KR20180046438A

KR20180046438A - SNP marker for classifying species of necrophagous fly and use thereof

Info

Publication number: KR20180046438A
Application number: KR1020160141319A
Authority: KR
Inventors: 박성환; 박지혜
Original assignee: 고려대학교 산학협력단
Priority date: 2016-10-27
Filing date: 2016-10-27
Publication date: 2018-05-09
Also published as: WO2018080225A3; WO2018080225A2; KR101861930B1

Abstract

TECHNICAL FIELD The present invention relates to SNP markers for classifying taste buds and their uses, and more particularly, to a SNP marker composition, a kit, a microarray, and a method for distinguishing a tasteful flies for species discrimination of taste buds.
The SNP markers for distinguishing the tasting flies of the present invention and the composition for distinguishing them can be used for criminal investigation such as estimation of death time since they can be used as means for easily distinguishing species of tasting flies with high accuracy .

Description

SNP markers for the identification of species-specific flies and their uses {SNP markers for classifying species of necrophagous fly and use thereof]

TECHNICAL FIELD The present invention relates to SNP markers for classifying taste buds and their uses, and more particularly, to a SNP marker composition, a kit, a microarray, and a method for distinguishing a tasteful flies for species discrimination of taste buds.

It is very important to accurately determine the time of death or postmortem interval (PMI) in a murder investigation. Corruption, which begins after the death of all animals, including humans, is caused by interventions of intestinal flora and tidal arthropods, which are characterized by the presence of necrophagous insects entering the body species. In particular, black tanks (Calliphoridae), jipparigwa (Muscidae), swiparigwa (Sarcophagidae), Cheese Thief tanks (Piophilidae), flea tanks flies species (necrophagous fly species) Tasting Castle belongs to (Phoridae) have come to the body within a few minutes after death Larvae of flies (ie, maggots) growing in the body are considered to be the most accurate indicators of the post-mortem time in the forensic field, since they hatch and continue to grow after spawning and after a certain period of time.

As described above, in order to estimate the post-elapsed time using insect evidence such as fly larvae, it is necessary to estimate the post-elapsed time of the growth rate, which is the most important factor in estimating the post-elapsed time, ), Diapause response, and ecological habits are very different, so it is necessary to pinpoint the species of flies. However, only highly skilled specialists can distinguish parasites by their morphological characteristics, and immature individuals with little morphological characteristics such as flies, eggs, larvae, and pupae, There is a disadvantage that identification is very difficult.

In addition, most of the insect evidence collected at the murder scene is the immature flies, Maggots or Pupae, which are growing in the body rather than the flies. Therefore, it takes a lot of time and effort to actually apply to the case, so it is required to develop a method that can identify the flies more accurately, simply and quickly.

In this regard, active research and development has been carried out on methods for identifying species by molecular genetics. It has been reported that mtDNA genetic markers can identify tidal parasites (Sperling G. et al., In Early Vision and Beyond, Cambridge, MA: MIT Press, 1994. pp. 133-142. (Seong Hwan Park et al., J Forensic Sci, September 2009, pp. 219-222), a method for distinguishing the species belonging to the black flies or the falciparum is described by analyzing the sequence analysis of CO I (Cytochrome C Oxidase Subunit I) Vol. 54, No. 5; Yu-Hoon Kim et al., The Scientific World Journal, Volume 2014, Article ID 275085, 9 pages). However, the method of identification through such sequencing requires a large amount of DNA, which is disadvantageous in that it takes a long time.

Under these circumstances, the present inventors have made intensive efforts to develop a method for distinguishing species of tasting flies in a short time using a small amount of DNA. As a result, SNP markers specific for the taste buds were selected, The inventors have developed a primer set capable of specifically detecting only markers, and have confirmed that it is possible to easily distinguish flies belonging to the tasting flies by using the primer sets.

It is an object of the present invention to provide a method for detecting A, T, G, A, C, T or G, wherein the 90th base of COI (Cytochrome C Oxidase Subunit I) Or T, wherein the 261st base is A, C or T, the 252st base is A or G, the 243st base is C or T, and the 902nd, 728th, 168th, 261th, To provide SNP marker compositions for species discrimination of tasteful flies, comprising a polynucleotide consisting of 5 to 300 consecutive bases or a complementary polynucleotide thereof.

It is another object of the present invention to provide a composition for distinguishing species of tasteful flies, which comprises an agent capable of detecting the SNP marker.

It is still another object of the present invention to provide a kit for sorting a tasteful flies containing the above-mentioned composition for distinguishing.

It is still another object of the present invention to provide a method for screening a compound of the present invention wherein the 90th base of CO I (Cytochrome C Oxidase Subunit I) gene represented by SEQ ID NO: 20 is A or T, the 72th base is A, C, T or G, Is A or T, the 261st base is A, C or T, the 252st base is A or G, the 243st base is C or T, and the 90th, 72nd, 168th, 261th, 252nd and 243rd bases are A polynucleotide consisting of 5 to 300 consecutive bases, or a polynucleotide complementary thereto.

Another object of the present invention is to provide a method for amplifying polymorphic DNA comprising: (a) amplifying a polymorphic site comprising the SNP of the polynucleotide of SEQ ID NO: 20 or a polynucleotide complementary thereto from the DNA of the sample isolated from the tasteful flies; And (b) determining the base of the amplified polymorphic site.

It is an object of the present invention to provide a method for detecting A, C or T at position 1491 of COI (Cytochrome C Oxidase Subunit I) gene of SEQ ID NO: 20, A, T or G at position 1488, Or T, wherein the 1485th base is A or G, and a polynucleotide consisting of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases, or a complementary polynucleotide thereof. And to provide a marker composition for species distinction of flies.

It is still another object of the present invention to provide a method for detecting the presence or absence of a nucleotide sequence in which the 1491th base of the COI (Cytochrome C Oxidase Subunit I) gene of SEQ ID NO: 20 is A, C or T, the 1488th base is A, T or G, Is A or T, the 1485th base is A or G, and the polynucleotide is composed of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases, or a complementary polynucleotide thereof. And to provide a microarray for distinguishing species of tasteable flies.

In order to accomplish the above object, one embodiment of the present invention is a method for producing a recombinant vector, wherein the 90th base of CO I (Cytochrome C Oxidase Subunit I) gene represented by SEQ ID NO: 20 is A or T, the 72nd base is A, Wherein the 168th base is A or T, the 261st base is A, C or T, the 252st base is A or G, the 243st base is C or T, and 90, 72, 168, 261, 252 And a polynucleotide consisting of 5 to 300 consecutive bases comprising the 243 base or a complementary polynucleotide thereof.

In the present invention, a SNP marker specific to the tasting flies was selected, and a primer set capable of specifically detecting only the SNP markers was developed. The use of the primer set can easily discriminate the flies belonging to the tasting flies Respectively. It was confirmed that the species can be distinguished more quickly and accurately by using a small amount of DNA equivalent to about 1 ng. Thus, the present invention has been completed.

The term "CO I (Cytochrome C Oxidase Subunit I) gene" of the present invention is a membrane protein existing in the mitochondria of bacteria and eukaryotes, and is a DNA marker used for classifying the species. Protein information is known from NCBI (Accession: ACL01376.1, AMH84773.1, etc.). In the present invention, the CO I gene may include, but is not limited to, the polynucleotide of SEQ ID NO: 20.

The term "tasting flies" of the present invention means flies found in a body, and is known as the first to arrive after the occurrence of a dead body. Tasting Castle Paris belongs like black tanks (Calliphoridae), swiparigwa (Sarcophagidae), jipparigwa (Muscidae), Cheese Thief tanks (Piophilidae), flea tanks (Phoridae).

The tasting flies are, for example, Lucilia ampullaceae ), a goldfinch ( Lucilia caesar ), a two-tailed golden-fern ( Triceratopyga calliphoroides , Lucilia illustris , Calliphora lata , black chrysomya megacephala , large black chick gold flies ( Chrysomya pinguis), black geumpari (Phormia regina), copper geumpari (Lucilia sericata) red cheeks blowfly (Calliphora vicina ), black fly ( Aldrichina grahami ), red calf large house fly ( Muscina angustifrons , Parasarcophaga albiceps , Sarcophaga dux , Sarcophaga hemorrhoidalis , Sarcophaga melanura , Sarcophoga peregrina , Sarcophaga similis , or Sarcophaga crassipalpis , but are not limited thereto.

The term "distinction" of the present invention means to classify, distinguish, distinguish, identify, or judge different tasting flies.

The term "SNP marker" of the present invention means a single nucleotide polymorphism (SNP) allele base pair on a DNA sequence used to identify an individual or species. Because SNPs are relatively frequent and stable and distributed throughout the genome, genetic diversity of individuals occurs, and SNP markers can serve as an indicator of genetic proximity among individuals. SNP markers generally involve phenotypic changes associated with single nucleotide polymorphisms but may or may not be.

In this specification, the 'SNP marker' may be named in combination with 'SNP'.

In the present invention, the SNP marker may be all or some of the polynucleotides including the SNP region of the COI gene represented by SEQ ID NO: 20, and more specifically, the nucleotide sequence of SEQ ID NO: Is A or T, the 72nd base is A, C, T or G, the 168th base is A or T, the 261st base is A, C or T, the 252nd base is A or G, Wherein the base is C or T and comprises 5 to 300, particularly 25 to 280, more particularly 45 to 260 consecutive bases comprising the 90, 72, 168, 261, 252 and 243 base, But are not limited to, SNP markers for species discrimination of tasting flies, including polynucleotides or complementary polynucleotides.

In a specific embodiment of the present invention, the class of mitochondrial nucleotide sequences of the flies (CO I; Species-specific SNPs were identified (Table 1) by identifying variations in species based on the Cytochrome C Oxidase Subunit Ⅰ gene region.

Another embodiment provides a composition for distinguishing species of tasteable flies, comprising an agent capable of detecting the SNP marker.

The term "agent capable of detecting a SNP marker" of the present invention means an agent capable of specifically recognizing the SNP marker contained in the SNP marker composition and recognizing it, or detecting and amplifying the SNP marker, For example, a probe capable of specifically binding to a polymorphic site containing the SNP marker or a primer capable of specifically detecting and amplifying a polynucleotide including the SNP marker or a complementary polynucleotide thereof ).

The term "probe" of the present invention means a nucleic acid fragment which is labeled with RNA or DNA corresponding to a few bases or a few hundred bases, which can achieve specific binding with mRNA. The probe can be produced in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like.

In the present invention, a probe that binds to and recognizes a SNP marker includes a sequence complementary to a polynucleotide sequence including a SNP, but may be in the form of DNA, RNA or DNA-RNA hybrid. Further, fluorescent markers, radiation markers, and the like can be additionally attached to the 5 'or 3' ends of the probe so as to be visually recognizable.

The term "primer" of the present invention means a base sequence having a short free 3 'hydroxyl group and can form base pairs with a complementary template, It means a short sequence functioning as a point. In the present invention, primers used for detection and amplification of SNP markers, appropriate conditions in appropriate buffers (for example, four other nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) Stranded oligonucleotides that can serve as a starting point for template-directed DNA synthesis under the control of the primers. The appropriate length of the primers may vary depending on the intended use. The primer sequence is not necessarily completely complementary to the polynucleotide comprising the SNP marker or its complementary polynucleotide, and can be used if it is sufficiently complementary to hybridize.

In addition, primers can be modified, and specific examples include methylation, capping, substitution of nucleotides or modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, phosphoramidate, Carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

For purposes of the present invention, the sequences of the primers and their lengths may be suitably selected by those skilled in the art.

As a specific example, the sequence of the primer may be modified to improve the specificity and binding ability to the SNP marker, and a plurality of primers having different base sequences with respect to the same SNP marker may be used.

In addition, the length of the primers can be varied to differentiate the SNP markers by making the amplification products containing the SNP markers have different sizes, and it is also possible to use primers having the same length for the same SNP markers, The primer length is not particularly limited as long as a primer having a different length is used. As a more specific example, the length of each primer can be adjusted by adding a repeating base at the terminal thereof, and the type of the base can be A, T, G, C or a combination thereof. However, There is no limitation on the type of More specifically, the terminal of the primer may further include 1 to 100 bases, specifically 1 to 80 bases, more specifically 1 to 60 bases, but the base is not particularly limited thereto. And can be appropriately selected by those skilled in the art in accordance with the purpose.

In the present invention, the primer may be a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1 and 2 or 5 to 15, but is not limited thereto.

The nucleotide sequences used in the present invention are interpreted to include sequences showing substantial identity with the sequences listed in the sequence listing, considering mutations having biologically equivalent activities. The term " substantial identity " means aligning the sequence of the present invention to any other sequence as much as possible, and when the aligned sequence is analyzed using an algorithm commonly used in the art, Means a sequence showing 60% homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology.

Therefore, the base sequence having high homology with the nucleotide sequence shown in SEQ ID NO: 1 and 2 and 5 to 15, for example, the homology thereof is 70% or more, specifically 80% or more, more specifically 90% or more Nucleotide sequences having high homology are also to be construed as falling within the scope of the present invention.

In one specific example of the present invention, primers represented by SEQ ID NOs: 1 and 2 were prepared to detect DNA fragments containing SNPs (Table 3), and DNA amplification products amplified by SEQ ID NOS: 1 and 2 To detect only the SNP, primers represented by SEQ ID NOS: 5 to 15 were prepared by adjusting the length by adding T base at the ends (Table 4).

Another aspect provides a kit for sorting a tasteful flies comprising the above-mentioned composition for distinguishing.

The kit of the present invention can distinguish species of tasteful flies by detecting and identifying bases of the SNP markers provided in the present invention using the composition for differentiation of the present invention. Specifically, the kit may be a PCR kit or a DNA chip kit, but is not limited thereto.

As a specific example, the kit may be a kit containing essential elements necessary for performing PCR. For example, a PCR kit can contain test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), ddNTPs (ddNTPs), as well as specific primers for the SNP markers. , Enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. It may also contain a primer pair specific for the gene used as a quantitative control.

As another example, the kit of the present invention may be a DNA chip kit for distinguishing species of a taste bud based on essential elements necessary for carrying out a DNA chip.

The term "DNA chip" of the present invention means one of DNA microarrays capable of identifying each base of hundreds of thousands of DNAs at a time. The DNA chip kit is formed by attaching nucleic acid species to a glass surface, which is generally not larger than a flat solid support plate, typically a slide for a microscope, in a gridded array. The nucleic acid is uniformly arranged on the chip surface, It is a tool that enables multiple parallel hybridization reactions between the nucleic acid on the chip and the complementary nucleic acid contained in the treated solution on the chip surface.

Another embodiment provides a microarray for classifying a taste bud based on a SNP marker composition for species discrimination of a taste bud.

Specifically, the microarray is characterized in that the 90th base of the CO I (Cytochrome C Oxidase Subunit I) gene represented by SEQ ID NO: 20 is A or T, the 72nd base is A, C, T or G, Or T, wherein the 261st base is A, C or T, the 252st base is A or G, the 243st base is C or T, and the 902nd, 728th, 168th, 261th, A polynucleotide consisting of 5 to 300 consecutive bases or a polynucleotide complementary thereto.

The microarray may comprise DNA or RNA polynucleotides. The microarray comprises a conventional microarray except that the polynucleotide of the present invention is contained in the probe polynucleotide.

Methods for producing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art. The probe polynucleotide means a polynucleotide capable of hybridizing, and means an oligonucleotide capable of binding to the complementary strand of the nucleic acid in a sequence-specific manner. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member but does not hybridize to a fragment derived from another member . In this case, the hybridization conditions show a significant difference in the intensity of hybridization between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms. The probe of the present invention can be used to detect alleles and to distinguish species of tasting flies. Such discrimination methods include detection methods based on hybridization of nucleic acids such as Southern blots, and may be provided in a form preliminarily bonded to a substrate of a DNA chip in a method using a DNA chip. The hybridization may be carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher. For example, conditions of 5x SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 < 0 > C may be suitable for allele-specific probe hybridization.

The process of immobilizing the probe polynucleotide associated with species discrimination of the tasteful flies of the present invention on a substrate can also be easily carried out using this conventional technique. In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. The detection can be accomplished, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal comprising a fluorescent material, such as Cy3 and Cy5, and then hybridizing on the microarray and generating The hybridization result can be detected.

(A) amplifying a polymorphic site comprising the SNP of the polynucleotide of SEQ ID NO: 20 or a complementary polynucleotide thereof from the DNA of the sample isolated from the tasteful flies; And (b) determining the base of the amplified polymorphic site.

As described above, the SNP marker composition for discriminating species of tasting flies provided in the present invention is a polynucleotide of SEQ ID NO: 20 capable of discriminating species of tasting flies, specifically COI (Cytochrome C Oxidase Subunit I) contains each SNP marker contained in the polynucleotide of the gene,

(C) the polynucleotide of SEQ ID NO: 20, wherein the 90th base is A, the 72st base is C, the 168th base is T, the 261st base is C, the 252st base is G, When the 243rd base is T, the blue lily ( Lucilia ampullaceae ); < / RTI >

In the polynucleotide of SEQ ID NO: 20, when the 90th base is A, the 72nd base is C, the 168th base is T, the 261st base is C, the 252st base is A, and the 243rd base is T , &Lt; / RTI > Lucilia caesar ;

In the polynucleotide of SEQ ID NO: 20, when the 90th base is A, the 72nd base is A, the 168th base is T, the 261st base is T, the 252nd base is A, and the 243rd base is C , Two-tailed goldfriars ( Triceratopyga calliphoroides ); < / RTI >

In the polynucleotide of SEQ ID NO: 20, when the 90th base is A, the 72nd base is C, the 168th base is T, the 261st base is T, the 252nd base is A, and the 243rd base is T , Lucifer illustris ; < / RTI >

In the polynucleotide of SEQ ID NO: 20, when the 90th base is A, the 72nd base is A, the 168th base is T, the 261st base is T, the 252nd base is A, and the 243rd base is T , &Lt; / RTI > judging a large black fly ( Calliphora lata );

In the polynucleotide of SEQ ID NO: 20, when the 90th base is A, the 72nd base is C, the 168th base is A, the 261st base is T, the 252st base is G, and the 243rd base is T , Black 빰 goldfry ( Chrysomya megacephala ); < / RTI >

In the polynucleotide of SEQ ID NO: 20, when the 90th base is A, the 72nd base is C, the 168th base is A, the 261st base is T, the 252nd base is A, and the 243rd base is T , Big Black Cheek Goldfry ( Chrysomya pinguis ); < / RTI >

In the polynucleotide of SEQ ID NO: 20, when the 90th base is A, the 72nd base is T, the 168th base is A, the 261st base is A, the 252nd base is A, and the 243rd base is T ( Phormia regina ); and further comprising:

In the polynucleotide of SEQ ID NO: 20, when the 90th base is T, the 72nd base is C, the 168th base is T, the 261st base is T, the 252st base is A, and the 243rd base is T , Copper money flies ( Lucilia sericata ); < / RTI > And

In the polynucleotide of SEQ ID NO: 20, when the 90th base is A, the 72nd base is G, the 168th base is T, the 261st base is T, the 252st base is A, and the 243st base is C , Red-black black fly ( Calliphora vice versa). < / RTI >

In the polynucleotide of SEQ ID NO: 20, when the 90th base is T, the 72nd base is A, the 168th base is C, the 261st base is C, the 252st base is A, and the 243st base is C , And judging it to be Aldrichina grahami .

In the polynucleotide of SEQ ID NO: 20, when the 90th base is C, the 72nd base is A, the 168th base is A, the 261st base is T, the 252nd base is A, and the 243rd base is T , And judging it to be Aldrichina grahami .

The term "polymorphism " of the present invention refers to the case where two or more alleles exist in one locus, and in the polymorphic site, only a single base is different depending on the individual, Polymorphism. As a specific example, a polymorphic marker may have, but is not limited to, two or more alleles exhibiting a frequency of occurrence of 1% or more, more specifically 5% or 10% or more in the selected population.

The term " allele " refers to various types of a gene located at the same gene locus of a homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

In the present invention, the step of amplifying the polymorphic site of the SNP marker from the DNA of step (a) may be any method known to those skilled in the art. Specific examples include, but are not limited to, PCR, ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, nucleic acid based sequence amplification (NASBA), and the like.

Further, the step of determining the base of the amplified polymorphic site in step (b) may be any method known to a person skilled in the art. Specific examples include sequencing, mini-sequencing, allele specific PCR, dynamic allele-specifichybridization (DASH), PCR extension analysis (eg, single base extension (SBE) PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., MassenRAY system of Sequenom), Bio-Plex system (BioRad) no.

Specifically, the sequencing or mini-sequencing analysis can use conventional methods for sequencing and can be performed using an automated gene analyzer.

The allele-specific PCR can be performed by amplifying a DNA fragment in which the mutation is located using a primer set including a primer designed with the base at the 3 'end at which the mutation site is located.

In addition, the PCR extension analysis is performed after amplifying a DNA fragment containing a SNP marker into a pair of primers. All the nucleotides added to the reaction are inactivated by dephosphorylation, and a specific extension primer, dNTP mixture, Nucleotide, reaction buffer, and DNA polymerase to perform a primer extension reaction. At this time, the extension primer has the 3 'end immediately adjacent to the 5' direction of the base where the mutation site is located, and the nucleic acid having the same base as the didyoxynucleotide is excluded in the dNTP mixture, and the didyoxynucleotide has a mutation &Lt; / RTI > For example, when dGTP, dCTP and TTP mixture and ddATP are added to the reaction in the presence of substitution from A to G, the primer is extended by the DNA polymerase in the base in which the substitution has occurred, The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at the position, so that it is possible to discriminate the kind of base showing the mutation by comparing the length of the extended primer.

At this time, when the extension primer or the digoxinucleotide is fluorescently labeled, fluorescence is detected using a gene analyzer (for example, PRISM 3500, 3700, or the like manufactured by ABI Corporation) used for determination of a general nucleotide sequence to detect the mutation And when the unlabeled extension primer and the didyxin nucleotide are used, the genetic variation of the SNP is detected by measuring the molecular weight using MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique .

In a specific embodiment of the present invention, a DNA fragment containing the SNP marker of the present invention is amplified by PCR using the primers represented by SEQ ID NOs: 1 and 2 from the extracted tidal flies, and then the amplified DNA product A single base extension (SBE) analysis was performed using the primers shown in SEQ ID NOS: 5 to 14, ddNTP labeled with fluorescence, and the like (Examples 2-2 and 2-3). As a result, bases of the amplified SNP markers were confirmed using an ABI PRISM 3500 DNA analyzer. As a result, 11 types of tasting flies belonging to the black flies and one species of the tasting flies belonging to the house flies had SNP markers selected in the present invention. Thus confirming that different species of tasting flies can be distinguished from each other (Figs. 1 to 12). This suggests that the SNP markers identified in the present invention and the composition for distinguishing them can be used as means for easily distinguishing species of tasting flies with high accuracy.

In order to achieve the above object, an embodiment of the present invention is a nucleotide sequence encoding an A, C or T base at position 1491 of CO I (Cytochrome C Oxidase Subunit I) , Wherein the 1479th base is A or T, the 1485th base is A or G, the polynucleotide consisting of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases, or a complementary poly A marker composition for species discrimination of tasting flies is provided, including nucleotides.

The term "distinction" of the present invention means classification, discrimination, discrimination, discrimination or judgment of different species belonging to the tasteful flies.

In this specification, the 'SNP marker' may be named in combination with 'SNP'.

In the present invention, the SNP marker may be all or some of the polynucleotides including the SNP region of the COI gene represented by SEQ ID NO: 20, more specifically, at the translation start position of the COI gene represented by SEQ ID NO: 20, Is A, C or T, the 1488th base is A, T or G, the 1479th base is A or T, the 1485th base is A or G, and the 1491, 1488, 1479 and 1485 bases A polynucleotide consisting of 5 to 300, in particular 25 to 280, more particularly 45 to 260 consecutive bases, or a polynucleotide complementary thereto, may be a SNP marker for species discrimination of tasting flies , But is not limited thereto.

In a specific embodiment of the present invention, the class of mitochondrial nucleotide sequences of the flies (CO I; Species-specific SNPs were identified to identify species within the species by identifying variants within the species based on the Cytochrome C Oxidase Subunit Ⅰ gene region (Table 2).

The term "agent capable of detecting SNP marker" means a preparation capable of specifically recognizing binding to the SNP marker contained in the SNP marker composition or detecting and amplifying the SNP, as a specific example , A probe capable of specifically binding to a polymorphic site containing the SNP marker or a primer capable of specifically detecting and amplifying a polynucleotide comprising the SNP marker or a complementary polynucleotide thereof, Lt; / RTI >

In the present invention, the primers may be polynucleotides consisting of the nucleotide sequences shown in SEQ ID NOS: 3 and 4, and 16 to 19, but the present invention is not limited thereto.

Therefore, a base sequence having high homology with the nucleotide sequence shown in SEQ ID NOs: 3 and 4 and 16 to 19, for example, a homology of 70% or more, specifically 80% or more, more specifically 90% or more Nucleotide sequences having high homology are also to be construed as falling within the scope of the present invention.

In one specific example of the present invention, primers represented by SEQ ID NOS: 3 and 4 were prepared to detect DNA fragments containing SNP (Table 3), and DNA amplification products amplified by SEQ ID NOS: 3 and 4 To detect only SNPs, primers represented by SEQ ID NOS: 16 to 19 whose lengths were adjusted by adding T base at the ends were prepared (Table 4).

Specifically, the microarray is characterized in that the 1491th base of the COI (Cytochrome C Oxidase Subunit I) gene of SEQ ID NO: 20 is A, C or T, the 1488th base is A, T or G, Or T, wherein the 1485th base is A or G, and the polynucleotide is composed of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases, or a complementary polynucleotide thereof.

The method, (c) from the polynucleotide of SEQ ID NO: 20, and the 1491st base is T, and the 1488th base is A, the 1479th base is T, when the 1485th base is A, white neck flesh fly (Parasarcophaga albiceps ); &Lt; / RTI >

In the polynucleotide of SEQ ID NO: 20, when the 1491th base is A, the 1488th base is G, the 1479th base is A, and the 1485th base is A, the step of judging as Sarcophaga dux is further performed Include;

In the polynucleotide of SEQ ID NO: 20, when the 1491th base is T, the 1488th base is T, the 1479th base is A, and the 1485th base is A, the step of judging as Sarcophaga hemorrhoidalis is further performed Include;

In the polynucleotide of SEQ ID NO: 20, when the 1491 base is C, the 1488 base is A, the 1479 base is A, and the 1485 base is A, a step of judging to be Sarcophaga melanura is added ;

In the polynucleotide of SEQ ID NO: 20, when the 1491th base is T, the 1488th base is G, the 1479th base is A, and the 1485th base is A, a step of judging to be Sarcophoga peregrina Include;

In the polynucleotide of SEQ ID NO: 20, when the 1491th base is T, the 1488th base is A, the 1479th base is A, and the 1485th base is A, a step of judging as Sarcophaga similis is added ; And

In the polynucleotide of SEQ ID NO: 20, when the 1491th base is C, the 1488th base is A, the 1479th base is A, and the 1485th base is G, a step of judging to be Sarcophaga crassipalpis is added As shown in FIG.

In a specific embodiment of the present invention, a DNA fragment containing the SNP marker of the present invention is amplified by PCR using the primers represented by SEQ ID NOS: 3 and 4 from the extracted tasting flies, and then the amplified DNA product A single base extension (SBE) analysis was performed using the primers represented by SEQ ID NOS: 16 to 19, ddNTP labeled with fluorescence, and the like (Examples 2-2 and 2-3). As a result, the base of the amplified SNP marker was confirmed using ABI PRISM 3500 DNA analyzer. As a result, the seven flies belonging to the tidal flies of the tasting flies each had the SNP markers selected in the present invention, (Figs. 13 to 19). This suggests that the SNP markers identified in the present invention and the composition for distinguishing them can be used as means for easily distinguishing species of tasting flies with high accuracy.

The SNP markers for distinguishing the tasting flies of the present invention and the composition for distinguishing them can be used for criminal investigation such as estimation of death time since they can be used as means for easily distinguishing species of tasting flies with high accuracy .

Figure 1 shows a blue-lipped gold flora ( Lucilia ampullaceae ) SNP markers. In the peak of the figure, green represents A, black represents C, blue represents G, and red represents a base of T, and the same applies to the following drawings.
Fig. 2 shows SNaPshot results of SNP markers of Lucifera caesar .
FIG. 3 shows a two-tailed parakeet ( Triceratopyga SNP markers that detected SNP markers of calliphoroides .
4 is a light green geumpari (Lucilia SNaPshot a result of the detection of a SNP marker illustris).
FIG. 5 shows SNaPshot results of SNP markers of a large black fly ( Calliphora lata ).
FIG. 6 shows the results of the measurement of It is the SNaPshot result that detected the SNP marker of the megacephala .
Figure 7 shows the results of a large black chick gold flies ( Chrysomya pinguis SNP markers.
Figure 8 is the SNaPshot result of detection of the SNP markers of the black flies ( Phormia regina ).
Fig. 9 shows the results of a fermentation process sericata ) SNP markers.
FIG. 10 shows the distribution of the calliphora Vicina ) SNP markers.
Fig. 11 shows SNaPshot results of SNP markers of Aldrichina grahami .
Figure 12 is a photograph of a red calf large house fly ( Muscina angustifrons ) SNP markers.
Fig. 13 is a photograph of a white napkin slide ( Parasarcophaga albicons ) SNP markers. In the peak of the figure, green represents A, black represents C, blue represents G, and red represents a base of T, and the same applies to the following drawings.
14 is padrone flesh fly (Sarcophaga dux ) SNP markers.
FIG. 15 is a cross- hemorrhoidalis ) SNP markers.
16 is spanking black flesh fly (Sarcophaga melanura ) SNP markers.
FIG. 17 is a schematic view of a Sarcophaga peregrina ) SNP markers.
FIG. 18 is a graph showing the distribution similis ) SNP markers.
19 is spanked red flesh fly (Sarcophaga This is the SNaPshot result that detected SNP markers of crassipalpis .

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.

Example 1. Selection of specific SNPs for flies

Species specific SNP markers were selected to identify species of tasting flies found in the body.

Specifically, the type of mitochondrial DNA of the fly (COI: Cytochrome C Oxidase Subunit Ⅰ gene (SEQ ID NO: 1)) listed in the existing literature (Korean J Leg Med., 2013; 37: 177-182) and GenBank (www.ncbi.nih.gov) Region), the mutation in the species was identified, and a common base sequence was generated to select SNPs having each species, so that a combination of these species could distinguish species of flies.

As a result, the species-specific SNPs were selected so that the flies of the black flies, which are a type of flies, can be identified by the combination of the SNP markers shown in Table 1 and Table 2, respectively.

In Table 2 above, Al is a white napkin slide ( Parasarcophaga albicons ), Dux is a Sarcophaga dux , Hm is a Sarcophaga hemorrhoidalis ); Me is a black rotifer ( Sarcophaga melanura ); Pg is a migratory peregrina ), Si is a sarcophagus ( Sarcophaga similis ); And Cr means Sarcophaga crassipalpis .

Example 2. Species-specific SNP detection in flies

In order to confirm whether the species of the flies can be distinguished through the SNPs selected in Example 1, primers specific to the SNPs were prepared according to the methods described in Examples 2-1 to 2-3 below, and the SNPs were detected Respectively.

Example 2-1. Paris DNA Extraction

A total of 176 flies or maggots were used in 19 species of flies found in the body. DNA was isolated from flies according to the method of the adjacent sample type provided by GeneAll Tissue SV Mini Kit (GeneAll, Seoul, Korea). DNA was isolated from the flies using a NanoDrop Spectrophotometer (Model: ND-2000C, Thermo Scientific, Wilmington, USA) . The DNA solution was diluted to the experimental concentration with the third distilled water and stored at 20 ° C until use.

Example 2-2. Amplification of DNA fragments containing SNPs

In order to prepare a specific primer of the SNP selected in Example 1, the sequence of the DNA fragment containing the SNP was first analyzed. For this purpose, PCR primers as described in Table 3 below were prepared.

division PCR primer sequence (5 '- > 3') Black fly ( Calliphoridae )
F: CAGTCTATTGCCTAAACTTCAG
(SEQ ID NO: 1) R: GTTARTGCRGGRGGTAAAAGTCA
(SEQ ID NO: 2) Sarcophagidae F: AAGTTTAGYATCHCAACGWCAAGT
(SEQ ID NO: 3) R: TTAAACCCATTGCACTAATCTGCC
(SEQ ID NO: 4)

Then, in order to amplify the DNA fragment containing the SNP, PCR was performed as follows.

Specifically, 1 ng of each DNA of each flies was mixed with 0.8 μM of each of the forward (F) and reverse (R) primers described in Table 3 and AmpliTaq Gold (5 U / ul) (Promega, Madison, . The mixture was denatured at 95 DEG C for 11 minutes and then incubated at 94 DEG C for 20 seconds; 30 seconds at 50 캜 (annealing step); And 7 minutes at 72 ° C for a total of 35 cycles and were reacted at final elongation 72 ° C for 15 minutes (final elongation step).

The obtained PCR product was used as a template for sequencing. The PCR products were purified using ExoSAP-IT reagent (Affymetrix, Santa Clara, USA), sequenced with the BigDye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) and finalized with ABI PRISM 3730 DNA sequencer &Lt; / RTI >

Example 2-3. Detection of SNP

In order to specifically detect the SNPs selected in Example 1, SNP-specific primers as shown in Table 4 below were prepared using IUPAC nucleotide codes based on the nucleotide sequences identified in Example 2-2 . Specifically, when the length of the primer becomes longer, the size of the PCR product amplified using the primer is also increased. In order to distinguish the amplified SNP markers from each other, a primer having a different length was prepared for the marker. The length of the primer was determined by adding a base (T) to the tail of the primer Respectively. For the same SNP marker, 1 to 3 primers having the same number of bases added at the ends and corresponding primer lengths but different primer sequences were prepared.

division SNP
Marker
(point) primer
Length
(bp) SNP marker specific primers (3 'to 5') Black flies
( Calliphoridae ) CA90 25 CTTGATC N GGAATA R T H GGAACTTC
(SEQ ID NO: 5) 25 CTTGATCCGGTATAAT Y GGAACTTC
(SEQ ID NO: 6) 25 CTTGATCAGGAATAATTGGTACTTC
(SEQ ID NO: 7) CA72 35 TTTTTTACTTTATA Y TTTATTTTTGGAGCTTGATC
(SEQ ID NO: 8) 35 TTTTTTACTTTATATTT Y ATTTTCGGAGCTTGATC
(SEQ ID NO: 9) CA168 45 TTTTTTTTTTTTTTTTGGAGA Y GA Y CAAATTTATAATGTAATTGT
(SEQ ID NO: 10) CA261 55 TTTTTTTTTTTTTTTTTTTTTTTTTTTAATTGATTAGTTCC W TTAATACTAGG R GC
(SEQ ID NO: 11) 55 TTTTTTTTTTTTTTTTTTTTTTTTTTTAATTGA Y TAGTTCCTTTAATGTTAGGAGC
(SEQ ID NO: 12) 55 TTTTTTTTTTTTTTTTTTTTTTTTTTTAATTGATTAGT Y CCTTTAATATTAGGAGC
(SEQ ID NO: 13) CA252 65 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAGG R TTTGGAAATTGA Y TAGT Y CC W TTAAT
(SEQ ID NO: 14) CA243 75 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAGG R TT Y GG W AATTGA Y TAGT
(SEQ ID NO: 15) Shifari
( Sarcophagidae ) SA1491 26 AATTCAGAATAACTATGTTCAGCTGG
(SEQ ID NO: 16) SA1488 36 T TTT TTT TTT TTT GAATAACTATGTTCAGCTGG H GG
(SEQ ID NO: 17) SA1479 46 TTTTTTTTTTTTTTTTTTAACTATGTTCAGCTGG H GG D GTATTTTG
(SEQ ID NO: 18) SA1485 56 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTATGTTCAGCTGG H GG D GT
(SEQ ID NO: 19)

Thereafter, the SNaPshot analysis was performed in the following manner.

Specifically, 1 ng of DNA of each flies amplified in Example 2-2, 0.8 pmol of each primer described in Table 4, Gold ST * R 10X Buffer (Promega, Madison, USA) and AmpliTaq Gold DNA polymerase , Madison, USA) were mixed to prepare 20 mu l of the reaction mixture. ABI SNaPshot analysis for single base extension (SBE) was performed using SNaPshot Multiplex Kit (Catalog number: 4323159, AB by Life Technologies), and the ABI SNaPshot analysis was performed for each base, (DdATP = green, ddCTP = black, ddGTP = blue, and ddTTP = red) labeled with 4 kinds of ddNTPs labeled as SEQ ID NO: Respectively.

As a result, as shown in FIGS. 1 to 12, it was confirmed that 11 species of flies belonging to the black flies of the tasteful flies and 1 species belonging to the house flies had different SNP markers, Marker combination.

As can be seen from FIGS. 13 to 19, it was confirmed that seven kinds of flies belonging to the tidal flies of the tasting flies had different SNP markers, which were the combination of the four SNP markers selected in Example 1 above.

From the above results, it was found that the SNP markers identified in the present invention and the primers used for the detection of the SNP markers can be easily distinguished with high accuracy.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Korea University Research and Business Foundation <120> SNP markers for classifying species of necrophagous fly and use the <130> KPA161231-KR <160> 20 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae F-primer <400> 1 cagtctattg cctaaacttc ag 22 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae R-primer <400> 2 gttartgcrg grggtaaaag tca 23 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Sarcophagidae F-primer <400> 3 aagtttagya tchcaacgwc aagt 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Sarcophagidae R-primer <400> 4 ttaaacccat tgcactaatc tgcc 24 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA90 primer <400> 5 cttgatcngg aatarthgga acttc 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA90 primer <400> 6 cttgatccgg tataatygga acttc 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA90 primer <400> 7 cttgatcagg aataattggt acttc 25 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA72 primer <400> 8 ttttttactt tataytttat ttttggagct tgatc 35 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA72 primer <400> 9 ttttttactt tatatttyat tttcggagct tgatc 35 <210> 10 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA168 primer <400> 10 tttttttttt ttttttggag aygaycaaat ttataatgta attgt 45 <210> 11 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA261 primer <400> 11 tttttttttt tttttttttt ttttttaatt gattagttcc wttaatacta ggrgc 55 <210> 12 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA261 primer <400> 12 tttttttttt tttttttttt ttttttaatt gaytagttcc tttaatgtta ggagc 55 <210> 13 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA261 primer <400> 13 tttttttttt tttttttttt ttttttaatt gattagtycc tttaatatta ggagc 55 <210> 14 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA252 primer <400> 14 tttttttttt tttttttttt tttttttttt tttggaggrt ttggaaattg aytagtyccw 60 ttaat 65 <210> 15 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Calliphoridae CA243 primer <400> 15 tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt ttggaggrtt 60 yggwaattga ytagt 75 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Sarcophagidae SA1491 primer <400> 16 aattcagaat aactatgttc agctgg 26 <210> 17 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Sarcophagidae SA1488 primer <400> 17 tttttttttt tttgaataac tatgttcagc tgghgg 36 <210> 18 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Sarcophagidae SA1479 primer <400> 18 tttttttttt ttttttttaa ctatgttcag ctgghggdgt attttg 46 <210> 19 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Sarcophagidae SA1485 primer <400> 19 tttttttttt tttttttttt tttttttttt ttttttctat gttcagctgg hggdgt 56 <210> 20 <211> 1534 <212> DNA <213> Sarcophaga crassipalpis <400> 20 tcgcaacaat ggttattctc tactaatcat aaagatattg gaactttata ttttatcttc 60 ggagcttgag cnggaatagt aggaacttcw ctaagaattc ttattcgagc agaattaggt 120 catcctggtg cattaattgg agatgatcaa atttataatg taattgtwac agctcatgct 180 tttattataa ttttttttat agtaatacca attatgattg gaggatttgg aaactgatta 240 gtyccaatta trctaggagc hccagatata gcctttcctc gaataaataa tataagtttt 300 tgacttttac ccccggcatt aacattgctt ctagtaagta gtatagtaga aaatggagct 360 ggaacggggt gaactgttta ccctccttta tcttctaata ttgctcatgg aggagcttct 420 gttgatttag ctattttttc tctacattta gctggaattt cttcaatttt aggagcagta 480 aattttatta ctacagtaat taatatacga tctacaggaa ttacctttga tcgaatacct 540 ttatttgttt gatcagtagt aattacagcc ctacttttac ttttatcttt accggtactt 600 gcaggagcta ttactatatt attaactgac cgaaatatta atacctcttt tttcgaccca 660 gcaggaggag gagatcctat tttatatcaa cacctatttt gatttttcgg tcaccctgaa 720 gtttatattt taattttacc aggattcgga ataatttctc atattattag tcaagaatca 780 ggtaaaaagg aaacattcgg atcattagga ataatttatg ctatattagc aattggactt 840 cttggattca ttgtatgagc tcaccatata ttcacagtag gaatagacgt agacacacga 900 gcttatttta cttcagcaac aataattatt gctgttccaa caggaattaa aatttttagt 960 tgacttgcta ctctatacgg aactcaatta aattactctc ctgctacttt atgagcctta 1020 ggatttgtat tcttatttac agtaggagga ttaactggag ttgttttagc taattcatca 1080 attgacatta ttttacatga tacatattat gtagtagctc acttccacta tgtactttca 1140 ataggagctg tatttgccat tatagcagga tttgttcact ggtacccttt atttaccgga 1200 ttaacattaa atgcaaaaat actaaaaagt caatttacta ttatatttat aggagtaaat 1260 ttactttct tcccgcaaca tttcttagga cttgcaggaa tacctcgacg atattcagat 1320 tacccagatg cttatacagc ttgaaatgta atttcaacaa tcggatcaac aatttcatta 1380 ttaggaatct ttttttctt ctttattatt tgagaaagtt tagtatcaca acgacaagtt 1440 atattcccag ttcaactaaa ttcatctatt gaatgactwc aaaaracdcc hccagctgaa 1500 catagttatt ctgaattgcc attattaact aact 1534

Claims

Wherein the 90th base of the COI (Cytochrome C Oxidase Subunit I) gene represented by SEQ ID NO: 20 is A or T, the 72nd base is A, C, T or G, the 168th base is A or T, Wherein the 252st base is A or G, the 243rd base is C or T, the 5 to 300 consecutive bases comprising the 90, 72, 168, 261, 252 and 243 bases Or a polynucleotide complementary thereto. &Lt; Desc / Clms Page number 19 >

The method of claim 1, wherein the tasting flies are selected from the group consisting of Lucilia ampullaceae ), a goldfinch ( Lucilia caesar ), a two-tailed golden-fern ( Triceratopyga calliphoroides , Lucilia illustris , Calliphora lata , black chrysomya megacephala , large black chick gold flies ( Chrysomya pinguis), black geumpari (Phormia regina), copper geumpari (Lucilia sericata), red cheeks blowfly (Calliphora vicina , Aldrichina grahami and Red Calf Muscina angustifrons . < / RTI >

A composition for distinguishing species of tasteable flies, comprising an agent capable of detecting the SNP marker of claim 1.

4. The composition of claim 3, wherein the agent is a primer or a probe.

5. The composition according to claim 4, wherein the primer is a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NOS: 5 to 15.

A kit for distinguishing species of a tasteable flies, comprising the composition of any one of claims 3 to 5.

7. The kit according to claim 6, wherein the kit is a PCR kit or a DNA chip kit.

Wherein the 90th base of the COI (Cytochrome C Oxidase Subunit I) gene represented by SEQ ID NO: 20 is A or T, the 72nd base is A, C, T or G, the 168th base is A or T, Wherein the 252st base is A or G, the 243rd base is C or T, the 5 to 300 consecutive bases comprising the 90, 72, 168, 261, 252 and 243 bases Or a polynucleotide complementary thereto. &Lt; RTI ID = 0.0 > 18. < / RTI >

(a) amplifying a polymorphic site comprising the SNP of the polynucleotide of SEQ ID NO: 20 or a polynucleotide complementary thereto from the DNA of the sample isolated from the tasteful flies; And
(b) determining the base of the amplified polymorphic site.

10. The method of claim 9, wherein the polynucleotide of SEQ ID NO: 20 comprises a nucleotide sequence selected from the group consisting of A at position 90, C at position 72, T at position 168, C at position 261, If a base is G, the 243rd base is T, the method further comprises the step of determining including a blue geumpari (Lucilia ampullaceae).

10. The method of claim 9, wherein the polynucleotide of SEQ ID NO: 20 comprises a nucleotide sequence selected from the group consisting of A at position 90, C at position 72, T at position 168, C at position 261, Further comprising the step of determining that the strain is a gold flies ( Lucilia caesar ) when the base is A and the 243rd base is T.

10. The method of claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 20, SEQ ID NO: 20, Further comprising the step of determining that the base is A and the 243rd base is C, as Triceratophaga calliphoroides .

10. The method according to claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 20, SEQ ID NO: 20, Further comprising the step of determining that the base is A and the 243rd base is T, as Lucilia illustris .

10. The method of claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 20, SEQ ID NO: 20, Further comprising the step of judging a large black fly ( Calliphora lata ) when the base is A and the 243rd base is T.

10. The method of claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 20, SEQ ID NO: 20, And determining that the base is G and the 243rd base is T, it is judged to be Chrysomya megacephala .

10. The method of claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 20, SEQ ID NO: 20, Further comprising the step of determining if the base is A and the 243rd base is T, the large black cheek parry ( Chrysomya pinguis ).

10. The method of claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 20, SEQ ID NO: 20, Further comprising the step of determining that the sample is Phormia regina when the base is A and the 243rd base is T.

10. The method of claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of T at position 90, T at position 72, C at position 168, T at position 261, T at position 252 Further comprising the step of determining that the nucleus is A and the 243rd nucleotide is T, and judging it to be a copper money flask ( Lucilia sericata ).

10. The method according to claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of A, B, G, T, T, Determining that the base is A and the 243rd base is C, Calliphora vicina .

10. The method of claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of T at position 90, T at position 72, position C at position 168, position C at position 261, position C at position 252, Further comprising the step of determining if the base is A and the 243rd base is C, to be Aldrichina grahami .

10. The method according to claim 9, wherein the polynucleotide of SEQ ID NO: 20 is selected from the group consisting of SEQ ID NO: 20 and SEQ ID NO: 20, wherein the 90th base is C, the 72nd base is A, the 168th base is A, the 261st base is T, Further comprising the step of judging that when the base is A and the 243rd base is T, it is Aldrichina grahami .

The 1491th base of COI (Cytochrome C Oxidase Subunit I) gene of SEQ ID NO: 20 is A, C or T, the 1488th base is A, T or G, the 1479th base is A or T, Is A or G, and comprises a polynucleotide consisting of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases, or a polynucleotide complementary thereto. &Lt; / RTI >

23. The method of claim 22, wherein the tasting flies are selected from the group consisting of Parasarcophaga albiceps , Sarcophaga dux , Sarcophaga hemorrhoidalis ), black flounder ( Sarcophaga melanura ), wanderer ( Sarcophaga peregrina ), Sarcophaga similis and Sarcophaga crassipalpis ). < / RTI >

22. A composition for distinguishing a tasteable paris species, comprising an agent capable of detecting the SNP marker of claim 22.

25. The composition of claim 24, wherein the agent is a primer or a probe.

26. The composition according to claim 25, wherein the primer is a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 16 to 19.

26. A kit for distinguishing species of tasteable flies, comprising the composition of any one of claims 24 to 26.

28. The kit of claim 27, wherein the kit is a PCR kit or a DNA chip kit.

The 1491th base of COI (Cytochrome C Oxidase Subunit I) gene of SEQ ID NO: 20 is A, C or T, the 1488th base is A, T or G, the 1479th base is A or T, Is A or G, and comprises a polynucleotide consisting of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases, or a polynucleotide complementary thereto. Microarray for.

32. The method of claim 30, wherein the method comprises: (c) in the polynucleotide of SEQ ID NO: 20, when the 1491th base is T, the 1488th base is A, the 1479th base is T and the 1485th base is A, Parasarcophaga albiceps ). < / RTI >

31. The method of claim 30, wherein the method further comprises: (c) in the polynucleotide of SEQ ID NO: 20, when the 1491th base is A, the 1488th base is G, the 1479th base is A and the 1485th base is A, The Sarcophaga dux ). < / RTI >

31. The method of claim 30, wherein the method further comprises: (c) in the polynucleotide of SEQ ID NO: 20, when the 1491th base is T, the 1488th base is T, the 1479th base is A and the 1485th base is A, The Sarcophaga hemorrhoidalis ). < / RTI >

31. The method of claim 30, wherein the method further comprises: (c) in the polynucleotide of SEQ ID NO: 20, when the 1491th base is C, the 1488th base is A, the 1479th base is A and the 1485th base is A, Sarcophaga melanura ). < / RTI >

31. The method of claim 30, wherein (c) the polynucleotide of SEQ ID NO: 20 has T at position 1491, G at position 1488, position A at position 1479, position A at position 1485, Sarcophaga peregrina ). < / RTI >

32. The method of claim 30, wherein the method further comprises: (c) in the polynucleotide of SEQ ID NO: 20, when the 1491th base is T, the 1488th base is A, the 1479th base is A and the 1485th base is A, Sarcophaga similis ). < / RTI >

31. The method of claim 30, wherein (c) the polynucleotide of SEQ ID NO: 20 has a base sequence selected from the group consisting of C, 1488th base, A at position 1479, A at position 1485, Sarcophaga crassipalpis ). < / RTI >