KR20180098513A - Method for treating surface of Titanium implant - Google Patents

Abstract

The present invention relates to a method for treating the surface of a titanium implant, and more specifically, to a manufacturing method in which the surface of a titanium implant is treated by an anodic oxidation process to form a TiO_2 nanotube, thereby enhancing adhesive ability of osteoblasts as well as inhibiting attachment of bacteria such as streptococcus mutans and porphyromonas gingivalis. According to the manufacturing method of the present invention, the surface of a titanium implant is treated by using an anodic oxidation process to form a TiO_2 nanotube, and treated by heat treatment and/or plasma at room temperature under an atmosphere, thereby enhancing adhesive ability of osteoblasts as well as inhibiting attachment of bacteria such as streptococcus mutans and porphyromonas gingivalis.

Description

[0001] The present invention relates to a method for treating a titanium implant,

The present invention relates to a surface treatment method of titanium implants, and more particularly, to a method of surface treatment of titanium implants by forming and treating TiO ₂ nanotubes with an anodization process on a surface of a titanium implant, thereby producing Streptococcus mutans and Porphyromonas (Porphyromonas gingivalis) bacteria. The present invention also relates to a method for producing the osteoblast.

Titanium is widely used as a material for dental and orthopedic implants due to its excellent mechanical properties, biocompatibility and osseointegration. Adhesion between biomaterials and surrounding tissues is very important for the long-term success of implants. However, when the implanted implant is exposed in the oral cavity, a colony of bacteria that induces periodontitis is formed within 2 weeks, and the gingival flap is completed within 4 weeks, which may lead to implant failure.

Implant periitis is an inflammation similar to periodontitis caused by a biofilm on the surface of an implant. The bacterial membrane is composed of various bacterial flies, and the saliva protein attaches to the surface to form an acquired pellicle.

Streptococcus mutans is a gram-positive organism that is commonly found in the mouth and has ciliates, which are easier to adhere to tooth surfaces and tissues than other bacteria, forming an initial bacterial membrane. The bacterial membrane formed by Streptococcus mutans accumulates to the bottom of the gingiva and interacts to induce bacterial adhesion such as Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, and Fusobacterium nucleatum called 'red complex' to facilitate late community formation. Among these, Porphyromonas gingivalis is a Gram-negative bacterium that is frequently found in periodontal disease patients with periodontal disease and can be observed in the union site where the implant periostitis progresses. Porphyromonas jinzi varis penetrates into various tissues or cells of the host and proliferates, so attachment of porphyromonas jinji valis in the mouth can lead to pathogenicity.

Unlike natural teeth, implants do not have blood vessels and nervous tissues, so the probability of bone tissue damage is high without feeling any special symptoms. When this inflammation spreads to the bone tissue, bone loss occurs. Therefore, inhibiting the formation of bacterial membranes on the implant surface is very important for implant maintenance.

Methods of treating peri-implantitis include mechanical removal and disinfection, and antibiotic therapy. Treatment with sterilization and antibiotics is limited in the treatment of peri-implantitis, and there is a limit to the necessity of mechanically removing the bacterial membrane attached to the surface. In addition, since the mechanical removal treatment is highly likely to damage the surface of the implant, it is difficult to use a specialized device that minimizes damage to the implant surface such as carbon fiber curette.

Therefore, it is required to develop a more effective treatment method of peri-implantitis.

Registered Patent No. 10-1252767 (Registered on April 03, 2013)

The present inventors have made efforts to solve all the disadvantages and problems of the prior art as described above, and as a result, the inventors have completed the present invention by forming and treating TiO ₂ nanotubes on the surface of a titanium implant using an anodization process.

Accordingly, an object of the present invention is to provide a titanium implant surface capable of inhibiting the increase of adhesion of Streptococcus mutans and Porphyromonas gingivalis bacteria and improving the adhesion ability of osteoblasts, And to provide a processing method.

The objects of the present invention are not limited to the above-mentioned objects, and other objects not mentioned can be clearly understood by those skilled in the art from the following description.

According to an aspect of the present invention, there is provided a method of manufacturing a titanium implant, comprising: preparing a titanium implant; Forming TiO ₂ nanotubes on the surface of the titanium implant using an anodizing process; And thermally treating the surface of the titanium implant having the TiO ₂ nanotubes formed thereon.

Preferably an increase in Streptococcus mutans bacterial adhesion, and the titanium implant may be a titanium implant contaminated with Streptococcus mutans bacteria.

Preferably, the step of forming the TiO ₂ nanotubes on the surface of the titanium implant using the anodic oxidation process comprises adding 1 M phosphoric acid (H ₃ PO ₄ ) and 1.5 wt% hydrofluoric acid (HF) to distilled water A titanium platinum sample and a platinum plate having an electrode connected to an electrolyte are immersed and an anodic oxidation is performed for 10 minutes by applying a voltage of 20 V to form a porous amorphous TiO ₂ nanotube on the surface of the titanium implant.

Preferably, the heat treatment is performed in a sintering furnace. The temperature is raised to a predetermined temperature in a range of 300 to 700 ° C at a rate of 1 ° C / min in an air atmosphere, maintained at that temperature for 1 hour, .

The present invention has the following excellent effects.

According to the manufacturing method of the present invention, TiO ₂ nanotubes are formed on the surface of a titanium implant using an anodizing process and treated by heat treatment and / or atmospheric pressure at room temperature to produce Streptococcus mutans and / Porphyromonas gingivalis inhibits the attachment of bacteria and improves the adhesion of osteoblasts.

According to the manufacturing method of the present invention, the surface of the titanium implant contaminated with Streptococcus mutans and / or Porphyromonas jinx valis bacteria can be treated to produce Streptococcus mutans and / or Porphyromonas jinx valis bacteria It is possible to prevent the increase of the adhesion of the osteoblast and improve the adhesion ability of the osteoblast.

1 is a graph showing XRD analysis results of anodized TiO ₂ nanotube specimens before and after heat treatment.
2 is a graph showing XPS analysis results of the surface of a TiO ₂ nanotube.
3 is a graph showing the atomic percentages of the respective elements of the TiO ₂ nanotube surface.
FIG. 4 is a graph showing the value of crystal violet for the experiment of adhesion of Streptococcus mutans bacteria according to the heat treatment.
FIG. 5 is a graph showing the value of crystal violet for the experiment of adhesion of Streptococcus mutans bacteria according to the plasma treatment.
FIG. 6 is a graph showing the value of crystal violet for the adhesion test of Porphyromonas gingivalis bacteria according to the heat treatment.
Fig. 7 is a graph showing the value of crystal violet for an experiment of adhesion of Porphyromonas jinx valis bacteria by plasma treatment.
8 is a scanning electron micrograph showing the degree of adhesion of osteoblasts.
Fig. 9 is a graph showing the results of evaluation of osteoblast proliferation (two days culture, heat treatment).
FIG. 10 is a graph showing the results for evaluation of osteoblast proliferation (2 days culture, plasma treatment).
Fig. 11 is a graph showing the results of evaluation of osteoblast proliferation (4 days culture, heat treatment).
FIG. 12 is a graph showing the results for the evaluation of osteoblast proliferation (4 days culture, plasma treatment).
FIGS. 13 to 15 are graphs showing results of osteogenic gene expression (heat treatment) related to osteoblast differentiation.
FIGS. 16 to 18 are graphs showing results of osteoblast differentiation-related bone morphogenetic gene expression (plasma treatment).

Although the terms used in the present invention have been selected as general terms that are widely used at present, there are some terms selected arbitrarily by the applicant in a specific case. In this case, the meaning described or used in the detailed description part of the invention The meaning must be grasped.

Hereinafter, the technical structure of the present invention will be described in detail with reference to the accompanying drawings and preferred embodiments.

However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Like reference numerals used to describe the present invention throughout the specification denote like elements.

First, the present invention is that the technical characterized in that in processing the surface of the titanium implant, forming the TiO ₂ nanotubes to the surface of the titanium implant using the anodizing process, and surface treatment using a heat treatment and / or atmospheric pressure plasma have.

Accordingly, a surface treatment method of a titanium implant according to an embodiment of the present invention includes the steps of preparing a titanium implant, forming a TiO ₂ nanotube on the surface of the titanium implant using an anodization process, and forming a TiO ₂ nanotube Treating the surface of the titanium implant on which the Streptococcus mutans bacteria are formed, and preventing the increase of Streptococcus mutans bacterial adhesion. At this time, the titanium implant may be a titanium implant contaminated with Streptococcus mutans bacteria.

According to another aspect of the present invention, there is provided a method of surface treating a titanium implant, comprising the steps of preparing a titanium implant, forming an TiO ₂ nanotube on the surface of the titanium implant using an anodization process, And treating the surface of the titanium implant on which the TiO ₂ nanotubes have been formed to prevent the increase of bacterial adhesion of Porphyromonas gingivalis and improve the adhesion ability of osteoblasts . At this time, the titanium implant may be a titanium implant contaminated with Porphyromonas gingivalis bacteria.

Further, the method for surface treatment of a titanium implant according to another embodiment of the present invention to form a step and, TiO ₂ nano-tubes on the surface of the titanium implant by using the anodizing process to prepare the titanium implant, TiO ₂ Treating the surface of the titanium implant on which the nanotube is formed, and treating the surface of the titanium implant heat-treated with the atmospheric plasma, wherein the Streptococcus mutans bacterium and the porphyromonas jinji valley (Porphyromonas gingivalis) bacteria, and enhances the adhesion of osteoblasts. At this time, the titanium implant may be a titanium implant contaminated with Streptococcus mutans bacteria and Porphyromonas gingivalis bacteria.

That is, all of the surface treatment methods of the titanium implant according to the embodiment of the present invention use the anodic oxidation process to form the TiO ₂ nanotube on the surface of the titanium implant, and then treat the surface.

The anodic oxidation process is a method of electrochemically forming a thin and coarse porous amorphous TiO ₂ oxide film on the surface of the titanium implant. The formation of amorphous TiO ₂ nanotubes on the surface of titanium implants by the anodic oxidation process improves the surface area to improve the adhesion, proliferation and differentiation rate of the surrounding bone to improve the bonding strength between the surrounding bone and the implant, .

The step of forming the TiO ₂ nanotubes on the surface of the titanium implant using the anodic oxidation process may be performed by adding 1 M phosphoric acid (H ₃ PO ₄ ) and 1.5 wt% hydrofluoric acid (HF) to the electrolytic solution A titanium implant sample to which electrodes are connected and a platinum plate are immersed and anodic oxidation is performed for 10 minutes by applying a voltage of 20 V to form a porous amorphous TiO ₂ nanotube on the surface of the titanium implant.

The heat treatment changes the crystal structure of the TiO ₂ nanotubes formed on the titanium surface to inhibit the adhesion of the bacteria without inhibiting the cell activity. Through the heat treatment process, the TiO ₂ nanotube forms an anatase or rutile crystal structure.

The heat treatment process is performed in a sintering furnace. The temperature of the heat treatment process is raised to a predetermined temperature in a range of 300 to 700 ° C at a rate of 1 ° C / min in an air atmosphere, followed by maintaining the temperature for 1 hour, followed by cooling.

Atmospheric plasma was applied to TiO ₂ nanotubes to change the surface energy and hydrophilicity of the titanium implant.

The atmospheric pressure plasma is generated using a room temperature atmospheric pressure plasma generator. The atmospheric pressure plasma treatment may be performed for a predetermined time ranging from 60 to 150 sec to improve the adhesion ability of osteoblasts. As described later, if the atmospheric pressure plasma treatment is performed within 60 seconds, the adhesion ability of the osteoblast is not improved. If the atmospheric pressure plasma treatment is performed for more than 150 seconds, the osteoblast adhesion ability is improved, but the porphyromonas gingivalis bacterium It is preferable to perform the atmospheric plasma treatment within the above range.

The atmospheric-pressure plasma generator uses a mixed gas of 99% argon and 1% oxygen and generates plasma at a rate of 10 L / min at a power of 300 W to generate plasma on the surface of the titanium implant.

As described above, in the surface treatment method of the titanium implant according to the embodiment of the present invention, the TiO ₂ nanotube is formed on the surface of the titanium implant using the anodic oxidation process, the surface treatment is performed using the atmospheric pressure plasma , It is possible to prevent the increase of adhesion of Streptococcus mutans bacteria and Porphyromonas gingivalis bacteria and improve the adhesion ability of osteoblasts.

Example 1

Ⅰ. Materials Preparation and Experimental Methods

1. Preparation of Titanium Specimen

Pure titanium for commercial use (ASTM Grade Ⅳ, Kobe Steel, Kobe, Japan)

15 mm in thickness and 3 mm in thickness. The prepared specimens were wet-polished using # 600 SiC abrasive paper in a polishing machine (Labopol-5, Struers, Denmark). After polishing, all specimens were ultrasonically cleaned with acetone, ethanol and distilled water for 15 minutes to remove residual organics and impurities on the surface.

2. Experimental Method

Classification of experimental group (heat treatment)

The experimental groups were divided into three groups according to the heat treatment conditions: H0 (not heat treated), H400

H600 (heat treatment at 600 占 폚)].

Experimental classification (plasma)

Experimental groups were divided into 6 groups according to plasma application [before plasma: H0, H40, H600 / after plasma: H0P, H400P, H600P].

Anodic oxidation process

Anodic oxidation was performed using a DC power supplier (Fine Power F-3005, SG EMD, Korea). The electrolytic solution was prepared by adding 1 M phosphoric acid (H ₃ PO ₄ ) and 1.5 wt% hydrofluoric acid (HF) to distilled water. A titanium specimen was connected to the anode, and a platinum plate (3 mm x 4 mm x 0.1 mm) was connected to the cathode. The specimen and the platinum plate were spaced apart by about 10 mm. The specimen and the platinum plate to which the electrodes were connected were immersed in the electrolytic solution, and an anodic oxidation was performed for 10 minutes by applying a voltage of 20 V after 1 minute. After 10 minutes, the specimens were taken out of the electrolytic solution, washed in flowing water for about 20 minutes, immersed in distilled water for 30 minutes, and then dried.

Heat treatment process

The heat treatment was carried out using a reclaiming furnace (IDS Plus Ex6000 Sintering Furnace, JG Co., Korea). The temperature was raised to 400 ° C and 600 ° C in an atmospheric environment at a rate of 1 ° C / min, respectively, and then the temperature was maintained for 1 hour, followed by cooling. After the heat treatment, the specimens were ultrasonically washed with alcohol and distilled water for 20 minutes, respectively, and dried.

Plasma treatment

Plasma irradiation was performed using an atmospheric pressure plasma generator (PGS-200 Plasma generator, Expantech Co, Korea). The gas was mixed with Ar ₂ (99%) / O ₂ (1%) and applied at a rate of 10 L / min at a power of 300 W. The distance between the flame of the atmospheric plasma and the specimen was maintained at 5 mm. The specimen was rotated at 180 rpm, and the flame of the plasma was moved to the left and right so that atmospheric pressure plasma could be uniformly applied to the specimen. Plasma was applied for 120 seconds by setting it to reciprocate 10 times per 12 seconds. The parameters of the atmospheric pressure plasma generator used in the embodiment of the present invention are shown in Table 1 below.

Parameter Value Average working power (W) 300 Voltage (V) 27 Frequency (MHz) 900 Atmospheric pressure (Torr) 760 Electrode type Electrodeless Cooling type Air cooled Plasma density 10 ¹⁵ / cm ³

3. Evaluation of surface characteristics

Contact angle

* Contact angle measurements were performed to compare the changes in hydrophilicity of surfaces subjected to heat treatment and plasma. After 4 seconds of distilled water was dropped on the surface, the angle between the surface and the solution after 10 seconds was measured with a contact angle measuring device (Phoenix 300, SEO, Korea). The average value of three contact angle measurements per group was calculated.

Surface form

The surface morphology changes in a vacuum state with a Sputter coater (E-1030, Hitachi, Japan)

After platinum coating for 60 seconds, a scanning electron microscope (FE-SEM S-4700, Hitachi horiba, Japan)

.

Surface roughness

The surface roughness was measured using a non-contact three-dimensional micro-profile measuring device (Nanosurface 3D Optical Profiler: NV-E1000, Nano System, Korea) (n = 3). The average value of Ra (average roughness) measured in three parts per one specimen was taken as the Ra value of the specimen.

Crystalline phase

The changes in the crystal structure of the surface after the heat treatment and plasma irradiation were analyzed using an X-ray diffractometer (XRD, X'Pert PRO Multi Purpose X-Ray Diffractometer, PANalytical, Netherlands). Diffraction conditions were performed in the 2θ range from 20 ° to 90 ° at a rate of 1.5 per minute using X-ray of CuKα line.

Chemical composition and bonding state

The chemical composition and bonding state of the surface were analyzed by X-ray photoelectron spectroscopy (XPS, VG Mulrilab 2000, Thermo scientific, UK). The peak area values for the detected elements were normalized and expressed as quantitative ratios.

4. Assessment of inhibition of biofilm formation

Bacterial culture

To evaluate biofilm formation inhibition ability, Gram positive anaerobic bacterium Streptococcus mutans (KCOM 1504) and Gram negative anaerobic bacterium Porphyromonas gingivalis (KCOM 2804) were used. Two species of bacteria were cultured in the Korean Oral Microbiology Resource Center (KCOM, Gwangju, Korea). The S. gingivalis strains were cultivated in TSB medium (Tryptic Soy Broth, Becton, Dickinson and Company, Sparks, MD, USA) in a medium of BHI (Brain Heart Infusion, Becton, Dickinson and Company, Lt; / RTI > A single colony formed in a solid medium was cultured in a liquid medium to prepare bacteria at a concentration of 1.5 x 10 7 CFU / ml. S. mutans were cultured in a 37 ° C incubator (LIB-150M, DAIHAN Labtech Co., Korea) and P. gingivalis were incubated in a 37 ° C anaerobic incubator (Forma Anaerobic System 1029; Thermo Fisher Scientific, Waltham, MA, USA).

Artificial saliva coating

Artificial saliva coating was performed to reproduce the oral environment. Artificial saliva was prepared by adding 1% mucin (Mucin from porcine stomach, M1778; Sigma-Aldrich, St Louis, MO, USA) to the adherence buffer. The composition of the manufactured saliva is shown in Table 2 below.

Component Quantity KH ₂ PO ₄ 10 mM / L KCl 50 mM / L CaCl ₂ 1 mM / L MgCl ₂ 0.1 mM / L pH 7.0 Mucin One%

Bacterial inoculation

Three specimens per group were placed in a 24-well plate and artificial saliva was dispensed, and the specimen was coated with saliva while stirring slowly in a 37 ° C incubator for 2 hours. After 2 hours, artificial saliva was removed and dried for 15 minutes. The bacteria were inoculated with 1.5 × 10 7 CFU / ml prepared on the specimen, and the S. mutans strain was cultured for 24 hours and the P. gingivalis strain was cultured for 48 hours.

Assessment of inhibition of biofilm formation

Fluorescent nucleic acid staining evaluation

Green fluorescent nucleic acid stain (SYTO 9®, Molecular Probes Europe BV, Leiden, Netherlands) was used for evaluation of bacterial membrane formation. After culturing the bacterium, the culture medium was removed and washed twice with PBS (phosphate buffered saline). 200 μl of fluorescence reagent (SYTO 9®: dH2O = 1.5 μl: 1 ml) was added to the specimen, and the well plate was stacked on an aluminum foil to prevent light from entering and reacted at room temperature for 15 minutes. After 15 minutes, the remaining staining solution was carefully washed with PBS solution and observed with a confocal laser scanning microscope (Leica TCS SP5 AOBS / tandem, Leica, Germany). The thickness of the biofilm formed on the specimen was measured using an analysis program (Leica LAS AF software, Leica Microsystems, Bensheim, Germany).

Crystal violet staining

After culturing the bacterium, the culture medium on the specimen was removed and washed twice with PBS solution to remove unattached bacteria. 500 μl of 0.3% crystal violet solution was added to the specimen and stained for 10 minutes. After 10 minutes, the crystal violet solution was removed, washed 3 times with PBS solution to remove residual solution, and dried for 15 minutes. 400 μl of desalted solution (80% ethyl alcohol + 20% acetone) was added and stirred for 1 hour. After 1 hour, 200 μl of desalted solution was added to a 96-well plate and the absorbance was measured at 595 nm using an absorbance meter (VersaMax ELISA Microplate Reader, Molecular Device, USA).

5. Evaluation of osteoblast activity

Cell culture

Minimum essential medium (α-MEM) containing 10% fetal bovine serum (FBS) and 100 U / ml penicillin was added to mouse osteoblast MC3T3-E1 cells (MC3T3-E1 Subclone 4, ATCC CRL2593, Rockville, (Dulbecco's modified Eagle's medium, Gibco-BRL, Grand Island, NY, USA) medium at 37 ° C in a 5% CO2 incubator (Forma Series II 3111 Water Jacketed CO2 Incubator, Thermo Scientific, USA).

Cell adhesion assessment

Two specimens per group were placed in a 24-well plate and the prepared cells were dispensed at 4 × 10 4 cells / ml. The 24-well plate containing the sample and the cell solution was incubated for 4 hours at 37 ° C in a 5% CO2 incubator. After 4 hours of cell culture, they were fixed in 2.5% glutaraldehyde for 2 hours to obtain scanning electron microscopy images. After washing twice for 10 minutes with PBS, cells were dehydrated in 40%, 50%, 60%, 70%, 80%, and 90% ethanol for 5 minutes and 100% ethanol for 10 minutes three times I went through the process. After dehydration, all specimens were dried for 1-2 hours on a clean bench. The dried specimens were platinum-coated for 60 seconds in a vacuum state using a sputter coater (E-1030, Hitachi, Japan), and then subjected to scanning electron microscopy (FE-SEM S-4700, Hitachi horiba, Japan) The degree and degree of adhesion were observed.

Cell proliferation assessment

Three specimens per group were placed in a 24-well plate and the prepared cells were dispensed at 4 × 10 4 cells / ml. After incubation for 24 hours and 48 hours in a 5% CO2 incubator at 37 ° C, the well plates containing the specimen and the cell solution were incubated with WST-8 reagent (EZ-Cytox, Itsbio, Inc., Seoul, Korea) Mu] l each, and cultured again in a 5% CO ₂ incubator at 37 [deg.] C. When orange color was developed, 100 μl of the solution was transferred to a 96-well plate, and the absorbance was measured at 450 nm using an absorbance analyzer (ELx 800 UV, Bio-TechInstrument, Inc., Winooski, VT, USA).

Investigation of osteogenic gene expression related to cell differentiation

Cell culture

The mouse osteoblast MC3T3-E1 cells (ATCC CRL2593) were incubated with 10% fetal bovine serum (FBS), 100 U / ml penicillin, 50 μg / ml ascorbic acid (AA) and 5 mM β-glycerophosphate ., St. Louis, MO, USA ) with α-MEM (α-Minimum Essential medium, Dulbecco's modified Eagle'smedium, Gibco-BRL, Grand Island, NY, USA) 37 ℃ with culture medium, 5% CO ₂ containing the (Forma Series II 3111 Water Jacketed CO ₂ Incubator, Thermo Scientific, USA). In order to evaluate the expression of RNA in MC3T3-E1 cells, cells prepared in a 24-well plate containing 3 specimens per group were dispensed at 4 × 10 ⁴ cells / ml. The wells containing the specimen and the cell solution were incubated for 2 and 4 days in a 5% CO2 incubator at 37 ° C.

RNA extraction

After 2 and 4 days of culture, total RNA of cells stuck to the specimen was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Template cDNAs were synthesized from total RNA (2000 ng) using random primers and M-MLV Reverse Transcriptase (Promega, Madison, Wis., USA). Expression of the target gene was confirmed by real-time polymerase chain reaction (PCR) using synthetic cDNA and selective primer.

Real time-PCR evaluation

Real-time PCR was performed using Rotor-Gene Q Thermal Cycler (Qiagen, Hidden, Germany). To each well, 2 μl of cDNA, 2 μl of distilled water, 2 μl of primers (10 pmol / μl) and 6 μl of 2 × RG SYBR PCR Master mix (Qiagen, Hidden, Germany) After 5 seconds of denaturation at 95 ° C and 10 seconds of restoration at 60 ° C were repeated 45 times. The base sequences of the primers used are as follows. Alkaline phosphatase: forward (F); TACATTCCCCATGTGATGGC, reverse (R); ACCTCTCCCTTGAGTGTGGG, Collagen type I: forward (F); CCCCAACCCTGGAAACAGAC, reverse (R); GGTCACGRRCAGTTGGTCAA, Osteocalcin: forward (F); CTCCTCAGTCTGACAAAGCCTT, reverse (R); GCTGTGACATCCATTACTTGC, b-actin: forward (F); ACTGCTGGGACTCTG, reverse (R); TGATGGCGTAGAACAG. The degree of gene expression was calculated by the comparative CT (2 ^-ΔΔCT ) method [20] using the measured Ct (threshold cycle) value, and β-actin was also used as an internal control.

6. Statistical Analysis

Heat treatment effect

Statistical analysis was performed by one-way analysis of variance (ANOVA), which was a parametric method when the normality was satisfied, and post-test was performed using the Tukey test. All results were tested for significance at P <0.05 level. Statistical analysis was performed using the Kruskal-Wallis test, a non-parametric method. Mann-Whitney U-test was performed using a pair of two groups, and Bonferroni's method was used to correct the first type error. Respectively.

Plasma effect

The significance test for plasma application was statistically analyzed by independent t-test, which was a parametric method when the normality was satisfied. When the normality was not satisfied, Mann-Whitney U-test, a nonparametric method, The two groups were compared. All results were tested for significance at P <0.05 level.

Ⅱ. result

1. Surface Characterization

Contact angle

TiO ₂ nanotube heat treatment and plasma application. (See Table 3 below). The H0 group had a contact angle of 19.5 ± 2 °, the H400 group had a contact angle of 14.2 ± 2 °, and the H600 group had a contact angle of 18.0 ± 2 °. After plasma application, contact angle decreased in all groups. The contact angle of the H0P group was 3.3 ± 6 °, and the H400P group and H600P group showed a decrease in contact angle.

Surface morphology analysis

Heat treatment effect

TiO ₂ nanotubes were uniformly distributed throughout the surface, irregularly elliptical, and hemispheric. The diameter and height of the H0 group were 111.3 ± 2 nm and 522.6 ± 4 nm, respectively. Diameter and height of the H400 group were 106.7 ± 1 nm and 500.8 ± 4 nm, respectively, which were not significantly different from those before the heat treatment. The diameters and height of the H600 group were 91.2 ± 1 nm and 498.0 ± 7 nm, respectively. As a result of FE-SEM observation, the nanotube length and morphology were maintained when TiO ₂ nanotubes were annealed at about 400 ° C in the atmosphere.

Plasma effect

Surface changes before and after plasma application were not observed.

Surface roughness

The surface morphology was observed using a noncontact three-dimensional microtiter. The Ra value of the H0 group was 424.7 ± 38 nm, the H400 group was 396.0 ± 07 nm, and the H600 group was 462.8 ± 28 nm. After plasma application, the Ra value of the H0P group was 432.9 ± 22 nm, the H400P group was 376.0 ± 42 nm, and the H600P group was 428.6 ± 10 nm. There was no statistically significant difference in surface roughness between heat treatment and plasma application (P> 0.05).

Crystallographic evaluation

Before heat treatment

FIG. 1 (a) is an XRD analysis result of a TiO ₂ nanotube specimen (H0 group) anodized at 1 V H ₂ PO ₄ + 1.5 wt.% HF solution at 20 V for 10 min. (002) plane at 38.4 degrees, (011) plane at 40.2 degrees, (012) plane at 53 degrees, (110) plane at 63 degrees, (013) plane at 70 degrees, , The (020) plane at 74 degrees, and the (112) plane at 76 degrees. It is considered that the titanium base material, which is the lower part of the TiO ₂ nanotubes having a length of about 500 nm, is detected because the X-ray penetrates 1 to 2 μm of the specimen.

After heat treatment

Fig. 1 (b) and Fig. 1 (c) show the results of the anodic oxidation of CP-Ti grade 4 specimen at 20 V in 1M H ₃ PO ₄ + 1.5 wt.% HF electrolyte for 10 min. min at a heating rate of 400 ° C and 600 ° C for 1 hour, respectively. (010), (002), (011), (012), (110), (013) and (112) planes of TiO ₂ and the TiO ₂ anatase (011) , (015), and (121) planes were observed. The peak intensities at 600 ° C (H600 group) were slightly different, but the surfaces observed at 400 ° C (NH400 group) and the newly observed TiO ₂ rutile (110), (011), (111) When TiO ₂ nanotubes were annealed at 600 ° C, TiO ₂ anatase phase and TiO ₂ rutile phase were mixed.

Chemical composition and bonding state evaluation

XPS analysis

2, it can be seen that C (1s), F (1s), O (1s), Ti (2p1) and Ti (2p3) were detected on the surface of all TiO ₂ nanotubes. Narrow analysis was performed to investigate the more accurate binding energy and chemical bonding.

Heat treatment effect

The peak of C1s in H0 group was mainly detected at 285.0 eV, 286.7 eV and 288.7 eV, 285.0 eV peak for CC or CH bond carbon, 286.7 eV peak for CO bond carbon, 288.7 eV The peak means a C = O bond carbon. 529.9 eV of the three peak (529.9 eV, 531.3 eV, 532.6 eV) of O1s peak peak corresponds to TiO _2, 531.3 eV peak is the peak of the OH hydroxyl groups, 532.6 eV is associated with the CO bond or a C = O bond have. The Ti2p peak was observed at 464.1 eV and 458.3 eV for the double peak of Ti specific pits. This corresponds to TiO ₂ . The O1s peak (530.0 eV, 531.5 eV, 532.6 eV) and the Ti2p peak (464.5 eV, 458.7 eV) of the H400 group and the O1s peak (530.1 eV, 531.6 eV and 532.7 eV) of the H600 group and the Ti2p peak , 458.9 eV) was slightly shifted toward higher binding energy.

Plasma effect

After application of the plasma, the C1s peak of the H0P group decreased and the lower peak between 292.1 eV and 281.2 eV shifted slightly towards higher binding energy. And another C1s peak was observed at 283.6 eV and 281.9 eV. This is related to C ₂ H ₄ and C ^4- . And the O1s peak was observed at 528.7 eV and 528.1 eV, which means O ₂ . The Ti2p peak was observed at 461.7 eV for the Ti2p1 / 2 peak and at 456.1 eV for the Ti2p3 / 2 peak. This corresponds to Ti ₂ O ₃ and TiO ₂ . In the H400P group, another C1s peak was observed at 289.7 eV. This is related to carboxyle (plasma O ₂ ) and Ar. The Ti2p peak was observed at 465 eV for the Ti2p1 / 2 peak and 459 eV for the Ti2p3 / 2 peak. This corresponds to TiO ₂ rutile and TiO ₂ . The Ti2p peak of the H600P group was further observed at 460.9 eV. It is believed to be associated with the titanium compound TiOx. The plasma application slightly shifted the Ti2p and O1s peaks of the TiO ₂ nanotubes towards higher binding energies. In the case of F detected in the analysis, it is considered that the fluorine added to the electrolyte in the anodic oxidation process remains on the surface of the TiO ₂ nanotube.

Normalized atomic percentage of XPS

The atomic percentages of each element from the XPS peak are plotted. Referring to FIG. 3, the carbon content of the H0 group surface was 37.1 at%, the oxygen content was 47.9 at%, and the fluorine content was 1.8 at%. The carbon in the HOP group applied plasma decreased to 20.7 at%, oxygen increased to 60.7 at% and fluorine increased to 3.2 at%. The carbon content of the H400 group surface was 40.3 at%, the oxygen content was 46.6 at%, and the fluorine content was 0.3 at%. The plasma of the H400P group decreased to 16.5 at%, and oxygen increased to 64.9 at% and fluorine increased to 0.5 at%. The carbon content of the H600 group surface was 31.2 at%, the oxygen content was 52.6 at%, and the fluorine content was 0.8 at%. The carbon content of H600P treated with plasma decreased to 9.5 at%, oxygen increased to 70.4 at% and fluorine increased to 1 at%.

2. Assessment of inhibition of biofilm formation

Fluorescent nucleic acid staining evaluation

Streptococcus mutans (Streptococcus mutans)

Table 4 shows changes in the thickness of the membrane of Streptococcus mutans caused by heat treatment and plasma application of TiO ₂ nanotubes.

Heat treatment effect

The thicknesses of S. mutans biofilm in H0 group, H400 group and H600 group were 38.1 ± 5 ㎛, 22.1 ± 2 ㎛ and 40.9 ± 1 ㎛, respectively. The H400 group showed a statistically significant decrease in the thickness of the S. mutans biofilm compared to the H0 and H600 groups (P <0.017).

Plasma effect

The thickness of S. mutans biofilm in H0P group, H400P, and H600P group applied plasma was 11.1 ± 1 ㎛, 17.4 ± 1 ㎛ and 32.9 ± 2 ㎛, respectively. There was a statistically significant decrease in S. mutans biofilm thickness in all groups after plasma application (P <0.05).

Porphyromonas gingivalis (Porphyromonas gingivalis)

Table 5 shows the variation of Porphyromonas gingivalis biofilm thickness according to heat treatment and plasma application of TiO ₂ nanotubes.

Heat treatment effect

The thickness of P. gingivalis biofilm in H0 group, H400 group and H600 group were 25.5 ± 1 ㎛, 28.4 ± 4 ㎛ and 26.4 ± 4 ㎛, respectively. There was no statistically significant difference in the thickness of P. gingivalis biofilm after heat treatment (P> 0.017).

Plasma effect

The thickness of P. gingivalis biofilm in plasma treated H0P, H400P and H600P groups were 30.4 ± 4 ㎛, 30.9 ± 2 ㎛ and 24.5 ± 4 ㎛, respectively. No statistically significant difference in the thickness of P.gingivalis biofilm due to plasma application was observed (P> 0.05).

Evaluation of crystal violet (CV) assay

Streptococcus mutans (Streptococcus mutans)

Heat treatment effect

Referring to FIG. 4, the H400 group and the H600 group showed a significant decrease in the attachment of S. mutans to the H0 group (P <0.017).

Plasma effect

Referring to FIG. 5, the adhesion of S. mutans was significantly decreased after plasma application in the H600 group (P <0.05).

Porphyromonas gingivalis (Porphyromonas gingivalis)

Heat treatment effect

6, the adhesion of P. gingivalis was significantly increased in the H400 group compared to the H0 group, and the adhesion of P. gingivalis was significantly decreased in the H600 group (P <0.017) compared to the H400 group .

Plasma effect

Referring to FIG. 7, the adhesion of P. gingivalis in the H0 group was significantly increased after plasma application, and the adhesion of P. gingivalis in the H600 group was significantly decreased after plasma application (P <0.05).

3. Estimation of osteoblast activity

Microscopic evaluation of cell adhesion

4 × 10 ⁴ cells / ml of MC3T3-E1 cells were added to the specimens and cultured for 4 hours, and the cell adhesion state was observed with a scanning electron microscope. Referring to FIG. 8, it was observed that MC3T3-E1 cells were well adhered in all specimens.

Cell proliferation assessment

Heat treatment effect (2 days culture)

9, the cell proliferation was significantly increased in the H400 group compared to the H0 group and the H600 group after the 2-day culture with 4 × 10 ⁴ cells / ml MC3T3-E1 cells on the test piece (P < 0.017).

Plasma treatment effect (2 days culture)

10, the cell proliferation after the application of plasma was significantly increased in the H0 group after 2 days of incubation with 4 × 10 ⁴ cells / ml of MC3T3-E1 cells on the specimen (P <0.05 ).

Heat treatment effect (4 days culture)

11, after 4 × 10 ⁴ cells / ml of MC3T3-E1 cells were placed on the specimen and cultured for 4 days, cell proliferation was significantly increased in the H400 group compared to the H0 group and the H600 group (P < 0.017).

Plasma treatment effect (4 days culture)

12, after 4 × 10 ⁴ cells / ml of MC3T3-E1 cells were placed on the specimen and cultured for 4 days, the cell proliferation of the H0 group and the H600 group was significantly increased after plasma application ( P < 0.05).

Investigation of osteogenic differentiation related bone mineral gene expression (real time PCR)

Alkaline phosphatase (ALP)

13, there was no significant difference (P> 0.017) in the expression of ALP upon heat treatment after the 2-day incubation of 4 × 10 ⁴ cells / ml of MC3T3-E1 cells on the specimen The expression of ALP was significantly increased in H0 group compared to H400 group and H600 group (P <0.05).

Heat treatment effect (Type I collagen, Col1)

Referring to Figure 14, the frequency divider to ⁴ × 10 4 cell / ml of MC3T3-E1 cells on the specimen, and there was no significant difference in the Col1 expression according to the heat treatment after 2 days incubation (P> 0.017), 4 days after culture Col1 expression was significantly increased in the H0 and H600 groups compared to the H400 group (P <0.05).

Heat treatment effect (Osteocalcin, OCN)

15, there was no significant difference (P> 0.017) in the expression of OCN upon heat treatment after the 2-day incubation of 4 × 10 ⁴ cells / ml of MC3T3-E1 cells on the specimen The H400 group showed a significant increase in OCN expression compared to the H0 group (P <0.05).

The plasma treatment effect (Alkaline phosphatase, ALP)

Referring to FIG. 16, the expression of ALP was significantly increased after application of plasma to the H0 group after 2 days of incubation with 4 × 10 ⁴ cells / ml of MC3T3-E1 cells on the specimen (P <0.05) . After 4 days of incubation, expression of ALP was significantly decreased in H0 group and plasma ALP expression was significantly increased in H400 group (P <0.05).

Plasma treatment effect (Type I collagen, Col1)

17, the expression of Col1 was significantly increased in the H400 group and the H600 after the application of plasma of 4 × 10 ⁴ cells / ml of MC3T3-E1 cells for 2 days (P < 0.05). After 4 days of culture, Col1 expression was significantly decreased in all groups after plasma application (P <0.05).

Effect of plasma treatment (Osteocalcin, OCN)

Referring to FIG. 18, the expression of OCN was significantly increased (P <0.05) after plasma application in the H0 group after 2 days of incubation with 4 × 10 ⁴ cells / ml of MC3T3-E1 cells on the specimen, After 4 days of incubation, the expression of OCN was significantly increased in H0 group and H600 group, and H400 group was decreased (P <0.05).

Ⅲ. conclusion

In the embodiment of the present invention, the TiO ₂ nanotube oxide film is formed on the titanium surface to improve the surface area, the TiO ₂ oxide film structure is changed through the heat treatment under various conditions, and the atmospheric plasma is applied to the TiO ₂ nanotube, Energy and hydrophilicity were changed and the following results were obtained.

1. Heat treatment effect

The 400 ° C heat treatment of TiO ₂ nanotubes formed on the surface of titanium implants significantly reduced the adhesion of Streptococcus mutans and significantly increased the adhesion of Porphyromonas gingivalis (P &Lt; 0.017). (P <0.017) and significantly increased the expression of OCN (P <0.05) in MC3T3-E1 cells. In addition, heat treatment of TiO ₂ nanotubes formed on the surface of titanium implants at 600 ° C significantly reduced the adhesion of Streptococcus mutans bacteria (P <0.017), and the adhesion of porphyromonas jinx valis bacteria and MC3T3-E1 cells (P > 0.017, P > 0.05).

2. Plasma effect

Plasma application of TiO ₂ nanotubes formed on the surface of titanium implants without heat treatment significantly increased adhesion of Porphyromonas jinx valis bacteria (P <0.05), and increased MC3T3-E1 cell proliferation and OCN expression (P < 0.05). The application of plasma to the TiO ₂ nanotubes annealed at 600 ° C significantly reduced the adhesion of Streptococcus mutans bacteria and porphyromonas jinx valis bacteria (P <0.05), and the proliferation of MC3T3-E1 cells and the expression of OCN (P < 0.05).

In summary, according to the surface treatment method of the titanium implant according to the embodiment of the present invention, the heat treatment of the TiO ₂ nanotubes inhibits the adhesion of Streptococcus mutans bacteria associated with the formation of the initial membrane, TiO ₂ nanotubes and applying a plasma to the TiO ₂ nanotubes by heat treatment at 600 ℃ Pseudomonas formate fatigue to cause the implant peri seriously balise (Porphyromonas gingivalis) can inhibit the adhesion of bacteria, and the heat treatment with a plasma of TiO ₂ nano-tubes Was found to be effective in promoting the proliferation and differentiation of MC3T3-E1 cells.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, Various changes and modifications may be made by those skilled in the art.

Claims (5)

Preparing a titanium implant;
Forming TiO ₂ nanotubes on the surface of the titanium implant using an anodizing process; And
And thermally treating the surface of the titanium implant having the TiO ₂ nanotubes formed thereon. The method according to claim 1,
Streptococcus mutans A method for surface treatment of a titanium implant characterized by preventing an increase in bacterial adhesion. 3. The method of claim 2,
Wherein the titanium implant is a titanium implant contaminated with Streptococcus mutans bacteria. The method of claim 3,
The step of forming the TiO ₂ nanotubes on the surface of the titanium implant using the anodic oxidation process may be performed by adding 1 M phosphoric acid (H ₃ PO ₄ ) and 1.5 wt% hydrofluoric acid (HF) to the electrolytic solution A titanium platinum specimen to which an electrode is connected and a platinum plate are immersed and an anodic oxidation is performed for 10 minutes by applying a voltage of 20 V to form a porous amorphous TiO ₂ nanotube on the surface of the titanium implant, Way. 5. The method of claim 4,
The heat treatment is performed in a sintering furnace. The temperature is raised to a predetermined temperature in a range of 300 to 700 占 폚 at 1 占 폚 / min in an air atmosphere, maintained at a temperature for 1 hour, Of the surface of the titanium implant.

Images