KR101900199B1 - Novel functionally enhanced mesenchymal progenitor cell, cell therapeutic composition for anti-inflammatory including the same and method for preparing mesenchymal progenitor cell - Google Patents

Abstract

One embodiment of the present invention overexpresses epidermal growth factor receptor (EGF-R) over mesenchymal stem cells (MSCs) and overexpresses CD95 (Cluster Differentiation 95) A novel mesenchymal precursor cell with improved function.

Description

TECHNICAL FIELD [0001] The present invention relates to a novel mesenchymal precursor cell having improved function, an antifungal cell therapeutic composition comprising the same, and a method for preparing a mesenchymal precursor cell. CELL}

The present invention relates to a novel functional novel enhanced mesenchymal progenitor (FEMP), which overexpresses epidermal growth factor receptor (EGF-R) and lowers CD95 (Cluster Differentiation 95) And to a method for preparing mesenchymal precursor cells.

The mesenchyme refers to the mesenchymal tissue that corresponds to the middle layer formed by the epithelial to mesenchyme transition (EMT) that occurs during the embryo development, and human embryonic stem cells are able to explain this early development in vitro It is unique and can be used as a source of beneficial cells.

Studies on mesenchymal stem cells or mesenchymal precursor cells derived from human embryonic stem cells as well as adult tissues have been actively carried out. As a result, there are progenitor cells such as mesenchymal stem cells that can form bone in bone marrow In addition to bone marrow, bone marrow, peripheral blood, adipose tissue, umbilical cord blood, amniotic membrane, and fetal tissues have been reported to be able to separate.

These adult-derived mesenchymal stem cells have various properties that can be useful for cell therapy. Therefore, in clinical treatment, there is a need for treatment of myocardial regeneration, pulmonary fibrosis, and treatment of spinal injuries in musculoskeletal and cardiovascular systems such as bone, cartilage and tendon And cell therapy has been attempted in various fields.

However, unlike embryonic stem cells, adult adult mesenchymal stem cells are known to exhibit irregular proliferative capacity in a long-term subculture in vitro, resulting in the ability of one cell to divide more than 40 times. In addition, there is no established cell line, and repeated cell preparation is required from the adult body, which limits its research.

In order to overcome these limitations, researches on the isolation and culture of mesenchymal stem cells from human embryonic stem cells are under way. In order to obtain mesenchymal stem cells from known embryonic stem cells, cells expressing the desired markers are separated by a flow cytometer (Fluorescent activated cell sorter, FACS) and cultured with cytokines to induce differentiation. And the like are generally used.

However, since the method using the flow cytometry analyzer uses a laser, not only the survival rate of the cells is lowered but also the culture period is increased due to the small number of cells obtained after the separation. In case of the cytokine treatment, There is a problem that it is difficult to effectively remove the ability to differentiate embryonic stem cells after differentiation.

On the other hand, studies have been actively conducted to utilize such stem cells or progenitor cells as a cell therapy agent. Of these, no definite mechanism has been established to date for the treatment of cells for anti-inflammatory purposes, and no apparent therapeutic effect is observed.

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made to solve the above problems of the prior art, and it is an object of the present invention to provide novel mesenchymal precursor cells having improved proliferative and differentiative capacity and improved mobility, angiogenic efficacy and viability, And a method for producing such mesenchymal precursor cells.

However, the problems to be solved by the present invention are not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In accordance with one embodiment of the present invention, the expression of EGF-R (Epidermal Growth Factor Receptor) is overexpressed in comparison to Mesenchymal Stem Cell (MSC) 95 (FEMP, Functionally Enhanced Mesenchymal Progenitors).

According to one aspect, the mesenchymal precursor cell (FEMP) may be an embryonic stem cell (ESC), an induced pluripotent stem cell (iPSC) or a somatic cell nuclear cell (SCNT) Transfer cell.

According to one aspect, the embryonic stem cells may be derived from mammals.

According to one aspect of the present invention, the mesenchymal precursor cells (FEMPs) are different from mesenchymal stem cells in terms of LTBP (Beta-binding Protein), VEGF (Vascular Endothelial Growth Factor) At least one angiogenesis factor selected from the group consisting of Frizzled, Fibroblast Growth Factor (FGF), Angiopoietin, Platelet-Derived Growth Factor Receptor (PDGFR) and Endothelial Monocyte-Activating Polypeptide (EMAP) Overexpression.

According to one aspect, the mesenchymal precursor cell (FEMP) may overexpress at least one of migration factor of MMP (Matrix Metalloproteinase) and HGF (hepatocyte growth factor) compared to mesenchymal stem cells.

According to one aspect, the mesenchymal precursor cell (FEMP) may have the ability to differentiate into adipocyte, osteocyte, chondrocyte or myocyte.

According to one aspect, the mesenchymal precursor cell (FEMP) may have a doubling time of 20 hours to 35 hours.

According to one aspect, the mesenchymal precursor cells (FEMP) can inhibit the proliferation of PBMC (Peripheral Blood Mononuclear Cell).

According to one side, the mesenchymal precursor cells (FEMP) may induce the secretion of IL-10 (Interleukin 10).

According to another embodiment of the present invention, there is provided an anti-inflammatory cell therapeutic composition comprising the mesenchymal precursor cell (FEMP) as an active ingredient.

According to another embodiment of the present invention, there is provided a method for producing an embryoid body, comprising the steps of: (a) providing an embryoid body derived from embryonic stem cells (ESC), inducible precursory pluripotent stem cells (iPSC), or somatic cell nuclear replaced stem cells (SCNT) Lt; / RTI > cell culture insert; (b) separating the precursor cells transferred to the lower part of the cell culture insert; And (c) comparing the expression level of epidermal growth factor receptor (EGF-R) and CD95 of the progenitor cells with the level of expression of mesenchymal stem cells (MSC). do.

According to one aspect, the pore size of the porous membrane may be between 1 탆 and 20 탆.

According to one aspect, the cell culture insert may comprise one or more additives selected from the group consisting of Fetal Bovine Serum (FBS), Serum replacement (SR), and Human platelet lysate (HPL).

The mesenchymal precursor cells of the present invention may exhibit excellent proliferative capacity, differentiation ability, migratory ability and angiogenic effect depending on the change of the specific marker expression pattern.

In addition, the cytotoxic agent composition comprising the mesenchymal precursor cells can exert excellent anti-inflammatory effect and can be applied as an effective therapeutic agent for inflammation sites caused by atopic dermatitis, cystitis, and the like.

Furthermore, by preparing the mesenchymal precursor cells using the cell culture insert having the porous membrane, the cell viability can be improved and the ability to separate the embryonic stem cells can be effectively removed at a low cost.

It should be understood that the effects of the present invention are not limited to the effects described above, but include all effects that can be deduced from the description of the invention or the composition of the invention set forth in the claims.

FIG. 1 is an image of mesenchymal precursor cells (FEMPs) according to an embodiment of the present invention.
FIG. 2 is an image of each step of the method for producing mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 3 is a graph showing Oct4 and Nanog expression levels of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 4 is an image of a cell morphology according to the culture conditions of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 5 shows a karyotype analysis result of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 6 is a graph showing EGF-R and CD95 expression rates of mesenchymal precursor cells (FEMP) and bone marrow-derived mesenchymal stem cells (BM-MSC) according to an embodiment of the present invention.
7 is an image of adipocyte and osteocyte differentiated from mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 8 is an image and a graph showing the movement characteristics of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
9 is a graph showing an expression level of an angiogenesis factor and a migration factor of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention in comparison with bone marrow derived mesenchymal stem cells ( cutoff: 1.1).
FIG. 10 is a graph showing the ability of FEMP to inhibit PBMC proliferation according to an embodiment of the present invention. FIG.
FIG. 11 is a graph showing IL-10 secretion inducing ability of mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.
FIG. 12 is an image showing the efficacy of treatment with cystitis for mesenchymal precursor cells (FEMP) according to an embodiment of the present invention.

In the following, embodiments will be described in detail with reference to the accompanying drawings.

Various modifications may be made to the embodiments described below. It is to be understood that the embodiments described below are not intended to limit the embodiments, but include all modifications, equivalents, and alternatives to them.

The terms used in the examples are used only to illustrate specific embodiments and are not intended to limit the embodiments. The singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, the terms "comprises" or "having" and the like refer to the presence of stated features, integers, steps, operations, elements, components, or combinations thereof, But do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, or combinations thereof.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this embodiment belongs. Terms such as those defined in commonly used dictionaries are to be interpreted as having a meaning consistent with the contextual meaning of the related art and are to be interpreted as either ideal or overly formal in the sense of the present application Do not.

In the following description of the embodiments, detailed description of related arts will be omitted if it is determined that the gist of the embodiment may be unnecessarily blurred.

New with enhanced functionality Intermittency Progenitor cell ( FEMP , Functionally Enhanced Mesenchymal Progenitors)

FIG. 1 is an image of mesenchymal precursor cells (FEMPs) according to an embodiment of the present invention.

As shown in FIG. 1, according to one embodiment of the present invention, epidermal growth factor receptor (EGF-R) overexpresses mesenchymal stem cell (MSC) Hepatopancreas precursor cells (FEMP), which downregulate CD95 (Cluster Differentiation 95), are provided.

The term "mesenchymal stem cell (MSC)" refers to a multipotent stem cell capable of differentiating into various mesodermal cells including bone, cartilage, fat and muscle cells. The mesenchymal stem cells may be derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, chorionic membrane, decidua or placenta, preferably bone marrow derived mesenchymal stem cells (BM- Marrow-Mesenchymal Stem Cell).

The mesenchymal stem cells may also be derived from mammals other than humans, fetuses or humans. Mammals other than humans include, but are not limited to, canines, felines, monkeys, animals, cows, sheep, pigs, horses, rats, mice, guinea pigs and the like.

The mesenchymal precursor cells (FEMP) overexpress the epidermal growth factor receptor (EGF-R) as compared to conventional mesenchymal stem cells (MSC) and undergo low expression of CD95, Have the ability to proliferate, differentiate, and migrate, and can also exhibit excellent body viability. That is, the mesenchymal precursor cell (FEMP) may mean a cell having superior functionality than the existing adult-derived mesenchymal stem cell.

The Epidermal Growth Factor Receptor (EGF-R) is a cell-surface receptor for the epithelial growth factor family of extracellular protein ligands. It promotes the paracrine of stem cells to produce VEGF (Vascular Endothelial Growth Factor ) And HGF (Fibroblast Growth Factor), and the expression of various growth factors and cytokines such as HBGR (Heparin-Binding EGF-like Growth Factor) and AREG (Amphiregulin) The proliferation and differentiation ability of the stem cells can be improved.

In addition, the EGF-R may act on stem cells together with MAP kinase (Mitogen-Activated Protein Kinase) and PKC (Protein Kinase C) to improve the migration ability. Therefore, the mesenchymal precursor cells (FEMP) overexpressing the EGF-R may exhibit superior proliferative capacity, differentiation ability and migration ability as compared with conventional mesenchymal stem cells.

Furthermore, in inflammatory diseases such as cystitis and atopic dermatitis, the EGF-R may promote anti-inflammatory activity and skin regeneration through interaction with epidermal growth factor (EGF).

The CD95 (Cluster Differentiation 95) is also known as FasR (Fas Receptor), APO-1 (Apoptosis antigen 1) or TNFRSF6 (Tumor Necrosis Factor Receptor Superfamily Member 6) apoptosis, which is a death receptor.

Specifically, a ligand known as FasL (Fas Ligand) or CD95L (CD95 Ligand) binds to CD95, thereby forming a Death-Inducing Signaling Complex (DISC), and cell suicide may occur.

That is, when stem cells or progenitor cells overexpress the CD95, signaling of apoptosis of the cell can be activated by the CD95, whereas stem cells or progenitor cells expressing the CD95 relatively low can induce cell suicide signaling Can be suppressed to exhibit superior proliferative activity. Thus, the mesenchymal precursor cells (FEMP) may have superior proliferative capacity as compared to mesenchymal stem cells (MSC), particularly bone marrow-derived mesenchymal stem cells (BM-MSC). This property may mean that the stem cell graft has excellent cell viability.

The mesenchymal precursor cells (FEMP) are derived from embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs) or Somatic Cell Nuclear Transfer Cells (SCNTs) .

As used herein, the term " Embryonic Stem Cell (ESC) "refers to a method in which an inner cell mass (ICM) is extracted from a blastocyst embryo immediately before embryonic transfer of a mammalian embryo into the uterus of a mother, Refers to a pluripotency stem cell capable of differentiating into all the cells of an animal. In a broad sense, this concept includes embryoid bodies, induced pluripotent stem cells (iPSCs), and Somatic Cell Nuclear Transfer Cells (SCNTs) derived from embryonic stem cells .

The embryonic stem cells include, but are not limited to, all embryonic stem cells from mammals including humans, primates, cows, pigs, sheep, horses, dogs, rats, rats and livestock, It may be a stem cell.

The human embryonic stem cell may be, for example, H9 (James A. Thomson et al., Embryonic Stem Cell Lines Derived from Human Blastocysts. Science 1998 Dec 4; 282 (5395): 1827) And human embryonic stem cells can be easily constructed by those skilled in the art.

In contrast, the mesenchymal precursor cells (FEMP) are different from the mesenchymal stem cells (MSC) in terms of LTBP (Beta-Binding Protein), VEGF (Vascular Endothelial Growth Factor), KDR (Kinase Insert Domain Receptor) At least one angiogenesis factor selected from the group consisting of Frizzled, Fibroblast Growth Factor (FGF), Angiopoietin, Platelet-Derived Growth Factor Receptor (PDGFR) and Endothelial Monocyte-Activating Polypeptide (EMAP) Overexpression.

In addition, the mesenchymal precursor cells (FEMP) can overexpress at least one of migration factor of MMP (Matrix Metalloproteinase) and HGF (hepatocyte growth factor) compared to mesenchymal stem cell (MSC).

When the mesenchymal precursor cells (FEMP) are present around the injured tissue, anti-inflammatory activity, cell migration ability, and vascular regenerative activity may be important factors for the treatment. That is, the function of regenerating the injured blood vessels and the inflammation can be sequentially performed by moving the stem cells to tissues or organs where inflammation has occurred by a wound or the like. At this time, wound healing efficacy can be determined according to the level of each anti-inflammatory activity, migration ability and blood vessel regeneration efficacy. The moving ability can be understood as a concept including a homing ability to move from a target organ to a tissue.

Since the mesenchymal precursor cells (FEMP) overexpress an angiogenic factor and a migration factor compared to mesenchymal stem cells (MSC), they can rapidly migrate to target organs or tissues to restore vascular tissues. Therefore, A therapeutic agent for cell therapy, and the like.

Particularly, FGF (Fibroblast Growth Factor) among the angiogenic factors not only exhibits an anti-inflammatory activity effect together with the above-mentioned epidermal growth factor receptor (EGF-R), but also promotes skin regeneration and thus has a therapeutic effect on inflammatory diseases such as atopic dermatitis Can be improved.

On the other hand, as described above, the mesenchymal precursor cells (FEMP) may have excellent differentiation ability, for example, the ability to differentiate into adipocytes, osteocytes, chondrocytes or myocytes.

Therefore, the mesenchymal precursor cells can be used as a cell therapy agent suitable for the treatment of diseases and conditions such as diabetic retinopathy, interstitial cystitis, and hypersensitivity cystitis, and can exhibit excellent effects particularly in the treatment of inflammatory diseases.

In addition, the mesenchymal precursor cells (FEMP) overexpress the epidermal growth factor receptor (EGF-R), which can enhance the ability to proliferate compared to normal mesenchymal stem cells. Specifically, the doubling time for doubling the number of cells from the stem cell culture time may be 20 hours to 35 hours, preferably 24 hours to 32 hours. This cell proliferation ability means that the effect of the FEMP can be further improved as a cell therapy agent.

The mesenchymal precursor cells (FEMP) may exhibit anti-inflammatory activity by inhibiting the proliferation of PBMC (Peripheral Blood Mononuclear Cell) or inducing the secretion of IL-10 (Interleukin 10). Accordingly, the cell therapeutic composition can be applied as an effective therapeutic agent for atopic dermatitis, rheumatoid arthritis, interstitial cystitis, and the like. The PBMC may include T-cells, B-cells, NK (Natural Killer) cells, monocytes, macrophages, and the like.

Specifically, the mesenchymal precursor cells (FEMP) inhibit MHC (Major Histocompatibility Complex) expression in macrophages and inhibit T-cell activity by inhibiting CD28, CD80, and CD86 interactions.

In addition, IL-10 secreted by the mesenchymal precursor cells (FEMP) inhibits the expression of inflammatory enzymes such as iNOS (inducible nitric oxide synthase) and COX-2 (inducible cyclooxygenase) in macrophages, Lt; / RTI > Specifically, the mesenchymal precursor cells (FEMP) may increase the secretion of IL-10 in PBMC.

According to the excellent anti-inflammatory activity as described above, the mesenchymal precursor cells can be used as a therapeutic composition for anti-inflammatory cells.

In addition, the cell therapeutic composition may further comprise a support, preferably a biodegradable support, for receiving the mesenchymal precursor cells (FEMP). The biodegradable scaffold may be a hydrogel such as fibrin glue, hyaluronic acid, gelatin, collagen, alginic acid, cellulose, pectin, chitin, polyglycolic acid or polylactic acid, but is not limited thereto.

The cell therapeutic composition may further comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be a mixture of one or more of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, human serum albumin (HSA) , And if necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added.

The cell therapeutic composition may be formulated into a form for injection, such as an aqueous solution, a suspension or an emulsion, by adding a diluent, a dispersant, a surfactant, a binder and a lubricant, but is not limited thereto.

New with enhanced functionality Intermittency Of progenitor cells (FEMP)  Manufacturing method

According to another embodiment of the present invention, there is provided a method for producing an embryoid body, comprising the steps of: (a) providing an embryoid body derived from embryonic stem cell (ESC), inducible precursory pluripotent stem cell (iPSC) or somatic cell nucleated stem cell (SCNT) Culturing on a cell culture insert; (b) separating the precursor cells transferred to the lower part of the cell culture insert; And (c) comparing the expression level of epidermal growth factor receptor (EGF-R) and CD95 of the progenitor cells with the level of expression of mesenchymal stem cells (MSC). do.

The embryonic stem cell, inducible precursor differentiation stem cell and somatic cell nuclear-replaced stem cell in the step (a) are as described above.

As used herein, the term " EB (Embryoid Body) "refers to a cell aggregate formed by adherence of embryonic stem cells. When embryonic stem cells from which elements that maintain undifferentiated state are removed are inoculated into a hydrophobic culture container, The embryonic stem cells do not adhere to the bottom of the culture vessel, but aggregate between the cells to form an amphibian with a size of 1 mm or less. The body may have the ability to differentiate into three components (endodermic, mesodermal, ectodermal) constituting the body composition of a mammal.

As used herein, the term "cell culture insert" is a device having a porous membrane. When cultured from embryonic stem cells, inducible precursor differentiation stem cells or somatic cell nuclear-derived stem cells, (EMT) is a mechanism that allows naturally occurring EMT (epithelial-mesenchymal transition) to occur. At this time, the pore size of the porous membrane may be 1 탆 to 20 탆, preferably 6 탆 to 12 탆, more preferably 8 탆.

As the culture medium of the cell culture insert, EGM2-MV, DMEM, MEM-α, STEMPRO-MSC and MesenCult-MSC medium can be used. EGM2-MV, DMEM or MEM- But is not limited thereto.

In addition, the cell culture insert may include at least one additive selected from the group consisting of FBS (Fetal bovine serum), SR (Serum replacement), and HPL (Human platelet lysate).

Specifically, the additive may be 1-10% FBS, 1-10% SR or 1-10% HPL, preferably 5% FBS or 2.5-5% HPL, but is limited to no.

In the step (b), the precursor cells, specifically, the mesenchymal precursor cells (FEMP) migrating to the lower part of the cell culture insert through the porous membrane after the step (a) can be isolated. At this time, the FEMP may be aggregated in the form of epithelial cells under the cell culture insert.

The multifunctional mesenchymal precursor cells (FEMP) can be separated by single cell separation through enzymatic separation, or by mechanical separation, followed by separation into an epithelial cell sheet. It may be desirable to use a mechanical method.

As used herein, the term "enzymatic separation" refers to a method of separating cell aggregates through enzymatic treatment. Specifically, the term " collagenase ", " collagenase ", " collagenase ", & (Accutase), Dispase, trypLE or trypsin-EDTA, preferably trypLE, a hypothetical enzyme, but is not limited thereto.

As a mechanical separation method, there can be used a method of separating and culturing in the state of maintaining a circular form of the epithelial cell shape using a scrapper.

The step (c) comprises comparing the expression level of the specific marker of the precursor cells isolated in step (b) with the expression level of mesenchymal stem cell (MSC), specifically bone marrow-derived mesenchymal stem cell (BM-MSC) , The marker may be the epidermal growth factor receptor (EGF-R) and CD95.

Accordingly, when the precursor cells isolated in step (c) overexpress the epidermal growth factor receptor (EGF-R) and undergo low expression of CD95 compared to the mesenchymal stem cells, the multifunctional mesenchymal precursor cells (FEMP) As shown in FIG. Specific marker characteristics are the same as described above.

Since the mesenchymal precursor cells prepared according to the above method are excellent in anti-inflammatory activity effect, they can be selected according to the level of marker expression such as EGF-R and CD95 and mixed with supporters, carriers, diluents and other additives. The support, carrier and the like are as described above.

Hereinafter, embodiments of the present invention will be described in detail.

Example 1: Isolation of human embryonic stem cell (hESC) derived mesenchymal precursor cells (FEMP)

FIG. 2 is an image of each step of the method for preparing mesenchymal precursor cells according to an embodiment of the present invention.

2, human embryonic stem cells (A) were initially differentiated through formation of a soma (B) in a normal oxygen state (37 ° C, 5% CO ₂ cell incubator) And plated on the culture insert (C). (Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12) containing 20% SR (Serum Replacement), 1% NEAA (non-essential amino acid), 0.1% β-mercaptoethanol and 1% anti- Medium was used.

The dendritic cells were cultured on the cell culture inserts for 1 to 10 days, and it was confirmed that the precursor cells migrated to the lower part of the insert to form sheets of epithelial cells (D). RT-PCR analysis confirmed the migration pattern of each cell and the results are shown in FIG. Specific conditions such as marker gene, primer base sequence and the like are shown in Table 1 below.

gene Primer base sequence Temperature
(° C) Number of times
(cycle) NCBI Reference
Sequence Oct4 Sense AACTCGAGCAATTTGCCAAGCTCC 55 30 NM_001110336.1 Anti-sense TTCGGGCACTGCAGGAACAAATTC Nanog Sense CAAAGGCAAACAACCCACTT 55 30 NM_024865.2 Anti-sense TCTGCTGGAGGCTGAGGTAT

3, human embryonic stem cells (hESCs) remaining on the cell culture insert express a pluripotency marker, Oct4 and Nanog, at a certain level, whereas the human embryonic stem cell (hESC) Progenitor cells (FEMP) showed almost no expression of Oct4 and Nanog similar to human embryonic fibroblasts (hEF).

These results indicate that the mesenchymal precursor cells (FEMP) migrating to the lower part of the cell culture insert through epithelial-mesenchymal transition can be easily separated, and the mesenchymal precursor cells (FEMP) ), Which can be predicted to exhibit different characteristics.

Example  2: human embryonic stem cells ( hESC ) Origin Intermittency Of progenitor cells (FEMP)  Cultivation and proliferation

FIG. 2 is an image of each step of the method for producing stem cells according to an embodiment of the present invention.

2, the mesenchymal precursor cells (FEMP) sheet formed in the lower part of the cell culture in Example 1 was peeled off (E) using a scrapper and transferred to a new culture dish and subcultured. At this time, EGM-2MV medium containing 5% FBS (Fetal Bovine Serum) was used as a culture medium.

Specifically, when the stem cells spread out from the epithelial-shaped sheet, the epithelial-shaped sheet was taken out, and the stem cells were continuously cultured to obtain stem cells continuously. The remaining stem cells were removed by using trypLE and subcultured.

As a result of observing the precursor cells of passage 1 (F), 5 passage (G) and 7 passage (H), no abnormalities were found in the morphology and characteristics of the precursor cells. These results indicate that the method of using the porous membrane without restriction of the passage of the mesenchymal precursor cells (FEMP) derived from human embryonic stem cells is a method of isolating and culturing the previously reported human embryonic stem cell-derived mesenchymal stem cells Lt; / RTI >

As a result of using 2.5% and 5% HPL (human platelet lysate) instead of 5% FBS, subcutaneous precursor cells (FEMP) were subcultured under the same conditions as above. As in the case of using FBS, (Fig. 4).

Example 3: Chromosomal analysis of mesenchymal precursor cells (FEMP)

To determine whether the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2 exhibited normal chromosomal characteristics regardless of the number and duration of passage, karyotyping was performed on the 9th and 19th stem cells.

Specifically, 20 μl of colchicine solution at a concentration of 100 μg / μl was mixed in a culture container containing 10 ml of the culture solution, and the mixture was allowed to stand at 37 ° C for 2 hours. Thereafter, the solution was centrifuged at 500 rpm, and the supernatant was removed, and the cells were suspended in 5 ml of stock solution (0.075 M KCl) and left in a constant temperature water bath at 37 ° C for 25 minutes. Five drops of methanol (glacial acetic acid = 3: 1, v / v) was added to each tube and centrifuged at 1,200 rpm for 8 minutes. The supernatant was removed and the cells were suspended in 5 ml fixative, For 10 minutes was repeated twice. The cells were suspended in 0.5 ml of the fixative, and the cell suspension was added dropwise onto the slide glass immersed in 70% ethanol. The ethanol on the slide was dried using an alcohol lamp, the moisture was removed from the air, and the cover slip was covered and observed with a microscope (FIG. 5).

Referring to FIG. 5, it was confirmed that the mesenchymal precursor cells (FEMP) showed normal chromosomal characteristics irrespective of the number and duration of the passage.

Example 4: Marker expression analysis of mesenchymal precursor cells (FEMP)

In order to confirm the cell characteristics of the 11th passage and 21th passage mesenchymal precursor cell (FEMP) prepared according to Example 2, the expression of the marker was analyzed using a fluorescence activated cell sorting (FACS). Specifically, stem cells were detached using trypsin-EDTA and suspended in PBS (Phosphate Buffered Saline) at a concentration of ⁵ x ¹⁰ cells / ml. Each of the cells was incubated for 45 min at room temperature with addition of CD73, CD95, CD44, CD11b, CD14, CD19, CD34, CD45, HLA-DR and EGF-R (anti- After the reaction, flow cytometry analysis was performed on each of the cells. The results are shown in Table 2, and the results of EGF-R and CD95 are shown in FIG. At this time, bone marrow-derived mesenchymal stem cells (BM-MSC) and 16-pass fibroblasts were used as control groups.

Marker BM-MSC p7 FEMP p11 FEMP p21 Fibroblast p16 CD73 99.75 99.27 98.92 99.4 CD95 93.64 12.38 18.07 93.90 CD44 99.59 99.79 99.65 97.43 CD11b 0.36 0.03 0.32 0.34 CD14 0.4 0.11 0.22 0.73 CD19 0.19 0.04 0.13 0.16 CD34 1.79 1.49 1.42 0.37 CD45 0.15 0.14 0.15 0.33 HLA-DR 0.36 0.1 0.06 0.26 EGF-R 15.26 85.93 58.43 98.84

(unit: %)

Referring to Table 2 and FIG. 6, it can be seen that the mesenchymal precursor cells (FEMP) overexpress EGF-R by about 40% to 70% and CD95 by about 80% as compared to BM-MSC. These results suggest that the mesenchymal precursor cells (FEMP) exhibit superior proliferative and differentiating ability than BM-MSC.

In addition, markers such as CD73 were strongly expressed, and hematopoietic stem cell markers such as CD34 and CD45 were not expressed, and thus the mesenchymal precursor cells (FEMP) were analyzed to include the characteristics of the normal mesenchymal stem cells and the pluripotency , And actually it was differentiated into adipocytes, bone cells, muscle cells and the like (Fig. 7).

Example 5 : Morocco To Ligand  by Intermittency Progenitor cells (FEMP) and  BM- MSC  Of cell death

Fas In order to confirm the ligand-induced apoptosis phenomenon, recombinant Fas ligand was treated with mesenchymal precursor cells. At this time, bone marrow-derived mesenchymal stem cells (BM-MSC) were used as a control group and A549 was used as a positive control group. Specifically, 100 μl of each of BM-MSC, FEMP, and A549 cells was seeded at 1 × 10 ⁴ cells / well in 96-well culture plates and cultured at 37 ° C for 24 hours. Then, apoptosis Recombinant human Fas ligand was reacted at concentrations of 0, 50, 100 and 500 ng / ml for 24 hours. Cell viability was analyzed by CCK-8 assay to identify populations of apoptotic cells. The results of the analysis are shown in Fig.

Referring to FIG. 8, when BM-MSC was treated with Fas ligand, apoptotic cells were increased in a concentration-dependent manner. In particular, it was confirmed that apoptotic cells increased 40.64 ± 12.02% on day 1 after treatment with 500 ng / ml Fas ligand. However, it was confirmed that 21.19 ± 7.21% increase of mesenchymal precursor cells (FEMP).

These results indicate that the cell death is inhibited by Fas ligand because the mesenchymal precursor cell (FEMP) is a CD95 low expression cell, and that BM-MSC is a CD95-expressing cell, thereby promoting apoptosis. This result influences the growth and apoptosis of MSCs dependent on the Fas ligand depending on the CD95 expression level.

Example 6: Analysis of proliferation characteristics of mesenchymal precursor cells (FEMP)

In order to confirm the proliferation characteristics of the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2, the cell proliferative capacity of the 16-stage mesenchymal precursor cells (FEMP) cultured under normal oxygen partial pressure was evaluated by viable cell density density (cells / cm ² ). At this time, 16-line bone marrow-derived mesenchymal stem cells (BM-MSC) cultured under normal oxygen partial pressure were used as a control group.

Each stem cell was plated in 3 wells (16, 17, 18, 19 passages) at a density of 2.0 × 10 ⁴ cells / plate in a 6 well plate culture dish. Each stem cell was cultured at normal oxygen partial pressure and then separated on a culture dish using 0.25% trypsin for each culture period. The average number of cells was determined by repeating the cell count three times using a hemocytometer, and the results are shown in Table 3 below.

Group Passage 16 Passage 17 Passage 18 Passage 19 BM-MSC doubling time (dT) 39.7559 51.7705 52.2821 59.7651 PDL (times) 2.3691 1.8203 1.8051 1.5818 FEMP doubling time (dT) 24.2851 25.6893 36.5355 31.8651 PDL (times) 3.9357 3.6722 2.6305 2.9216

Referring to Table 3, it can be seen that the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2 were significantly reduced in doubling time compared to bone marrow-derived mesenchymal stem cells (BM-MSC) have.

Specifically, it is analyzed that BM-MSC exhibits a doubling time of over 39 hours, whereas the mesenchymal precursor cell (FEMP) shows a doubling time of less than 32 hours, indicating significantly enhanced proliferative capacity.

Example 7: Analysis of migration characteristics of mesenchymal precursor cells (FEMP)

In order to confirm the migration characteristics of the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2, the number of mobile cells was measured using a 35 mm high-culture-insert (high culture-insert) Respectively. At this time, bone marrow-derived mesenchymal stem cells (BM-MSC) were used as a control group.

Specifically, the mesenchymal precursor cells (FEMP) and BM-MSC were seeded at a concentration of 3 × 10 ⁴ cells / well in an amount of 70 μl at 35 μl of each μ-dish, cultured at 37 ° C. for 24 hours, Culture-insert was removed, 2 ml of 10% DMEM was added, and then the number of migrated cells was counted by a microscope. The results of the analysis are shown in FIG.

9, it can be seen that the number of mesenchymal precursor cells (FEMP) cells is significantly higher than that of BM-MSCs. These results indicate that the mesenchymal precursor cells (FEMP) .

Example 8: Analysis of angiogenic factors and migration factors of mesenchymal precursor cells (FEMP)

In order to confirm the expression characteristics of the angiogenesis factor and migration factor of the mesenchymal precursor cells (FEMP) of Examples 1 and 2, in the same manner as in Example 4, (BMEMC) and bone marrow-derived mesenchymal stem cells (FEMP).

The results of the analysis are shown by the fold change of the FEMP / BM-MSC, and the cutoff value is set to 1.1, as shown in FIG.

10, the migration factors MMP-1 and HGF were expressed more than 1.3 times in the mesenchymal precursor cells (FEMP) as compared to the BM-MSC, and the mesenchymal precursor cells (FEMP) , Which is a result consistent with the seventh embodiment.

Compared with BM-MSC, various angiogenic factors such as LTBP-1, ANG-1 and FGF-16 are expressed at high levels in mesenchymal precursor cells (FEMP), especially LTBP-1, VEGF- Frizzled-1 and FGF-16 were expressed more than 1.3-fold, indicating that the mesenchymal precursor cells (FEMP) had better angiogenic potential than BM-MSC.

From these results, it can be seen that the mesenchymal precursor cells (FEMP) can achieve excellent efficacy as an anti-inflammatory as well as an angiogenesis, ie, a cell therapy agent for use in damaged blood vessel regeneration.

Example 9: Inhibition effect of PBMC proliferation of mesenchymal precursor cells (FEMP)

In order to confirm PBMC (Peripheral Blood Mononuclear Cell) proliferation inhibitory effect of the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2, cell numbers (n = 1000, 2000, 5000, 10000) The mesenchymal precursor cells (FEMP) and bone marrow-derived mesenchymal stem cells (BM-MSC) were co-cultured for 5 days in 96-well plates containing 2 × 10 ⁵ cells / well of PBMC (Peripheral Blood Mononuclear Cell). Each test group was labeled with CFSE (Carboxy Fluorescein Succinimidyl Ester) to measure PBMC proliferation inhibition (%). The results are shown in Table 4 and FIG.

Cell number BM-MSC FEMP 1000 0.70 + - 0.56 2.09 ± 0.20 2000 0.31 0.32 4.10 ± 0.61 5000 6.01 ± 1.16 12.83 + - 0.60 10000 3.54 1.81 36.24 0.41

Referring to Table 4 and FIG. 11, the mesenchymal precursor cells (FEMP) showed an improved PBMC inhibition rate at the same number of cells as compared with BM-MSC, .

These results suggest that the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2 inhibit the proliferation of PBMCs formed by blood vessel, tissue damage, etc., and thus can be applied as a cell therapy agent exhibiting excellent anti-inflammatory activity.

Experimental Example 10: Effect of inducing IL-10 secretion of mesenchymal precursor cells (FEMP)

In order to confirm the anti-inflammatory activity, specifically IL-10 (Interleukin 10) induction, of the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2, 1 x 10 ⁶ cells / well of PBMC (Peripheral Blood Mononuclear Cells were plated on 96-well plates and induced inflammation with 100 ng / ml LPS.

Specifically, the concentration of IL-10 was measured in each experimental group with and without LPS treatment and with or without FEMP or BM-MSC treatment, and the results are shown in Table 5 and FIG.

Experimental group IL-10 concentration (pg / ml) PBMC -5.20 ± 5.29 PBMC + LPS 39.96 + - 3.38 PBMC + BM-MSC 2.70 ± 1.07 PBMC + BM-MSC + LPS 67.96 ± 2.16 PBMC + FEMP -4.69 + 0.71 PBMC + FEMP + LPS 56.58 ± 1.74

Referring to Table 5 and FIG. 12, it can be seen that a certain level of IL-10 was secreted from the PBMC induced by LPS as compared with before LPS addition. In addition, IL-10 was further increased when co-cultured with BM-MSC or FEMP for PBMCs that induced inflammatory responses to LPS.

These results suggest that not only mesenchymal stem cell (BM-MSC) derived from bone marrow but also mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2 induce secretion of IL-10 by PBMC in an inflammatory environment Suggesting that they may exhibit anti-inflammatory activity. Therefore, the composition containing the FEMP can be applied as a therapeutic agent for anti-inflammation.

Experimental Example  11: Intermittency Of progenitor cells (FEMP)  Analysis of cystitis treatment effect

Animal models were prepared to confirm the therapeutic effect of the mesenchymal precursor cells (FEMP) prepared according to Examples 1 and 2 on cystitis. A 24-gauge catheter was inserted into the bladder of a 6-week-old female SD rat, exposed to 0.2 mM HCl for 10 minutes, neutralized by treating with 1 M bicarbonate for 10 minutes, and then washed twice with PBS to induce cystitis.

After one week, the abdominal cavity was opened to expose the bladder, and the mesenchymal precursor cells were treated at the concentration level between the bladder outer membrane and the inner membrane, and the control group was treated with PBS and sutured. At 4 weeks and 8 weeks after the transplantation of the cells, the tissue was excised to prepare tissue slides, and H & E stain was performed to observe the results on a microscope.

Referring to FIG. 13, infiltration of inflammatory cells and formation of granulation were observed in the lining of the bladder in the control group treated with PBS, and hyperproliferation of epithelial cells was observed.

Mesenchymal progenitor cells (FEMP) a low concentration ^{(1x10 5 cell / 100㎕, 1x10} 6 cell / 100㎕) treated group, although not verified. The results are shown or cystitis distinct therapeutic effects similar to the control group, treatment the concentration 3x10 ⁶ or more In one group, the bladder epithelium and lamina propria tissue were recovered to a similar degree to normal tissue.

From these results, it can be seen that the mesenchymal precursor cells (FEMP) can be applied for the treatment of cystitis, especially for the treatment of interstitial cystitis.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. For example, if the techniques described are performed in a different order than the described methods, and / or if the described components are combined or combined in other ways than the described methods, or are replaced or substituted by other components or equivalents Appropriate results can be achieved.

Therefore, other implementations, other embodiments, and equivalents to the claims are also within the scope of the following claims.

Claims (13)

(EGF-R, Epidermal Growth Factor Receptor) over mesenchymal stem cell (MSC)
The present invention relates to a cell therapy composition for anti-inflammatory cells, which comprises as an active ingredient, mesenchymal precursor cells which express CD95 (Cluster Differentiation 95) at a lower level than mesenchymal stem cells.
The method according to claim 1,
The present invention relates to a mesenchymal precursor cell derived from an embryonic stem cell (ESC), an induced pluripotent stem cell (iPSC) or a somatic cell nuclear transfer cell (SCNT) ≪ / RTI >
3. The method of claim 2,
Wherein the embryonic stem cell comprises mesenchymal precursor cells derived from a mammal as an active ingredient.
The method according to claim 1,
In contrast to mesenchymal stem cells, LTBP (Beta-binding protein), VEGF (vascular endothelial growth factor), KDR (Kinase insert Domain Receptor), FZD (Frizzled), FGF (Fibroblast Growth Factor), ANG ), An at least one angiogenesis factor selected from the group consisting of Platelet-Derived Growth Factor Receptor (PDGFR) and Endothelial Monocyte-Activating Polypeptide (EMAP). An anti-inflammatory cell therapeutic composition.
The method according to claim 1,
A cell therapy composition for anti-inflammation, comprising as an active ingredient, mesenchymal precursor cells overexpressing at least one of a matrix metalloproteinase (MMP) and a hepatocyte growth factor (HGF) as compared to mesenchymal stem cells.
The method according to claim 1,
The present invention relates to a cell therapy composition for anti-inflammation, which comprises, as an active ingredient, a mesenchymal precursor cell having an ability to differentiate into adipocyte, osteocyte, chondrocyte or myocyte.
The method according to claim 1,
Wherein the composition comprises a mesenchymal precursor cell having a doubling time of 20 hours to 35 hours as an active ingredient.
The method according to claim 1,
A cell therapy composition for antiinflammatory, comprising as an active ingredient a mesenchymal precursor cell which inhibits the proliferation of PBMC (Peripheral Blood Mononuclear Cell).
The method according to claim 1,
IL-10 (Interleukin 10) secreted by a cell line, comprising as an active ingredient a mesenchymal precursor cell. delete delete delete delete

Images