KR20180126322A - Escherichia coli producing glycolate from xylose, method for preparing the same and method for producing glycolate using the same - Google Patents

Abstract

The present invention relates to Escherichia coli having the ability to produce glycolic acid from xylose, a method for preparing the same, and a method for producing glycolic acid using the same. More specifically, the present invention relates to transformed Escherichia coli which can mass-produce glycolic acid from xylose, a method for preparing the same, and a method for producing glycolic acid from xylose using the transformed Escherichia coli. According to the present invention, transformed Escherichia coli which can mass-produce glycolic acid from xylose can be provided. Also, according to the present invention, a by-product generated in the process of producing glycolic acid from xylose can be introduced to the glycolic acid biosynthesis pathway, and thus the yield of by-products can be significantly reduced while producing glycolic acid in high yields.

Description

TECHNICAL FIELD [0001] The present invention relates to an Escherichia coli having the ability to produce glycolic acid from xylose, a process for producing the same, and a process for producing glycolic acid using the same. BACKGROUND ART [0002]

The present invention relates to a method for producing glycolic acid from xylose, a process for producing the same, and a process for producing glycolic acid using the same, and more particularly, to a process for producing glycolic acid from xylose, And a method for producing glycolic acid from xylose using the above-mentioned transformed E. coli.

Glycolic acid (GA) is the simplest alpha hydroxy acid. Glycolic acid is widely applicable because of its primary alcohol and moderately strong carboxylic acid functional groups. For example, glycolic acid is widely used in cosmetics and dermatology due to its peeling effect and moisturizing effect. Polyglycolic acid (PGA), a polymeric form of glycolic acid, has been used as a good packaging material due to its excellent gas barrier properties. Glycolic acid is also used in the medical field as a copolymeric substrate for poly (lactic-co-glycolic acid) (poly (lactic-co-glycolic acid)). In addition, the demand for glycolic acid in PET bottles and medical sutures is very high. In addition, it is possible to apply glycolic acid in leather processes, oil and gas processes, laundry and textile processes.

Glycolic acid, which is commonly produced by Du Pont Company, is produced through the reaction of formaldehyde and carbon monoxide when water and acid catalysts are present from a fossil fuel source at high and high pressure conditions. Other manufacturers produce glycolic acid through direct reaction and reacidification of chloroacetic acid and sodium hydroxide. Other chemical methods for synthesizing glycolic acid include (1) a method in which ethylene glycol is oxidized with glycolaldehyde and then oxidized with glycolic acid, and (2) a method in which formaldehyde cyanohydrin is prepared and then hydrated have.

Recently, as concerns over depletion of fossil fuels have increased, methods have been developed for over-expressing genes involved in the glyoxylate shunt pathway and producing glycolic acid from the transformed microorganisms carrying them. On the other hand, glycolic acid has been known as a byproduct produced during the fermentation of xylose to produce ethylene glycol using the Dahms pathway of E. coli in the prior art. In addition, there has been reported a method of sequentially increasing the production of glycolic acid while preserving carbon through a reverse application of the glyoxylic acid shunt pathway. However, no studies on the biosynthesis of glycolic acid by combining the Dahms pathway and the glyoxylic acid shunt pathway have been reported so far.

Mainguet, S. E., L. S. Gronenberg, S. S. Wong, and J. C. Liao (2013) A reverse glycylate shunt to build a non-native route from C4 to C2 in Escherichia coli. Metab. Eng. 19: 116-127.

The present invention provides a transformed Escherichia coli (recombinant Escherichia coli) capable of efficiently producing glycolic acid from xylose and a process for producing the same. Also provided is a method for producing glycolic acid using the transformed Escherichia coli.

In order to achieve the above object, the present invention provides a method for producing xylose isomerase gene xylA And knocking out the xylulokinase gene xylB (step a); Knocking out the glycolic acid oxidase gene glcD in E. coli of step a (step b); And a step (c) of transforming Escherichia coli of step (b) using an expression vector comprising xylose dehydrogenase gene xdh , wherein the step (c) comprises the step of transforming Escherichia coli .

The xylose isomerase gene xylA may be composed of the nucleotide sequence shown in SEQ ID NO: 1.

The xylurokinase gene xylB may be composed of the nucleotide sequence shown in SEQ ID NO: 2.

The glycolic acid oxidase gene glcD may be composed of the nucleotide sequence shown in SEQ ID NO: 3.

The xylose dehydrogenase gene xdh is expressed by Caulobacter < RTI ID = 0.0 > crescentus ) and may be composed of the nucleotide sequence shown in SEQ ID NO: 4.

The expression vector of step c is selected from the group consisting of xylonic acid dehydratase gene yjhG , xylonic acid dehydratase gene yagF , xylonic acid dehydratase gene xylD , 2 , The 2,3-keto xylonate aldolase gene yjhH , the 2,3-keto xylonate aldolase gene yagE , the lactaldehyde dehydrogenase ( lactaldehyde dehydrogenase gene aldA , glyoxylate reductase gene ycdW , isocitrate lyase gene aceA , isocitrate dehydrogenase kinase / phosphatase gene aceK , malic acid thiokinase (malate thiokinase) -2 sucC gene, thio malic acid kinase (malate thiokinase) -2 sucD gene and dry -CoA lyase (malyl-CoA lyase) gene mcl - 1 And the nucleotide sequence of SEQ ID NOS: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 and 16 ≪ / RTI >

Wherein the expression vector of step c is selected from the group consisting of xylonic acid dihydratase gene yagF , 2,3- ketojylonic acid aldolase gene yagE , lactaldehyde dehydrogenase gene aldA , glyoxylic acid reductase gene ycdW , isocitrate lyase it may be desirable to include a combination of the gene aceA and iso-citric acid dehydrogenase kinase / phosphatase gene aceK.

The E. coli may be E. coli W3110 (DE3).

The present invention also provides a method for producing a recombinant vector comprising the step of transforming Escherichia coli knocked out with xylose isomerase gene xylA , xylulokinase gene xylB and glycolic acid oxidase gene glcD with an expression vector containing xylose dehydrogenase gene xdh , And a transformed E. coli having a glycolic acid producing ability.

The expression vector may be selected from the group consisting of a xylon dehydratase gene yjhG , a xylonic acid dihydratase gene yagF , a xylonic acid dihydratase gene xylD , a 2,3-keto xylonic acid aldolase gene yjhH , A lactic acid aldolase gene yagE , a lactaldehyde dehydrogenase gene aldA , a glyoxylic acid reductase gene ycdW , an isocitrate lyase gene aceA , an isocitrate dihydrogenase kinase / phosphatase gene aceK , a malonic acid thiokinase gene sucC -2 , Malate thiokinase gene sucD- 2 and malyl - CoA lyase gene mcl - 1 .

In another aspect, the present invention, xylose isomerase gene xylA, xylene ruro kinase gene xylB and glycolic acid oxidase gene of E. coli which knock out glcD, xylose dehydrogenase gene xdh, xylene acid di-hydrazide hydratase gene yagF, 2, Expression comprising the 3-keto- xylonic acid aldolase gene yagE , the lactaldehyde dehydrogenase gene aldA , the glyoxylic acid reductase gene ycdW , the isocitrate degrading enzyme gene aceA and the isocitrate dihydrogenase / kinase / phosphatase gene aceK Transformed E. coli having the ability to produce glycolic acid.

In another aspect, the present invention, xylose isomerase gene xylA, xylene ruro kinase gene xylB and glycolic acid oxidase gene of E. coli which knock out glcD, xylose dehydrogenase gene xdh, xylene acid di-hydrazide hydratase gene yagF, 2, A first expression vector comprising the 3-keto- xylonic acid aldolase gene yagE , the lactaldehyde dehydrogenase gene aldA and the glyoxylic acid reductase gene ycdW , the isocitrate synthase gene aceA and the isocitrate dihydrogenase kinase / And a second expression vector comprising a phosphatase gene aceK , wherein the transformed E. coli is capable of producing glycolic acid.

The first expression vector may be pACM4 and the second expression vector may be pETM6.

In another aspect, the present invention, xylose isomerase gene xylA, xylene ruro kinase gene and the xylB and glycolic acid oxidase gene glcD knockout, xylose dehydrogenase of E. coli transformed with Kinase expression vector containing the gene xdh, xylose (Step 1); And a step (step 2) of obtaining a glycolic acid from the culture cultured in step 1.

The culture of step 1 may be performed by a shake flask fermentation method.

According to the present invention, it is possible to provide a transformed E. coli which can mass-produce glycolic acid from xylose. Also, according to the present invention, by-products generated in the course of producing glycolic acid from xylose can be introduced into the glycolic acid biosynthesis pathway, glycolic acid can be produced at a high yield while significantly reducing the production of by-products.

FIG. 1 shows a process of biosynthesizing glycolic acid through a Dahms pathway and a modified glyoxylic acid shunt pathway using a transforming microorganism according to an embodiment of the present invention.
FIG. 2 is a graph showing the concentration of metabolites produced during the initial culture of strain GA1 after fermentation in a shaking flask for 72 hours at 37.degree. C. using 4 g / L xylose and stirring at 250 rpm.
FIG. 3 is a graph showing the concentrations of glycolic acid and xylonic acid produced in the control strains GA0 and GA1 after fermentation in a shaking flask for 72 hours using 10 g / L xylose.
Figure 4 shows that xdh , a xylonic acid dihydratase, was overexpressed after fermentation in a shaking flask for 72 hours at 37 ° C using 10 g / L xylose and stirring at 250 rpm, and xylD derived from C. crescentus , YjhG from E. coli And yagF were overexpressed, respectively, as shown in FIG.
5 is a graph showing the concentrations of glycolic acid and xylonic acid produced in strain GA5 and GA6 after fermentation in a shaking flask for 72 hours at 37 DEG C using 10 g / L xylose and stirring at 250 rpm.
6 is a graph showing the effect of overexpression of lactaldehyde dehydrogenase ( aldA ) on the production of glycolic acid in strains overexpressing different xylonic acid dihydratases .
Figure 7 shows the results of comparing the concentrations of glycolic acid produced from strains harboring either or both of the genes of the plasmids of module I and module II after fermentation in a shaking flask for 96 hours.
FIG. 8 shows the results of comparing the concentrations and yields of glycolic acid produced from the GA14 and GA21 strains having both the module I plasmid and the plasmid gene of the module II after the fermentation for 96 hours in the shaking flask .

Hereinafter, the present invention will be described in more detail with reference to Examples. The objects, features and advantages of the present invention will be readily understood through the following examples. The present invention is not limited to the embodiments described herein, but may be embodied in other forms. The embodiments described herein are provided to enable those skilled in the art to fully understand the spirit of the present invention. Therefore, the present invention should not be limited by the following examples.

< Example >

Glycolic acid Production capacity  Preparation of transgenic microorganisms having

All strains and plasmids used in the present invention are shown in Table 1 below.

The plasmid and strain used in the present invention Plasmid / strain Relative feature Reference pACM4 pACYC-Duet derivative; with ePathBrick feature; T7 promoter; Cmr Xu et al.,
2012 pETM6 pET-Duet derivative; with ePathBrick feature; T7 promoter; Ampr Xu et al., 2012 pTrcHis2A pBR322 derivative; Trc promoter; rRnB anti-terminator; Amp Invitrogen pX Caulobacter pCM4 carrying crescentus- derived codon-optimized xdh Invention pXD PACM4 carrying the optimized xdh and xylD - C. crescentus derived codon Invention pXG PACM4 carrying the E. coli-derived and optimized xdh yjhG - C. crescentus derived codon Invention pXF PCM4 carrying cadons -optimized xdh from C. crescentus and yagF from E. coli Invention pXE PACM4 carrying cadons -optimized xdh from C. crescentus and yagE from E. coli Invention pXH PCM4 carrying cadons -optimized xdh from C. crescentus and yjhH from E. coli Invention pEFX YagE from E. coli And yagF ; PCM4 carrying the codon-optimized xdh from C. crescentus Invention pEAGX E. coli derived yagE , alda And yjHG ; PCM4 carrying the codon-optimized xdh from C. crescentus Invention pEADX YagE from E. coli and alda ; PACM4 carrying the optimized xylD and xdh - C. crescentus derived codon Invention pEAFX E. coli derived yagE , alda And yagF ; PCM4 carrying the codon-optimized xdh from C. crescentus Invention pEAX YagE from E. coli and alda ; PCM4 carrying the codon-optimized xdh from C. crescentus Invention pEAFXY (Module I) E. coli derived yagE , alda , yagF And ycdW ; PCM4 carrying the codon-optimized xdh from C. crescentus Invention pCD Methylococcus capsulatus- derived codon-optimized sucC- 2 and sucD- 2- bearing pETM6 Invention pK PETM6 carrying the E. coli-derived aceK Invention pM Rhodobacter pETM6 carrying sphaeroides- derived codon-optimized mcl1 Invention pA PETM6 carrying the E. coli-derived aceA Invention pCDM M. capsulatus- derived codon-optimized sucC- 2 and sucD- 2 ; PETM6 carrying R. sphaeroides- derived codon-optimized mcl1 Invention pKA AceK from E. coli And pETM6 carrying ceA Invention pCDKMA (Module II) M. capsulatus- derived codon-optimized sucC- 2 and sucD- 2 ; R. sphaeroides derived codon-optimized mcl1 ; E. coli-derived pETM6 carrying aceK and aceA Invention E. coli DH5α F 'Φ80lacZ ΔM15 (lacZYA-argF) U169 deoR recA1 endA1 hsdR17 (rk-, mk +) phoAsupE44thi-1gyrA96relA1 Enzynomics E. coli W3110 (DE3) xylAB FmcrA mcrB IN (rrnDrrnE) 1? (DE3); ATCC No. 27325; with deletion in xylAB genes Liu et al., 2012 GA0-1 E. coli W3110 (DE3) ΔxylAB ΔglcD pACM4 Invention GA0-2 E. coli W3110 (DE3) ΔxylAB ΔglcD pACM4 and pETM6 Invention GA1 E. coli W3110 (DE3) ΔxylAB ΔglcD pX Invention GA2 E. coli W3110 (DE3) ΔxylAB ΔglcD pXD Invention GA3 E. coli W3110 (DE3) ΔxylAB ΔglcD pXG Invention GA4 E. coli W3110 (DE3) ΔxylAB ΔglcD pXF Invention GA5 E. coli W3110 (DE3) ΔxylAB ΔglcD pXE Invention GA6 E. coli W3110 (DE3) ΔxylAB ΔglcD pXH Invention GA7 E. coli W3110 (DE3) ΔxylAB ΔglcD pEFX Invention GA8 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAGX Invention GA9 E. coli W3110 (DE3) ΔxylAB ΔglcD pEADX Invention GA10 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAFX Invention GA11 E. coli W3110 (DE3)? XylAB? GlcD pEAX Invention GA12 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAFXY Invention GA13 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAFX and pCDKMA Invention GA14 E. coli W3110 (DE3) [Delta] xylAB [Delta] glcD pEAFXY and pCDKMA Invention GA15 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAFXY and pA Invention GA16 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAFXY and pCD Invention GA17 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAFXY and pK Invention GA18 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAFXY and pM Invention GA19 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAFXY and pKA Invention GA20 E. coli W3110 (DE3) ΔxylAB ΔglcD pEAFXY and pCDM Invention GA21 E. coli W3110 (DE3) ΔxylAB ΔglcDEFGB ΔaceB pEAFXY and pCDKMA Invention

While using E. coli W3110 DNA as a template during the PCR for the purpose of cloning E. coli- derived genes using the primers shown in Table 2 below, xdh from Caulobacter crescentus , Rhodobacter sphaeroides- derived mcl and Methylococcus capsulatus- derived sucC -2 and sucD -2 were codon-optimized.

The primer sequence used in the present invention primer Sequence 5 '→ 3' / restriction enzyme function cc-xdh-F CGGT CATATG TCTTCTGCGATCTACCCG [NdeI] (SEQ ID NO: 17) amplification of xdh gene cc-xdH-R CTTT CTCGAG TCAACGCCAACCCGC [XhoI] (SEQ ID NO: 18) cc-xylD-F CTGT CATATG CGTTCTGCGCTGTCTAAC [NdeI] (SEQ ID NO: 19) amplification of the xylD gene cc-xylD-R CGTT CTCGAG TCAGTGGTTGTGACGC [XhoI] (SEQ ID NO: 20) yjhG-F GGGG CATATG TCTGTTCGCAATATTTTG [NdeI] (SEQ ID NO: 21) amplification of the yjhG gene yjHG-R CGCC CTCGAG TCAGTTTTTATTCATAAAATCGC [XhoI] (SEQ ID NO: 22) yagF-F CCCG CATATG ACCATTGAGAAAATT [NdeI] (SEQ ID NO: 23) amplification of yagF gene yagF-R CTCT CTCGAG TTAAATTCCGAGCGC [XhoI] (SEQ ID NO: 24) yjHH-F CCCG CATATG AAAAAATTCAGCGGCATTA [NdeI] (SEQ ID NO: 25) Amplification of the yjhH gene yjHH-R CTCT CTCGAG TTCTCCTCAGACTGGTAA [XhoI] (SEQ ID NO: 26) yagE-F CTCG CATATG ATTCAGCAAGGAGATC [NdeI] (SEQ ID NO: 27) amplification of yagE gene yagE-R CTCT CTCGAG TCAGCAAAGCTTGAGCTG [XhoI] (SEQ ID NO: 28) ycdW-F CCCG CATATG GATATCATCTTTTATCACCC [NdeI] (SEQ ID NO: 29) amplification of the ycdW gene ycdW-R CTTT CTCGAG TTAGTAGCCGCGTGCGC [XhoI] (SEQ ID NO: 30) aceA-F CCAA CAATTG GATGAAAACCCGTACACAAC [MunI] (SEQ ID NO: 31) amplification of the aceA gene aceA-R CTTT CTCGAG TTAGAACTGCGATTCTTCAG [XhoI] (SEQ ID NO: 32) AceK-F AAAA CATATG CCGCGTGGCCTGGAAT [NdeI] (SEQ ID NO: 33) amplification of aceK gene AceK-R AAAA CTCGAG TCAAAAAAGCATCTCCCCATAC [XhoI] (SEQ ID NO: 34) aldA-F CCAC CATATG TCAGTACCCGTTCAACATC [NdeI] (SEQ ID NO: 35) amplification of the aldA gene ALdA-R CCCC CTCGAG TTAAGACTGTAAATAAACCAC [XhoI] (SEQ ID NO: 36) mcl-F CCAA CATATG TCTTTCCGTCTGCA [NdeI] (SEQ ID NO: 37) amplification of the mcl1 gene mCl-R CAAC CTCGAG TCACGCAGAGATCATTT [XhoI] (SEQ ID NO: 38) sucC-2-F CCAA CATATG AACATCCACGAATACCAGG [NdeI] (SEQ ID NO: 39) amplification of sucC -2 gene sucC-2-R CAAC CTCGAG TTAACCTTTAACGATCGCAAC [XhoI] (SEQ ID NO: 40) sucD-2-F CCCC CATATG TCTGTTTTCGTTAA [NdeI] (SEQ ID NO: 41) amplification of sucD -2 gene sucD-2-R CAAA CTCGAG TCAGAAACGGATACC [XhoI] (SEQ ID NO: 42) glcD-KO-F gctggaaaaaggtgtgttgttggtgatggcgcgctttaaaCATATGAATATCCTCCTTAGT (SEQ ID NO: 43) amplification of the glcD disruption cassette glcD-KO-R AAATCATATTGCTGCGATAAACGGGCAATGCCTTCCAGTAGTGTAGGCTGGAGCTGCTTCG (SEQ ID NO: 44) glcD-Ver-F ATGAGCATCTTGTACGAAGA (SEQ ID NO: 45) glcD burst check glcD-Ver-R TTCAGGGAAAGGTAAATGAC (SEQ ID NO: 46) glcB-KO-F ttctctgcacggacgctcgctgctgtttatccgcaacgtgCATATGAATATCCTCCTTAGT (SEQ ID NO: 47) amplification of the glcB disruption cassette glcB-KO-R TTCAAATTCAGCATTGAACTCGGTCTGGGCAATGTTGGCTGTGTAGGCTGGAGCTGCTTCG (SEQ ID NO: 48) glcB-Ver-F cgcacatcaacgatgttatc (SEQ ID NO: 49) Check glcB rupture glcB-Ver-R GCCACATTGTGAATATCCGG (SEQ ID NO: 50) aceB-KO-F tcactggcaccagactggaacaaagtgatcgacgggcaaa CATATGAATATCCTCCTTAGT (SEQ ID NO: 51) Amplification of the aceB disruption cassette aceB-KO-R ACCGTTATTGGCTTCCAGCGATTTATCCGCTTTTACTTTGGTGTAGGCTGGAGCTGCTTCG (SEQ ID NO: 52) aceB-Ver-F gaaacagcttccattcgcg (SEQ ID NO: 53) aceB Confirmation of rupture aceB-Ver-R GTAATCGGCGCGTCTTGTTC (SEQ ID NO: 54) YAG F-His-F CCC CTCGAG AACCATTGAGAAAATT [XhoI] (SEQ ID NO: 55) Amplification of His tagged yagF gene YAG F-His-R CCC AAGCTT AATTCCGAGCGCTTTTTT [HindIII] (SEQ ID NO: 56)

The PCR product was treated with NdeI / XhoI or MunI / XhoI and cloned into pACM4 (Addgene plasmid # 49797) or pETM6 (Addgene plasmid # 49795) provided by Mattheos Koffas and treated with the same enzyme.

The first module plasmid was constructed in a pseudo-operon configuration in which each gene shares a terminator under an independent promoter. The donor vector was treated with Avr II / Sal I and then ligated with the target vector treated with Spe I / Sal I. To construct yagF and ycdW genes containing Sal I sites with an open reading frame, the donor vector was treated with Avr II / Nhe I and then ligated with the Spe I / Nhe I treated and dephosphorylated target vector.

In the second module plasmid, the sucC -2 and sucD -2 genes were constructed as operon sequences and the other genes were constructed as pseudo-operon sequences. Recombinant plasmids were transformed into chemically or electrically activated E. coli cells. Chemically-activated E. coli cells were prepared by a one-step method using a transformation and storage solution. Other DNA manipulations, electroporation and protein level expression assays were performed according to standard procedures (Sambrook and Russell, 2001). Gene-free strains were constructed using the one-step gene inactivation method (Cherepanov and Wackernagel, 1995; Cabulong et al., 2017).

<Experimental Example>

Production of glycolic acid by shaking-flask fermentation

The shake-flask fermentation was performed by adding 100 mL of M9 medium supplemented with 1 g / L of peptone, 0.5 g / L of yeast extract, 10 g / L of xylose, 1 mM of MgSO ₄ , 20 g / L of MOPS, 35 ㎍ / mL of chloramphenicol, 100 [mu] g / mL. 2 mL of the cultured medium overnight was inoculated into each flask, followed by fermentation at 37 DEG C for 72 to 96 hours, followed by agitation at 250 rpm. Induction was performed by adding 0.5 mM IPTG when the OD ₆₀₀ of the culture reached 0.3 AU. At specific time intervals, the OD ₆₀₀ of the biomass was measured and 1 ml of sample was collected to quantify substrate and metabolites using HPLC. Fermentation was carried out at least twice.

Enzyme purification

To purify the enzyme, E. coli W3110 (DE3) xylAB glcD, in which yjhG or yagF gene was overexpressed with histidine in the plasmid pTrcHis2A, was used. Here, xylAB is xylose isomerase means sikyeotdaneun deleting the (xylose isomerase) gene xylA and xylene ruro kinase (xylulokinase) gene xylB and, glcD means sikyeotdaneun deletion of the glycolic acid oxidase (glycolate oxidase) gene glcD do. Briefly, the recombinant strains were cultured in LB broth medium and IPTG 0.5 mM was added when the OD ₆₀₀ of the culture reached 0.3 AU. After induction for 5 hours, cells were collected by centrifugation at 4,000xg for 15 minutes at 4 &lt; 0 &gt; C. Macherey-Nagel of Protino Ni-TED 2000 in accordance with the packed columns protocol, Lysis-Cquilibration-Wash (LEW ) buffer reproduce _{(50 mM NaH 2 PO 4,} 300 mM NaCl, pH 8.0) the cell pellet suspended in 2-5 mL . Lysosyme was then added to destroy the cells to a final concentration of 1 mg / mL, and the solution was shaken on ice for 30 minutes. After that, ultrasonic treatment was performed on ice for 15 minutes with a cooling time of 15 seconds and a cell rupture interval of 15 seconds. The samples were then centrifuged at 10,000xg for 30 minutes at 4 DEG C and cell lysates were obtained as supernatants. After equilibrating the Protino Ni-TED column with 1x LEW buffer, the cell lysate passed through the column by gravity. After washing the column with 1x LEW buffer, polyhistidine-tagged proteins were eluted using elution buffer. Dialysis was performed overnight using 1x LEW buffer. The purified protein was visualized on a polyacrylamide gel and its concentration was measured using a Bio-Rad protein kit based on the Bradford assay method.

Enzyme analysis

The enzyme activity of yagF and yjhG dihydratase was measured using a semicarbazide assay. The reaction mixture was made up to volume of 0.15 mL containing 50 mM Tris-HCl (pH 8.0), 100 mM MgCl ₂ , 10 mM xylonic acid, a suitable amount of dihydratase and water. The mixture was incubated at 30 DEG C for 30 minutes, followed by addition of 1 mL of semicarbazide reagent and cooling. After the mixture was incubated again at 30 ° C for 15 minutes, the absorbance was measured at 250 nm using a UV-Vis spectrophotometer Agilent 8453. The activity of dihydratase was defined as the amount of enzyme catalyzing the formation of 1 μmol of 2-keto-3-deoxy-D-xylon acid (KDX) per minute and a molar extinction coefficient of 10,200 M ^-1 cm ^-1 .

Experimental Example 1: Analysis of glycolic acid production of strain overexpressing xylose dehydrogenase

In a previous study, glycolic acid was known to be a byproduct produced during the fermentation of ethylene glycol through the Dahms pathway. Glycolic acid is produced when xdh is expressed at high levels, but is re-assimilated in cells to form biomass. Therefore, in the present invention, the glcD gene encoding glycolic acid oxidase was removed to prevent re-assimilation of glycolic acid (Fig. 1). Subsequently, xdh was replicated in pACM4 , a low copy plasmid vector with a low copy number, to reduce xylonic acid accumulation. During consumption of xylose for the first 12 hours, sugar consumption was observed, leading to the accumulation of xylonic acid; The production of biomass and glycolic acid increased with the re-assimilation of xylonic acid (Fig. 2). The strain GA1 with overexpression of xdh gene was found to produce 1.21 g / L of glycolic acid at a yield of 0.30 g / g from 4 g / L xylose in the initial fermentation process.

To improve the titer of the glycolic acid produced, the initial xylose concentration was increased from 4 g / L to 10 g / L. As a result, in the GA0 control strain carrying the plasmid, xylose and glycolic acid were not accumulated after fermentation for 72 hours, even when the concentration of xylose was increased. On the other hand, strain GA1 produced 1.96 g / L of glycolic acid at a yield of 0.20 g / g, which is lower than the expected increase in glycolic acid activity. It is believed that after fermentation, the production of glycolic acid was decreased because 3.21 g / L of xylonic acid remained in the medium and led to the accumulation of serious xylonic acid (Fig. 3). The accumulation of xylonic acid appears to be due to the high expression of xdh and low pathway activity. Accumulation of xylonic acid may be alleviated by overexpressing downstream enzymes to (a) lower (or lower) xdh expression (b) and rapidly convert the products generated in the Dahms pathway to other intermediates.

Experimental Example 2: Analysis of glycolic acid production of strain overexpressing xylonic acid dihydratase

In order to increase the production amount of glycolic acid, overexpression of xylonic acid dihydratase and enzyme screening were performed. The xylonic acid dihydratase catalyzes the conversion of xylonic acid to 2,3-keto xylonic acid, and the efficient xylonic acid dihydratratase speeds up the xylose to glycolic acid by lowering or eliminating the accumulation of xylonic acid in the medium It is expected to convert. GA2, GA3 and GA4 strains were prepared to compare xylD from C. crescentus and xylon dehydratase encoded by yagF and yjhG from E. coli based on xylonic acid and glycolic acid accumulated after fermentation for 72 hours respectively Respectively. As a result, as shown in Fig. 4, it was found that the zyhlonic acid was accumulated in the medium after fermentation at 3.55, 1.96 and 0.64 g / L from GA2, GA3 and GA4, respectively, and the glycolic acid was produced at 1.43, 1.55 and 1.64 g / L there was. Among the three strains, GA4 strain containing overexpressed yagF accumulated the least amount of xylonic acid and produced the most glycolic acid. This means that the yagF gene is a xylonic acid dihydratase suitable for producing glycolic acid. To further confirm this, an enzyme assay was performed to compare the activity of two potential xylonic acid dihydratases , yagF and yjhG , derived from E. coli . The enzyme activities of yagF and yjhG were 34.5 and 13.5 nmol / min / mg, respectively (Table 3).

Enzyme activity of purified xylonic acid dihydratase Xylonic acid dihydratase Enzyme activity (nmol / min / mg) YagF 34.5 ± 6.36 YjhG 13.5 ± 0.71

It was confirmed that yagF has higher enzyme activity than yjhG and that yagF is a xylonic acid dihydratratase which is good for glycolic acid production compared to yjhG in fermentation process.

Experimental Example 3: Analysis of glycolic acid production of a strain overexpressing 2,3-keto-xylonic acid aldolase

Next, screening of 2,3-keto xylonic acid aldolase derived from E. coli was performed. 2,3-keto-xylonic acid aldolase cleaves 2,3-keto-xylonic acid to form pyruvic acid for growth and glycolaldehyde which is converted to glycolic acid or ethylene glycol. Similar to the experiment in which xylonic acid dihydratase was screened , yagE and yjhH derived from E. coli were overexpressed. Based on the xylonic and glycolic acid accumulated after fermentation for 72 hours, yagE And yjhH , GA5 and GA6 strains were respectively prepared and compared. As shown in Fig. 5, when GA5 and GA6 strains were used, the amounts of xylonic acid remaining in the medium were 3.24 and 3.30 g / L, respectively, and glycolic acid was found to be produced by 1.59 and 1.34 g / L, respectively. GA5 strain overexpressed yagE showed higher glycolic acid production than GA6 strain, but no significant difference in xylon accumulation. As a result, it was confirmed that the yagE gene is 2,3-keto xylonic acid aldolase suitable for producing glycolic acid. However, GA2, GA3, GA4, GA5 and GA6 strains produced significantly lower amounts of glycolic acid than strain GA1. It is believed that this is due to the metabolic burden and / or unknown regulation involved in the overexpression of xylonic acid dihydratase and 2,3-keto xylonic acid aldolase.

Experimental Example 4: Analysis of the effect of lactaldehyde dehydrogenase through a transformant strain

The efficient action of all enzymes involved in the Dahms pathway leads to a process that prevents efficient conversion of intermediates and toxic accumulation of intermediates, which is one of the key factors in increasing the final potency in metabolic engineering. In this experiment, plasmids containing three genes xdh , yagF, and yagE involved in the Dahms pathway were recombined and transformed with an E. coli host to produce strain GA7 and tested for glycolic acid production. As a result of the experiment, it was confirmed that the strain GA7 produced 1.43 g / L of glycolic acid, unlike the expectation that the production of glycolic acid would increase (FIG. 6). This means that a pull of carbon to synthesize glycolic acid is not sufficient to overexpress the three genes. Thereafter, recombinant DNA was prepared by changing only the xylon dehydratase gene in xylose dehydrogenase, xylonic acid dihydratase, 2,3-keto-xylon acid aldolase and over-expressed plasmid of lactaldehyde dehydrogenase The fermentation experiments were further conducted using strains. As a result of the experiment, it was confirmed that the production amount of glycolic acid was markedly increased as the four genes were over-expressed (FIG. 6). GA8 strains overexpressing yjhG is 2.74 g / L, GA9 strains overexpressing xylD is 3.28 g / L, GA10 strain overexpressing the yagF was producing the glycolic acid of 3.96 g / L. Among the strains used in the test, strain GA10 showed the highest glycolic acid activity with a yield of 0.40 g / g. This means that overexpression of yagF imparts a high production of glycolic acid. In addition, the strain GA11 , which overexpresses only xdh , yagE and aldA , was tested to confirm the accumulation of serious xylonic acid. This means that the low activity of the xylonic acid dihydratase in E. coli causes bottlenecks in the Dahms pathway to accumulate xylonic acid and at the same time diminish the potency and productivity of the glycolic acid.

Experimental Example 5: Confirmation of effect of glyoxylic acid reductase on glycolic acid production

In order to complete the module I plasmid, ycdW encoding the glyoxylic acid reductase Was linked to a plasmid (pEAFX) containing four genes, and GA12 strain producing glycolic acid was constructed through the Dahms pathway and the fermentation experiment was carried out. ycdW catalyzes the conversion of glyoxylic acid to glycolic acid. As a result, the conversion of glycolic acid was expected to increase with overexpression of ycdW. However, GA10 produced 3.96 g / L compared to glycolic acid produced by GA10, while GA12 produced 3.72 g / L . After 96 hours fermentation, there was no significant difference in the production of glycolic acid produced between the two strains.

Then, the strain GA13 was prepared by transforming plasmid pEAFX and the module II plasmid. A second module plasmid is methyl carboxy capsulartus-derived malt thiokinase encoded by sucC- 2 and sucD- 2 ; Rhodobacter sprooid- derived Malyl-CoA lyase coded by mcl1 ; And aceA and aceK from E. coli . These genes were included as high copy plasmids to increase carbon flux to glyoxylic acid.

A strain containing the module II plasmid was prepared and fermentation was carried out. As a result, the production amount of glycolic acid was remarkably increased (FIG. 7). The strain GA13 produced 4.18 g / L of glycolic acid and produced more glycolic acid than the strains GA10 and GA12. To confirm whether ycdW plays an important role in glycolic acid production, strain GA14 was prepared and it was confirmed that it produced 4.51 g / L of glycolic acid. It was confirmed that ycdW is an enzyme important for the biosynthesis of glycolic acid involved in the glyoxylic acid shunt pathway even though it acts on one of the intermediates in the Dahms pathway and that it has high affinity for glyoxylic acid . &Lt; / RTI &gt;

Experimental Example 6: Confirmation of Effect of Module II Plasmid Gene on Production of Glycolic Acid 1

GA15 ( aceA overexpression) and GA16 ( sucC ) were separately expressed by expressing the gene of the module II plasmid together with the module I plasmid in order to identify a gene involved in increasing the production amount of glycolic acid of the GA14 strain among the genes derived from the module II plasmid -2 and sucD- 2 overexpression), GA17 (overexpression of aceK ) and GA18 (overexpression of mcl1 ). As a result of the experiment, the strains produced 4.07, 3.36, 3.00 and 3.39 g / L of glycolic acid, respectively. The strain GA15 showed no significant difference in the production of glycolic acid with that of strain GA13 but showed a considerably lower production of glycolic acid than the strain GA14. In addition, GA16, GA17 and GA18 strains showed much lower glycolic acid production than GA14 strains. This means that overexpressing only one gene of the module II plasmid in the process of increasing the production of glycolic acid is not enough compared with the combination of genes.

Experimental Example 7: Confirmation of Effect of Module II Plasmid Gene on Production of Glycolic Acid 2

The glyoxylate shunt pathway is regulated by aceK and is regulated by the phosphorylation status of isocitrate dehydrogenase, an enzyme that catalyzes the conversion of isocitric acid to -ketoglutaric acid. When the enzyme is phosphorylated, the activity of the enzyme is decreased and the glyoxylate shunt is activated. If the level of aceK expression is low, overexpressing aceA alone may not be sufficient to increase glycolic acid production. In this experiment, the production of glycolic acid was analyzed using strain GA19 produced by overexpressing aceA and aceK . The strain produced 4.57 g / L of glycolic acid, which is very advantageous for glycolic acid production (Table 4).

The titer of the glycolic acid and the yield of the strain carrying the combination of the module I plasmid and the module II plasmid Strain Plasmid Glycolic acid (g / L) Yield (g / g) GA14 First, second module 4.51 ± 0.18 0.45 GA19 The first module and pKA 4.57 ± 0.24 0.46 GA20 The first module and pCDM 2.96 ± 0.40 0.35

As a result of the experiment with GA20 strain overexpressing the module I, sucC -2 and sucD -2 , it was confirmed that glycolic acid was produced at 2.96 g / L. From these results, it can be seen that aceK and aceA are involved in glyoxylic acid formation and are important genes for producing glycolic acid.

Experimental Example 8: Effect of malic acid synthase gene on glycolic acid production

In order to confirm that the production of glycolic acid can be further increased through the strain GA14, a strain GA21 in which glcB and aceB genes coding for malic acid synthase G and malic acid synthase A were additionally deleted was prepared and the experiment was conducted. For reference, there is deleted with FIG glcE (SEQ ID NO: 57), glcF (SEQ ID NO: 58) and glcG (SEQ ID NO: 59) gene in between glcD and glcB when deleting a glcD and glcB gene in GA21 strain production process, which glcD Because the remaining flippase recognition target (FRT) recognizes both the FRT locus of the glcB and glcD genes. Thus glcE, glcF and glcG gene between glcD and glcB flip Paget active process is also deleted together. The strain GA21 was expected to block the conversion of glyoxylic acid to malic acid, thereby increasing the yield of glycolic acid production. Unexpectedly, however, it was confirmed that the strain GA21 after 96 hours of fermentation produced 2.49 g / L of glycolic acid at a yield of 0.41 g / L due to very low productivity (FIG. 8). This seems to be a burden to the metabolism by the additional removal of the genes of the cells. Additional engineering skills will be needed to further improve the glycolic acid productivity, potency and yield of the strain.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> MYONGJI UNIVERSITY INDUSTRY AND ACADEMIA COOPERATION FOUNDATION <120> ESCHERICHIA COLI PRODUCING GLYCOLATE FROM XYLOSE, METHOD FOR          PREPARING THE SAME AND METHOD FOR PRODUCING GLYCOLATE USING THE          SAME <130> P17-0067 <160> 59 <170> KoPatentin 3.0 <210> 1 <211> 1323 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 xylose isomerase xylA gene <400> 1 atgcaagcct attttgacca gctcgatcgc gttcgttatg aaggctcaaa atcctcaaac 60 ccgttagcat tccgtcacta caatcccgac gaactggtgt tgggtaagcg tatggaagag 120 cacttgcgtt ttgccgcctg ctactggcac accttctgct ggaacggggc ggatatgttt 180 ggtgtggggg cgtttaatcg tccgtggcag cagcctggtg aggcactggc gttggcgaag 240 cgtaaagcag atgtcgcatt tgagtttttc cacaagttac atgtgccatt ttattgcttc 300 cacgatgtgg atgtttcccc tgagggcgcg tcgttaaaag agtacatcaa taattttgcg 360 caaatggttg atgtcctggc aggcaagcaa gaagagagcg gcgtgaagct gctgtgggga 420 acggccaact gctttacaaa ccctcgctac ggcgcgggtg cggcgacgaa cccagatcct 480 gaagtcttca gctgggcggc aacgcaagtt gttacagcga tggaagcaac ccataaattg 540 ggcggtgaaa actatgtcct gtggggcggt cgtgaaggtt acgaaacgct gttaaatacc 600 gacttgcgtc aggagcgtga acaactgggc cgctttatgc agatggtggt tgagcataaa 660 cataaaatcg gtttccaggg cacgttgctt atcgaaccga aaccgcaaga accgaccaaa 720 catcaatatg attacgatgc cgcgacggtc tatggcttcc tgaaacagtt tggtctggaa 780 aaagagatta aactgaacat tgaagctaac cacgcgacgc tggcaggtca ctctttccat 840 catgaaatag ccaccgccat tgcgcttggc ctgttcggtt ctgtcgacgc caaccgtggc 900 gatgcgcaac tgggctggga caccgaccag ttcccgaaca gtgtggaaga gaatgcgctg 960 gtgatgtatg aaattctcaa agcaggcggt ttcaccaccg gtggtctgaa cttcgatgcc 1020 aaagtacgtc gtcaaagtac tgataaatat gatctgtttt acggtcatat cggcgcgatg 1080 gatacgatgg cactggcgct gaaaattgca gcgcgcatga ttgaagatgg cgagctggat 1140 aaacgcatcg cgcagcgtta ttccggctgg aatagcgaat tgggccagca aatcctgaaa 1200 ggccaaatgt cactggcaga tttagccaaa tatgctcagg aacatcattt gtctccggtg 1260 catcagagtg gtcgccagga acaactggaa aatctggtaa accattatct gttcgacaaa 1320 taa 1323 <210> 2 <211> 1455 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 xylulose kinase xylB gene <400> 2 atgtatatcg ggatagatct tggcacctcg ggcgtaaaag ttattttgct caacgagcag 60 ggtgaggtgg ttgctgcgca aacggaaaag ctgaccgttt cgcgcccgca tccactctgg 120 tcggaacaag acccggaaca gtggtggcag gcaactgatc gcgcaatgaa agctctgggc 180 gatcagcatt ctctgcagga cgttaaagca ttgggtattg ccggccagat gcacggagca 240 accttgctgg atgctcagca acgggtgtta cgccctgcca ttttgtggaa cgacgggcgc 300 tgtgcgcaag agtgcacttt gctggaagcg cgagttccgc aatcgcgggt gattaccggc 360 aacctgatga tgcccggatt tactgcgcct aaattgctat gggttcagcg gcatgagccg 420 gagatattcc gtcaaatcga caaagtatta ttaccgaaag attacttgcg tctgcgtatg 480 acgggggagt ttgccagcga tatgtctgac gcagctggca ccatgtggct ggatgtcgca 540 aagcgtgact ggagtgacgt catgctgcag gcttgcgact tatctcgtga ccagatgccc 600 gcattatacg aaggcagcga aattactggt gctttgttac ctgaagttgc gaaagcgtgg 660 ggtatggcga cggtgccagt tgtcgcaggc ggtggcgaca atgcagctgg tgcagttggt 720 gtgggaatgg ttgatgctaa tcaggcaatg ttatcgctgg ggacgtcggg ggtctatttt 780 gctgtcagcg aagggttctt aagcaagcca gaaagcgccg tacatagctt ttgccatgcg 840 ctaccgcaac gttggcattt aatgtctgtg atgctgagtg cagcgtcgtg tctggattgg 900 gccgcgaaat taaccggcct gagcaatgtc ccagctttaa tcgctgcagc tcaacaggct 960 gatgaaagtg ccgagccagt ttggtttctg ccttatcttt ccggcgagcg tacgccacac 1020 aataatcccc aggcgaaggg ggttttcttt ggtttgactc atcaacatgg ccccaatgaa 1080 ctggcgcgag cagtgctgga aggcgtgggt tatgcgctgg cagatggcat ggatgtcgtg 1140 gcgtagtgag 1200 tactggcgtc agatgctggc ggatatcagc ggtcagcagc tcgattaccg tacggggggg 1260 gatgtggggc cagcactggg cgcagcaagg ctggcgcaga tcgcggcgaa tccagagaaa 1320 tcgctcattg aattgttgcc gcaactaccg ttagaacagt cgcatctacc agatgcgcag 1380 cgttatgccg cttatcagcc acgacgagaa acgttccgtc gcctctatca gcaacttctg 1440 ccattaatgg cgtaa 1455 <210> 3 <211> 1500 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 glycolate oxidase glcD gene <400> 3 atgagcatct tgtacgaaga gcgtcttgat ggcgctttac ccgatgtcga ccgcacatcg 60 gtactgatgg cactgcgtga gcatgtccct ggacttgaga tcctgcatac cgatgaggag 120 atcattcctt acgagtgtga cgggttgagc gcgtatcgca cgcgtccatt actggttgtt 180 ctgcctaagc aaatggaaca ggtgacagcg attctggctg tctgccatcg cctgcgtgta 240 ccggtggtga cccgtggtgc aggcaccggg ctttctggtg gcgcgctgcc gctggaaaaa 300 ggtgtgttgt tggtgatggc gcgctttaaa gagatcctcg acattaaccc cgttggtcgc 360 cgcgcgcgcg tgcagccagg cgtgcgtaac ctggcgatct cccaggccgt tgcaccgcat 420 aatctctact acgcaccgga cccttcctca caaatcgcct gttccattgg cggcaatgtg 480 gctgaaaatg ccggcggcgt ccactgcctg aaatatggtc tgaccgtaca taacctgctg 540 aaaattgaag tgcaaacgct ggacggcgag gcactgacgc ttggatcgga cgcgctggat 600 tcacctggtt ttgacctgct ggcgctgttc accggatcgg aaggtatgct cggcgtgacc 660 accgaagtga cggtaaaact gctgccgaag ccgcccgtgg cgcgggttct gttagccagc 720 tttgactcgg tagaaaaagc cggacttgcg gttggtgaca tcatcgccaa tggcattatc 780 cccggcgggc tggagatgat ggataacctg tcgatccgcg cggcggaaga ttttattcat 840 gccggttatc ccgtcgacgc cgaagcgatt ttgttatgcg agctggacgg cgtggagtct 900 gacgtacagg aagactgcga gcgggttaac gacatcttgt tgaaagcggg cgcgactgac 960 gtccgtctgg cacaggacga agcagagcgc gtacgtttct gggccggtcg caaaaatgcg 1020 ttcccggcgg taggacgtat ctccccggat tactactgca tggatggcac catcccgcgt 1080 cgcgccctgc ctggcgtact ggaaggcatt gcccgtttat cgcagcaata tgatttacgt 1140 gttgccaacg tctttcatgc cggagatggc aacatgcacc cgttaatcct tttcgatgcc 1200 aacgaacccg gtgaatttgc ccgcgcggaa gagctgggcg ggaagatcct cgaactctgc 1260 gttgaagttg gcggcagcat cagtggcgaa catggcatcg ggcgagaaaa aatcaatcaa 1320 atgtgcgccc agttcaacag cgatgaaatc acgaccttcc atgcggtcaa ggcggcgttt 1380 gaccccgatg gtttgctgaa ccctgggaaa aacattccca cgctacaccg ctgtgctgaa 1440 tttggtgcca tgcatgtgca tcacggtcat ttacctttcc ctgaactgga gcgtttctga 1500                                                                         1500 <210> 4 <211> 747 <212> DNA <213> Artificial Sequence <220> <223> Caulobacter crescentus NA1000_codon optimized Xdh gene <400> 4 atgtcttctg cgatctaccc gtctctgaaa ggtaaacgtg ttgttatcac cggtggtggt 60 tctggtatcg gtgcgggtct gaccgcgggt ttcgcgcgtc agggtgcgga agttatcttc 120 ctggacatcg cggacgaaga ctctcgtgcg ctggaagcgg aactggcggg ttctccgatc 180 ccgccggttt acaaacgttg cgacctgatg aacctggaag cgatcaaagc ggttttcgcg 240 gaaatcggtg acgttgacgt tctggttaac aacgcgggta acgacgaccg tcacaaactg 300 gcggacgtta ccggtgcgta ctgggacgaa cgtatcaacg ttaacctgcg tcacatgctg 360 ttctgcaccc aggcggttgc gccgggtatg aaaaaacgtg gtggtggtgc ggttatcaac 420 ttcggttcta tctcttggca cctgggtctg gaagacctgg ttctgtacga aaccgcgaaa 480 gcgggtatcg aaggtatgac ccgtgcgctg gcgcgtgaac tgggtccgga cgacatccgt 540 gttacctgcg ttgttccggg taacgttaaa accaaacgtc aggaaaaatg gtacaccccg 600 gaaggtgaag cgcagatcgt tgcggcgcag tgcctgaaag gtcgtatcgt tccggaaaac 660 gttgcggcgc tggttctgtt cctggcgtct gacgacgcgt ctctgtgcac cggtcacgaa 720 tactggatcg acgcgggttg gcgttga 747 <210> 5 <211> 1968 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 dehydratase gene YjhG <400> 5 atgtctgttc gcaatatttt tgctgacgag agccacgata tttacaccgt cagaacgcac 60 gccgatggcc cggacggcga actcccatta accgcagaga tgcttatcaa ccgcccgagc 120 ggggatctgt tcggtatgac catgaatgcc ggaatgggtt ggtctccgga cgagctggat 180 cgggacggta ttttactgct cagtacactc ggtggcttac gcggcgcaga cggtaaaccc 240 gtggcgctgg cgttgcacca ggggcattac gaactggaca tccagatgaa agcggcggcc 300 gaggttatta aagccaacca tgccctgccc tatgccgtgt acgtctccga tccttgtgac 360 gggcgtactc agggtacaac ggggatgttt gattcgctac cataccgaaa tgacgcatcg 420 atggtaatgc gccgccttat tcgctctctg cccgacgcga aagcagttat tggtgtggcg 480 agttgcgata aggggcttcc ggccaccatg atggcactcg ccgcgcagca caacatcgca 540 accgtgctgg tccccggcgg cgcgacgctg cccgcaaagg atggagaaga caacggcaag 600 gtgcaaacca ttggcgcacg cttcgccaat ggcgaattat ctctacagga cgcacgccgt 660 gcgggctgta aagcctgtgc ctcttccggc ggcggctgtc aatttttggg cactgccggg 720 acatctcagg tggtggccga aggattggga ctggcaatcc cacattcagc cctggcccct 780 tccggtgagc ctgtgtggcg ggagatcgcc agagcttccg cgcgagctgc gctgaacctg 840 agtcaaaaag gcatcaccac ccgggaaatt ctcaccgata aagcgataga gaatgcgatg 900 acggtccatg ccgcgttcgg tggttcaaca aacctgctgt tacacatccc ggcaattgct 960 caccaggcag gttgccatat cccgaccgtt gatgactgga tccgcatcaa caagcgcgtg 1020 ccccgactgg tgagcgtact gcctaatggc ccggtttatc atccaacggt caatgccttt 1080 atggcaggtg gtgtgccgga agtcatgttg catctgcgca gcctcggatt gttgcatgaa 1140 gacgttatga cggttaccgg cagcacgctg aaagaaaacc tcgactggtg ggagcactcc 1200 gaacggcgtc agcggttcaa gcaactcctg ctcgatcagg aacaaatcaa cgctgacgaa 1260 gtgatcatgt ctccgcagca agcaaaagcg cgcggattaa cctcaactat caccttcccg 1320 gtgggcaata ttgcgccaga aggttcggtg atcaaatcca ccgccattga cccctcgatg 1380 attgatgagc aaggtatcta ttaccataaa ggtgtggcga aggtttatct gtccgagaaa 1440 agtgcgattt acgatatcaa acatgacaag atcaaggcgg gcgatattct ggtcattatt 1500 ggcgttggac cttcaggtac agggatggaa gaaacctacc aggttaccag tgccctgaag 1560 catctgtcat acggtaagca tgtttcgtta atcaccgatg cacgtttctc gggcgtttct 1620 actggcgcgt gcatcggcca tgtggggcca gaagcgctgg ccggaggccc catcggtaaa 1680 ttacgcaccg gggatttaat tgaaattaaa attgattgtc gcgagcttca cggcgaagtc 1740 aatttcctcg gaacccgtag cgatgaacaa ttaccttcac aggaggaggc aactgcaata 1800 ttaaatgcca gacccagcca tcaggattta cttcccgatc ctgaattgcc agatgatacc 1860 cggctatggg caatgcttca ggccgtgagt ggtgggacat ggaccggttg tatttatgat 1920 gtaaacaaaa ttggcgcggc tttgcgcgat tttatgaata aaaactga 1968 <210> 6 <211> 1968 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 dehydratase gene YagF <400> 6 atgaccattg agaaaatttt caccccgcag gacgacgcgt tttatgcggt gatcacccac 60 gcggcggggc cgcagggcgc tctgccgctg accccgcaga tgctgatgga atctcccagc 120 ggcaacctgt tcggcatgac gcagaacgcc gggatgggct gggacgccaa caagctcacc 180 ggcaaagagg tgctgattat cggcactcag ggcggcatcc gcgccggaga cggacgccca 240 atcgcgctgg gctaccacac cgggcattgg gagatcggca tgcagatgca ggcggcggcg 300 aaggagatca cccgcaatgg cgggatcccg ttcgcggcct tcgtcagcga tccgtgcgac 360 gt; atcgtgtttc gccgcctgat ccgctccctg ccgacgcggc gggcggtgat cggcgtagcg 480 acctgcgata aagggctgcc cgccaccatg attgcgctgg ccgcgatgca cgacctgccg 540 actattctgg tgccgggcgg ggcgacgctg ccgccgaccg tcggggaaga cgcgggcaag 600 gtgcagacca tcggcgcgcg tttcgccaac cacgaactct ccctgcagga ggccgccgaa 660 ctgggctgtc gcgcctgcgc ctcgccgggc ggcgggtgtc agttcctcgg cacggcgggc 720 acctcgcagg tggtcgcgga ggcgctgggt ctggcgctgc cgcactccgc gctggcgccg 780 tccgggcagg cggtgtggct ggagatcgcc cgccagtcgg cgcgcgcggt cagcgagctg 840 gatagccgcg gcatcaccac gcgggatatc ctctccgata aagccatcga aaacgcgatg 900 gtgatccacg cggcgttcgg cggctccacc aatttactgc tgcacattcc ggccatcgcc 960 ccgcggcgg gctgcacgat cccggacgtt gagcactgga cgcgcatcaa ccgtaaagtg 1020 ccgcgtctgg tgagcgtgct gcccaacggc ccggactatc acccgaccgt gcgcgccttc 1080 ctcgcgggcg gcgtgccgga ggtgatgctc cacctgcgcg acctcggcct gctgcatctg 1140 gcgccatga ccgtgaccgg ccagacggtg ggcgagaacc ttgaatggtg gcaggcgtcc 1200 gagcgccggg cgcgcttccg ccagtgcctg cgcgagcagg acggcgtaga gccggatgac 1260 gtgatcctgc cgccggagaa ggcaaaagcg aaagggctga cctcgacggt ctgcttcccg 1320 acgggcaaca tcgctccgga aggttcggtg atcaaggcca cggcgatcga cccgtcggtg 1380 gtgggcgaag atggcgtata ccaccacacc ggccgggtgc gggtgtttgt ctcggaagcg 1440 caggcgatca aggcgatcaa gcgggaagag attgtgcagg gcgatatcat ggtggtgatc 1500 ggcggcgggc cgtccggcac cggcatggaa gagacctacc agctcacctc cgcgctaaag 1560 catatctcgt ggggcaagac ggtgtcgctc atcaccgatg cgcgcttctc gggcgtgtcg 1620 acgggcgcct gcttcggcca cgtgtcgccg gaggcgctgg cgggcgggcc gattggcaag 1680 ctgcgcgata acgacatcat cgagattgcc gtggatcgtc tgacgttaac tggcagcgtg 1740 aacttcatcg gcaccgcgga caacccgctg acgccggaag agggcgcgcg cgagctggcg 1800 cggcggcaga cgcacccgga cctgcacgcc cacgactttt tgccggacga cacccggctg 1860 tgggcggcac tgcagtcggt gagcggcggc acctggaaag gctgtattta tgacaccgat 1920 aaaattatcg aggtaattaa cgccggtaaa aaagcgctcg gaatttaa 1968 <210> 7 <211> 1788 <212> DNA <213> Artificial Sequence <220> <223> Caulobacter crescentus CB15_codon optimized XylD dehydratase gene <400> 7 atgcgttctg cgctgtctaa ccgtaccccg cgtcgtttcc gttctcgtga ctggttcgac 60 aacccggacc acatcgacat gaccgcgctg tacctggaac gtttcatgaa ctacggtatc 120 accccggaag aactgcgttc tggtaaaccg atcatcggta tcgcgcagac cggttctgac 180 atctctccgt gcaaccgtat ccacctggac ctggttcagc gtgttcgtga cggtatccgt 240 gacgcgggtg gtatcccgat ggaattcccg gttcacccga tcttcgaaaa ctgccgtcgt 300 ccgaccgcgg cgctggaccg taacctgtct tacctgggtc tggttgaaac cctgcacggt 360 tacccgatcg acgcggttgt tctgaccacc ggttgcgaca aaaccacccc ggcgggtatc 420 atggcggcga ccaccgttaa catcccggcg atcgttctgt ctggtggtcc gatgctggac 480 ggttggcacg aaaacgaact ggttggttct ggtaccgtta tctggcgttc tcgtcgtaaa 540 ctggcggcgg gtgaaatcac cgaagaagaa ttcatcgacc gtgcggcgtc ttctgcgccg 600 tctgcgggtc actgcaacac catgggtacc gcgtctacca tgaacgcggt tgcggaagcg 660 ctgggtctgt ctctgaccgg ttgcgcggcg atcccggcgc cgtaccgtga acgtggtcag 720 atggcgtaca aaaccggtca gcgtatcgtt gacctggcgt acgacgacgt taaaccgctg 780 gacatcctga ccaaacaggc gttcgaaaac gcgatcgcgc tggttgcggc ggcgggtggt 840 tctaccaacg cgcagccgca catcgttgcg atggcgcgtc acgcgggtgt tgaaatcacc 900 gcggacgact ggcgtgcggc gtacgacatc ccgctgatcg ttaacatgca gccggcgggt 960 aaatacctgg gtgaacgttt ccaccgtgcg ggtggtgcgc cggcggttct gtgggaactg 1020 ctgcagcagg gtcgtctgca cggtgacgtt ctgaccgtta ccggtaaaac catgtctgaa 1080 aacctgcagg gtcgtgaaac ctctgaccgt gaagttatct tcccgtacca cgaaccgctg 1140 gcggaaaaag cgggtttcct ggttctgaaa ggtaacctgt tcgacttcgc gatcatgaaa 1200 tcttctgtta tcggtgaaga attccgtaaa cgttacctgt ctcagccggg tcaggaaggt 1260 gttttcgaag cgcgtgcgat cgttttcgac ggttctgacg actaccacaa acgtatcaac 1320 gacccggcgc tggaaatcga cgaacgttgc atcctggtta tccgtggtgc gggtccgatc 1380 ggttggccgg gttctgcgga agttgttaac atgcagccgc cggaccacct gctgaaaaaa 1440 ggtatcatgt ctctgccgac cctgggtgac ggtcgtcagt ctggtaccgc ggactctccg 1500 tctatcctga acgcgtctcc ggaatctgcg atcggtggtg gtctgtcttg gctgcgtacc 1560 ggtgacacca tccgtatcga cctgaacacc ggtcgttgcg acgcgctggt tgacgaagcg 1620 accatcgcgg cgcgtaaaca ggacggtatc ccggcggttc cggcgaccat gaccccgtgg 1680 cggaaatct accgtgcgca cgcgtctcag ctggacaccg gtggtgttct ggaattcgcg 1740 gttaaatacc aggacctggc ggcgaaactg ccgcgtcaca accactga 1788 <210> 8 <211> 906 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 aldolase gene YjhH <400> 8 tgacggaacc 60 cttgataaaa aggcaatgcg cgaagttgcc gacttcctga ttaataaagg ggtcgacggg 120 ctgttttatc tgggtaccgg tggtgaattt agccaaatga atacagccca gcgcatggca 180 ctcgccgaag aagctgtaac cattgtcgac gggcgagtgc cggtattgat tggcgtcggt 240 tccccttcca ctgacgaagc ggtcaaactg gcgcagcatg cgcaagccta cggcgctgat 300 ggtatcgtcg ccatcaaccc ctactactgg aaagtcgcac cacgaaatct tgacgactat 360 taccagcaga tcgcccgtag cgtcacccta ccggtgatcc tgtacaactt tccggatctg 420 acgggtcagg acttaacccc ggaaaccgtg acgcgtctgg ctctgcaaaa cgagaatatc 480 gttggcatca aagacaccat cgacagcgtt ggtcacttgc gtacgatgat caacacagtt 540 aagtcggtac gcccgtcgtt ttcggtattc tgcggttacg atgatcattt gctgaatacg 600 atgctgctgg gcggcgacgg tgcgataacc gccagcgcta actttgctcc ggaactctcc 660 gtcggcatct accgcgcctg gcgtgaaggc gatctggcga ccgctgcgac gctgaataaa 720 aaactactac aactgcccgc tatttacgcc ctcgaaacac cgtttgtctc actgatcaaa 780 tacagcatgc agtgtgtcgg gctgcctgta gagacatatt gcttaccacc gattcttgaa 840 gcatctgaag aagcaaaaga taaagtccac gtgctgctta ccgcgcaggg cattttacca 900 gtctga 906 <210> 9 <211> 930 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 aldolase gene YagE <400> 9 atgattcagc aaggagatct catgccgcag tccgcgttgt tcacgggaat cattccccct 60 gtctccacca tttttaccgc cgacggccag ctcgataagc cgggcaccgc cgcgctgatc 120 gacgatctga tcaaagcagg cgttgacggc ctgttcttcc tgggcagcgg tggcgagttc 180 tcccagctcg gcgccgaaga gcgtaaagcc attgcccgct ttgctatcga tcatgtcgat 240 cgtcgcgtgc cggtgctgat cggcaccggc ggcaccaacg cccgggaaac catcgaactc 300 agccagcacg cgcagcaggc gggcgcggac ggcatcgtgg tgatcaaccc ctactactgg 360 aaagtgtcgg aagcgaacct gatccgctat ttcgagcagg tggccgacag cgtcacgctg 420 ccggtgatgc tctataactt cccggcgctg accgggcagg atctgactcc ggcgctggtg 480 aaaaccctcg ccgactcgcg cagcaatatt atcggcatca aagacaccat cgactccgtc 540 gcccacctgc gcagcatgat ccataccgtc aaaggtgccc atccgcactt caccgtgctc 600 tgcggctacg acgatcatct gttcaatacc ctgctgctcg gcggcgacgg ggcgatatcg 660 gcgagcggca actttgcccc gcaggtgtcg gtgaatcttc tgaaagcctg gcgcgacggg 720 gacgtggcga aagcggccgg gtatcatcag accttgctgc aaattccgca gatgtatcag 780 ctggatacgc cgtttgtgaa cgtgattaaa gaggcgatcg tgctctgcgg tcgtcctgtc 840 tccacgcacg tgctgccgcc cgcctcgccg ctggacgagc cgcgcaaggc gcagctgaaa 900 accctgctgc aacagctcaa gctttgctga 930 <210> 10 <211> 1440 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 aldehyde dehydrogenase A gene AldA <400> 10 atgtcagtac ccgttcaaca tcctatgtat atcgatggac agtttgttac ctggcgtgga 60 gacgcatgga ttgatgtggt aaaccctgct acagaggctg tcatttcccg catacccgat 120 ggtcaggccg aggatgcccg taaggcaatc gatgcagcag aacgtgcaca accagaatgg 180 gaagcgttgc ctgctattga acgcgccagt tggttgcgca aaatctccgc cgggatccgc 240 gaacgcgcca gtgaaatcag tgcgctgatt gttgaagaag ggggcaagat ccagcagctg 300 gctgaagtcg aagtggcttt tactgccgac tatatcgatt acatggcgga gtgggcacgg 360 cgttacgagg gcgagattat tcaaagcgat cgtccaggag aaaatattct tttgtttaaa 420 cgtgcgcttg gtgtgactac cggcattctg ccgtggaact tcccgttctt cctcattgcc 480 cgcaaaatgg ctcccgctct tttgaccggt aataccatcg tcattaaacc tagtgaattt 540 acgccaaaca atgcgattgc attcgccaaa atcgtcgatg aaataggcct tccgcgcggc 600 gtgtttaacc ttgtactggg gcgtggtgaa accgttgggc aagaactggc gggtaaccca 660 aaggtcgcaa tggtcagtat gacaggcagc gtctctgcag gtgagaagat catggcgact 720 gcggcgaaaa acatcaccaa agtgtgtctg gaattggggg gtaaagcacc agctatcgta 780 atggacgatg ccgatcttga actggcagtc aaagccatcg ttgattcacg cgtcattaat 840 agtgggcaag tgtgtaactg tgcagaacgt gtttatgtac agaaaggcat ttatgatcag 900 ttcgtcaatc ggctgggtga agcgatgcag gcggttcaat ttggtaaccc cgctgaacgc 960 aacgacattg cgatggggcc gttgattaac gccgcggcgc tggaaagggt cgagcaaaaa 1020 gtggcgcgcg cagtagaaga aggggcgaga gtggcgttcg gtggcaaagc ggtagagggg 1080 aaaggatatt attatccgcc gacattgctg ctggatgttc gccaggaaat gtcgattatg 1140 catgaggaaa cctttggccc ggtgctgcca gttgtcgcat ttgacacgct ggaagatgct 1200 atctcaatgg ctaatgacag tgattacggc ctgacctcat caatctatac ccaaaatctg 1260 aacgtcgcga tgaaagccat taaagggctg aagtttggtg aaacttacat caaccgtgaa 1320 aacttcgaag ctatgcaagg cttccacgcc ggatggcgta aatccggtat tggcggcgca 1380 gatggtaaac atggcttgca tgaatatctg cagacccagg tggtttattt acagtcttaa 1440                                                                         1440 <210> 11 <211> 939 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 glyoxylate reductase gene YcdW <400> 11 atggatatca tcttttatca cccaacgttc gatacccaat ggtggattga ggcactgcgc 60 aaagctattc ctcaggcaag agtcagagca tggaaaagcg gagataatga ctctgctgat 120 tatgctttag tctggcatcc tcctgttgaa atgctggcag ggcgcgatct taaagcggtg 180 ttcgcactcg gggccggtgt tgattctatt ttgagcaagc tacaggcaca ccctgaaatg 240 ctgaaccctt ctgttccact ttttcgcctg gaagataccg gtatgggcga gcaaatgcag 300 gaatatgctg tcagtcaggt gctgcattgg tttcgacgtt ttgacgatta tcgcatccag 360 caaaatagtt cgcattggca accgctgcct gaatatcatc gggaagattt taccatcggc 420 attttgggcg caggcgtact gggcagtaaa gttgctcaga gtctgcaaac ctggcgcttt 480 ccgctgcgtt gctggagtcg aacccgtaaa tcgtggcctg gcgtgcaaag ctttgccgga 540 cgggaagaac tgtctgcatt tctgagccaa tgtcgggtat tgattaattt gttaccgaat 600 acccctgaaa ccgtcggcat tattaatcaa caattactcg aaaaattacc ggatggcgcg 660 tatctcctca acctggcgcg tggtgttcat gttgtggaag atgacctgct cgcggcgctg 720 gatagcggca aagttaaagg cgcaatgttg gatgttttta atcgtgaacc cttaccgcct 780 gaaagtccgc tctggcaaca tccacgcgtg acgataacac cacatgtcgc cgcgattacc 840 cgtcccgctg aagctgtgga gtacatttct cgcaccattg cccagctcga aaaaggggag 900 agggtctgcg ggcaagtcga ccgcgcacgc ggctactaa 939 <210> 12 <211> 1305 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 isocitrate lyase gene AceA <400> 12 atgaaaaccc gtacacaaca aattgaagaa ttacagaaag agtggactca accgcgttgg 60 gaaggcatta ctcgcccata cagtgcggaa gatgtggtga aattacgcgg ttcagtcaat 120 cctgaatgca cgctggcgca actgggcgca gcgaaaatgt ggcgtctgct gcacggtgag 180 tcgaaaaaag gctacatcaa cagcctcggc gcactgactg gcggtcaggc gctgcaacag 240 gcgaaagcgg gtattgaagc agtctatctg tcgggatggc aggtagcggc ggacgctaac 300 ctggcggcca gcatgtatcc ggatcagtcg ctctatccgg caaactcggt gccagctgtg 360 gtggagcgga tcaacaacac cttccgtcgt gccgatcaga tccaatggtc cgcgggcatt 420 gagccgggcg atccgcgcta tgtcgattac ttcctgccga tcgttgccga tgcggaagcc 480 gt; gcggcagttc acttcgaaga tcagctggcg tcagtgaaga aatgcggtca catgggcggc 600 aaagttttag tgccaactca ggaagctatt cagaaactgg tcgcggcgcg tctggcagct 660 gcgtgacgg gcgttccaac cctgctggtt gcccgtaccg atgctgatgc ggcggatctg 720 atcacctccg attgcgaccc gtatgacagc gaatttatta ccggcgagcg taccagtgaa 780 ggcttcttcc gtactcatgc gggcattgag caagcgatca gccgtggcct ggcgtatgcg 840 ccatatgctg acctggtctg gtgtgaaacc tccacgccgg atctggaact ggcgcgtcgc 900 tttgcacaag ctatccacgc gaaatatccg ggcaaactgc tggcttataa ctgctcgccg 960 tcgttcaact ggcagaaaaa cctcgacgac aaaactattg ccagcttcca gcagcagctg 1020 tcggatatgg gctacaagtt ccagttcatc accctggcag gtatccacag catgtggttc 1080 aacatgtttg acctggcaaa cgcctatgcc cagggcgagg gtatgaagca ctacgttgag 1140 aaagtgcagc agccggaatt tgccgccgcg aaagatggct ataccttcgt atctcaccag 1200 caggaagtgg gtacaggtta cttcgataaa gtgacgacta ttattcaggg cggcacgtct 1260 tcagtcaccg cgctgaccgg ctccactgaa gaatcgcagt tctaa 1305 <210> 13 <211> 1737 <212> DNA <213> Artificial Sequence <220> <223> Escherichia coli W3110 isocitrate dehydrogenase          kinase / phosphatase gene AceK <400> 13 atgccgcgtg gcctggaatt attgattgct caaaccattt tgcaaggctt cgatgctcag 60 tatggtcgat tcctcgaagt gacctccggt gcgcagcagc gtttcgaaca ggccgactgg 120 catgctgtcc agcaggcgat gaaaaaccgt atccatcttt acgatcatca cgttggtctg 180 gtcgtggagc aactgcgctg cattactaac ggccaaagta cggacgcggc atttttacta 240 cgtgttaaag agcattacac ccggctgttg ccggattacc cgcgcttcga gattgcggag 300 agctttttta actccgtgta ctgtcggtta tttgaccacc gctcgcttac tcccgagcgg 360 ctttttatct ttagctctca gccagagcgc cgctttcgta ccattccccg cccgctggcg 420 aaagactttc accccgatca cggctgggaa tctctactga tgcgcgttat cagcgaccta 480 ccgctgcgcc tgcgctggca gaataaaagc cgtgacatcc attacattat tcgccatctg 540 acggaaacgc tggggacaga caacctcgcg gaaagtcatt tacaggtggc gaacgaactg 600 ttttaccgca ataaagccgc ctggctggta ggcaaactga tcacaccttc cggcacattg 660 ccatttttgc tgccgatcca ccagacggac gacggcgagt tatttattga tacctgcctg 720 acgacgaccg ccgaagcgag cattgttttt ggctttgcgc gttcttattt tatggtttat 780 gcgccgctgc ccgcagcgct ggtcgagtgg ctacgggaaa ttctgccagg taaaaccacc 840 gctgaattgt atatggctat cggctgccag aagcacgcca aaaccgaaag ctaccgcgaa 900 tatctcgttt atctacaggg ctgtaatgag cagttcattg aagcgccggg tattcgtgga 960 atggtgatgt tggtgtttac gctgccgggc tttgatcggg tattcaaagt catcaaagac 1020 aggttcgcgc cgcagaaaga gatgtctgcc gctcacgttc gtgcctgcta tcaactggtg 1080 aaagagcacg atcgcgtggg ccgaatggcg gacacccagg agtttgaaaa ctttgtgctg 1140 gagaagcggc atatttcccc ggcattaatg gaattactgc ttcaggaagc agcggaaaaa 1200 atcaccgatc tcggcgaaca aattgtgatt cgccatcttt atattgagcg gcggatggtg 1260 ccgctcaata tctggctgga acaagtggaa ggtcagcagt tgcgcgacgc cattgaagaa 1320 tacggtaacg ctattcgcca gcttgccgct gctaacattt tccctggcga catgctgttt 1380 aaaaacttcg gtgtcacccg tcacgggcgt gtggtttttt atgattacga tgaaatttgc 1440 tacatgacgg aagtgaattt ccgcgacatc ccgccgccgc gctatccgga agacgaactt 1500 gccagcgaac cgtggtacag cgtctcgccg ggcgatgttt tcccggaaga gtttcgccac 1560 tggctatgcg ccgacccgcg tattggtccg ctgtttgaag agatgcacgc cgacctgttc 1620 cgcgctgatt actggcgcgc actacaaaac cgcatacgtg aagggcatgt ggaagatgtt 1680 tatgcgtatc ggcgcaggca aagatttagc gtacggtatg gggagatgct tttttga 1737 <210> 14 <211> 1170 <212> DNA <213> Artificial Sequence <220> <223> Methylococcus capsulatus codon optimized sucC-2 (Succinyl-CoA          ligase beta-subunit) gene <400> 14 atgaacatcc acgaatacca ggcgaaagaa ctgctgaaaa cctacggtgt tccggttccg 60 gacggtgcgg ttgcgtactc tgacgcgcag gcggcgtctg ttgcggaaga aatcggtggt 120 tctcgttggg ttgttaaagc gcagatccac gcgggtggtc gtggtaaagc gggtggtgtt 180 aaagttgcgc actctatcga agaagttcgt cagtacgcgg acgcgatgct gggttctcac 240 ctggttaccc accagaccgg tccgggtggt tctctggttc agcgtctgtg ggttgaacag 300 gcgtctcaca tcaaaaaaga atactacctg ggtttcgtta tcgaccgtgg taaccagcgt 360 atcaccctga tcgcgtcttc tgaaggtggt atggaaatcg aagaagttgc gaaagaaacc 420 ccggaaaaaa tcgttaaaga agttgttgac ccggcgatcg gtctgctgga cttccagtgc 480 cgtaaagttg cgaccgcgat cggtctgaaa ggtaaactga tgccgcaggc ggttcgtctg 540 atgaaagcga tctaccgttg catgcgtgac aaagacgcgc tgcaggcgga aatcaacccg 600 ctggcgatcg ttggtgaatc tgacgaatct ctgatggttc tggacgcgaa attcaacttc 660 gcgacaacg cgctgtaccg tcagcgtacc atcaccgaaa tgcgtgacct ggcggaagaa 720 gacccgaaag aagttgaagc gtctggtcac ggtctgaact acatcgcgct ggacggtaac 780 atcggttgca tcgttaacgg tgcgggtctg gcgatggcgt ctctggacgc gatcaccctg 840 cacggtggtc gtccggcgaa cttcctggac gttggtggtg gtgcgtctcc ggaaaaagtt 900 accaacgcgt gccgtatcgt tctggaagac ccgaacgttc gttgcatcct ggttaacatc 960 ttcgcgggta tcaaccgttg cgactggatc gcgaaaggtc tgatccaggc gtgcgactct 1020 ctgcagatca aagttccgct gatcgttcgt ctggcgggta ccaacgttga cgaaggtcgt 1080 aaaatcctgg cggaatctgg tctgtctttc atcaccgcgg aaaacctgga cgacgcggcg 1140 gcgaaagcgg ttgcgatcgt taaaggttaa 1170 <210> 15 <211> 903 <212> DNA <213> Artificial Sequence <220> <223> Methylococcus capsulatus codon optimized sucD-2 (Succinyl-CoA          ligase alpha-subunit) gene <400> 15 atgtctgttt tcgttaacaa acactctaaa gttatcttcc agggtttcac cggtgaacac 60 gcgaccttcc acgcgaaaga cgcgatgcgt atgggtaccc gtgttgttgg tggtgttacc 120 ccgggtaaag gtggtacccg tcacccggac ccggaactgg cgcacctgcc ggttttcgac 180 accgttgcgg aagcggttgc ggcgaccggt gcggacgttt ctgcggtttt cgttccgccg 240 ccgttcaacg cggacgcgct gatggaagcg atcgacgcgg gtatccgtgt tgcggttacc 300 atcgcggacg gtatcccggt tcacgacatg atccgtctgc agcgttaccg tgttggtaaa 360 gactctatcg ttatcggtcc gaacaccccg ggtatcatca ccccgggtga atgcaaagtt 420 ggtatcatgc cgtctcacat ctacaaaaaa ggtaacgttg gtatcgtttc tcgttctggt 480 accctgaact acgaagcgac cgaacagatg gcggcgctgg gtctgggtat caccacctct 540 gttggtatcg gtggtgaccc gatcaacggt accgacttcg ttaccgttct gcgtgcgttc 600 gaagcggacc cggaaaccga aatcgttgtt atgatcggtg aaatcggtgg tccgcaggaa 660 gttgcggcgg cgcgttgggc gaaagaaaac atgaccaaac cggttatcgg tttcgttgcg 720 ggtctggcgg cgccgaccgg tcgtcgtatg ggtcacgcgg gtgcgatcat ctcttctgaa 780 gcggacaccg cgggtgcgaa aatggacgcg atggaagcgc tgggtctgta cgttgcgcgt 840 aacccggcgc agatcggtca gaccgttctg cgtgcggcgc aggaacacgg tatccgtttc 900 tga 903 <210> 16 <211> 957 <212> DNA <213> Artificial Sequence <220> <223> Rhodobacter spaeroides codon optimized mcl-1 (malyl-CoA lyase)          gene <400> 16 atgtctttcc gtctgcagcc ggcgccgccg gcgcgtccga accgttgcca gctgttcggt 60 ccgggttctc gtccggcgct gttcgaaaaa atggcggcgt ctgcggcgga cgttatcaac 120 ctggacctgg aagactctgt tgcgccggac gacaaagcgc aggcgcgtgc gaacatcatc 180 gaagcgatca acggtctgga ctggggtcgt aaatacctgt ctgttcgtat caacggtctg 240 gacaccccgt tctggtaccg tgacgttgtt gacctgctgg aacaggcggg tgaccgtctg 300 tgacgcggg gttaccgcga tcgaacgtgc gaaaggtcgt accaaaccgc tgtctttcga agttatcatc 420 gaatctgcgg cgggtatcgc gcacgttgaa gaaatcgcgg cgtcttctcc gcgtctgcag 480 gcgatgtctc tgggtgcggc ggacttcgcg gcgtctatgg gtatgcagac caccggtatc 540 ggtggtaccc aggaaaacta ctacatgctg cacgacggtc agaaacactg gtctgacccg 600 tggcactggg cgcaggcggc gatcgttgcg gcgtgccgta cccacggtat cctgccggtt 660 gcggtccgt tcggtgactt ctctgacgac gaaggtttcc gtgcgcaggc gcgtcgttct 720 gcgaccctgg gtatggttgg taaatgggcg atccacccga aacaggttgc gctggcgaac 780 gaagttttca ccccgtctga aaccgcggtt accgaagcgc gtgaaatcct ggcggcgatg 840 gacgcggcga aagcgcgtgg tgaaggtgcg accgtttaca aaggtcgtct ggttgacatc 900 gcgtctatca aacaggcgga agttatcgtt cgtcaggcgg aaatgatctc tgcgtga 957 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> cc-xdh-F <400> 17 cggtcatatg tcttctgcga tctacccg 28 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> cc-xdH-R <400> 18 ctttctcgag tcaacgccaa cccgc 25 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> cc-xylD-F <400> 19 ctgtcatatg cgttctgcgc tgtctaac 28 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> cc-xylD-R <400> 20 cgttctcgag tcagtggttg tgacgc 26 <210> 21 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> yjHG-F <400> 21 ggggcatatg tctgttcgca atatttttg 29 <210> 22 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> yjHG-R <400> 22 cgccctcgag tcagttttta ttcataaaat cgc 33 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> yagF-F <400> 23 cccgcatatg accattgaga aaatt 25 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> YAGF-R <400> 24 ctctctcgag ttaaattccg agcgc 25 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> yjHH-F <400> 25 cccgcatatg aaaaaattca gcggcatta 29 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> yjHH-R <400> 26 ctctctcgag ttctcctcag actggtaa 28 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> yagE-F <400> 27 ctcgcatatg attcagcaag gagatc 26 <210> 28 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> yagE-R <400> 28 ctctctcgag tcagcaaagc ttgagctg 28 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ycdW-F <400> 29 cccgcatatg gatatcatct tttatcaccc 30 <210> 30 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ycdW-R <400> 30 ctttctcgag ttagtagccg cgtgcgc 27 <210> 31 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> aceA-F <400> 31 ccaacaattg gatgaaaacc cgtacacaac 30 <210> 32 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> aceA-R <400> 32 ctttctcgag ttagaactgc gattcttcag 30 <210> 33 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> AceK-F <400> 33 aaaacatatg ccgcgtggcc tggaat 26 <210> 34 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> AceK-R <400> 34 aaaactcgag tcaaaaaagc atctccccat ac 32 <210> 35 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> aldA-F <400> 35 ccaccatatg tcagtacccg ttcaacatc 29 <210> 36 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> aldA-R <400> 36 ccccctcgag ttaagactgt aaataaacca c 31 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> mCl-F <400> 37 ccaacatatg tctttccgtc tgca 24 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> μC1-R <400> 38 caacctcgag tcacgcagag atcattt 27 <210> 39 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> sucC-2-F <400> 39 ccaacatatg aacatccacg aataccagg 29 <210> 40 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> sucC-2-R <400> 40 caacctcgag ttaaccttta acgatcgcaa c 31 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sucD-2-F <400> 41 cccccatatg tctgttttcg ttaa 24 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sucD-2-R <400> 42 caaactcgag tcagaaacgg atacc 25 <210> 43 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> GlcD-KO-F <400> 43 gctggaaaaa ggtgtgttgt tggtgatggc gcgctttaaa catatgaata tcctccttag 60 t 61 <210> 44 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> GlcD-KO-R <400> 44 aaatcatatt gctgcgataa acgggcaatg ccttccagta gtgtaggctg gagctgcttc 60 g 61 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GlcD-Ver-F <400> 45 atgagcatct tgtacgaaga 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GlcD-Ver-R <400> 46 ttcagggaaa ggtaaatgac 20 <210> 47 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> glcB-KO-F <400> 47 ttctctgcac ggacgctcgc tgctgtttat ccgcaacgtg catatgaata tcctccttag 60 t 61 <210> 48 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> GlcB-KO-R <400> 48 ttcaaattca gcattgaact cggtctgggc aatgttggct gtgtaggctg gagctgcttc 60 g 61 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GlcB-Ver-F <400> 49 cgcacatcaa cgatgttatc 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GlcB-Ver-R <400> 50 gccacattgt gaatatccgg 20 <210> 51 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> aceB-KO-F <400> 51 tcactggcac cagactggaa caaagtgatc gacgggcaaa catatgaata tcctccttag 60 t 61 <210> 52 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> aceB-KO-R <400> 52 accgttattg gcttccagcg atttatccgc ttttactttg gtgtaggctg gagctgcttc 60 g 61 <210> 53 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> aceB-Ver-F <400> 53 gaaacagctt ccattcgcg 19 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aceB-Ver-R <400> 54 gtaatcggcg cgtcttgttc 20 <210> 55 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> YAG F-His-F <400> 55 cccctcgaga accattgaga aaatt 25 <210> 56 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> YAG F-His-R <400> 56 cccaagctta attccgagcg ctttttt 27 <210> 57 <211> 1053 <212> DNA <213> Artificial Sequence <220> <223> glycolate oxidase glcE gene <400> 57 atgctacgcg agtgtgatta cagccaggcg ctgctggagc aggtgaatca ggcgattagc 60 gataaaacgc cgctggtgat tcagggcagc aatagcaaag cctttttagg tcgccctgtc 120 accgggcaaa cgctggatgt tcgttgtcat cgcggcattg ttaattacga cccgaccgag 180 ctggtgataa ccgcgcgtgt cggaacgccg ctggtgacaa ttgaagcggc gctggaaagc 240 gcggggcaaa tgctcccctg tgagccgccg cattatggtg aagaagccac ctggggcggg 300 atggtcgcct gcgggctggc ggggccgcgt cgcccgtgga gcggttcggt ccgcgatttt 360 gtcctcggca cgcgcatcat taccggcgct ggaaaacatc tgcgttttgg tggcgaagtg 420 atgaaaaacg ttgccggata cgatctctca cggttaatgg tcggaagcta cggttgtctt 480 ggcgtgctca ctgaaatctc aatgaaagtg ttaccgcgac cgcgcgcctc cctgagcctg 540 cgtcgggaaa tcagcctgca agaagccatg agtgaaatcg ccgagtggca actccagcca 600 ttacccatta gtggcttatg ttacttcgac aatgcgttgt ggatccgcct tgagggcggc 660 gaaggatcgg taaaagcagc gcgtgaactg ctgggtggcg aagaggttgc cggtcagttc 720 tggcagcaat tgcgtgaaca acaactgccg ttcttctcgt taccaggtac cttatggcgc 780 atttcattac ccagtgatgc gccgatgatg gatttacccg gcgagcaact gatcgactgg 840 ggcggggcgt tacgctggct gaaatcgaca gccgaggaca atcaaatcca tcgcatcgcc 900 cgcaacgctg gcggtcatgc gacccgcttt agtgccggag atggtggctt tgccccgcta 960 tcggctcctt tattccgcta tcaccagcag cttaaacagc agctcgaccc ttgcggcgtg 1020 tttaaccccg gtcgcatgta cgcggaactt tga 1053 <210> 58 <211> 1224 <212> DNA <213> Artificial Sequence <220> <223> glycolate oxidase glcF gene <400> 58 atgcaaaccc aattaactga agagatgcgg cagaacgcgc gcgcgctgga agccgacagc 60 atcctgcgcg cctgtgttca ctgcggattt tgtaccgcaa cctgcccaac ctatcagctt 120 ctgggcgatg aactggacgg gccgcgcggg cgcatctatc tgattaaaca ggtgctggaa 180 ggcaacgaag tcacgcttaa aacacaggag catctcgatc gctgcctcac ttgccgtaat 240 tgtgaaacca cctgtccttc tggtgtgcgc tatcacaatt tgctggatat cgggcgtgat 300 attgtcgagc agaaagtgaa acgcccactg ccggagcgaa tactgcgcga aggattgcgc 360 caggtagtgc cgcgtccggc ggtcttccgt gcgctgacgc aggtagggct ggtgctgcga 420 ccgtttttac cggaacaggt cagagcaaaa ctgcctgctg aaacggtgaa agctaaaccg 480 cgtccgccgc tgcgccataa gcgtcgggtt ttaatgttgg aaggctgcgc ccagcctacg 540 ctttcgccca acaccaacgc ggcaactgcg cgagtgctgg atcgtctggg gatcagcgtc 600 atgccagcta acgaagcagg ctgttgtggc gcggtggact atcatcttaa tgcgcaggag 660 aaagggctgg cacgggcgcg caataatatt gatgcctggt ggcccgcgat tgaagcaggt 720 gccgaggcaa ttttgcaaac cgccagcggc tgcggcgcgt ttgtcaaaga gtatgggcag 780 atgggggg atatgccgat aaagcacgtc aggtcagtga actggcggtc 840 gatttagtcg aacttctgcg cgaggaaccg ctggaaaaac tggcaattcg cggcgataaa 900 aagctggcct tccactgtcc gtgtacccta caacatgcgc aaaagctgaa cggcgaagtg 960 gaaaaagtgt tgcttcgtct tggatttacc ttaacggacg ttcccgacag ccatctgtgc 1020 tgcggttcag cgggaacata tgcgttaacg catcccgatc tggcacgcca gctgcgggat 1080 aacaaaatga atgcgctgga aagcggcaaa ccggaaatga tcgtcaccgc caacattggt 1140 tgccagacgc atctggcgag cgccggtcgt acctctgtgc gtcactggat tgaaattgta 1200 gaacaagccc ttgaaaagga ataa 1224 <210> 59 <211> 405 <212> DNA <213> Artificial Sequence <220> <223> glycolate oxidase glcG gene <400> 59 atgaaaacta aagtcattct tagccagcaa atggcgagtg caattattgc cgcaggtcag 60 gaagaggcgc agaaaaataa ctggtctgtt tccattgctg ttgccgatga cggcggtcat 120 ctgctggcgt taagtcgcat ggacgattgc gcgccgattg cggcttatat ctcccaggag 180 aaagcgcgta ccgccgcgct ggggcgtcgt gaaactaagg gctatgaaga gatggtgaac 240 aacggacgta ccgcgttcgt gactgcgccg ttattaacgt cgctggaagg cggcgtaccg 300 gttgttgtgg atgggcaaat tattggtgcc gtgggcgttt ctggtttaac cggagcacag 360 gatgcgcagg tcgcgaaagc ggcagcagcg gtgttggcga aataa 405

Claims (14)

Knocking out the xylose isomerase gene xylA and the xylulokinase gene xylB in E. coli (step a);
Knocking out the glycolic acid oxidase gene glcD in E. coli of step a (step b); And
A method for producing a transformed Escherichia coli having a glycolic acid producing ability, comprising the step of transforming Escherichia coli of step (b) using an expression vector containing xylose dehydrogenase gene xdh .
The method according to claim 1,
Wherein the xylose isomerase gene xylA comprises the nucleotide sequence of SEQ ID NO: 1. 2. A method for producing a transformed E. coli having a glycolic acid-producing ability.
The method according to claim 1,
Wherein the xylulokinase gene xylB is a nucleotide sequence of SEQ ID NO: 2.
The method according to claim 1,
Wherein the glycolic acid oxidase gene glcD is composed of the nucleotide sequence of SEQ ID NO: 3.
The method according to claim 1,
The xylose dehydrogenase gene xdh is expressed by Caulobacter &lt; RTI ID = 0.0 &gt; wherein the nucleotide sequence of SEQ ID NO: 4 is derived from crescentus , and the nucleotide sequence is SEQ ID NO: 4.
The method according to claim 1,
The expression vector of step c)
Xylonic acid dehydratase gene yjhG , xylonic acid dehydratase gene yagF , xylonic acid dehydratase gene xylD , 2,3-keto- xylonic acid aldolase dehydratase (2,3-keto xylonate aldolase) gene yjhH, 2,3- xylylene keto acid aldolase (2,3-keto xylonate aldolase) gene yagE, lactic aldehyde dehydrogenase (lactaldehyde dehydrogenase) gene aldA, glycidyl Glyoxylate reductase gene ycdW , isocitrate lyase gene aceA , isocitrate dehydrogenase kinase / phosphatase gene aceK , malate thiokinase gene sucC - 2, thio malic acid kinase (malate thiokinase) -2 sucD gene and dry -CoA lyase (malyl-CoA lyase) is selected from the group consisting of gene mcl -1 Method of producing a transformed E. coli having a glycolic acid-producing ability, which is characterized in that it further comprises or more.
The method of claim 6,
Wherein the genes contained in the expression vector are each composed of a nucleotide sequence represented by SEQ ID NOS: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, A method for producing a transformed Escherichia coli having a glycolic acid producing ability.
The method according to claim 1,
The expression vector of step c)
The xylose dehydratase gene yagF , the 2,3-keto xylonic acid aldolase gene yagE , the lactaldehyde dehydrogenase gene aldA , the glyoxylic acid reductase gene ycdW , the isocitrate lyase gene aceA and the isocitrate dihydrogenase A method for producing a transformed Escherichia coli having a glycolic acid producing ability, characterized by comprising a combination of an azekinase / phosphatase gene aceK .
The method according to claim 1,
Wherein the Escherichia coli is E. coli W3110 (DE3).
A xylose isomerase gene xylA , a xylulose kinase gene xylB And A transformed Escherichia coli having a glycolic acid producing ability, wherein Escherichia coli knocked out with the glycolic acid oxidase gene glcD is transformed with an expression vector containing xylose dehydrogenase gene xdh .
The method of claim 10,
The expression vector may include,
The xylonic acid dihydratase gene yjhG , the xylonic acid dihydratase gene yagF , the xylonic acid dihydratase gene xylD , the 2,3- ketojylonic acid aldolase gene yjhH , the 2,3-keto xylonic acid aldolase Gene yagE , a lactaldehyde dehydrogenase gene aldA , a glyoxylic acid reductase gene ycdW , an isocitrate lyase gene aceA , an isocitrate dihydrogenase / kinase / phosphatase gene aceK , a malonic acid thiokinase gene sucC -2 , a malonic acid thiokinase gene sucD- 2 and a malic - CoA lyase gene mcl - 1 , which is capable of producing a glycolic acid-producing E. coli.
A xylose isomerase gene xylA , a xylulose kinase gene xylB And E. coli knocking out the glycolic acid oxidase gene glcD ,
The xylose dehydrogenase gene xdh , the xylonic acid dihydratase gene yagF , the 2,3-keto- xylonic acid aldolase gene yagE , the lactaldehyde dehydrogenase gene aldA , the glyoxylic acid reductase gene ycdW , the isocitric acid Transformed Escherichia coli having the ability to produce glycolic acid, which is transformed with an expression vector comprising the degrading enzyme gene aceA and the isocitrate dihydrogenase kinase / phosphatase gene aceK .
A xylose isomerase gene xylA , a xylulose kinase gene xylB And E. coli knocking out the glycolic acid oxidase gene glcD ,
A gene including xylose dehydrogenase gene xdh , xylonic acid dihydratase gene yagF , 2,3-keto- xylonic acid aldolase gene yagE , lactaldehyde dehydrogenase gene aldA, and glyoxylic acid reductase gene ycdW A transformed E. coli having the ability to produce a glycolic acid, which is transformed with a second expression vector comprising a first expression vector, an isocitrate synthase gene aceA and an isocitrate dihydrogenase / kinase / phosphatase gene aceK .
A xylose isomerase gene xylA , a xylulose kinase gene xylB And Culturing the Escherichia coli transformed with the expression vector containing the xylose dehydrogenase gene xdh in a culture medium containing xylose (step 1), wherein the glycolic acid oxidase gene glcD is knocked out and cultured; And
(Step 2) of obtaining a glycolic acid from the culture cultured in step 1.

Images