asp Glu Glu Lys Ala        2675 2680 2685 Arg Val Leu Glu Leu Ala Arg Gln Arg Ala Val Arg Gln Ala Trp Ala    2690 2695 2700 Arg Glu Gln Gln Arg Leu Arg Glu Gly Glu Glu Gly Leu Arg Ala Trp 2705 2710 2715 2720 Thr Glu Gly Glu Lys Gln Gln Val Leu Ser Thr Gly Arg Val Gln Gly                2725 2730 2735 Tyr Asp Gly Phe Phe Val Ile Ser Val Glu Gln Tyr Pro Glu Leu Ser            2740 2745 2750 Asp Ser Ala Asn Asn Ile His Phe Met Arg Gln Ser Glu Met Gly Arg        2755 2760 2765 Arg     <210> 40 <211> 4684 <212> PRT <213> Homo sapiens <400> 40 Met Val Ala Gly Met Leu Met Pro Arg Asp Gln Leu Arg Ala Ile Tyr   1 5 10 15 Glu Val Leu Phe Arg Glu Gly Val Met Val Ala Lys Lys Asp Arg Arg              20 25 30 Pro Arg Ser Leu His Pro His Val Pro Gly Val Thr Asn Leu Gln Val          35 40 45 Met Arg Ala Met Ala Ser Leu Arg Ala Arg Gly Leu Val Arg Glu Thr      50 55 60 Phe Ala Trp Cys His Phe Tyr Trp Tyr Leu Thr Asn Glu Gly Ile Ala  65 70 75 80 His Leu Arg Gln Tyr Leu His Leu Pro Pro Glu Ile Val Pro Ala Ser                  85 90 95 Leu Gln Arg Val Arg Arg Pro Val Ala Met Val Met Pro Ala Arg Arg             100 105 110 Thr Pro His Val Gln Ala Val Gln Gly Pro Leu Gly Ser Pro Pro Lys         115 120 125 Arg Gly Pro Leu Pro Thr Glu Glu Gln Arg Val Tyr Arg Arg Lys Glu     130 135 140 Leu Glu Glu Val Ser Pro Glu Thr Pro Val Val Pro Ala Thr Thr Gln 145 150 155 160 Arg Thr Leu Ala Arg Pro Gly Pro Glu Pro Ala Pro Ala Thr Asp Glu                 165 170 175 Arg Asp Arg Val Gln Lys Lys Thr Phe Thr Lys Trp Val Asn Lys His             180 185 190 Leu Ile Lys Ala Gln Arg His Ile Ser Asp Leu Tyr Glu Asp Leu Arg         195 200 205 Asp Gly His Asn Leu Ile Ser Leu Leu Glu Val Leu Ser Gly Asp Ser     210 215 220 Leu Pro Arg Glu Lys Gly Arg Met Arg Phe His Lys Leu Gln Asn Val 225 230 235 240 Gln Ile Ala Leu Asp Tyr Leu Arg His His Gln Val Lys Leu Val Asn                 245 250 255 Ile Arg Asn Asp Asp Ile Ala Asp Gly Asn Pro Lys Leu Thr Leu Gly             260 265 270 Leu Ile Trp Thr Ile Ile Leu His Phe Gln Ile Ser Asp Ile Gln Val         275 280 285 Ser Gly Gln Ser Glu Asp Met Thr Ala Lys Glu Lys Leu Leu Leu Trp     290 295 300 Ser Gln Arg Met Val Glu Gly Tyr Gln Gly Leu Arg Cys Asp Asn Phe 305 310 315 320 Thr Ser Ser Trp Arg Asp Gly Arg Leu Phe Asn Ale Ile His Arg                 325 330 335 His Lys Pro Leu Leu Ile Asp Met Asn Lys Val Tyr Arg Gln Thr Asn             340 345 350 Leu Glu Asn Leu Asp Glu Ala Phe Ser Val Ala Glu Arg Asp Leu Gly         355 360 365 Val Thr Arg Leu Leu Asp Pro Glu Asp Val Asp Val Pro Gln Pro Asp     370 375 380 Glu Lys Ser Ile Ile Thr Tyr Val Ser Ser Leu Tyr Asp Ala Met Pro 385 390 395 400 Arg Val Pro Asp Val Gln Asp Gly Val Arg Ala Asn Glu Leu Gln Leu                 405 410 415 Arg Trp Gln Glu Tyr Arg Glu Leu Val Leu Leu Leu Leu Gln Trp Met             420 425 430 Arg His His Thr Ala Ala Phe Glu Glu Arg Arg Phe Pro Ser Ser Phe         435 440 445 Glu Ile Glu Ile Leu Trp Ser Gln Phe Leu Lys Phe Lys Glu Met     450 455 460 Glu Leu Pro Ala Lys Glu Ala Asp Lys Asn Arg Ser Lys Gly Ile Tyr 465 470 475 480 Gln Ser Leu Glu Gly Ala Val Gln Ala Gly Gln Leu Lys Val Pro Pro                 485 490 495 Gly Tyr His Pro Leu Asp Val Glu Lys Glu Trp Gly Lys Leu His Val             500 505 510 Ala Ile Leu Glu Arg Glu Lys Gln Leu Arg Ser Glu Phe Glu Arg Leu         515 520 525 Glu Cys Leu Gln Arg Ile Val Thr Lys Leu Gln Met Glu Ala Gly Leu     530 535 540 Cys Glu Glu Gln Leu Asn Gln Ala Asp Ala Leu Leu Gln Ser Asp Val 545 550 555 560 Arg Leu Leu Ala Ala Gly Lys Val Pro Gln Arg Ala Gly Glu Val Glu                 565 570 575 Arg Asp Leu Asp Lys Ala Asp Ser Met Ile Arg Leu Leu Phe Asn Asp             580 585 590 Val Gln Thr Leu Lys Asp Gly Arg His Pro Gln Gly Glu Gln Met Tyr         595 600 605 Arg Arg Val Tyr Arg Leu His Glu Arg Leu Val Ala Ile Arg Thr Glu     610 615 620 Tyr Asn Leu Arg Leu Lys Ala Gly Val Ala Ala Pro Ala Thr Gln Val 625 630 635 640 Ala Gln Val Thr Leu Gln Ser Val Gln Arg Arg Pro Glu Leu Glu Asp                 645 650 655 Ser Thr Leu Arg Tyr Leu Gln Asp Leu Leu Ala Trp Val Glu Glu Asn             660 665 670 Gln His Arg Val Asp Gly Ala Glu Trp Gly Val Asp Leu Pro Ser Val         675 680 685 Glu Ala Gln Leu Gly Ser His Arg Gly Leu His Gln Ser Ile Glu Glu     690 695 700 Phe Arg Ala Lys Ile Glu Arg Ala Arg Ser Asp Glu Gly Gln Leu Ser 705 710 715 720 Pro Ala Thr Arg Gly Ala Tyr Arg Asp Cys Leu Gly Arg Leu Asp Leu                 725 730 735 Gln Tyr Ala Lys Leu Leu Asn Ser Ser Lys Ala Arg Leu Arg Ser Leu             740 745 750 Glu Ser Leu His Ser Phe Val Ala Ala Ala Thr Lys Glu Leu Met Trp         755 760 765 Leu Asn Glu Lys Glu Glu Glu Glu Val Gly Phe Asp Trp Ser Asp Arg     770 775 780 Asn Thr Asn Met Thr Ala Lys Lys Glu Ser Tyr Ser Ala Leu Met Arg 785 790 795 800 Glu Leu Glu Leu Lys Glu Lys Lys Ile Lys Glu Leu Gln Asn Ala Gly                 805 810 815 Asp Arg Leu Leu Arg Glu Asp His Pro Ala Arg Pro Thr Val Glu Ser             820 825 830 Phe Gln Ala Leu Gln Thr Gln Trp Ser Trp Met Leu Gln Leu Cys         835 840 845 Cys Cys Ile Glu Ala His Leu Lys Glu Asn Ala Ala Tyr Phe Gln Phe     850 855 860 Phe Ser Asp Val Arg Glu Ala Glu Gly Gln Leu Gln Lys Leu Gln Glu 865 870 875 880 Ala Leu Arg Arg Lys Tyr Ser Cys Asp Arg Ser Ala Thr Val Thr Arg                 885 890 895 Leu Glu Asp Leu Leu Gln Asp Ala Gln Asp Glu Lys Glu Gln Leu Asn             900 905 910 Glu Tyr Lys Gly His Leu Ser Gly Leu Ala Lys Arg Ala Lys Ala Val         915 920 925 Val Gln Leu Lys Pro Arg His Pro Ala His Pro Met Arg Gly Arg Leu     930 935 940 Pro Leu Leu Ala Val Cys Asp Tyr Lys Gln Val Glu Val Thr Val His 945 950 955 960 Lys Gly Asp Glu Cys Gln Leu Val Gly Pro Ala Gln Pro Ser His Trp                 965 970 975 Lys Val Leu Ser Ser Ser Gly Ser Glu Ala Ala Val Ser Ser Val Cys             980 985 990 Phe Leu Val Pro Pro Pro Asn Gln Glu Ala Gln Glu Ala Val Thr Arg         995 1000 1005 Leu Glu Ala Gln His Gln Ala Leu Val Thr Leu Trp His Gln Leu His    1010 1015 1020 Val Asp Met Lys Ser Leu Leu Ala Trp Gln Ser Leu Arg Arg Asp Val 1025 1030 1035 1040 Gln Leu Ile Arg Ser Trp Ser Leu Ala Thr Phe Arg Thr Leu Lys Pro                1045 1050 1055 Glu Glu Gln Arg Gln Ala Leu His Ser Leu Glu Leu His Tyr Gln Ala            1060 1065 1070 Phe Leu Arg Asp Ser Gln Asp Ala Gly Gly Phe Gly Pro Glu Asp Arg        1075 1080 1085 Leu Met Ala Glu Arg Glu Tyr Gly Ser Cys Ser His His Tyr Gln Gln    1090 1095 1100 Leu Leu Gln Ser Leu Glu Gln Gly Ala Gln Glu Glu Ser Arg Cys Gln 1105 1110 1115 1120 Arg Cys Ile Ser Glu Leu Lys Asp Ile Arg Leu Gln Leu Glu Ala Cys                1125 1130 1135 Glu Thr Arg Thr Val His Arg Leu Arg Leu Pro Leu Asp Lys Glu Pro            1140 1145 1150 Ala Arg Glu Cys Ala Gln Arg Ile Ala Glu Gln Gln Lys Ala Gln Ala        1155 1160 1165 Glu Val Glu Gly Leu Gly Lys Gly Val Ala Arg Leu Ser Ala Glu Ala    1170 1175 1180 Glu Lys Val Leu Ala Leu Pro Glu Pro Ser Pro Ala Ala Pro Thr Leu 1185 1190 1195 1200 Arg Ser Glu Leu Glu Leu Thr Leu Gly Lys Leu Glu Gln Val Arg Ser                1205 1210 1215 Leu Ser Ala Ile Tyr Leu Glu Lys Leu Lys Thr Ile Ser Leu Val Ile            1220 1225 1230 Arg Gly Thr Gln Gly Ala Glu Glu Val Leu Arg Ala His Glu Glu Gln        1235 1240 1245 Leu Lys Glu Ala Gln Ala Val Pro Ala Thr Leu Pro Glu Leu Glu Ala    1250 1255 1260 Thr Lys Ala Ser Leu Lys Lys Leu Arg Ala Gln Ala Glu Ala Gln Gln 1265 1270 1275 1280 Pro Thr Phe Asp Ala Leu Arg Asp Glu Leu Arg Gly Ala Gln Glu Val                1285 1290 1295 Gly Glu Arg Leu Gln Gln Arg His Gly Glu Arg Asp Val Glu Val Glu            1300 1305 1310 Arg Trp Arg Glu Arg Val Ala Gln Leu Leu Glu Arg Trp Gln Ala Val        1315 1320 1325 Leu Ala Gln Thr Asp Val Arg Gln Arg Glu Leu Glu Gln Leu Gly Arg    1330 1335 1340 Gln Leu Arg Tyr Tyr Arg Glu Ser Ala Asp Pro Leu Gly Ala Trp Leu 1345 1350 1355 1360 Gln Asp Ala Arg Arg Arg Gln Glu Gln Ile Gln Ala Met Pro Leu Ala                1365 1370 1375 Asp Ser Gln Ala Val Arg Glu Gln Leu Arg Gln Glu Gln Ala Leu Leu            1380 1385 1390 Glu Ile Glu Arg His Gly Glu Lys Val Glu Glu Cys Gln Arg Phe        1395 1400 1405 Ala Lys Gln Tyr Ile Asn Ala Ile Lys Asp Tyr Glu Leu Gln Leu Val    1410 1415 1420 Thr Tyr Lys Ala Gln Leu Glu Pro Val Ala Ser Pro Ala Lys Lys Pro 1425 1430 1435 1440 Lys Val Gln Ser Gly Ser Glu Ser Val Ile Gln Glu Tyr Val Asp Leu                1445 1450 1455 Arg Thr His Tyr Ser Glu Leu Thr Thr Leu Thr Ser Gln Tyr Ile Lys            1460 1465 1470 Phe Ile Ser Glu Thr Leu Arg Arg Met Glu Glu Glu Glu Arg Leu Ala        1475 1480 1485 Glu Gln Gln Arg Ala Glu Glu Arg Glu Arg Leu Ala Glu Val Glu Ala    1490 1495 1500 Ala Leu Glu Lys Gln Arg Gln Leu Ala Glu Ala His Ala Gln Ala Lys 1505 1510 1515 1520 Ala Gln Ala Glu Arg Glu Ala Lys Glu Leu Gln Gln Arg Met Gln Glu                1525 1530 1535 Glu Val Val Arg Arg Glu Glu Ala Ala Val Asp Ala Gln Gln Gln Lys            1540 1545 1550 Arg Ser Ile Gln Glu Glu Leu Gln Gln Leu Arg Gln Ser Ser Glu Ala        1555 1560 1565 Glu Ile Gln Ala Lys Ala Arg Gl Ala Glu Ala Ala Glu Arg Ser Arg    1570 1575 1580 Leu Arg Ile Glu Glu Glu Ile Arg Val Val Arg Leu Gln Leu Glu Ala 1585 1590 1595 1600 Thr Glu Arg Gln Arg Gly Gly Ala Glu Gly Glu Leu Gln Ala Leu Arg                1605 1610 1615 Ala Arg Ala Glu Glu Ala Glu Ala Gln Lys Arg Gln Ala Gln Glu Glu            1620 1625 1630 Ala Glu Arg Leu Arg Arg Gln Val Gln Asp Glu Ser Gln Arg Lys Arg        1635 1640 1645 Gln Ala Glu Ala Gla Ala Gla Ala Gla    1650 1655 1660 Ala Arg Glu Lys Gln Arg Ala Leu Gln Ala Leu Glu Glu Leu Arg Leu 1665 1670 1675 1680 Gln Ala Glu Glu Ala Glu Arg Arg Leu Arg Gln Ala Glu Val Glu Arg                1685 1690 1695 Ala Arg Gln Val Gln Val Ala Leu Glu Thr Ala Gln Arg Ser Ala Glu            1700 1705 1710 Ala Glu Leu Gln Ser Lys Arg Ala Ser Phe Ala Glu Lys Thr Ala Gln        1715 1720 1725 Leu Glu Arg Ser Leu Gln Glu Glu His Val Ala Val Ala Gln Leu Arg    1730 1735 1740 Glu Glu Ala Glu Arg Arg Ala Gln Gln Gln Ala Glu Ala Glu Arg Ala 1745 1750 1755 1760 Arg Glu Glu Ala Glu Arg Glu Leu Glu Arg Trp Gln Leu Lys Ala Asn                1765 1770 1775 Glu Ala Leu Arg Leu Arg Leu Gln Ala Glu Glu Val Ala Gln Gln Lys            1780 1785 1790 Ser Leu Ala Gln Ala Glu Ala Glu Lys Gln Lys Glu Glu Ala Glu Arg        1795 1800 1805 Glu Ala Arg Arg Gly Lys Ala Glu Glu Gln Ala Val Arg Gln Arg    1810 1815 1820 Glu Leu Ala Glu Glu Glu Leu Glu Lys Gln Arg Gln Leu Ala Glu Gly 1825 1830 1835 1840 Thr Ala Gln Gln Arg Leu Ala Ala Glu Gln Glu Leu Ile Arg Leu Arg                1845 1850 1855 Ala Glu Thr Glu Gln Gly Glu Gln Gln Arg Gln Leu Leu Glu Glu Glu            1860 1865 1870 Leu Ala Arg Leu Gln Arg Glu Ala Ala Ala Ala Thr Gln Lys Arg Gln        1875 1880 1885 Glu Leu Glu Ala Glu Leu Ala Lys Val Arg Ala Glu Met Glu Val Leu    1890 1895 1900 Leu Ala Ser Lys Ala Arg Ala Glu Glu Glu Ser Ser Ser Thr Ser Glu 1905 1910 1915 1920 Lys Ser Lys Gln Arg Leu Glu Ala Glu Ala Gly Arg Phe Arg Glu Leu                1925 1930 1935 Ala Glu Ala Gla Ala Gla Ala Lys Arg            1940 1945 1950 Gln Arg Gln Leu Ala Glu Glu Asp Ala Ala Arg Gln Arg Ala Glu Ala        1955 1960 1965 Glu Arg Val Leu Ala Glu Lys Leu Ala Ala Ile Gly Glu Ala Thr Arg    1970 1975 1980 Leu Lys Thr Glu Ala Glu Ile Ala Leu Lys Glu Lys Glu Ala Glu Asn 1985 1990 1995 2000 Glu Arg Leu Arg Arg Leu Ala Glu Asp Glu Ala Phe Gln Arg Arg Arg                2005 2010 2015 Leu Glu Glu Gln Ala Ala Gln His Lys Ala Asp Ile Glu Glu Arg Leu            2020 2025 2030 Ala Gln Leu Arg Lys Ala Ser Asp Ser Glu Leu Glu Arg Gln Lys Gly        2035 2040 2045 Leu Val Glu Asp Thr Leu Arg Gln Arg Arg Gln Val Glu Glu Glu Ile    2050 2055 2060 Leu Ala Leu Lys Ala Ser Phe Glu Lys Ala Ala Ala Gly Lys Ala Glu 2065 2070 2075 2080 Leu Glu Leu Glu Leu Gly Arg Ile Arg Ser Asn Ala Glu Asp Thr Leu                2085 2090 2095 Arg Ser Lys Glu Gln Ala Glu Leu Glu Ala Ala Arg Gln Arg Gln Leu            2100 2105 2110 Ala Ala Glu Glu Glu Arg Arg Arg Arg Glu Ala Glu Glu Arg Val Gln        2115 2120 2125 Lys Ser Leu Ala Ala Glu Glu Glu Ala Ala Arg Gln Arg Lys Ala Ala    2130 2135 2140 Leu Glu Glu Val Glu Arg Leu Lys Ala Lys Val Glu Glu Ala Arg Arg 2145 2150 2155 2160 Leu Arg Glu Arg Ala Glu Gln Glu Ser Ala Arg Gln Leu Gln Leu Ala                2165 2170 2175 Gln Glu Ala Ala Gln Lys Arg Leu Gln Ala Glu Glu Lys Ala His Ala            2180 2185 2190 Phe Ala Val Gln Gln Lys Glu Gln Glu Leu Gln Gln Thr Leu Gln Gln        2195 2200 2205 Glu Gln Ser Val Leu Asp Gln Leu Arg Gly Glu Ala Glu Ala Ala Arg    2210 2215 2220 Arg Ala Ala Glu Ala Glu Ala Glu Ala Gla Ala Glu 2225 2230 2235 2240 Ala Ala Gln Ser Arg Arg Gln Val Glu Glu Ala Glu Arg Leu Lys Gln                2245 2250 2255 Ser Ala Glu Glu Gln Ala Gln Ala Arg Ala Gln Ala Gln Ala Ala Ala            2260 2265 2270 Glu Lys Leu Arg Lys Glu Ala Glu Gln Glu Ala Ala Arg Arg Ala Gln        2275 2280 2285 Ala Glu Gln Ala Ala Leu Arg Gln Lys Gln Ala Ala Asp Ala Glu Met    2290 2295 2300 Glu Lys His Lys Lys Phe Ala Glu Gln Thr Leu Arg Gln Lys Ala Gln 2305 2310 2315 2320 Val Glu Gln Glu Leu Thr Thr Leu Arg Leu Gln Leu Glu Glu Thr Asp                2325 2330 2335 His Gln Lys Asn Leu Leu Asp Glu Glu Leu Gln Arg Leu Lys Ala Glu            2340 2345 2350 Ala Thr Glu Ala Ala Arg Gln Arg Ser Gln Val Glu Glu Glu Leu Phe        2355 2360 2365 Ser Val Arg Val Gln Met Glu Glu Leu Ser Lys Leu Lys Ala Arg Ile    2370 2375 2380 Glu Ala Glu Asn Arg Ala Leu Ile Leu Arg Asp Lys Asp Asn Thr Gln 2385 2390 2395 2400 Arg Phe Leu Gln Glu Glu Ala Glu Lys Met Lys Gln Val Ala Glu Glu                2405 2410 2415 Ala Ala Arg Leu Ser Val Ala Ala Gln Glu Ala Ala Arg Leu Arg Gln            2420 2425 2430 Leu Ala Glu Glu Asp Leu Ala Gln Gln Arg Ala Leu Ala Glu Lys Met        2435 2440 2445 Leu Lys Glu Lys Met Gln Ala Val Gln Glu Ala Thr Arg Leu Lys Ala    2450 2455 2460 Glu Ala Glu Leu Leu Gln Gln Gln Lys Glu Leu Ala Gln Glu Gln Ala 2465 2470 2475 2480 Arg Arg Leu Gln Glu Asp Lys Glu Gln Met Ala Gln Gln Leu Ala Glu                2485 2490 2495 Glu Thr Gln Gly Phe Gln Arg Thr Leu Glu Ala Glu Arg Gln Arg Gln            2500 2505 2510 Leu Glu Met Ser Ala Glu Ala Glu Arg Leu Lys Leu Arg Val Ala Glu        2515 2520 2525 Met Ser Arg Ala Gln Ala Arg Ala Glu Glu Asp Ala Gln Arg Phe Arg    2530 2535 2540 Lys Gln Ala Glu Glu Ile Gly Glu Lys Leu His Arg Thr Glu Leu Ala 2545 2550 2555 2560 Thr Gln Glu Lys Val Thr Leu Val Gln Thr Leu Glu Ile Gln Arg Gln                2565 2570 2575 Gln Ser Asp His Asp Ala Glu Arg Leu Arg Glu Ala Ile Ala Glu Leu            2580 2585 2590 Glu Arg Glu Lys Glu Lys Leu Gln Gln Glu Ala Lys Leu Leu Gln Leu        2595 2600 2605 Lys Ser Glu Glu Met Gln Thr Val Glu Gln Glu Gln Leu Leu Gln Glu    2610 2615 2620 Thr Gln Ala Leu Gln Gln Ser Phe Leu Ser Glu Lys Asp Ser Leu Leu 2625 2630 2635 2640 Gln Arg Glu Arg Phe Ile Glu Gln Glu Lys Ala Lys Leu Glu Gln Leu                2645 2650 2655 Phe Gln Asp Glu Val Ala Lys Ala Gln Gln Leu Arg Glu Glu Gln Gln            2660 2665 2670 Arg Gln Gln Gln Gln Met Glu Gln Glu Arg Gln Arg Leu Val Ala Ser        2675 2680 2685 Met Glu Glu Ala Arg Arg Arg Gln His Glu Ala Glu Glu Gly Val Arg    2690 2695 2700 Arg Lys Gln Glu Glu Leu Gln Gln Leu Glu Gln Gln Arg Arg Gln Gln 2705 2710 2715 2720 Glu Glu Leu Leu Ala Glu Glu Asn Gln Arg Leu Arg Glu Gln Leu Gln                2725 2730 2735 Leu Leu Glu Glu Gln His Arg Ala Ala Leu Ala His Ser Glu Glu Val            2740 2745 2750 Thr Ala Ser Gln Val Ala Ala Thr Lys Thr Leu Pro Asn Gly Arg Asp        2755 2760 2765 Ala Leu Asp Gly Pro Ala Ala Glu Ala Glu Pro Glu His Ser Phe Asp    2770 2775 2780 Gly Leu Arg Arg Lys Val Ser Ala Gln Arg Leu Gln Glu Ala Gly Ile 2785 2790 2795 2800 Leu Ser Ala Glu Glu Leu Gln Arg Leu Ala Gln Gly His Thr Thr Val                2805 2810 2815 Asp Glu Leu Ala Arg Arg Glu Asp Val Arg His Tyr Leu Gln Gly Arg            2820 2825 2830 Ser Ser Ile Ala Gly Leu Leu Leu Lys Ala Thr Asn Glu Lys Leu Ser        2835 2840 2845 Val Tyr Ala Leu Gln Arg Gln Leu Leu Ser Pro Gly Thr Ala Leu    2850 2855 2860 Ile Leu Leu Glu Ala Gln Ala Ala Ser Gly Phe Leu Leu Asp Pro Val 2865 2870 2875 2880 Arg Asn Arg Arg Leu Thr Val Asn Glu Ala Val Lys Glu Gly Val Val                2885 2890 2895 Gly Pro Glu Leu His His Lys Leu Leu Ser Ala Glu Arg Ala Val Thr            2900 2905 2910 Gly Tyr Lys Asp Pro Tyr Thr Gly Gln Gln Ile Ser Leu Phe Gln Ala        2915 2920 2925 Met Gln Lys Gly Leu Ile Val Arg Glu His Gly Ile Arg Leu Leu Glu    2930 2935 2940 Ala Gln Ile Ala Thr Gly Gly Val Ile Asp Pro Val His Ser His Arg 2945 2950 2955 2960 Val Pro Val Asp Val Ala Tyr Arg Arg Gly Tyr Phe Asp Glu Glu Met                2965 2970 2975 Asn Arg Val Leu Ala Asp Pro Ser Asp Asp Thr Lys Gly Phe Phe Asp            2980 2985 2990 Pro Asn Thr His Glu Asn Leu Thr Tyr Leu Gln Leu Leu Glu Arg Cys        2995 3000 3005 Val Glu Asp Pro Glu Thr Gly Leu Cys Leu Leu Pro Leu Thr Asp Lys    3010 3015 3020 Ala Ala Lys Gly Gly Glu Leu Val Tyr Thr Asp Ser Glu Ala Arg Asp 3025 3030 3035 3040 Val Phe Glu Lys Ala Thr Val Ser Ala Pro Phe Gly Lys Phe Gln Gly                3045 3050 3055 Lys Thr Val Thr Ile Trp Glu Ile Ile Asn Ser Glu Tyr Phe Thr Ala            3060 3065 3070 Glu Gln Arg Arg Asp Leu Leu Arg Gln Phe Arg Thr Gly Arg Ile Thr        3075 3080 3085 Val Glu Lys Ile Ile Lys Ile Ile Ile Thr Val Val Glu Glu Gln Glu    3090 3095 3100 Gln Lys Gly Arg Leu Cys Phe Glu Gly Leu Arg Ser Leu Val Pro Ala 3105 3110 3115 3120 Ala Glu Leu Leu Glu Ser Arg Val Ile Asp Arg Glu Leu Tyr Gln Gln                3125 3130 3135 Leu Gln Arg Gly Glu Arg Ser Val Arg Asp Val Ala Glu Val Asp Thr            3140 3145 3150 Val Arg Arg Ala Leu Arg Gly Ala Asn Val Ile Ala Gly Val Trp Leu        3155 3160 3165 Glu Glu Ala Gly Gln Lys Leu Ser Ile Tyr Asn Ala Leu Lys Lys Asp    3170 3175 3180 Leu Leu Pro Ser Asp Met Ala Val Ala Leu Leu Glu Ala Gln Ala Gly 3185 3190 3195 3200 Thr Gly His Ile Ile Asp Pro Ala Thr Ser Ala Arg Leu Thr Val Asp                3205 3210 3215 Glu Ala Val Arg Ala Gly Leu Val Gly Pro Glu Phe His Glu Lys Leu            3220 3225 3230 Leu Ser Ala Glu Lys Ala Val Thr Gly Tyr Arg Asp Pro Tyr Thr Gly        3235 3240 3245 Gln Ser Val Ser Leu Phe Gln Ala Leu Lys Lys Gly Leu Ile Pro Arg    3250 3255 3260 Glu Gln Gly Leu Arg Leu Leu Asp Ala Gln Leu Ser Thr Gly Gly Ile 3265 3270 3275 3280 Val Asp Pro Ser Lys Ser His Arg Val Pro Leu Asp Val Ala Cys Ala                3285 3290 3295 Arg Gly Cys Leu Asp Glu Glu Thr Ser Arg Ala Leu Ser Ala Pro Arg            3300 3305 3310 Ala Asp Ala Lys Ala Tyr Ser Asp Pro Ser Thr Gly Glu Pro Ala Thr        3315 3320 3325 Tyr Gly Glu Leu Gln Gln Arg Cys Arg Pro Asp Gln Leu Thr Gly Leu    3330 3335 3340 Ser Leu Leu Pro Leu Ser Glu Lys Ala Ala Arg Ala Arg Gln Glu Glu 3345 3350 3355 3360 Leu Tyr Ser Glu Leu Gln Ala Arg Glu Thr Phe Glu Lys Thr Pro Val                3365 3370 3375 Glu Val Pro Gly Gly Phe Lys Gly Arg Thr Val Thr Val Trp Glu            3380 3385 3390 Leu Ile Ser Ser Glu Tyr Phe Thr Ala Glu Gln Arg Gln Glu Leu Leu        3395 3400 3405 Arg Gln Phe Arg Thr Gly Lys Val Thr Val Glu Lys Val Ile Lys Ile    3410 3415 3420 Leu Ile Thr Ile Val Glu Glu Val Glu Thr Leu Arg Gln Glu Arg Leu 3425 3430 3435 3440 Ser Phe Ser Gly Leu Arg Ala Pro Val Ala Ser Glu Leu Leu Ala                3445 3450 3455 Ser Gly Val Leu Ser Arg Ala Gln Phe Glu Gln Leu Lys Asp Gly Lys            3460 3465 3470 Thr Thr Val Lys Asp Leu Ser Glu Leu Gly Ser Val Arg Thr Leu Leu        3475 3480 3485 Gln Gly Ser Gly Cys Leu Ala Gly Ile Tyr Leu Glu Asp Thr Lys Glu    3490 3495 3500 Lys Val Ser Ile Tyr Glu Ala Met Arg Arg Gly Leu Leu Arg Ala Thr 3505 3510 3515 3520 Thr Ala Leu Leu Leu Glu Ala Ala Ala Thr Gly Phe Leu Val                3525 3530 3535 Asp Pro Val Arg Asn Gln Arg Leu Tyr Val His Glu Ala Val Lys Ala            3540 3545 3550 Gly Val Val Gly Pro Glu Leu His Glu Gln Leu Leu Ser Ala Glu Lys        3555 3560 3565 Ala Val Thr Gly Tyr Arg Asp Pro Tyr Ser Gly Ser Thr Ile Ser Leu    3570 3575 3580 Phe Gln Ala Met Gln Lys Gly Leu Val Leu Arg Gln His Gly Ile Arg 3585 3590 3595 3600 Leu Leu Glu Ala Gln Ile Ala Thr Gly Gly Ile Ile Asp Pro Val His                3605 3610 3615 Ser His Val Val Pro Val Asp Val Ala Tyr Gln Arg Gly Tyr Phe Ser            3620 3625 3630 Glu Glu Met Asn Arg Val Leu Ala Asp Pro Ser Asp Asp Thr Lys Gly        3635 3640 3645 Phe Phe Asp Pro Asn Thr His Glu Asn Leu Thr Tyr Arg Gln Leu Leu    3650 3655 3660 Glu Arg Cys Val Glu Asp Pro Glu Thr Gly Leu Arg Leu Leu Pro Leu 3665 3670 3675 3680 Lys Gly Ala Glu Lys Ala Glu Val Val Glu Thr Thr Gln Val Tyr Thr                3685 3690 3695 Glu Glu Thr Arg Arg Ala Phe Glu Glu Thr Gln Ile Asp Ile Pro            3700 3705 3710 Gly Gly Gly Ser His Gly Gly Ser Thr Met Ser Leu Trp Glu Val Met        3715 3720 3725 Gln Ser Asp Leu Ile Pro Glu Glu Gln Arg Ala Gln Leu Met Ala Asp    3730 3735 3740 Phe Gln Ala Gly Arg Val Thr Lys Glu Arg Met Ile Ile Ile Ile Ile 3745 3750 3755 3760 Glu Ile Ile Glu Lys Thr Glu Ile Ile Arg Gln Gln Gly Leu Ala Ser                3765 3770 3775 Tyr Asp Tyr Val Arg Arg Arg Leu Thr Ala Glu Asp Leu Phe Glu Ala            3780 3785 3790 Arg Ile Ile Ser Leu Glu Thr Tyr Asn Leu Leu Arg Glu Gly Thr Arg        3795 3800 3805 Ser Leu Arg Glu Ala Leu Glu Ala Glu Ser Ala Trp Cys Tyr Leu Tyr    3810 3815 3820 Gly Thr Gly Ser Val Ala Gly Val Tyr Leu Pro Gly Ser Arg Gln Thr 3825 3830 3835 3840 Leu Ser Ile Tyr Gln Ala Leu Lys Lys Gly Leu Leu Ser Ala Glu Val                3845 3850 3855 Ala Arg Leu Leu Leu Glu Ala Gln Ala Ala Thr Gly Phe Leu Leu Asp            3860 3865 3870 Pro Val Lys Gly Glu Arg Leu Thr Val Asp Glu Ala Val Arg Lys Gly        3875 3880 3885 Leu Val Gly Pro Glu Leu His Asp Arg Leu Leu Ser Ala Glu Arg Ala    3890 3895 3900 Val Thr Gly Tyr Arg Asp Pro Tyr Thr Glu Gln Thr Ile Ser Leu Phe 3905 3910 3915 3920 Gln Ala Met Lys Lys Glu Leu Ile Pro Thr Glu Glu Ala Leu Arg Leu                3925 3930 3935 Leu Asp Ala Gln Leu Ala Thr Gly Gly Ile Val Asp Pro Arg Leu Gly            3940 3945 3950 Phe His Leu Pro Leu Glu Val Ala Tyr Gln Arg Gly Tyr Leu Asn Lys        3955 3960 3965 Asp Thr His Asp Gln Leu Ser Glu Pro Ser Glu Val Arg Ser Ser Val Val    3970 3975 3980 Asp Pro Ser Thr Asp Glu Arg Leu Ser Tyr Thr Gln Leu Leu Arg Arg 3985 3990 3995 4000 Cys Arg Arg Asp Asp Gly Thr Gly Gln Leu Leu Leu Pro Leu Ser Asp                4005 4010 4015 Ala Arg Lys Leu Thr Phe Arg Gly Leu Arg Lys Gln Ile Thr Met Glu            4020 4025 4030 Glu Leu Val Arg Ser Glu Val Met Asp Glu Ala Thr Ala Leu Gln Leu        4035 4040 4045 Arg Glu Gly Leu Thr Ser Ile Glu Glu Val Thr Lys Asn Leu Gln Lys    4050 4055 4060 Phe Leu Glu Gly Thr Ser Cys Ile Ala Gly Val Phe Val Asp Ala Thr 4065 4070 4075 4080 Lys Glu Arg Leu Ser Val Tyr Gln Ala Met Lys Lys Gly Ile Ile Arg                4085 4090 4095 Pro Gly Thr Ala Phe Glu Leu Leu Glu Ala Gln Ala Ala Thr Gly Tyr            4100 4105 4110 Val Ile Asp Pro Ile Lys Gly Leu Lys Leu Thr Val Glu Glu Ala Val        4115 4120 4125 Arg Met Gly Ile Val Gly Pro Glu Phe Lys Asp Lys Leu Leu Ser Ala    4130 4135 4140 Glu Arg Ala Val Thr Gly Tyr Lys Asp Pro Tyr Ser Gly Lys Leu Ile 4145 4150 4155 4160 Ser Leu Phe Gln Ala Met Lys Lys Gly Leu Ile Leu Lys Asp His Gly                4165 4170 4175 Ile Arg Leu Leu Glu Ala Gln Ile Ala Thr Gly Gly Ile Ile Asp Pro            4180 4185 4190 Glu Glu Ser His Arg Leu Pro Val Glu Val Ala Tyr Lys Arg Gly Leu        4195 4200 4205 Phe Asp Glu Glu Met Asn Glu Ile Leu Thr Asp Pro Ser Asp Asp Thr    4210 4215 4220 Lys Gly Phe Phe Asp Pro Asn Thr Glu Glu Asn Leu Thr Tyr Leu Gln 4225 4230 4235 4240 Leu Met Glu Arg Cys Ile Thr Asp Pro Gln Thr Gly Leu Cys Leu Leu                4245 4250 4255 Pro Leu Lys Glu Lys Lys Arg Glu Arg Lys Thr Ser Ser Lys Ser Ser            4260 4265 4270 Val Arg Lys Arg Arg Val Val Ile Val Asp Pro Glu Thr Gly Lys Glu        4275 4280 4285 Met Ser Val Tyr Glu Ala Tyr Arg Lys Gly Leu Ile Asp His Gln Thr    4290 4295 4300 Tyr Leu Glu Leu Ser Glu Gln Glu Cys Glu Trp Glu Glu Ile Thr Ile 4305 4310 4315 4320 Ser Ser Ser Asp Gly Val Val Lys Ser Met Ile Ile Asp Arg Arg Ser                4325 4330 4335 Gly Arg Gln Tyr Asp Ile Asp Asp Ala Ile Ala Lys Asn Leu Ile Asp            4340 4345 4350 Arg Ser Ala Leu Asp Gln Tyr Arg Ala Gly Thr Leu Ser Ile Thr Glu        4355 4360 4365 Phe Ala Asp Met Leu Ser Gly Asn Ala Gly Gly Phe Arg Ser Ser Ser    4370 4375 4380 Ser Ser Val Gly Ser Ser Ser Ser Tyr Pro Ile Ser Pro Ala Val Ser 4385 4390 4395 4400 Arg Thr Gln Leu Ala Ser Trp Ser Asp Pro Thr Glu Glu Thr Gly Pro                4405 4410 4415 Val Ala Gly Ile Leu Asp Thr Glu Thr Leu Glu Lys Val Ser Ile Thr            4420 4425 4430 Glu Ala Met His Arg Asn Leu Val Asp Asn Ile Thr Gly Gln Arg Leu        4435 4440 4445 Leu Glu Ala Gln Ala Cys Thr Gly Gly Ile Ile Asp Pro Ser Thr Gly    4450 4455 4460 Glu Arg Phe Pro Val Thr Asp Ala Val Asn Lys Gly Leu Val Asp Lys 4465 4470 4475 4480 Ile Met Val Asp Arg Ile Asn Leu Ala Gln Lys Ala Phe Cys Gly Phe                4485 4490 4495 Glu Asp Pro Arg Thr Lys Thr Lys Met Ser Ala Ala Gln Ala Leu Lys            4500 4505 4510 Lys Gly Trp Leu Tyr Tyr Glu Ala Gly Gln Arg Phe Leu Glu Val Gln        4515 4520 4525 Tyr Leu Thr Gly Gly Leu Ile Glu Pro Asp Thr Pro Gly Arg Val Pro    4530 4535 4540 Leu Asp Glu Ala Leu Gln Arg Gly Thr Val Asp Ala Arg Thr Ala Gln 4545 4550 4555 4560 Lys Leu Arg Asp Val Gly Ala Tyr Ser Lys Tyr Leu Thr Cys Pro Lys                4565 4570 4575 Thr Lys Leu Lys Ile Ser Tyr Lys Asp Ala Leu Asp Arg Ser Ser Met Val            4580 4585 4590 Glu Glu Glu Thr Gly Leu Arg Leu Leu Glu Ala Ala Ala Gln Ser Thr        4595 4600 4605 Lys Gly Tyr Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser    4610 4615 4620 Gly Ser Arg Thr Gly Ser Arg Thr Gly Ser Arg Ala Gly Ser Arg Arg 4625 4630 4635 4640 Gly Ser Phe Asp Ala Thr Gly Ser Gly Phe Ser Met Thr Phe Ser Ser                4645 4650 4655 Ser Ser Tyr Ser Ser Ser Gly Tyr Gly Arg Arg Tyr Ala Ser Gly Ser            4660 4665 4670 Ser Ala Ser Leu Gly Gly Pro Glu Ser Ala Val Ala        4675 4680 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 41 cccgcttact gatctcctgt 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 42 gtctctggct gtcagggttt 20 <210> 43 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 43 ggacaaggaa agcatgagat gct 23 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 44 tgacctcatc ttctctccag gtt 23 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 45 gctggaggtt gggaagagaa aag 23 <210> 46 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 46 tggaaatgtt tgcatcggaa aacag 25 <210> 47 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 47 tcataggttg ggtctgagaa ttcct 25 <210> 48 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 48 caagacccaa cctgctgaag aa 22 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 49 ggtaccctga gccctctagt 20 <210> 50 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 50 ctgagaagat ctggtctaat cggg 24 <210> 51 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 51 gcaaacacct tggccttgt 19 <210> 52 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ARAP3 <400> 52 ccactgacct gcttctccat c 21 <210> 53 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 53 gaaggttgat tgtgaaatac ttactcctga 30 <210> 54 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 54 catgtggctt ttctttttcg tttcttttt 29 <210> 55 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 55 atctggacac accagttaag cag 23 <210> 56 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 56 tctgatcatg gcaagtatgg atcatc 26 <210> 57 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 57 gccagcaaga atgcttaccc tt 22 <210> 58 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 58 agggtcctga caactgtaca aag 23 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 59 ttgcacaaaa atttaatact gacccatgaa 30 <210> 60 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 60 ctaactctga gtcttgtttc tacagct 27 <210> 61 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 61 gggcaatagt atctataccc aaagtactt 29 <210> 62 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ERBB4 <400> 62 tgcaaagtac acatatggag cattct 26 <210> 63 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> F8 <400> 63 agatataatc agcccaggtt cttgga 26 <210> 64 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F8 <400> 64 ttccacccgt ttcatttcag agt 23 <210> 65 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F8 <400> 65 gtgactgaat ttgtggcact tgt 23 <210> 66 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F8 <400> 66 cttctcatct tccagcagca tct 23 <210> 67 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> F8 <400> 67 cttcttggca actgagcgaa tt 22 <210> 68 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> F8 <400> 68 aagcttatgt caaagtagac agctgt 26 <210> 69 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> RNF40 <400> 69 gtatcatgtt ggaaagcact aaggga 26 <210> 70 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RNF40 <400> 70 ggagaggagt cccatcacat gt 22 <210> 71 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RNF40 <400> 71 agcatctgct ccctcattgt tc 22 <210> 72 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RNF40 <400> 72 cctctgccag gtgcttattg ag 22 <210> 73 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RNF40 <400> 73 cgtatggcag agctggagaa ac 22 <210> 74 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RNF40 <400> 74 tgggatcagc aacaggattc ag 22 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> CEP 295; SLC4A2 <400> 75 ccctccctcc agttctgtag 20 <210> 76 <211> 24 <212> DNA <213> Artificial Sequence <220> CEP 295; SLC4A2 <400> 76 agatcaagaa ggcgaagatc tcct 24 <210> 77 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 77 ccatgtgtcc cattggcttc t 21 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 78 gggttcgtga gcaaaggagg 20 <210> 79 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 79 cgctttagct ccgcctctc 19 <210> 80 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 80 actagcgacc caactccgc 19 <210> 81 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 81 gggacctcca ctccaaactc t 21 <210> 82 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 82 ctcaccagga taaaggcaga agga 24 <210> 83 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 83 atggtccgcc agacagaga 19 <210> 84 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 84 gtgcttcaag ggagccaaga gt 22 <210> 85 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 85 gcacttgagt ctagctgtca gt 22 <210> 86 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SCAF1 <400> 86 ccgccatacc tttatcattg gg 22 <210> 87 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GXYLT1 <400> 87 aaaaggaaag gcaaatctta catttctca 29 <210> 88 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> GXYLT1 <400> 88 caagaagcag aagaaggagg aatctt 26 <210> 89 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> GXYLT1 <400> 89 ctggaattat atgtaactct tcagagactc atg 33 <210> 90 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> GXYLT1 <400> 90 aaaaactctt taaaccatgt gcttcg 26 <210> 91 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> GXYLT1 <400> 91 caaaaatatg gaattgaaga ggtttgatgc 30 <210> 92 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GXYLT1 <400> 92 aactgttgaa aaatgtggtt ttctttcct 29 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> CEP 295; SLC4A2 <400> 93 ccctccctcc agttctgtag 20 <210> 94 <211> 24 <212> DNA <213> Artificial Sequence <220> CEP 295; SLC4A2 <400> 94 agatcaagaa ggcgaagatc tcct 24 <210> 95 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCDHA6 <400> 95 tcacgctact gctgtacaca g 21 <210> 96 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCDHA6 <400> 96 gccatgagat ccatcttggg tg 22 <210> 97 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ZNF844 <400> 97 cacagaagtc ttctgggaga gaga 24 <210> 98 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ZNF844 <400> 98 gcctattaag ggaagaatga ccca 24 <210> 99 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ZNF844 <400> 99 cttatacatg aacgagttca cactgga 27 <210> 100 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ZNF844 <400> 100 gactaccgaa tgctttccca ca 22 <210> 101 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ZNF844 <400> 101 caagagaaac cctatgaatg taagcagt 28 <210> 102 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ZNF844 <400> 102 gctttccagt gtgagtcctt tca 23 <210> 103 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 103 gccctcctct tccttcaatt cag 23 <210> 104 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 104 tttgttgtgt agttggtttt cgttgag 27 <210> 105 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 105 tttttctttt tctcagtttc gtagcaaa 28 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 106 ggatctgccc gttttcggag 20 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 107 cggctggaat cccactgatg 20 <210> 108 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 108 ttgtgtttcg ttttgtttgt ggaatct 27 <210> 109 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 109 gctagtccaa agagcgacga a 21 <210> 110 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 110 aaaaagtaat gcacagtatt tctagcaga 29 <210> 111 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 111 ggcccaagcc tcctcttaaa aa 22 <210> 112 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> MAFA <400> 112 tctctatgca ccagaacata tctgtaact 29 <210> 113 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 113 gcgcattttc tggaactcag c 21 <210> 114 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 114 ctggaggagg aaatcgaggc ag 22 <210> 115 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 115 tctccttctc tgtctctgca cttt 24 <210> 116 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 116 attctgcttc ttattataat ctgatttgga ca 32 <210> 117 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 117 tggtctatca cacacacact gg 22 <210> 118 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 118 catggttcca caggagaatt tgaataag 28 <210> 119 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 119 gtcaaacaag agaggccaga tca 23 <210> 120 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 120 ggtggaccct aaggagtcct tt 22 <210> 121 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 121 gggcttcaat tcgctccctt t 21 <210> 122 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MYH1 <400> 122 cagccagggt ccttaactgg 20 <210> 123 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NDUFAF3 <400> 123 gcggcttcat gataaacgga aa 22 <210> 124 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NDUFAF3 <400> 124 cagaggaaag ccaagtttgc ag 22 <210> 125 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> NKAIN3 <400> 125 gcttggattc aatgctaatg aactttct 28 <210> 126 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> NKAIN3 <400> 126 attatgtatc gaggtctgta ctgaatgg 28 <210> 127 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> NKAIN3 <400> 127 agtatggaaa cttggcatag attcttaagg 30 <210> 128 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> NKAIN3 <400> 128 gttttggaag ctgtatctca ttcaaaagg 29 <210> 129 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> NKAIN3 <400> 129 attctcagat tcatgtgatc tgcaagt 27 <210> 130 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NKAIN3 <400> 130 cacatgaggc ttgactgatg tga 23 <210> 131 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SERPINI2 <400> 131 acttcaaaag ggtcagcacc at 22 <210> 132 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SERPINI2 <400> 132 tgtatgtttc ccaagtgacg caa 23 <210> 133 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SERPINI2 <400> 133 cctttgcatc ttgaaaatcc acca 24 <210> 134 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SERPINI2 <400> 134 tgtactgaag tcatttttct ctgccat 27 <210> 135 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ZBTB41 <400> 135 ctcttacatc acatttccaa ctttcactc 29 <210> 136 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ZBTB41 <400> 136 gtacttgatc ctggtaatta ctgtcaacat 30 <210> 137 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ZBTB41 <400> 137 cggtcaaatg ttttatcaca tttaggaca 29 <210> 138 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ZBTB41 <400> 138 agtactctga cattgaagaa caaagtgaaa 30 <210> 139 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ZBTB41 <400> 139 acaaaaagat ggttgcttct gccta 25 <210> 140 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ZBTB41 <400> 140 ccaagtgacc tatactcatt ctgca 25 <210> 141 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 141 gagtggacaa tgaggagtgt ga 22 <210> 142 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 142 ctcctcattt tctcccagtc ctt 23 <210> 143 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 143 ggtgcctgta ctggtgtgtt 20 <210> 144 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 144 cccaagctca tttagcacgg 20 <210> 145 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 145 ggtgtgttga ggaagtgtgg t 21 <210> 146 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 146 ctccaccgac cacgatcaag 20 <210> 147 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 147 cactggtggt cggtgtcatt 20 <210> 148 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 148 tactcacacg gtcatcatcc ct 22 <210> 149 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 149 tcttgaagga tgttgccgtc at 22 <210> 150 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 150 acttctacta ccacgattac tcccaa 26 <210> 151 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 151 ggttctggtg cgtgtactag tg 22 <210> 152 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 152 tcattcagca caaacaaaac acctac 26 <210> 153 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 153 cgttgttggt ggaggaatgg t 21 <210> 154 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 154 atcacaccct gagaccacac t 21 <210> 155 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 155 gataggtagt ggtggcatgg aa 22 <210> 156 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 156 acaagaacga ctactgaata cacaacg 27 <210> 157 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 157 ctctctccct tgtttgtggg at 22 <210> 158 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 158 caccctaggc tgctacaact g 21 <210> 159 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 159 acctggcacc ttcgatgttg 20 <210> 160 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MUC6 <400> 160 gccatctact gcggcttcta 20 <210> 161 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 161 tgcagaaact cctgttccct tac 23 <210> 162 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 162 actcaagaat ttatccagca cagtca 26 <210> 163 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 163 gctggtgact gtgctggata aa 22 <210> 164 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 164 agagaggaat ggttcaggaa gacat 25 <210> 165 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 165 gcccatgtct tcctgaacca tt 22 <210> 166 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 166 ggatgcaatt cggagggag tt 22 <210> 167 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 167 agacagattt ggaaatataa aggtgtgtga 30 <210> 168 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 168 cgcaccgatg tatttcttta ataaggaaaa 30 <210> 169 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 169 aatgattcta ctcatcctgg taattgcttt 30 <210> 170 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 170 gtaaagtggt tcagaaattt tcagtggatt 30 <210> 171 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 171 ggatttaatc cactgaaaat ttctgaacca 30 <210> 172 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SLC27A6 <400> 172 ccctctcact cttcctaaga aagc 24 <210> 173 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BTNL3 <400> 173 ggaagtgcgg ttcttcagga at 22 <210> 174 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BTNL3 <400> 174 gatgtccgag ggagtgatgt tt 22 <210> 175 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BTNL3 <400> 175 gtccacaagg acaggatttg tctt 24 <210> 176 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BTNL3 <400> 176 aaggtggatg gaacacaata tgct 24 <210> 177 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BTNL3 <400> 177 actaagggtc tgtgggactg tt 22 <210> 178 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BTNL3 <400> 178 ccatgcttct ctctctcact tacc 24 <210> 179 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> BTNL3 <400> 179 ggaccatctc cttcttcaat acaaatga 28 <210> 180 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BTNL3 <400> 180 taagcagggt cttctctgtc tca 23 <210> 181 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 181 agcagactct aggaccaaat ggt 23 <210> 182 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 182 gggtcctgga ctccacctta aa 22 <210> 183 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 183 gcagcttgcc agtgaaatat atttca 26 <210> 184 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 184 agcaatggta caacagctcc at 22 <210> 185 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 185 ctccttggtt ttcaaggagg agaa 24 <210> 186 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 186 tcgttttcat gttttcctgt ttctttacag 30 <210> 187 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 187 atgacagaaa agaagaaaac aaagtccct 29 <210> 188 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 188 cgatcccagc ctttatgtgg tg 22 <210> 189 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 189 gcatattgac tgtgggactc gaa 23 <210> 190 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> CADPS <400> 190 tcactgacct ctcagaaaat atctcctc 28 <210> 191 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> CCDC173 <400> 191 gggagtagaa aactagcatg aattctgt 28 <210> 192 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CCDC173 <400> 192 atgaaagcag atcagatttt ctggga 26 <210> 193 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CCDC173 <400> 193 cacagtggaa aggtcctaac tctg 24 <210> 194 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CCDC173 <400> 194 gattattgct agagatattg cagaagctga 30 <210> 195 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PPIL4 <400> 195 tctccacatc taagtctgga cattagag 28 <210> 196 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PPIL4 <400> 196 tatattagat gagcaggccg aagact 26 <210> 197 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PPIL4 <400> 197 ttgtgacttt tcataacaca tcacacag 28 <210> 198 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PPIL4 <400> 198 acaccaagag tgatttcaag gagtatg 27 <210> 199 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> PPIL4 <400> 199 cctgttcttt ttcatactcc ttgaaatcac 30 <210> 200 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> PPIL4 <400> 200 ctttctctgt ctctcgatat atgccattta 30 <210> 201 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> PPIL4 <400> 201 tgaatgtaca tttaatcata agagggcttt act 33 <210> 202 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> PPIL4 <400> 202 tggatttatt ttgtaaggat aaatcatacg gt 32 <210> 203 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SHMT2 <400> 203 gagtactccc gctttcagct 20 <210> 204 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SHMT2 <400> 204 gccaggataa ccctccgagt a 21 <210> 205 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SHMT2 <400> 205 ggatatcagc cacgtccatc tt 22 <210> 206 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SHMT2 <400> 206 cactctcctc cttaacccta agga 24 <210> 207 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SHMT2 <400> 207 cccatttctt acccacctta ggt 23 <210> 208 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SHMT2 <400> 208 gtctccagga caggtgttct tg 22 <210> 209 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC47A2 <400> 209 cctcctctgg agtcctgaag aa 22 <210> 210 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLC47A2 <400> 210 gtggttaacc taggtttccc gat 23 <210> 211 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SLC47A2 <400> 211 ggaatgtgat aaatctgagg acacact 27 <210> 212 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SLC47A2 <400> 212 gcaccttttg tctcttccag ttg 23 <210> 213 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC47A2 <400> 213 ctcttccacg tacccatgag g 21 <210> 214 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC47A2 <400> 214 gcctctgttt ccaggttggt c 21 <210> 215 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TMEM169 <400> 215 atggaagagc caacagcagt ag 22 <210> 216 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TMEM169 <400> 216 gtctgagcgg tagatgatga tgg 23 <210> 217 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TMEM169 <400> 217 ctgcctgtgg ttttcatcct ttc 23 <210> 218 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TMEM169 <400> 218 caagggcaat acgagatctt gtg 23 <210> 219 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TMEM169 <400> 219 gaaaggacct tctggcacaa ga 22 <210> 220 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TMEM169 <400> 220 ccacagaagc ctttctccat gt 22 <210> 221 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TMEM169 <400> 221 gtctggagga ctgttctccc ta 22 <210> 222 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TMEM169 <400> 222 gccagaggag ggagtaagtt gt 22 <210> 223 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TMEM184C <400> 223 tcactgtggg tgatattgca aca 23 <210> 224 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> TMEM184C <400> 224 caaagaatcc tattggaaaa ggaaaacaga 30 <210> 225 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TMEM184C <400> 225 atttctgttt tccttttcca ataggattct ttg 33 <210> 226 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TMEM184C <400> 226 acttattaat ctgactcctt gtcaataaca tac 33 <210> 227 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TMEM184C <400> 227 actaacagaa aactttatat taaaggacgg aca 33 <210> 228 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TMEM184C <400> 228 ggaaattgca tcttgtgatg atgatgataa taa 33 <210> 229 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> TMEM184C <400> 229 aaaaattgtt tcccgaggat caagatc 27 <210> 230 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TMEM184C <400> 230 tcagatatct tagctgtggt aggtgtag 28 <210> 231 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> WDR62 <400> 231 gtcgtgtacg tggagaatga ca 22 <210> 232 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> WDR62 <400> 232 ccacttgcct cagatttcca ct 22 <210> 233 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> WDR62 <400> 233 cttcatggac gagctggtca a 21 <210> 234 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> WDR62 <400> 234 gtcccaccag acaccaacta c 21 <210> 235 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> WDR62 <400> 235 atgcgcaggt cccacagaag at 22 <210> 236 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> WDR62 <400> 236 gggactcagt cagtgtctca aa 22 <210> 237 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> WDR62 <400> 237 cttcaaccca cgcctgagta 20 <210> 238 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> WDR62 <400> 238 ggaaggtatg ggtgaacctg t 21 <210> 239 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 239 atccaaagtt tcaggagatg atgttattga 30 <210> 240 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 240 tgaaatgtct tcggatgatt ctttatcagt 30 <210> 241 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 241 gacatttcag agactaatga caagcttttt 30 <210> 242 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 242 gatcccaagt cagtatttcg ttagtaaagt 30 <210> 243 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 243 gatacgaatg tctccttaga agatgtga 28 <210> 244 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> RTN3 <400> 244 gtttaacatt tttcccatgt aatgactcca 30 <210> 245 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SCN2A <400> 245 cctgacagct tccgcttctt ta 22 <210> 246 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SCN2A <400> 246 taaatggaag agattttcct gcttccaa 28 <210> 247 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SCN2A <400> 247 ggaacgcaag gatgaggatg at 22 <210> 248 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SCN2A <400> 248 ggcaacttga ctaagaactc actttcttat 30 <210> 249 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SCN2A <400> 249 catctgaaat tctacttcta gggcacaa 28 <210> 250 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SCN2A <400> 250 gacttttaac ataccttcca tggtgttg 28 <210> 251 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SCN2A <400> 251 gcaaaatctt ggccaactct aaatatgc 28 <210> 252 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SCN2A <400> 252 cacaatcatt ggaaatcttg cagaca 26 <210> 253 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> SLC25A13 <400> 253 atgttgaaga atagtttctg cattaggaga 30 <210> 254 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC25A13 <400> 254 cgtcaagatc cgtttgcaag tg 22 <210> 255 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC25A13 <400> 255 ctcgaggacc agtggtgatt tc 22 <210> 256 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SLC25A13 <400> 256 ttcatctctt cctgacccac ctta 24 <210> 257 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SLC25A13 <400> 257 cttagtccac acctgttgac ca 22 <210> 258 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SLC25A13 <400> 258 ttttcttcaa ggtgaacgat tttgtgag 28 <210> 259 <211> 20 <212> DNA <213> Artificial Sequence <220> CEP 295; SLC4A2 <400> 259 ccctccctcc agttctgtag 20 <210> 260 <211> 24 <212> DNA <213> Artificial Sequence <220> CEP 295; SLC4A2 <400> 260 agatcaagaa ggcgaagatc tcct 24 <210> 261 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DDX20 <400> 261 ttggctccta caagagaaat tgct 24 <210> 262 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DDX20 <400> 262 gcattgttat cttaccagga gatcca 26 <210> 263 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DDX20 <400> 263 tcgtgggatt gatgctgaga ag 22 <210> 264 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DDX20 <400> 264 attcaaagcc cacctgtcac atta 24 <210> 265 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> DDX20 <400> 265 gaaatcattc agaaaacagt ggtctagagt 30 <210> 266 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DDX20 <400> 266 cacagcagct ttaacttcca catc 24 <210> 267 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DDX20 <400> 267 caagaacctc ttcccagagc aa 22 <210> 268 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> DDX20 <400> 268 ccaggtgatt cttgatattt ctctggattg 30 <210> 269 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ARHGAP26 <400> 269 cgactgctgc ctcgatagtc 20 <210> 270 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ARHGAP26 <400> 270 ctcgggacac tcactcttga g 21 <210> 271 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ARHGAP26 <400> 271 gaggcctcag gaagaaacag tag 23 <210> 272 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ARHGAP26 <400> 272 gcaaatctga gccaactctg aag 23 <210> 273 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ARHGAP26 <400> 273 tgtagcaata gactgtccct atgca 25 <210> 274 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ARHGAP26 <400> 274 gggtcactgg agttcatgtt gg 22 <210> 275 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ARHGAP26 <400> 275 cctcctgtgc tcccattgtg 20 <210> 276 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ARHGAP26 <400> 276 cgtggatgag gtgggcata 19 <210> 277 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GABRE <400> 277 ttaaggcaaa caagccagta gagca 25 <210> 278 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GABRE <400> 278 cgtggatgag gtgggcata 19 <210> 279 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GABRE <400> 279 gggttgtgat tatttcagtt ttgttgc 27 <210> 280 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GABRE <400> 280 cctctttctc acattccttt ccagttt 27 <210> 281 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> IPO7 <400> 281 tttttctttg taggcacaca agtctc 26 <210> 282 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> IPO7 <400> 282 acacttctgc tattcgatta tgaacctttt 30 <210> 283 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> IPO7 <400> 283 tctaggtact gcaaaagact atggga 26 <210> 284 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> IPO7 <400> 284 acaaacacac taaagaatac cttcagaagt 30 <210> 285 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> IPO7 <400> 285 tttttgtagt gcattccctt attcgtg 27 <210> 286 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> IPO7 <400> 286 gggaagcgaa gattttctaa ggtattga 28 <210> 287 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PDE4C <400> 287 tgtcacacat gggactgatg tc 22 <210> 288 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PDE4C <400> 288 ccaagcctcg atctctgtag gt 22 <210> 289 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PDE4C <400> 289 tggcctcacc atgtcaatga c 21 <210> 290 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PDE4C <400> 290 ctggcgctta tgtacaacga c 21 <210> 291 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PDE4C <400> 291 acccacttcc cactcctact ta 22 <210> 292 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PDE4C <400> 292 tcaggctgtg ttcacagact tg 22 <210> 293 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PDE4C <400> 293 ggcagtgact caacaaagct ca 22 <210> 294 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PDE4C <400> 294 tcatcacggt cttcaccttc tct 23 <210> 295 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRKCQ <400> 295 gctctggaaa ggtcgaactt gt 22 <210> 296 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> PRKCQ <400> 296 tgagaccctg tcttggacaa aataaataaa 30 <210> 297 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRKCQ <400> 297 gcgccattga aggtatcatg ct 22 <210> 298 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRKCQ <400> 298 tgttgagtgc acgatggtag ag 22 <210> 299 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> PRKCQ <400> 299 agtttaatct gcagagatgg tctttcttt 29 <210> 300 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> PRKCQ <400> 300 cctccattac tccatgttca tttttaacc 29 <210> 301 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PRKCQ <400> 301 cttcccttgt tgatatgggc atca 24 <210> 302 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> PRKCQ <400> 302 gtgctactgt tgagttgaac tgaattattt 30 <210> 303 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PRSS38 <400> 303 caggaagaaa ctggcttttc aatcc 25 <210> 304 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PRSS38 <400> 304 tgaggtttac gaggcctacg ta 22 <210> 305 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PRSS38 <400> 305 gccagtgttt cctatttctc aaaatgg 27 <210> 306 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PRSS38 <400> 306 gagaatccta gagtgggtat cctga 25 <210> 307 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 307 aaatattcct tagggttctc caagtacatg 30 <210> 308 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 308 gatggtgact attaccttaa cattaaggga 30 <210> 309 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 309 ccaagtggcc aaatgcaaac ag 22 <210> 310 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 310 tgcaaacaac tgtggattta gttacaga 28 <210> 311 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 311 agactatttc attcacttgt ctgatttggt 30 <210> 312 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 312 cgacatgtaa attttcaaag acactgcata 30 <210> 313 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 313 ggcaagcatg catatgacac tg 22 <210> 314 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 314 tcttgttttt agtgttcaca aacatgtgg 29 <210> 315 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 315 tctcataaga atacttacgg gtgaccaa 28 <210> 316 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 316 gatgctcttg atagaatagc agatgaatca 30 <210> 317 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 317 ggaggagtaa atataacaca acttttgtgc 30 <210> 318 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 318 ggcttctgta attcaagtac caaacct 27 <210> 319 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 319 tttttgatgt gtgtcctaaa actctttctt 30 <210> 320 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ADAMTS20 <400> 320 tttttgcgat atttttcgtc acatcca 27 <210> 321 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> (ODZ4) TENM4 <400> 321 ggccacaaaa gagtagctgt ct 22 <210> 322 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> (ODZ4) TENM4 <400> 322 ctacgacggc tttttcgtga tc 22 <210> 323 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> (ODZ4) TENM4 <400> 323 ggccgtcagc atcatactca ta 22 <210> 324 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> (ODZ4) TENM4 <400> 324 gaaggaagtg cagtatgaga tcttcc 26 <210> 325 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> (ODZ4) TENM4 <400> 325 gcatttaccg atagaacagt cgtgt 25 <210> 326 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> (ODZ4) TENM4 <400> 326 gtctgcgtga gaggcgaat 19 <210> 327 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> (ODZ4) TENM4 <400> 327 ccacatcgat acactggttg gt 22 <210> 328 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> (ODZ4) TENM4 <400> 328 tggacattga ttcatgccag act 23 <210> 329 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PLEC <400> 329 ctccttcagc ggcaagagac a 21 <210> 330 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PLEC <400> 330 atgaggagat gaacgagatc ctga 24 <210> 331 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PLEC <400> 331 cctacctcct ggatgacact ct 22 <210> 332 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PLEC <400> 332 agtgcattgc cacaggacta tg 22 <210> 333 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PLEC <400> 333 gcagaggact caggtaggtg tt 22 <210> 334 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PLEC <400> 334 ggacaaggcg gatagcatga tc 22

Claims (17)

MLC6, SLC27A6, BTNL3, CADPS, CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, MEK6, NKAIN3, SERPINI2, ZBTB41, MUC6, SLC27A6, BTNL3, ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, Which is a mutation of a gene encoding at least one selected from the group consisting of TMEM184C, WDR62, RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ, PRSS38, ADAMTS20, ODZ4, A kit that provides information necessary for predicting the difference in effect of renal cancer treatment according to the age of a kidney cancer patient who can detect an enemy marker or for diagnosing a prognosis of a kidney cancer patient.
The method according to claim 1,
The mutation of the gene encoding ARAP3 may be a mismatch mutation which is C527F or a nonsense mutation which is at least one of S836 * and S836 * or a mutation of Q391Pfs * 35, R763Efs * 11, P744Tfs * 3 and A652Sfs * 3; at least one frame shift insert (FS ins) mutation selected from the group consisting of:
Wherein the mutation of the gene encoding ERBB4 is at least one mismatch mutation selected from the group consisting of C593F, M799L, P1054H, I353N and C293F in the amino acid sequence of SEQ ID NO: 2;
The mutation of the gene encoding F8 may be a mutation of frame shift delete (FS del), N1460Kfs * 2 frame shift mutation in the amino acid sequence of SEQ ID NO: 3, N1460Ifs * 5, or at least one of S372F and L1462H One mismatch mutation, or a nonsense mutation that is Q2055 *;
Wherein the mutation of the gene encoding RNF40 is at least one mismatch mutation selected from the group consisting of T277I, R369L and E113D in the amino acid sequence of SEQ ID NO: 4;
The mutation of the gene encoding SLC4A2 is a missense mutation of R793C or a frame shift insertion mutation of P928Sfs * 28 in the amino acid sequence of SEQ ID NO: 5;
Wherein the mutation of the gene encoding SCAF1 comprises at least one frame shift insertion mutation selected from the group consisting of A219Sfs * 11, P211Tfs * 19 and P211Tfs * 19, or a frame shift deletion of A216Pfs * 94 in the amino acid sequence of SEQ ID NO: Mutation;
The mutation of the gene encoding GXYLT1 is at least one mismatch mutation selected from the group consisting of S107R, D373G and P204L in the amino acid sequence of SEQ ID NO: 7;
Wherein the mutation of the gene encoding CEP295 is a missense mutation of R793C or a frame shift insertion mutation of P928Sfs * 28 in the amino acid sequence of SEQ ID NO: 8;
The mutation of the gene encoding PCDHA6 is at least one mismatch mutation selected from the group consisting of S608L, A731T and Y718H in the amino acid sequence of SEQ ID NO: 9;
Wherein the mutation of the gene encoding ZNF844 is at least one mismatch mutation selected from the group consisting of H514D, N508I, T91R and Q241K in the amino acid sequence of SEQ ID NO: 10;
The mutation of the gene encoding MAFA is an in-frame delete (IF del) mutation in the amino acid sequence of SEQ ID NO: 11, which is H208del;
Wherein the mutation of the gene encoding MYH1 is at least one mismatch mutation selected from the group consisting of P685A, R823H, S1144F and A13V in the amino acid sequence of SEQ ID NO: 12, or a frame shift insertion mutation of K59Efs * 5;
Wherein the mutation of the gene encoding NDUFAF3 is a mismatch mutation of at least one of S62G and Q88K in the amino acid sequence of SEQ ID NO: 13;
Wherein the mutation of the gene encoding NKAIN3 is at least one mismatch mutation selected from the group consisting of A35G, C185F and E174V in the amino acid sequence of SEQ ID NO: 14;
Wherein the mutation of the gene encoding SERPINI2 is a mismatch mutation of at least one of S344G and A110S in the amino acid sequence of SEQ ID NO: 15;
Wherein the mutation of the gene encoding ZBTB41 is at least one mismatch mutation selected from the group consisting of E346G, R61G and A449E or a frame shift insertion mutation of F444Sfs * 3 in the amino acid sequence of SEQ ID NO: 16;
The mutation of the gene encoding MUC6 is an in-frame deletion mutation in the amino acid sequence of SEQ ID NO: 17, which is T1544del, or a frame shift insertion mutation that is at least one of P1570Tfs * 136 and P1570Tfs * 136, or N1937T, T1861A, D1187N, A1471S At least one mismatch mutation selected from the group consisting of A1479T, S2156W, T1911M, F1585L, G1581E, P1569L, V1416I and T1138M, or a frame shift deletion mutant of P1571Hfs * 21;
The mutation of the gene encoding SLC27A6 is at least one mismatch mutation selected from the group consisting of G77R, M564I, G615A, G375W, R140L and L35M in the amino acid sequence of SEQ ID NO: 18;
Wherein the mutation of the gene encoding BTNL3 is at least one mismatch mutation selected from the group consisting of A448V, R82Q and S187R in the amino acid sequence of SEQ ID NO: 19, or an in-frame deletion mutant which is M254del;
Wherein the mutation of the gene encoding CADPS is selected from the group consisting of a mismatch mutation in at least one of D1242H and S1332I in the amino acid sequence of SEQ ID NO: 20, a nonsense mutation in Q1285 *, or a splice mutation in X1185_splice Or a frame shift insertion mutation of T1111Yfs * 6;
The mutation of the gene encoding the CCDC 173 is a nonsense mutation which is E419 * in the amino acid sequence of SEQ ID NO: 21, or a mutation of at least one of K375N and V431F;
The mutation of the gene encoding PPIL4 is at least one mismatch mutation selected from the group consisting of D353E, G328V, T389S and D168N in the amino acid sequence of SEQ ID NO: 22;
Wherein the mutation of the gene encoding SHMT2 is a mismatch mutation or at least one of E401K and F79L in the amino acid sequence of SEQ ID NO: 23, or a frame shift deletion mutation that is Y195 *;
The mutation of the gene coding for SLC47A2 may be a frame shift deletion mutation of F397Lfs * 11, a splice mutation of X530_splice (substitution of T with C at chromosome 19582221), at least one of F291L and F27L in the amino acid sequence of SEQ ID NO: One missense mutation;
The mutation of the gene encoding the TMEM169 is a frame shift mutation in the amino acid sequence of SEQ ID NO: 25, K42Rfs * 43, a nonstop mutation of * 298Yext * 18, and a mutation of at least one of A240T and Y181F;
Wherein the mutation of the gene encoding TMEM184C is at least one mismatch mutation selected from the group consisting of S389F, D96N, R85T and F363C in the amino acid sequence of SEQ ID NO: 26;
Wherein the mutation of the gene encoding WDR62 comprises a nonsense mutation that is E541 * in the amino acid sequence of SEQ ID NO: 27, or a mutation in at least one of G494E and P1054S, or at least one frame shift deletion mutation of S1105Qfs * 22 and S1105 * ego;
The mutation of the gene encoding RTN3 is at least one mismatch mutation selected from the group consisting of E622K, E260D and S312N in the amino acid sequence of SEQ ID NO: 28;
Wherein the mutation of the gene encoding SCN2A is at least one mismatch mutation selected from the group consisting of G899S, D693E and E44G or a frame shift insertion mutation of G59Vfs * 30 in the amino acid sequence of SEQ ID NO: 29;
Wherein the mutation of the gene encoding SLC25A13 is at least one mismatch mutation selected from the group consisting of G482R, S426P and G441S in the amino acid sequence of SEQ ID NO: 30;
The mutation of the gene encoding SLC4A2 is a missense mutation of R793C or a frame shift insertion mutation of P928Sfs * 28 in the amino acid sequence of SEQ ID NO: 5;
The mutation of the gene encoding DDX20 is at least one mismatch mutation selected from the group consisting of S172P, F403L and S685Y in the amino acid sequence of SEQ ID NO: 31, or a splice mutation wherein X438_splice is a mutation;
The mutation of the gene encoding ARHGAP26 comprises at least one mismatch mutation selected from the group consisting of N621Y, K566N and R19L in the amino acid sequence of SEQ ID NO: 32, or a mutant of N666Efs * 79, N666Efs * 79 and N666Efs * 79 At least one frame shift insertion mutation selected from the group consisting of:
Wherein the mutation of the gene encoding GABRE is a mismatch mutation of at least one of R472H and Y478N in the amino acid sequence of SEQ ID NO: 33, or a frame shift insertion mutation of I234Nfs * 3;
The mutation of the gene encoding IPO7 is at least one mismatch mutation selected from the group consisting of N34H, R427Q and M781I in the amino acid sequence of SEQ ID NO: 34;
Wherein the mutation of the gene encoding PDE4C is at least one mismatch mutation selected from the group consisting of S254F, D429N, T561M, L488Q and N437K or a frame shift insertion mutation of Y557Lfs * 21 in the amino acid sequence of SEQ ID NO: 35;
Wherein the mutation of the gene encoding PRKCQ is a frame shift deletion mutation in the amino acid sequence of SEQ ID NO: 36, Q43Rfs * 32, or at least one meseSense mutation in F448V and L350V, or a frame shift insertion mutation in V457Cfs * 31;
The mutation of the gene coding for PRSS38 is a frame shift insertion mutation of S314Qfs * 21, a Missense mutation of V315I, or a splice mutation of X104_splice in the amino acid sequence of SEQ ID NO: 37 (G is substituted at T at position 228004909 );
The mutation of the gene encoding ADAMTS20 is a splice mutation in at least one of X1741_splice (C is substituted for T at position 43769952) and X205_splice (C is substituted at T at position 43896209 for C) in the amino acid sequence of SEQ ID NO: 38 At least one mismatch mutation selected from the group consisting of R1630W, V1383I, S1546L and G1209V, or a nonsense mutation that is W1085 *;
The mutation of the gene encoding ODZ4 is at least one mismatch mutation selected from the group consisting of V2177L, L697F and M2761T in the amino acid sequence of SEQ ID NO: 39, or a frame shift insertion mutation of K619Efs * 4;
Wherein the mutation of the gene encoding the PLEC comprises at least one mismatch mutation selected from the group consisting of K1427R, P3986Q, T2862M, R609C, A2774G and A1713V, or a nonsense mutation in which the mutation is E4243 * in the amino acid sequence of SEQ ID NO: .
The method according to claim 1,
SEQ ID NO: 41 and SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44, SEQ ID NO: 45 and SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 48, SEQ ID NO: 49 and SEQ ID NO: 50 and SEQ ID NO: 51 for mutation detection of ARAP3 At least one primer set selected from the group consisting of base sequence pairs shown in SEQ ID NO: 52;
SEQ ID NO: 53 and SEQ ID NO: 54, SEQ ID NO: 55 and SEQ ID NO: 56, SEQ ID NO: 57 and SEQ ID NO: 58, SEQ ID NO: 59 and SEQ ID NO: 60, SEQ ID NO: 61 and SEQ ID NO: 62 for mutation detection of ERBB4 At least one primer set selected from the group consisting of:
At least one primer set selected from the group consisting of SEQ ID NO: 63 and SEQ ID NO: 64 for the mutation detection of F8, SEQ ID NO: 65 and SEQ ID NO: 66, and SEQ ID NO: 67 and SEQ ID NO: 68;
At least one primer set selected from the group consisting of SEQ ID NO: 69 and SEQ ID NO: 70, SEQ ID NO: 71 and SEQ ID NO: 72 and SEQ ID NO: 73 and SEQ ID NO: 74 for mutation detection of RNF40;
A primer set of the nucleotide sequence pair shown in SEQ ID NO: 75 and SEQ ID NO: 76 for mutation detection of SLC4A2;
SEQ ID NO: 77 and SEQ ID NO: 78, SEQ ID NO: 79 and SEQ ID NO: 80, SEQ ID NO: 81 and SEQ ID NO: 82, SEQ ID NO: 83 and SEQ ID NO: 84, SEQ ID NO: 85 and SEQ ID NO: 86 for mutation detection of SCAF1 At least one primer set selected from the group consisting of:
At least one primer set selected from the group consisting of SEQ ID NO: 87 and SEQ ID NO: 88, SEQ ID NO: 89 and SEQ ID NO: 90, SEQ ID NO: 91 and SEQ ID NO: 92 for mutation detection of GXYLT1;
A primer set of the nucleotide sequence pair shown in SEQ ID NO: 93 and SEQ ID NO: 94 for the mutation detection of CEP295;
A primer set of base sequence pairs shown in SEQ ID NO: 95 and SEQ ID NO: 96 for mutation detection of PCDHA6;
At least one primer set selected from the group consisting of SEQ ID NO: 97 and SEQ ID NO: 98, SEQ ID NO: 99 and SEQ ID NO: 100 and SEQ ID NO: 101 and SEQ ID NO: 102 for mutation detection of ZNF844;
SEQ ID NO: 103 and SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106, SEQ ID NO: 107 and SEQ ID NO: 108, SEQ ID NO: 109 and SEQ ID NO: 110 and SEQ ID NO: 111 and SEQ ID NO: 112 for mutation detection of MAFA At least one primer set selected from the group consisting of:
113 and SEQ ID NO: 114, SEQ ID NO: 115 and SEQ ID NO: 116, SEQ ID NO: 117 and SEQ ID NO: 118, SEQ ID NO: 119 and SEQ ID NO: 120, SEQ ID NO: 121 and SEQ ID NO: 122 for the mutation detection of MYH1 At least one primer set selected from the group consisting of:
A primer set of a nucleotide sequence pair shown in SEQ ID NO: 123 and SEQ ID NO: 124 for mutation detection of NDUFAF3;
At least one primer set selected from the group consisting of SEQ ID NO: 125 and SEQ ID NO: 126, SEQ ID NO: 127 and SEQ ID NO: 128, SEQ ID NO: 129 and SEQ ID NO: 130 for mutation detection of NKAIN3;
At least one primer set of SEQ ID NO: 131 and SEQ ID NO: 132, SEQ ID NO: 133 and SEQ ID NO: 134 for the mutation detection of SERPINI2;
At least one primer set selected from the group consisting of SEQ ID NO: 135 and SEQ ID NO: 136, SEQ ID NO: 137 and SEQ ID NO: 138 and SEQ ID NO: 139 and SEQ ID NO: 140 for mutation detection of ZBTB41;
SEQ ID NO: 141 and SEQ ID NO: 142, SEQ ID NO: 143 and SEQ ID NO: 144, SEQ ID NO: 145 and SEQ ID NO: 146, SEQ ID NO: 147 and SEQ ID NO: 148, SEQ ID NO: 149 and SEQ ID NO: 150, SEQ ID NO: 151 and SEQ ID NO: At least one primer set selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 152, SEQ ID NO: 153 and SEQ ID NO: 154, SEQ ID NO: 155 and SEQ ID NO: 156, SEQ ID NO: 157 and SEQ ID NO: 158, SEQ ID NO: ;
SEQ ID NO: 161 and SEQ ID NO: 162, SEQ ID NO: 163 and SEQ ID NO: 164, SEQ ID NO: 165 and SEQ ID NO: 166, SEQ ID NO: 167 and SEQ ID NO: 168, SEQ ID NO: 169 and SEQ ID NO: 170 and SEQ ID NO: 171 and SEQ ID NO: 171 for mutation detection of SLC27A6, At least one primer set selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 172;
At least one nucleotide sequence selected from the group consisting of SEQ ID NO: 173 and SEQ ID NO: 174, SEQ ID NO: 175 and SEQ ID NO: 176, SEQ ID NO: 177 and SEQ ID NO: 178, SEQ ID NO: 179 and SEQ ID NO: 180 for mutation detection of BTNL3 Primer set;
181 and SEQ ID NO: 182, SEQ ID NO: 183 and SEQ ID NO: 184, SEQ ID NO: 185 and SEQ ID NO: 186, SEQ ID NO: 187 and SEQ ID NO: 188 and SEQ ID NO: 189 and SEQ ID NO: 190 for mutation detection of CADPS At least one primer set selected from the group consisting of:
A primer set of at least one of the nucleotide sequence pairs shown in SEQ ID NO: 191 and SEQ ID NO: 192 and SEQ ID NO: 193 and SEQ ID NO: 194 for mutation detection of CCDC173;
At least one selected from the group consisting of SEQ ID NO: 195 and SEQ ID NO: 196, SEQ ID NO: 197 and SEQ ID NO: 198, SEQ ID NO: 199 and SEQ ID NO: 200 and SEQ ID NO: 201 and SEQ ID NO: 202 for the mutation detection of PPIL4 Primer set;
At least one primer set selected from the group consisting of SEQ ID NO: 203 and SEQ ID NO: 204, SEQ ID NO: 205 and SEQ ID NO: 206 and SEQ ID NO: 207 and SEQ ID NO: 208 for mutation detection of SHMT2;
At least one primer set selected from the group consisting of SEQ ID NO: 209 and SEQ ID NO: 210, SEQ ID NO: 211 and SEQ ID NO: 212 and SEQ ID NO: 213 and SEQ ID NO: 214 for mutation detection of SLC47A2;
At least one nucleotide sequence selected from the group consisting of SEQ ID NO: 215 and SEQ ID NO: 216, SEQ ID NO: 217 and SEQ ID NO: 218, SEQ ID NO: 219 and SEQ ID NO: 220, SEQ ID NO: 221 and SEQ ID NO: 222 for mutation detection of TMEM169 Primer set;
At least one selected from the group consisting of SEQ ID NO: 223 and SEQ ID NO: 224, SEQ ID NO: 225 and SEQ ID NO: 226, SEQ ID NO: 227 and SEQ ID NO: 228, SEQ ID NO: 229 and SEQ ID NO: 230 for mutation detection of TMEM184C Primer set;
At least one nucleotide sequence selected from the group consisting of SEQ ID NO: 231 and SEQ ID NO: 232, SEQ ID NO: 233 and SEQ ID NO: 234, SEQ ID NO: 235 and SEQ ID NO: 236, SEQ ID NO: 237 and SEQ ID NO: 238 for mutation detection of WDR62 Primer set;
At least one primer set selected from the group consisting of SEQ ID NO: 239 and SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO: 243 and SEQ ID NO: 244 for mutation detection of RTN3;
245, SEQ ID NO: 247, SEQ ID NO: 248, SEQ ID NO: 249 and SEQ ID NO: 250 and SEQ ID NO: 251 and SEQ ID NO: 252 for the mutation detection of SCN2A, Primer set;
At least one primer set selected from the group consisting of SEQ ID NO: 253 and SEQ ID NO: 254, SEQ ID NO: 255 and SEQ ID NO: 256, SEQ ID NO: 257 and SEQ ID NO: 258 for mutation detection of SLC25A13;
A primer set of a nucleotide sequence pair shown in SEQ ID NO: 259 and SEQ ID NO: 260 for mutation detection of SLC4A2;
At least one selected from the group consisting of SEQ ID NO: 261 and SEQ ID NO: 262, SEQ ID NO: 263 and SEQ ID NO: 264, SEQ ID NO: 265 and SEQ ID NO: 266, SEQ ID NO: 267 and SEQ ID NO: 268 for mutation detection of DDX20 Primer set;
At least one selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 269 and SEQ ID NO: 270, SEQ ID NO: 271 and SEQ ID NO: 272, SEQ ID NO: 273 and SEQ ID NO: 274, SEQ ID NO: 275 and SEQ ID NO: 276 for mutation detection of ARHGAP26 Primer set;
277 and SEQ ID NO: 278 for the mutation detection of GABRE, and at least one of the pair of base sequences shown in SEQ ID NO: 279 and SEQ ID NO: 280;
At least one primer set selected from the group consisting of SEQ ID NO: 281 and SEQ ID NO: 282, SEQ ID NO: 283 and SEQ ID NO: 284, and SEQ ID NO: 285 and SEQ ID NO: 286 for mutation detection of IPO7;
At least one selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 287 and SEQ ID NO: 288, SEQ ID NO: 289 and SEQ ID NO: 290, SEQ ID NO: 291 and SEQ ID NO: 292, SEQ ID NO: 293 and SEQ ID NO: 294 for mutation detection of PDE4C, Primer set;
At least one selected from the group consisting of SEQ ID NO: 295 and SEQ ID NO: 296, SEQ ID NO: 297 and SEQ ID NO: 298, SEQ ID NO: 299 and SEQ ID NO: 300, SEQ ID NO: 301 and SEQ ID NO: 302 for mutation detection of PRKCQ, Primer set;
A primer set of at least one of the nucleotide sequence pairs shown in SEQ ID NO: 303 and SEQ ID NO: 304, and SEQ ID NO: 305 and SEQ ID NO: 306 for the mutation detection of PRSS38;
SEQ ID NO: 307 and SEQ ID NO: 308, SEQ ID NO: 309 and SEQ ID NO: 310, SEQ ID NO: 311 and SEQ ID NO: 312, SEQ ID NO: 313 and SEQ ID NO: 314, SEQ ID NO: 315 and SEQ ID NO: 316 for mutation detection of ADAMTS20, At least one primer set selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 318, SEQ ID NO: 319, and SEQ ID NO: 320;
At least one selected from the group consisting of nucleotide sequence pairs shown in SEQ ID NO: 321 and SEQ ID NO: 322, SEQ ID NO: 323 and SEQ ID NO: 324, SEQ ID NO: 325 and SEQ ID NO: 326, and SEQ ID NO: 327 and SEQ ID NO: 328 for mutation detection of ODZ4 Primer set;
At least one primer set selected from the group consisting of SEQ ID NO: 329 and SEQ ID NO: 330, SEQ ID NO: 331, SEQ ID NO: 332 and SEQ ID NO: 333 and SEQ ID NO: 334 for mutation detection of PLEC; Of primer set.
Preparing sample DNA from a sample of a kidney cancer patient of known age;
Amplifying the sample DNA using the kit of claim 1;
Confirming presence or absence of an age-specific marker specific to the age group of the subject from the amplification result;
Treating a kidney cancer patient whose age-specific marker is confirmed by treating or treating any kidney cancer candidate candidate with an arbitrary method; And
A method of treating a renal cancer patient, comprising the steps of: administering to the renal cancer patient an optional renal cancer therapeutic candidate or any therapeutic method treating the renal cancer, wherein the age-specific marker is employed as a candidate therapeutic agent or treatment method suitable for the age group of the identified renal cancer patient A method of providing information necessary to determine the difference in the effect of treating renal cancer according to age.
The method of claim 4,
The age-specific marker may be selected from the group consisting of ARAP3, ERBB4, F8, RNF40, SLC4A2, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, MYH1, NDUFAF3, NKAIN3, SERPINI2, ZBTB41, MUC6, SLC27A6, BTNL3, CADPS, CCDC173, SHMT2, SLC47A2, TMEM169, TMEM184C and WDR62.
The method of claim 5,
The age specific markers in patients with renal cancer less than 50 years of age are mutations of a gene encoding one selected from the group consisting of RNF40, SCAF1, GXYLT1, CEP295, PCDHA6, ZNF844, MAFA, NDUFAF3, NKAIN3, RNF40, and SERPINI2 .
The method of claim 5,
Wherein age-specific markers in kidney cancer patients aged 51 to 60 years are mutations of a gene encoding one selected from the group consisting of ARAP3, MYH1 and ZBTB41.
The method of claim 5,
Wherein the age-specific marker is a mutation in the gene encoding SLC27A6 in a patient under age 60 with renal cancer.
The method of claim 5,
Wherein the age-specific marker is a mutation in a gene encoding MUC6 in patients with renal cancer> 61 years of age.
The method of claim 5,
In age-matched renal cancer patients aged 71 years or older, the age-specific marker is a mutation of a gene encoding one selected from the group consisting of ERBB4, F8, SLC4A2, BTNL3, CADPS, CCDC173, PPIL4, SHMT2, SLC47A2, TMEM169, TMEM184C and WDR62 .
Preparing sample DNA from a sample of a kidney cancer patient;
Amplifying the sample DNA using the kit of claim 1; And
And confirming the presence or absence of an age-specific marker from the amplification result. The method for providing information necessary for diagnosing a prognosis of renal cancer according to the age of a patient with renal cancer.
The method of claim 11,
Wherein said method predicts the total or disease-free survival rate of patients with renal cancer.
The method of claim 12,
When a mutation is confirmed in a gene encoding one selected from the group consisting of RTN3, SCN2A, SLC25A13, SLC4A2, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C, PRKCQ, PRSS38, ADAMTS20, ODZ4 and PLEC, Determining that the survival rate of the cancer patient is not good or the recurrence rate of renal cancer in the kidney cancer patient is high.
The method of claim 12,
And determining that the renal cancer recurrence rate of the kidney cancer patient is high when the age of the kidney cancer patient is 50 years or less and the mutation is confirmed in the gene encoding PRSS38.
The method of claim 12,
When a mutation is confirmed in a gene encoding a gene selected from the group consisting of RTN3, SLC25A13, DDX20, AGAP7P, ARHGAP26, GABRE, IPO7, PDE4C and PRKCQ, the age of the kidney cancer patient is 61 to 70 years, Determining that the survival rate of the patient is not good or the recurrence rate of renal cancer in the kidney cancer patient is high.
The method of claim 12,
And determining that the renal cancer recurrence rate of the kidney cancer patient is high when the age of the kidney cancer patient is 61 years or more and the mutation is confirmed in the gene encoding at least one of ODZ4 and PLEC.
The method of claim 12,
Determining the recurrence rate of renal cancer in the kidney cancer patient to be high when the age of the kidney cancer patient is 71 years or more and the mutation is confirmed in the gene encoding at least one of SCN2A and SLC4A2.

Images