KR20180063817A - Novel functionally enhanced mesenchymal progenitor cells, cell therapeutic composition for revascularization or preventing vascular damage including the same, and method for preparing the same - Google Patents

Abstract

One embodiment of the present invention provides a cell therapeutic composition for revascularization or vascular damage prevention, which comprises mesenchymal progenitors as an active ingredient, wherein the mesenchymal progenitors express epidermal growth factor receptors (EGF-R) at a higher level than mesenchymal stem cells (MSC) and express cluster differentiation 95 (CD95) at a lower level than mesenchymal stem cells.

Description

[0001] The present invention relates to a cell therapeutic composition for regenerating blood vessels or preventing blood vessel damage, which comprises novel mesenchymal precursor cells with improved function, and a method for producing the same, PREPARING THE SAME}

TECHNICAL FIELD The present invention relates to a cell therapeutic composition for regenerating blood vessels or preventing vascular damage comprising mesenchymal progenitors with improved function, and a method for producing the same.

The mesenchyme refers to the mesenchymal tissue that corresponds to the middle layer formed by the epithelial to mesenchyme transition (EMT) that occurs during the embryo development, and human embryonic stem cells are able to explain this early development in vitro It is unique and can be used as a source of beneficial cells.

Studies on mesenchymal stem cells or mesenchymal precursor cells derived from human embryonic stem cells as well as adult tissues have been actively carried out. As a result, there are progenitor cells such as mesenchymal stem cells that can form bone in bone marrow In addition to bone marrow, bone marrow, peripheral blood, adipose tissue, umbilical cord blood, amniotic membrane, and fetal tissues have been reported to be able to separate.

These adult-derived mesenchymal stem cells have various properties that can be useful for cell therapy. Therefore, in clinical treatment, there is a need for treatment of myocardial regeneration, pulmonary fibrosis, and treatment of spinal injuries in musculoskeletal and cardiovascular systems such as bone, cartilage and tendon And cell therapy has been attempted in various fields.

However, unlike embryonic stem cells, adult adult mesenchymal stem cells are known to exhibit irregular proliferative capacity in a long-term subculture in vitro, resulting in the ability of one cell to divide more than 40 times. In addition, there is no established cell line, and repeated cell preparation is required from the adult body, which limits its research.

In order to overcome these limitations, studies for separating and culturing mesenchymal stem cells or progenitor cells from human embryonic stem cells have been continuously carried out. In order to obtain mesenchymal stem cells or progenitor cells from previously known embryonic stem cells, cells expressing the desired markers are separated by a flow cytometer (Fluorescent activated cell sorter, FACS) and cytokines Cytokine) have been commonly used

However, the method using a flow cytometer does not only lower the survival rate of the cells because of the use of a laser, but also has a problem that the culture period is increased due to the small number of cells obtained after the separation. In the case of cytokine treatment, There is a problem that it is difficult to effectively remove the ability to differentiate embryonic stem cells.

On the other hand, studies have been actively conducted to utilize such stem cells or progenitor cells as a cell therapy agent. Of these, research results using mesenchymal stem cell-derived secretions or angioplast precursor cells have been reported for wounding and burn treatment purposes, but they are costly to manufacture and have limitations in mass production and commercialization.

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made to solve the above-mentioned problems occurring in the prior art, and it is an object of the present invention to provide a cell therapy composition comprising mesenchymal precursor cells with improved proliferative and differentiative capacity and excellent migration and angiogenic effects, .

However, the problems to be solved by the present invention are not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In accordance with one embodiment of the present invention, the expression of EGF-R (Epidermal Growth Factor Receptor) is overexpressed in comparison to Mesenchymal Stem Cell (MSC) 95) as mesenchymal progenitors as an active ingredient. The present invention also provides a cell therapy composition for vascular regeneration or prevention of vascular injury.

According to one aspect of the present invention, the mesenchymal precursor cells are selected from the group consisting of ESC (Embryonic Stem Cell), iPSC (Induced Pluripotent Stem Cell) or Somatic Cell Nuclear Transfer Cell (SCNT) Lt; / RTI >

According to one aspect, the embryonic stem cells may be derived from mammals.

According to one aspect of the present invention, the mesenchymal precursor cells are different from the mesenchymal stem cells in terms of LTBP (Beta-binding protein), VEGF (vascular endothelial growth factor), KDR (kinase insert domain receptor), FZD , Angiogenesis factor selected from the group consisting of FGF (Fibroblast Growth Factor), ANG (Angiopoietin), PDGFR (Platelet-Derived Growth Factor Receptor) and EMAP (Endothelial Monocyte-Activating Polypeptide) have.

According to one aspect, the mesenchymal precursor cells overexpress at least one of migration factor of MMP (Matrix Metalloproteinase) and HGF (hepatocyte growth factor) compared to mesenchymal stem cells.

According to one aspect, the mesenchymal precursor cells may have the ability to differentiate into adipocyte, osteocyte, chondrocyte or myocyte.

According to one aspect, the mesenchymal precursor cells may have a doubling time of 20 hours to 35 hours.

According to one aspect, the mesenchymal precursor cells may induce proliferation of endothelial cells.

According to one aspect, the mesenchymal precursor cells can interact with vascular endothelial cells.

According to another embodiment of the present invention, there is provided a method for producing an embryoid body, comprising the steps of: (a) providing an embryoid body derived from embryonic stem cell (ESC), inducible precursory pluripotent stem cell (iPSC) or somatic cell nucleated stem cell (SCNT) Culturing on a cell culture insert; (b) separating the mesenchymal precursor cells migrating to the lower part of the cell culture insert; (c) comparing the epidermal growth factor receptor (EGF-R) and CD95 expression level of mesenchymal precursor cells with the level of mesenchymal stem cell (MSC) expression; And (d) formulating the mesenchymal precursor cells. The present invention also provides a method of preparing a cell therapeutic composition for vascular regeneration or vascular injury prevention.

According to one aspect, the pore size of the porous membrane may be between 1 탆 and 20 탆.

According to one aspect, the cell culture insert may comprise one or more additives selected from the group consisting of Fetal Bovine Serum (FBS), Serum replacement (SR), and Human platelet lysate (HPL).

The mesenchymal precursor cells of the present invention may exhibit excellent proliferative, differentiating, migrating, and angiogenic effects depending on changes in specific marker expression patterns.

In addition, the cell therapeutic composition comprising such a mesenchymal precursor cell can be used as an effective therapeutic agent for injured parts due to burns and wound due to its ability to prevent vascular regeneration and vascular injury.

Furthermore, by preparing the mesenchymal precursor cells using the cell culture insert having the porous membrane, the cell viability can be improved and the ability to separate the embryonic stem cells can be effectively removed at a low cost.

It should be understood that the effects of the present invention are not limited to the effects described above, but include all effects that can be deduced from the description of the invention or the composition of the invention set forth in the claims.

1 is an image of a mesenchymal precursor cell (FEMP) according to an embodiment of the present invention.
FIG. 2 is an image of each step of the method for producing mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 3 is a graph showing Oct4 and Nanog expression levels of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 4 is an image of a cell morphology according to the culture conditions of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 5 shows a karyotype analysis result of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 6 is a graph showing EGF-R and CD95 expression rates of mesenchymal precursor cells (FEMP) and bone marrow-derived mesenchymal stem cells (BM-MSC) according to an embodiment of the present invention.
7 is an image of adipocyte and osteocyte differentiated from mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 8 is an image and a graph showing the movement characteristics of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
9 is a graph showing an expression level of an angiogenesis factor and a migration factor of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention in comparison with bone marrow derived mesenchymal stem cells ( cutoff: 1.1).
FIG. 10 is a graph showing the effect of mesenchymal precursor cells (FEMP) on vascular endothelial cell proliferation according to an embodiment of the present invention.
11 is an image of a blood vessel tube formed from mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 12 shows a dye transfer assay result of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 13 shows a tube assembly assay result of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIGS. 14 and 15 illustrate the effect of the therapeutic treatment of mesenchymal precursor cells (FEMP) according to an example of the present invention.
FIG. 16 shows the wound healing efficacy of mesenchymal precursor cells (FEMP) according to an example of the present invention.

In the following, embodiments will be described in detail with reference to the accompanying drawings. Like reference symbols in the drawings denote like elements.

Various modifications may be made to the embodiments described below. It is to be understood that the embodiments described below are not intended to limit the embodiments, but include all modifications, equivalents, and alternatives to them.

The terms used in the examples are used only to illustrate specific embodiments and are not intended to limit the embodiments. The singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, the terms "comprises" or "having" and the like refer to the presence of stated features, integers, steps, operations, elements, components, or combinations thereof, But do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, or combinations thereof.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this embodiment belongs. Terms such as those defined in commonly used dictionaries are to be interpreted as having a meaning consistent with the contextual meaning of the related art and are to be interpreted as either ideal or overly formal in the sense of the present application Do not.

In the following description of the present invention with reference to the accompanying drawings, the same components are denoted by the same reference numerals regardless of the reference numerals, and redundant explanations thereof will be omitted. In the following description of the embodiments, a detailed description of related arts will be omitted if it is determined that the gist of the embodiments may be unnecessarily blurred.

New with enhanced functionality Intermittency Progenitor cell ( FEMP , Functionally Enhanced Mesenchymal Progenitors)

1 is an image of a mesenchymal precursor cell (FEMP) according to an embodiment of the present invention.

As shown in FIG. 1, according to an embodiment of the present invention, epidermal growth factor receptor (EGF-R) is overexpressed compared to mesenchymal stem cell (MSC) There is provided a cell therapy composition for vascular regeneration or vascular injury prevention comprising as an active ingredient a mesenchymal precursor cell that lowers CD95 (Cluster Differentiation 95) compared to stem cells.

The term "mesenchymal stem cell (MSC)" refers to a multipotent stem cell capable of differentiating into various mesodermal cells including bone, cartilage, fat and muscle cells. The mesenchymal stem cells may be derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, chorionic membrane, decidua or placenta, preferably bone marrow derived mesenchymal stem cells (BM- Marrow-Mesenchymal Stem Cell).

The mesenchymal precursor cells may be derived from a mammal other than human, fetus or human. Mammals other than humans include, but are not limited to, canines, felines, monkeys, animals, cows, sheep, pigs, horses, rats, mice, guinea pigs and the like.

The mesenchymal precursor cells overexpress the epidermal growth factor receptor (EGF-R) as compared to the normal mesenchymal stem cell (MSC), and undergo low expression of CD95, the mesenchymal stem cells have excellent proliferative, It is possible to retain the moving ability. That is, the mesenchymal precursor cells may mean a functionally enhanced mesenchymal progenitor (FEMP).

The Epidermal Growth Factor Receptor (EGF-R) is a cell-surface receptor for the epithelial growth factor family of extracellular protein ligands. It promotes the paracrine of stem cells to produce VEGF (Vascular Endothelial Growth Factor ) And HGF (Fibroblast Growth Factor), and the expression of various growth factors and cytokines such as HBGR (Heparin-Binding EGF-like Growth Factor) and AREG (Amphiregulin) The proliferation and differentiation ability of the stem cells can be improved.

In addition, the EGF-R may act on stem cells together with MAP kinase (Mitogen-Activated Protein Kinase) and PKC (Protein Kinase C) to improve the migration ability. Therefore, the mesenchymal precursor cells overexpressing the EGF-R may exhibit superior proliferative capacity, differentiation ability and migration ability as compared with conventional mesenchymal stem cells.

The CD95 (Cluster Differentiation 95) is also known as FasR (Fas Receptor), APO-1 (Apoptosis antigen 1) or TNFRSF6 (Tumor Necrosis Factor Receptor Superfamily Member 6) apoptosis, which is a death receptor.

Specifically, a ligand known as FasL (Fas Ligand) or CD95L (CD95 Ligand) binds to CD95, thereby forming a Death-Inducing Signaling Complex (DISC), and cell suicide may occur.

That is, when stem cells or progenitor cells overexpress the CD95, signaling of apoptosis of the cell can be activated by the CD95, whereas stem cells relatively less expressing the CD95 inhibit apoptosis signaling It can exhibit excellent proliferative activity. Therefore, the mesenchymal precursor cells may have superior proliferative capacity as compared with mesenchymal stem cells (MSC), particularly bone marrow-derived mesenchymal stem cells (BM-MSC). This property may mean that the stem cell graft has excellent cell viability.

The mesenchymal precursor cells may be derived from embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs) or Somatic Cell Nuclear Transfer Cells (SCNTs).

As used herein, the term " Embryonic Stem Cell (ESC) "refers to a method in which an inner cell mass (ICM) is extracted from a blastocyst embryo immediately before embryonic transfer of a mammalian embryo into the uterus of a mother, Refers to a pluripotency stem cell capable of differentiating into all the cells of an animal. In a broad sense, this concept includes embryoid bodies, induced pluripotent stem cells (iPSCs), and Somatic Cell Nuclear Transfer Cells (SCNTs) derived from embryonic stem cells .

The embryonic stem cells include, but are not limited to, all embryonic stem cells from mammals including humans, primates, cows, pigs, sheep, horses, dogs, rats, rats and livestock, It may be a stem cell.

The human embryonic stem cell may be, for example, H9 (James A. Thomson et al., Embryonic Stem Cell Lines Derived from Human Blastocysts. Science 1998 Dec 4; 282 (5395): 1827) And human embryonic stem cells can be easily constructed by those skilled in the art.

In contrast, the mesenchymal precursor cells are differentiated from the mesenchymal stem cells (MSC) by LTBP (Beta-binding protein), VEGF (vascular endothelial growth factor), KDR (kinase insert domain receptor), FZD , Angiogenesis factor selected from the group consisting of FGF (Fibroblast Growth Factor), ANG (Angiopoietin), PDGFR (Platelet-Derived Growth Factor Receptor) and EMAP (Endothelial Monocyte-Activating Polypeptide) have.

In addition, the mesenchymal precursor cells overexpress at least one of migration factor of MMP (Matrix Metalloproteinase) and HGF (hepatocyte growth factor) in comparison with mesenchymal stem cell (MSC).

When the stem cells are present in the vicinity of the vascular degeneration tissue or wounded tissue, the cell migration ability and angiogenic effect may be important factors for the treatment. The moving ability can be understood as a concept including a homing ability to move from a target organ to a tissue.

Since the mesenchymal precursor cells overexpress an angiogenic factor and a migration factor compared to mesenchymal stem cells (MSC), they can rapidly migrate to target organs or tissues and restore vascular tissues. Therefore, for prevention or treatment of related vascular diseases Cell medicines and the like.

On the other hand, as described above, the mesenchymal precursor cells may have excellent differentiation ability, for example, the ability to differentiate into adipocytes, osteocytes, chondrocytes or myocytes.

Therefore, the mesenchymal precursor cells can be used as a cell therapy agent suitable for the treatment of diseases and symptoms such as wound and burns.

In addition, the mesenchymal precursor cells overexpress the epidermal growth factor receptor (EGF-R), which can enhance the ability to proliferate compared to normal mesenchymal stem cells. Specifically, the doubling time for doubling the number of cells from the stem cell culture time may be 20 hours to 35 hours, preferably 24 hours to 32 hours. This cell proliferation ability means that the effect of the FEMP can be further improved as a cell therapy agent.

The cell therapeutic composition comprising the mesenchymal precursor cells can promote angiogenesis, i.e. regeneration of damaged blood vessels, as well as prevent further damage of already damaged blood vessels due to persistent external force or the like. Accordingly, the cell therapeutic composition can be applied as an effective therapeutic agent for burn, wound, and the like.

The angiogenesis can be induced by inducing the proliferation of endothelial cells. As used herein, the term "endothelial cell" refers to a layer of cells that constitutes the inner membrane of the endothelium by endothelial adhesion to the endothelium. The term endothelial cell is used to control vasodilation through endothelin production, Regulation, vascular permeability control, substance exchange, and biological defense through interaction with leukocyte cells. That is, the ability of the vascular endothelial cell to proliferate in damaged blood vessels may indicate vascular regeneration ability.

On the other hand, the prevention of further damage to blood vessels can be influenced by the pericyte capacity of the mesenchymal precursor cells, that is, their ability to interact with vascular endothelial cells.

As used herein, the term "pericyte" refers to vascular parietal cells located within the basement membrane of the microvascular system, forming a unique local contact with the vascular endothelium. It is a connective tissue cell around small blood vessels, also called Rouget cells, adventitial cells or mural cells, which are known to surround 10% to 50% of the vascular endothelium. It is a thin, long, contractile cell that surrounds the capillary free artery outside the basement membrane.

The pericytes are relatively undifferentiated multipotent cells, which function to support blood vessels and can be differentiated into fibroblasts, smooth muscle or macrophages as needed. In addition, the peripheral vascular cells play an important role in blood vessel barrier stability as well as angiogenesis, and the blood flow in the microvascular system can be controlled by adhesion to the intravascular cells.

The cell therapeutic composition may further comprise a support, preferably a biodegradable support, for receiving the mesenchymal precursor cells. The biodegradable scaffold may be a hydrogel such as fibrin glue, hyaluronic acid, gelatin, collagen, alginic acid, cellulose, pectin, chitin, polyglycolic acid or polylactic acid, but is not limited thereto.

In addition, the cell therapeutic composition may further comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components. If necessary, an antioxidant, Other conventional additives such as buffers and bacteriostats may be added.

In addition, the cell therapeutic composition may be formulated into a form for injection, such as an aqueous solution, suspension, emulsion, etc., by adding a diluent, a dispersant, a surfactant, a binder and a lubricant, but is not limited thereto.

Improved functionality Intermittency Progenitor cells (FEMP)  A method for preparing a cell therapeutic composition comprising

According to another embodiment of the present invention, there is provided a method for producing an embryoid body, comprising the steps of: (a) providing an embryoid body derived from embryonic stem cell (ESC), inducible precursory pluripotent stem cell (iPSC) or somatic cell nucleated stem cell (SCNT) Culturing on a cell culture insert; (b) separating the mesenchymal precursor cells migrating to the lower part of the cell culture insert; (c) comparing the epidermal growth factor receptor (EGF-R) and CD95 expression level of mesenchymal precursor cells with the level of mesenchymal stem cell (MSC) expression; And (d) formulating the mesenchymal precursor cells. The present invention also provides a method for preparing a cell therapeutic composition for vascular regeneration or vascular injury prevention.

The embryonic stem cell, inducible precursor differentiation stem cell and somatic cell nuclear-replaced stem cell in the step (a) are as described above.

As used herein, the term " EB (Embryoid Body) "refers to a cell aggregate formed by adherence of embryonic stem cells. When embryonic stem cells from which elements that maintain undifferentiated state are removed are inoculated into a hydrophobic culture container, The embryonic stem cells do not adhere to the bottom of the culture vessel, but aggregate between the cells to form an amphibian with a size of 1 mm or less. The body may have the ability to differentiate into three components (endodermic, mesodermal, ectodermal) constituting the body composition of a mammal.

As used herein, the term "cell culture insert" is a device having a porous membrane. When cultured from embryonic stem cells, inducible precursor differentiation stem cells or somatic cell nuclear-derived stem cells, (EMT) is a mechanism that allows naturally occurring EMT (epithelial-mesenchymal transition) to occur. At this time, the pore size of the porous membrane may be 1 탆 to 20 탆, preferably 6 탆 to 12 탆, more preferably 8 탆.

As the culture medium of the cell culture insert, EGM2-MV, DMEM, MEM-α, STEMPRO-MSC and MesenCult-MSC medium can be used. EGM2-MV, DMEM or MEM- But is not limited thereto.

In addition, the cell culture insert may include at least one additive selected from the group consisting of FBS (Fetal bovine serum), SR (Serum replacement), and HPL (Human platelet lysate).

Specifically, the additive may be 1-10% FBS, 1-10% SR, or 1-10% HPL, preferably 5% FBS or 2.5-5% HPL, It is not.

In the step (b), the precursor cells, specifically the mesenchymal precursor cells migrated to the lower part of the cell culture insert through the porous membrane after the step (a) can be isolated. At this time, the cells may be aggregated in the form of epithelial cells under the cell culture insert.

Separation of mesenchymal precursor cells can be carried out by separation into single cells through enzymatic separation or separation into epithelial cell sheets by mechanical separation. It is preferable to use a mechanical method for maintaining the round shape of stem cells can do.

As used herein, the term "enzymatic separation" refers to a method of separating cell aggregates through enzymatic treatment. Specifically, the term " collagenase ", " collagenase ", " collagenase ", & (Accutase), Dispase, trypLE or trypsin-EDTA, preferably trypLE, a hypothetical enzyme, but is not limited thereto.

As a mechanical separation method, there can be used a method of separating and culturing in the state of maintaining a circular form of the epithelial cell shape using a scrapper.

In step (c), the level of specific marker expression of the mesenchymal precursor cells isolated in step (b) is compared with the expression level of mesenchymal stem cells (MSC), specifically bone marrow-derived mesenchymal stem cells (BM-MSC) The marker may be a epidermal growth factor receptor (EGF-R) and CD95.

Accordingly, when the mesenchymal precursor cells isolated in step (c) overexpress the epidermal growth factor receptor (EGF-R) and undergo low expression of CD95 in comparison with the mesenchymal stem cells, It can be judged that it corresponds to a precursor cell. Specific marker characteristics are the same as described above.

In step (d), the selected mesenchymal precursor cells may be mixed with supporters, carriers, diluents, and other additives according to marker expression levels such as EGF-R and CD95, and may be formulated. The support, carrier and the like are as described above.

Hereinafter, embodiments of the present invention will be described in detail.

Example  1: human embryonic stem cells ( hESC ) Origin Intermittency Of progenitor cells (FEMP)  detach

FIG. 2 is an image of each step of the method for preparing mesenchymal precursor cells according to an embodiment of the present invention.

2, human embryonic stem cells (A) were initially differentiated through formation of a soma (B) in a normal oxygen state (37 ° C, 5% CO ₂ cell incubator) And plated on the culture insert (C). (Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12) containing 20% SR (Serum Replacement), 1% NEAA (non-essential amino acid), 0.1% β-mercaptoethanol and 1% anti- Medium was used.

The dendritic cells were cultured on the cell culture inserts for 1 to 10 days, and it was confirmed that the precursor cells migrated to the lower part of the insert to form sheets of epithelial cells (D). RT-PCR analysis confirmed the migration pattern of each cell and the results are shown in FIG. Specific conditions such as marker gene, primer base sequence and the like are shown in Table 1 below.

gene Primer base sequence Temperature
(° C) Number of times
(cycle) NCBI Reference
Sequence Oct4 Sense AACTCGAGCAATTTGCCAAGCTCC 55 30 NM_001110336.1 Anti-sense TTCGGGCACTGCAGGAACAAATTC Nanog Sense CAAAGGCAAACAACCCACTT 55 30 NM_024865.2 Anti-sense TCTGCTGGAGGCTGAGGTAT

3, human embryonic stem cells (hESCs) remaining on the cell culture insert express a pluripotency marker, Oct4 and Nanog, at a certain level, whereas the human embryonic stem cell (hESC) Progenitor cells (FEMP) showed almost no expression of Oct4 and Nanog similar to human embryonic fibroblasts (hEF).

These results indicate that the mesenchymal precursor cells (FEMP) migrated to the lower part of the cell culture insert through the epithelial-mesenchymal transition can be easily separated, and the mesenchymal precursor cells (FEMP) It can be predicted that it will exhibit a characteristic different from that of FIG.

Example  2: human embryonic stem cells ( hESC ) Origin Intermittency Of progenitor cells (FEMP)  Cultivation and proliferation

FIG. 2 is an image of each step of the method for producing stem cells according to an embodiment of the present invention.

2, the mesenchymal precursor cells (FEMP) sheet formed in the lower part of the cell culture in Example 1 was peeled off (E) using a scrapper and transferred to a new culture dish and subcultured. At this time, EGM-2MV medium containing 5% FBS (Fetal Bovine Serum) was used as a culture medium.

Specifically, when the precursor cells spread out from the epithelial-shaped sheet, the epithelial-shaped sheet was taken out, and the precursor cells were continuously obtained again. The surviving progenitor cells were removed by using trypLE and subcultured.

As a result of observing the precursor cells of passage 1 (F), passage 5 (G) and passage 7 (H), no abnormalities were found in the morphology and characteristics of cells even after repeated passaging. These results indicate that the method of using the porous membrane without restriction of the passage of the mesenchymal precursor cells (FEMP) derived from human embryonic stem cells is a method of isolating and culturing the previously reported human embryonic stem cell-derived mesenchymal stem cells Lt; / RTI >

As a result of using 2.5% and 5% HPL (human platelet lysate) instead of 5% FBS, subculture cells (FEMP) were subcultured under the same conditions as above, (Fig. 4).

Example  3: Intermittency Of progenitor cells (FEMP)  Chromosome analysis

To determine whether the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2 exhibited normal chromosomal characteristics regardless of the number and duration of passage, karyotyping was performed on the 9th and 19th stem cells.

Specifically, 20 μl of colchicine solution at a concentration of 100 μg / μl was mixed in a culture container containing 10 ml of the culture solution, and the mixture was allowed to stand at 37 ° C for 2 hours. Thereafter, the solution was centrifuged at 500 rpm, and the supernatant was removed, and the cells were suspended in 5 ml of stock solution (0.075 M KCl) and left in a constant temperature water bath at 37 ° C for 25 minutes. Five drops of methanol (glacial acetic acid = 3: 1, v / v) was added to each tube and centrifuged at 1,200 rpm for 8 minutes. The supernatant was removed and the cells were suspended in 5 ml fixative, For 10 minutes was repeated twice. The cells were suspended in 0.5 ml of the fixative, and the cell suspension was added dropwise onto the slide glass immersed in 70% ethanol. The ethanol on the slide was dried using an alcohol lamp, the moisture was removed from the air, and the cover slip was covered and observed with a microscope (FIG. 5).

Referring to FIG. 5, it was confirmed that the mesenchymal precursor cells (FEMP) showed normal chromosomal characteristics irrespective of the number and duration of the passage.

Example  4: Intermittency Of progenitor cells (FEMP) Marker  Expression analysis

In order to confirm the cell characteristics of the 11th passage and 21th passage mesenchymal precursor cell (FEMP) prepared according to Example 2, the expression of the marker was analyzed using a fluorescence activated cell sorting (FACS). Specifically, the precursor cells were detached using trypsin-EDTA and suspended in PBS (Phosphate Buffered Saline) at a concentration of ⁵ x 10 ⁵ cells / ml. Each of the cells was incubated for 45 min at room temperature with addition of CD73, CD95, CD44, CD11b, CD14, CD19, CD34, CD45, HLA-DR and EGF-R (anti- After the reaction, flow cytometry analysis was performed on each of the cells. The results are shown in Table 2, and the results of EGF-R and CD95 are shown in FIG. At this time, bone marrow-derived mesenchymal stem cells (BM-MSC) and 16-pass fibroblasts were used as control groups.

Marker BM-MSC p7 FEMP p11 FEMP p21 Fibroblast p16 CD73 99.75 99.27 98.92 99.4 CD95 93.64 12.38 18.07 93.90 CD44 99.59 99.79 99.65 97.43 CD11b 0.36 0.03 0.32 0.34 CD14 0.4 0.11 0.22 0.73 CD19 0.19 0.04 0.13 0.16 CD34 1.79 1.49 1.42 0.37 CD45 0.15 0.14 0.15 0.33 HLA-DR 0.36 0.1 0.06 0.26 EGF-R 15.26 85.93 58.43 98.84

(unit: %)

Referring to Table 2 and FIG. 6, it can be seen that the mesenchymal precursor cells (FEMP) overexpress EGF-R by about 40% to 70% and CD95 by about 80% as compared to BM-MSC. From these results, it can be expected that FEMP exhibits superior proliferative and differentiating ability as compared to BM-MSC.

In addition, markers such as CD73 were strongly expressed, and hematopoietic stem cell markers such as CD34 and CD45 were not expressed, and thus, the mesenchymal precursor cells (FEMP) were analyzed to include the characteristics of the mesenchymal stem cells and the pluripotency , And actually it was differentiated into adipocytes, bone cells, muscle cells and the like (Fig. 7).

Example  5: Intermittency Of progenitor cells (FEMP)  Analysis of proliferation characteristics

In order to confirm the proliferation characteristics of the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2, the cell proliferative capacity of the 16-stage mesenchymal precursor cells (FEMP) cultured under normal oxygen partial pressure was evaluated by viable cell density density (cells / cm ² ). At this time, 16-line bone marrow-derived mesenchymal stem cells (BM-MSC) cultured under normal oxygen partial pressure were used as a control group.

Each stem cell was plated in 3 wells (16, 17, 18, 19 passages) at a density of 2.0 × 10 ⁴ cells / plate in a 6 well plate culture dish. Each cell was cultured at normal oxygen partial pressure and then separated on a culture dish using 0.25% trypsin for each culture period. The average number of cells was determined by repeating the cell count three times using a hemocytometer, and the results are shown in Table 3 below.

Group Passage 16 Passage 17 Passage 18 Passage 19 BM-MSC doubling time (dT) 39.7559 51.7705 52.2821 59.7651 PDL (times) 2.3691 1.8203 1.8051 1.5818 FEMP doubling time (dT) 24.2851 25.6893 36.5355 31.8651 PDL (times) 3.9357 3.6722 2.6305 2.9216

Referring to Table 3, it can be seen that the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2 were significantly reduced in doubling time compared to bone marrow-derived mesenchymal stem cells (BM-MSC) have.

Specifically, FEMP is analyzed to exhibit significantly improved proliferative potency with a doubling time of less than 32 hours, whereas BM-MSC represents doubling time over 39 hours.

Example  6: Intermittency Of progenitor cells (FEMP)  Movement characterization

In order to confirm the migration characteristics of the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2, the number of mobile cells was measured using a 35 mm high-culture-insert (high culture-insert) Respectively. At this time, bone marrow-derived mesenchymal stem cells (BM-MSC) were used as a control group.

Specifically, each dish μ- 35㎜ each 3x10 ⁴ cells / well in a concentration by 70㎕ seeded (seeding) the FEMP and the BM-MSC, and then incubated at 37 ℃ for 24 hours, the culture insert (culture insert- ), And 2 ml of 10% DMEM was added thereto, and the number of migrated cells was calculated by photographing with a microscope. The results of the analysis are shown in Fig.

8 shows that the number of cells of mesenchymal precursor cells (FEMP) is significantly higher than that of BM-MSCs. These results indicate that the mesenchymal precursor cells (FEMP) .

Example  7: Intermittency Of progenitor cells (FEMP) Angiogenic factor  And Transfer factor  analysis

In order to confirm the expression characteristics of the angiogenesis factor and migration factor of the mesenchymal precursor cells (FEMP) of Examples 1 and 2, in the same manner as in Example 4, (BMEMC) and bone marrow-derived mesenchymal stem cells (FEMP).

The analysis results are shown by the fold change of the FEMP / BM-MSC and the cutoff value is set to 1.1, as shown in FIG.

9, MMP-1 and HGF, which are movement factors, were expressed more than 1.3-fold in FEMP as compared to BM-MSC, and thus the FEMP exhibited excellent migration ability, which is consistent with Example 6 .

In addition, various angiogenic factors such as LTBP-1, ANG-1 and FGF-16 are expressed at high levels in FEMP as compared with BM-MSC. Especially LTBP-1, VEGF-B, KDR, Frizzled- 16, the expression of FEMP is superior to that of BM-MSC.

From these results, it can be seen that the FEMP can exert excellent effects as a cell therapy agent for use such as blood vessel regeneration.

Example  8: Intermittency Of progenitor cells (FEMP)  Analysis of vascular regeneration effect

In order to confirm the vascular regenerating effect of the mesenchymal precursor cells (FEMP) prepared according to the above Examples 1 and 2, the medium (CM, Conditioned Media) in which the mesenchymal precursor cells (FEMP) (HUVEC, Human Umbilical Vein Endothelial Cell) were cultured in EBM (Endothelial cell Basal Medium). The results are shown in Table 4 and FIG. 10, respectively.

Badge type HUVEC Growth Rate (%) CPA 100 ± 0 FEMP CM 816.9 ± 145.5

Referring to Table 4 and FIG. 10, it can be seen that the growth rate of vascular endothelial cells was increased 8-fold or more in the conditioned medium containing the FEMP as compared with that of the control medium.

In addition, when the mesenchymal precursor cells (FEMP) were cultured on a Matrigel-coated medium, it was confirmed that a blood vessel tube was formed as shown in FIG.

These results suggest that the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2 can promote the regeneration of injured blood vessels by improving the proliferation of vascular endothelial cells. Therefore, the mesenchymal precursor cells (FEMP) can be used as an effective therapeutic agent for blood vessels damaged by burns, wounds, and the like.

Example  9: Intermittency Of progenitor cells (FEMP)  Analysis of prevention effect of vascular injury

In order to confirm the pericyte capacity of the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2, that is, mutual substance exchangeability with vascular endothelial cells (HUVEC), a dye transfer assay ) Were performed.

Calcein is a fluorescent substance that is moved only through a gap-junction, which is a part of cell interactions. It is a fluorescent substance that is transported to the intercellular precursor cells (FEMP) Intercellular gap-junctions must be formed.

12, Calcine-labeled vascular endothelial cells (Calcein-HUVEC, green) and Dil-labeled stem cells (Dil-FEMP, red) were cultured in a 5% CO ² incubator at 37 ° C for 1 hour As a result of co-culture, it was confirmed that the green fluorescence of calcein and the red fluorescence of dil are detected in the mesenchymal precursor cells (FEMP).

From these results, it can be seen that the mesenchymal precursor cells (FEMP) can perform an interaction such as mass transfer by forming a gap-junction with the HUVEC.

In addition, as a result of tube coassembly of the mesenchymal precursor cells (FEMP) and vascular endothelial cells (HUVEC) in fibrin gel, the result of dilution of the Dio-labeled HUVEC in the vessel- (FEMP) is located in the cell line (Fig. 13).

These results suggest that the mesenchymal precursor cells (FEMP) function as perivascular progenitor cells, that is, they are located around the endothelial cells and perform essential functions for microvascular system formation.

Example  10: Intermittency Progenitor cells (FEMP)  Confirmation of the ability to use the image

Experiments were carried out to investigate the effect of FEMP administration on skin tissue regeneration from damage caused by Shim Jae Sung 2 degree burns. Visual observation results showed that the regeneration rate was significantly faster in the FEMP treated group than in the control group from the one week after the injury to the recovery period. In addition, inflammatory factors such as MCP, TNF, and IL6 were decreased in the FEMP-treated group compared with the control group, and IL-10, a representative anti-inflammatory agent, was increased. (Fig. 14).

These results suggest that the administration of FEMP may increase the secretion of anti - inflammatory drugs and reduce the secretion of inflammatory factors, which may shorten the wound healing period.

A 90 ° C pharyngeal was attached to the skin for 10 seconds to induce a deep second degree burn, and 1x10 ⁶ FEMP was injected intradermally at 3 sites around the wound. After 1 week and 4 weeks of cell transplantation, tissues were biopsied and tissue slides were prepared and burned regions were observed. After one week, both the experimental and control groups were burned causing scar formation on the damaged skin. On the other hand, in the underside of the dermal tissue, the epidermis was disappeared due to burning or damaged dermis tissue regeneration, and a plurality of inflammatory cells were infiltrated into the granulation tissues to form a different shape from normal tissues (Fig. 15).

Example  11: Intermittency Progenitor cells (FEMP)  Confirmation of wound treatment ability

A wound model inducing ischemic necrosis was prepared by cutting three sides of dorsal skin tissue of nude mice and blocking blood supply, thereby confirming the effect of FEMP administration.

As a result of the visual observation, the area of ischemic necrosis was less in the FEMP group than in the control group, and newly generated microvessels were observed due to immunostaining with the cells injected from the FEMP group. Histologic analysis showed that inflammation associated with skin necrosis was reduced in the FEMP group. Thus, it has been shown that FEMP administration inhibits and protects against tissue loss by improving the inflammatory response in the ischemic wound model and improving blood vessel formation and subsequent blood flow (FIG. 16).

The above results indicate that the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2 can stabilize blood vessels around injured blood vessels, thereby preventing further blood vessel injuries and thus being used as therapeutic agents for burns and wound .

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. For example, if the techniques described are performed in a different order than the described methods, and / or if the described components are combined or combined in other ways than the described methods, or are replaced or substituted by other components or equivalents Appropriate results can be achieved.

Therefore, other implementations, other embodiments, and equivalents to the claims are also within the scope of the following claims.

Claims (12)

(EGF-R, Epidermal Growth Factor Receptor) over mesenchymal stem cells (MSCs), and the expression of CD95 (Cluster Differentiation 95) as compared to mesenchymal stem cells A cell therapeutic composition for vascular regeneration or prevention of vascular injury, which comprises cells (Mesenchymal Progenitors) as an active ingredient.
The method according to claim 1,
The mesenchymal precursor cells are derived from embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs) or Somatic Cell Nuclear Transfer cells (SCNTs) Or a cell therapeutic composition for preventing damage to blood vessels.
3. The method of claim 2,
Wherein the embryonic stem cell is derived from a mammal, the composition for cell regeneration for vascular regeneration or prevention of vascular injury.
The method according to claim 1,
The mesenchymal precursor cells are different from mesenchymal stem cells in terms of LTBP (Beta-Binding Protein), VEGF (Vascular Endothelial Growth Factor), KDR (Kinase Insert Domain Receptor), FZD (Frizzled), FGF Which overexpresses at least one angiogenesis factor selected from the group consisting of angiogenesis factor, ANG (angiopoietin), platelet-derived growth factor receptor (PDGFR) and endothelial monocyte-activating polypeptide (EMAP) A cell therapeutic composition for preventing damage.
The method according to claim 1,
Wherein said mesenchymal precursor cells overexpress at least one of migration factor of MMP (Matrix Metalloproteinase) and HGF (hepatocyte growth factor) as compared to mesenchymal stem cells.
The method according to claim 1,
The mesenchymal precursor cell has the ability to differentiate into adipocyte, osteocyte, chondrocyte or myocyte. The composition for cell regenerative therapy for vascular regeneration or prevention of vascular injury.
The method according to claim 1,
Wherein the mesenchymal precursor cells have a doubling time of 20 hours to 35 hours.
The method according to claim 1,
Wherein said mesenchymal precursor cells induce the proliferation of endothelial cells.
The method according to claim 1,
Wherein said mesenchymal precursor cells interact with vascular endothelial cells.
(a) culturing an embryoid body derived from embryonic stem cell (ESC), inducible precursor differentiating stem cell (iPSC) or somatic cell nuclear replaced stem cell (SCNT) on a cell culture insert equipped with a porous membrane;
(b) separating the mesenchymal precursor cells migrating to the lower part of the cell culture insert;
(c) comparing the epidermal growth factor receptor (EGF-R) and CD95 expression level of mesenchymal precursor cells with the level of mesenchymal stem cell (MSC) expression; And
(d) Formulating the mesenchymal precursor cells. A method for preparing a cell therapeutic composition for vascular regeneration or vascular injury prevention.
11. The method of claim 10,
Wherein the porous membrane has a pore size of 1 占 퐉 to 20 占 퐉.
11. The method of claim 10,
Wherein the cell culture insert comprises at least one additive selected from the group consisting of FBS (Fetal bovine serum), SR (Serum replacement) and HPL (Human platelet lysate) Way.

Images