KR20180040269A - Method for producing rare ginsenosides from ginseng berry - Google Patents

Abstract

The present invention provides a method for producing rare ginsenoside by treating a ginsenoside substrate present in a ginseng berry with β-glucosidase, hemicellulase, or a mixed enzyme thereof. The method of the present invention effectively decomposes a plurality of substrates included in a ginseng berry, thereby effectively increasing the content of various types of rare ginsenoside having high bioavailability. Therefore, a rare ginsenoside material produced by the method of the present invention has excellent absorptivity and efficiency, thereby being able to be used as a health functional food or a cosmetic raw material. In addition, a rare ginsenoside material produced by the method of the present invention can be separated into a single component having high purity so as to be used as a medicine raw material or the like.

Description

The present invention relates to a method for producing rare ginsenosides from ginseng fruits,

The present invention relates to a method for producing rare ginsenoside from ginseng fruit, wherein a juice of ginseng fruit or an extract of ginseng fruit is treated with a specific enzyme to newly produce a rare ginsenoside which is not present in ginseng, To increase the content of rare ginsenosides present in the composition.

Ginseng (Panax ginseng C.A. Meyer) is a Korean medicinal herb that is native to the Korean peninsula and has been widely used for over 2,000 years. Red ginseng, which has been produced by repeated heat treatment and drying of ginseng, has a new activity of ginsenoside which is different from ginseng. From the studies on the physiological activity of ginseng, various pharmacological effects of ginseng are known to be mainly due to saponin, ginsenoside, which is a key ingredient of ginseng. Ginsenoside is a glycoside structure with a sugar number of 30 in the triterpene skeleton, such as glucose, arabinose and rhamnose. Depending on its structure, it is divided into protopanaxadiol (PPD) and protopanaxatriol (PPT). Like other glycosides, ginsenoside, which is a ginseng glycoside, is easily absorbed through the process of elimination of sugar by the degrading enzyme of microorganisms present in the digestive tract during ingestion. A large number of Koreans have reported that the enzymes in the intestinal tract have no activity or are so weak that they do not receive the efficacy of ginseng.

Therefore, in order to maximize the effect of ginsenoside, it is desirable to increase the absorption rate of the ginsenoside by low molecular weight before ingestion of the ginsenoside. For example, recent research on biological treatment methods using microorganisms or enzymes capable of various conversions according to the reaction and selectively producing specific low molecular weight glycosides, rather than physical and chemical treatment methods such as heat treatment and acid / base treatment . Until now, studies on these ginsenosides have mainly used roots of ginseng underground. However, recent research has shown that ginsenosides are also found in the upper parts of ginseng leaves and ginseng fruits in addition to the ginseng undergrowths of ginseng (Attele AS et al, Biochem Pharmacol, 58, 1685-1693, 1999). Ginseng is usually harvested for 4-6 years, and it is commercialized as ginseng, red ginseng and various products using it. In the process, ginseng leaves and fruits have been treated as waste.

Ginseng fruit is more than 240 mg per gram of crude saponin, which is three times higher than 80 mg per g of 6-year-old ginseng, which is a good resource for saponin production. However, in ginseng cultivator, seeds were harvested at the age of 4 years to promote the growth of ginseng roots at the time of cultivation for 6 years, and at the end of 3, 5, and 6 years, 3,000 tons of fruit are being abandoned annually. Ginsenoside of ginseng root is different according to cultivation soil and climatic conditions, while ginseng fruit is known to have little difference in composition and content. The ginseng fruit has recently been developed as a beverage due to its high saponin content. The ginseng fruit extract has been shown to improve male sexual function (Korean Patent No. 10-1241050), Parkinson's disease / Alzheimer's disease prevention and treatment (Korean Patent No. 10-1581497) , And type 2 diabetes treatment (Korean Patent No. 10-1484502). Recently, a method of recovering saponins having excellent activity from ginseng fruit has been studied. For example, Korean Patent Registration No. 10-1330935 discloses a process for producing ginseng pulp by transplanting flesh from ginseng fruit; Allowing the ginseng flesh fluid to stand for 30 minutes to 2 hours on an ultrasonic wave to elute the components of the flesh of the ginseng fruit and then centrifuging; Filtering the centrifuged supernatant; And ultrafiltering said filtrate to a molecular weight of 1000-2000 to remove water, ionic material and water-soluble low molecular weight material and to obtain a concentrate at 15-30%. A method for producing a ginseng fruit extract is disclosed. Korean Patent Registration No. 10-1416669 discloses a method for preparing a ginseng extract, which comprises: 1 part by weight of ginseng fruit into 5 to 300 parts by weight of distilled water and sonicating at a temperature within a range of 90 ° C to 110 ° C for a period of time ranging from 35 minutes to 45 minutes; And a step of concentrating and freeze-drying the ultrasonic treated ginseng fruit under reduced pressure to increase the content of ginsenosides Rg2, Rg3, Rh1, Rk1 and F4. . Korean Patent No. 10-1051519 also discloses a method for producing a ginseng extract, comprising the steps of: after ginseng fruit is dried, pulverizing the ginseng fruit so as to have a moisture content of 12 3%; Dissolving the pulverized ginseng fruit powder in a water-soluble solvent or a solvent in which a water-soluble solvent and an organic solvent are mixed to cause an enzyme reaction with one or more selected from alpha-galactosidase, pectinase, cellulase and lactase ; And a step of mixing and extracting EM (Effective Micro-organisms) fermented green tea solution into the enzyme-reacted composition, thereby producing a ginseng fruit extract. Korean Patent No. 10-1182741 discloses a ginseng saponin component ginsenoside Rb1 derived from Aspergillus niger KCCM 11239 strain having a molecular weight of 123 kDa and having an optimum temperature stability of 70 캜 and an optimal pH stability of 4.0 using a β-glucosidase enzyme. Rd , F2 and Rg3. Korean Patent No. 10-0443411 also discloses a method for producing ginsenoside F1 from ginsenoside Re or ginsenoside Rg1 using beta-glycosidase derived from genus Penicillium or Ubumetium Method is disclosed.

The present invention has been made under the background of the prior art, and an object of the present invention is to provide a method for effectively producing a rare ginsenoside having excellent physiological activity from a ginseng fruit.

The present inventors have found that the ginseng fruit has a sufficient amount of ginsenosides Rd and Rd which are effective substrates for producing rare ginsenoside and that the ginsenosides present in the ginseng fruit are treated with a specific enzyme alone or a combination of specific enzymes The present inventors confirmed that it is possible to produce a variety of rare ginsenosides.

In order to solve the above-mentioned object, the present invention provides a method for producing a ginseng fruit juice extract, a ginseng fruit extract, a ginseng fruit pulp juice extract, a ginseng fruit pulp extract or a concentrate thereof with a β-glucosidase, a hemicellulase, And a method for preparing rare ginsenosides from ginseng fruits by reacting them with the mixed enzyme to increase the content of rare ginsenoside.

The production method of the present invention can effectively decompose a large number of substrates contained in ginseng fruit to effectively increase the content of various rare ginsenosides having high bioavailability. Therefore, the rare ginsenoside material produced by the production method of the present invention is excellent in absorption and efficacy and can be used as a health functional food, a cosmetic raw material and the like. In addition, if the rare ginsenoside material produced by the production method of the present invention is separated into a single high purity component, it can be used as a raw material for pharmaceuticals.

Figure 1 shows the content of ginsenosides in the reaction product when the juice concentrate of matured ginseng fruit was reacted with purified DT-BGL and purified CS-BGL.

Hereinafter, the present invention will be described in detail. The term 'rare ginsenoside' as used in the present invention is a concept that includes all of ginsenosides newly generated through physical, chemical, or biological treatments existing in ginseng in a trace amount.

The present invention relates to a method for preparing rare ginsenosides from ginseng fruits. The method for producing rare ginsenoside according to an embodiment of the present invention is to react ginsenoside-containing substrate obtained from ginseng fruit with beta-glucosidase, hemicellulase or a mixed enzyme thereof . Specifically, a method for producing rare ginsenosides according to a preferred embodiment of the present invention is a method for producing ginsenosides from ginseng fruit juice, ginseng fruit juice extract, ginseng fruit juice juice extract, ginseng fruit pulp extract, or concentrate thereof with beta-glucosidase glucosidase, hemicellulase, or a mixed enzyme thereof.

The ginseng as a source of the ginseng fruit is not particularly limited in terms of the variety, origin, and the like. For example, the ginseng fruit may be selected from various kinds of ginseng such as Korean ginseng, Korean ginseng, Korean ginseng, Chinese ginseng, American ginseng, Chinese ginseng, Chinese ginseng , Vietnamese samphire, and mandarin oranges can be used.

In addition, the ginseng fruit may be selected from immature fruit or mature fruit, and it is preferable that the ginseng fruit is a mature fruit considering the composition ratio of ginsenoside present in the ginseng fruit.

In addition, considering the reaction efficiency and the physiological activity and diversity of the rare ginsenosides in the conversion of ginsenoside present in ginseng fruit to rare ginsenosides, the beta-glucosidase is a beta-glucosidase, -Glucosidase is preferably derived from Clostridium stercorarium and is preferably derived from Clostridium stercorarium subsp. Stercorarium DSM 8532 strain Is more preferable. The β-glucosidase derived from the Clostridium stercorarium subsp. Stercorarium strain DSM 8532 is composed of the amino acid sequence of SEQ ID NO: 1.

In addition, the hemicellulase is selected from enzymes that decompose plant cell wall components xylan, β-1,3-1,4-glucan, xyloglucan, glucomannan and the like, preferably xylanase ), Galactanase, mannanase, or arabinase, and is characterized in that the substrate availability to the ginsenosides present in the ginseng fruit and that of the rare ginsenosides A combination of xylanase and galactanase is preferable in view of the conversion efficiency and the synergistic action by combination with beta-glucosidase.

In addition, the mixing weight ratio of beta-glucosidase to hemicellulase in the mixed enzyme of beta-glucosidase and hemicellulase is not limited to a great extent, May be selected from 0.1: 99.9 to 99.9: 0.1. However, it is preferable that the mixing weight ratio of β-glucosidase to hemicellulase is 1: 4 to 4: 1 in consideration of the increased level of rare ginsenoside by enzyme treatment.

The rare ginsenosides having an increased content after the reaction according to the present invention are at least one selected from Rg1, Rg2, Rg3, Rh1, Rh2, F2, Compound Mc, Compound K or Compound Y, Rh1, Rh2, F2, Compound Mc, Compound K or Compound Y.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are intended to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.

1. Preparation of juice of ginseng fruit and analysis of ginsenoside composition

One of the immature ginseng fruits collected at the end of July and one of the mature ginseng fruits collected at the end of August from the farms in Pocheon area were supplied with 40 kg of each, and the seeds were squeezed without removing the seeds to produce ginseng fruit juice Respectively. The above-mentioned immature ginseng fruit is named GBG (ginseng berry green) with the epidermis being mainly green, and ginseng berry red is named GBR (ginseng berry red) because the mature ginseng fruit has a reddish color. Then, the ginseng juice was concentrated about 15 times to prepare a concentrate of ginseng fruit juice having a solid concentration of about 60 brix.

10 g of juice concentrate of ginseng fruit juice was diluted with methanol 5 times and filtered with 0.2 ㎛ membrane filter. The filtrate was used as a sample for high performance liquid chromatography (HPLC) analysis. The HPLC analysis conditions are shown below.

* Complete system: Agilent 1200 HPLC system

* Detector and analysis wavelength: UV detector, 203 nm

* Mobile phase solvent: Acetonitrile (solvent A) and water (solvent B)

* Concentration gradient of mobile phase solvent: The ratio of solvent A starts at the initial 25% and progressively increases until it reaches 100% over a total of 45 minutes.

* Standard: purchased from Facechem and Sigma

Table 1 below shows the results of HPLC analysis of the ginsenoside composition of GBG juice concentrate and GBR juice concentrate. The total ginsenoside content of the GBG juice concentrate and the GBR juice concentrate was 135.34 mg and 174.32 mg per g, respectively. The content of ginsenoside Rd was the highest in GBG juice concentrate and the content of ginsenoside Re was the highest in GBR juice concentrate. In the subsequent experiments, a GBR juice concentrate was used as a substrate for the enzyme reaction.

Gin Senocide classification GBG juice concentrate (mg / g) GBR juice concentrate (mg / g) Rb1 8.35 14.75 Rb2 5.15 9.6 Rb3 5.94 10.2 Rc 10.68 12.96 Rd 47.46 38.28 Re 39.48 61.36 Rf 1.21 1.34 Rg1 8.67 9.9 Rg2 6.32 12.3 Rg3 0.45 0.53 Rh1 0.97 1.09 Rh2 0.0 0.0 F1 0.0 0.0 F2 0.0 0.0 Compound Mc 0.0 0.0 Compound Mc1 0.0 0.0 Compound Y 0.0 0.0 Compound K 0.0 0.0 APPD 0.0 0.0 APPT 0.0 0.0

2. Recombinant beta-glucosidase (&bgr; glucosidase )of Cloning  And production

(1) Dictyoglomus Cloning and production of recombinant beta-glucosidase derived from turgidum DSM 6724 strain

Dictyoglomus DNA of the turgidum DSM 6724 strain-derived recombinant beta-glucosidase (GenBank number: ACK415480; dubbed DT-BGL) was prepared by the method of Lee et al. (Biotechnol. Lett. 2012, 34 (9): 1679) Then, the transformant strain was diluted with citrate-phosphate buffer, disrupted using ultrasonic waves, and centrifuged to collect DT-BGL expression supernatant. The supernatant was purified with a peptide tag The DT-BGL expression supernatant and the purified DT-BGL were selectively used in the experiments described below. DT-BGL was synthesized from the ginsenoside Rb1 as the substrate, Rd, F2, and Compound K, And the compound Mc from the substrate Ginsenoside Rc The optimal reaction conditions for DT-BGL were: citrate-phosphate buffer 50 mM, pH 5.5, reaction Temperature 80 ℃ .

(2) Cloning and production of recombinant beta-glucosidase derived from Clostridium stercorarium subsp. Stercorarium DSM 8532 strain

Clostridium stercorarium subsp. Stercorarium DSM 8532 strain recombinant beta-glucosidase (GenBank number: AGC67337; designated 'CS-BGL') is an amino acid of SEQ ID NO: 1 Dictyoglomus The amino acid sequence homology difference with turgidum DSM 6724 strain-derived recombinant beta-glucosidase DT-BGL is 67%. A CS-BGL DNA fragment consisting of the nucleotide sequence of SEQ ID NO: 2 was amplified by polymerase chain reaction (PCR). The primers used for the PCR were as follows. For the cloning, restriction enzymes NheI and XhoI were used.

Forward primer: 5 '-CGGCGCTAGCGTAATACCAATTGTTGCAAGAGTGTC-3'

Reverse primer: 5 '- AGTACTCGAGAGCCTGTTCAGCTTTTCCTCGTTCAGTTCC -3'

The template DNA used in the PCR was obtained by the following method. Clostridium stercorarium subsp. Stercorarium strain DSM 8532 was inoculated in Clostridium medium (DSM medium No. 255) at an agar concentration of 15 g / l and cultured for 2 days in anaerobic condition Colonies were formed. After removing oxygen by replacing nitrogen with vial (Wheaton, 10 ml capacity) containing 5 ml of Clostridium medium (DSM medium No. 255), Clostridium stercorarium ( Clostridium stercorarium) subsp. stercorarium DSM 8532 colonies were inoculated and sealed, and then cultured for 30 hours at a temperature of 60 ° C and a stirring condition of 150 rpm. Cells were recovered by centrifuging the culture, and template DNA was obtained from the recovered cells using a genomic DNA isolation kit (Bioneer).

Polymerase chain reaction (PCR) was performed using the Phusion® High-Fidelity DNA Polymerase kit (NEB), predenaturation at 98 ° C for 2 minutes, denaturation at 98 ° C for 10 seconds; annealing 55 캜, 30 sec; Extension A total of 30 cycles were performed at 72 ° C for 130 seconds as one cycle, and the reaction was finally performed at 72 ° C for 10 minutes. After amplification of the DNA fragments on the agarose gel electrophoresis, the DNA fragments were eluted and then separated by gel elution kit (Qiagen). The isolated DNA fragment was digested with NheI and XhoI restriction enzymes and cloned into pET-24a vector (Novagen) treated with the same restriction enzymes and the nucleotide sequence was confirmed. The pET-24a vector in which CS-BGL was cloned was designated as pCSBG plasmid, and 50 ng of the plasmid was transformed into E. coli ER2566 strain by electroporation and single colonies were obtained in LB-kanamycin agar medium. Then, the obtained single colonies were inoculated into LB broth having a kanamycin concentration of 50 μg / ml and cultured overnight, and used as seeds. The seeds were inoculated into 500 ml of LB broth at a concentration of 50 μg / ml of kanamycin and stirred at 230 rpm in a shaking incubator at 37 ° C. When the optical density at 600 nm reached 0.5, IPTG The final concentration was 1 mM to induce the expression of the target enzyme and further cultured for 15 hours at a temperature of 16 DEG C and a stirring condition of 150 rpm. After the cultivation was completed, the culture medium of the transformant was centrifuged at 3000 rpm for 20 minutes to recover the cells. The recovered cells were washed with physiological saline 20 times and then diluted with citrate-phosphate buffer. Subsequently, the diluted cells were disrupted using a sonicator (Branson, model 100), and the cell lysate was centrifuged at 14,000 rpm for 20 minutes to remove the insoluble protein portion and collect the CS-BGL expression supernatant. Further, the supernatant was purified by a histidine tag contained in the pET-24a vector to obtain purified CS-BGL. Purified CS-BGL was solubilized in Citrate-Phosphate Buffer and used in the experiments described below. Purification was carried out using metal ion affinity chromatography (IMAC) cartridge (Bio-Rad) and immidazole.

3. Increased content of rare ginsenosides by recombinant beta-glucosidases

1 g of the GBR juice concentrate obtained above was added to citrate-phosphate buffer (50 mM, pH 5.5), and 2 ml of the enzyme-expressed supernatant (total amount of protein: 4 mg) was added thereto and reacted at 65 ° C for 1 hour. The ginsenoside composition of the reaction product was analyzed by HPLC and the results are shown in Table 2 below.

Gin Senocide classification
GBR juice concentrate (mg / g) Before enzyme reaction After reaction with CS-BGL After reaction with DT-BGL Rb1 14.75 0.0 0.20 Rb2 9.60 7.78 7.80 Rb3 10.20 5.36 10.12 Rc 12.96 9.42 9.56 Rd 38.28 50.34 48.24 Re 61.36 49.22 54.76 Rf 1.34 0.89 0.96 Rg1 9.90 10.94 7.32 Rg2 12.3 11.57 5.11 Rg3 0.53 4.55 0.0 Rh1 1.09 2.83 2.46 Rh2 0.0 2.12 0.0 F1 0.0 0.0 0.0 F2 0.0 3.64 1.55 Compound Mc 0.0 2.35 2.43 Compound Mc1 0.0 0.0 0.0 Compound Y 0.0 1.58 1.64 Compound K 0.0 0.78 0.68 APPD 0.0 0.0 0.0 APPT 0.0 0.0 0.0

As shown in Table 2, beta-glucosidase CS-BGL was similar to beta-glucosidase DT-BGL in terms of the amount of ginsenoside Rh1, Compound MC, Compound Y and Compound K produced. However, beta-glucosidase CS-BGL newly produced ginsenosides Rg3 and Rh2 as compared to beta-glucosidase DT-BGL, and the amount of ginsenosides Rg1 and F2 was also very high. In addition, since the content of ginsenoside Rb1, which is a substrate, was completely degraded by beta-glucosidase CS-BGL, the content of ginsenoside Rd was rather increased, and the reaction rate of beta-glucosidase CS- protopanaxadiol) family of ginsenosides. In addition, the content of Rg1, which is a reaction product of ginsenoside Re, was increased by the reaction with beta-glucosidase CS-BGL. As a result, beta-glucosidase CS-BGL was found to contain protopanaxatriol (PPT) It is presumed that the glucose present at the carbon position is decomposed.

Rg1, Rg2, Rg3, Rh1, Rh2 and F2 of the reaction product were reacted under the same conditions as the enzyme expression supernatant using purified DT-BGL and purified CS-BGL in place of the enzyme expression supernatant. Were compared. Figure 1 shows the content of ginsenosides in the reaction product when the juice concentrate of matured ginseng fruit was reacted with purified DT-BGL and purified CS-BGL. As shown in FIG. 1, the content of ginsenosides Rg3 and Rh1 in the juice concentrate of mature ginseng fruit increased 8-fold and 2-fold, respectively, when they were reacted with purified CS-BGL. In addition, purified CS-BGL produced more ginsenosides Rh2 and F2 than purified DT-BGL, and the other trace ginsenosides produced were also higher. As a result, it is considered that beta-glucosidase CS-BGL can react with ginsenoside in the concentrate of ginseng fruit juice concentrate to increase the content of trace ginsenoside evenly.

4. Hemicellulase  Increased content of rare ginsenosides by

1 g of the GBR juice concentrate obtained above was added to citrate-phosphate buffer (50 mM, pH 5.5), and 2 ml of hemicellulase as a commercial enzyme was added thereto, followed by reaction at 35 ° C for 1 hour. The ginsenoside composition of the reaction product was analyzed by HPLC and the results are shown in Table 3 below. The hemicellulase, which is a commercial enzyme, is composed of xylanase and galactanase, and is a product of Japanese company Amno.

Gin Senocide classification GBR juice concentrate (mg / g) Before enzyme reaction After reaction with hemicellulase R2 2.21 0.0 Rb1 14.75 10.27 Rb2 9.6 7.78 Rb3 10.2 5.19 Rc 12.96 9.42 Rd 38.28 55.10 Re 61.36 50.37 Rf 1.34 1.29 Rg1 9.90 13.01 Rg2 12.3 16.78 Rg3 0.53 1.13 Rh1 1.09 3.54 Rh2 0.0 1.33 F1 0.0 0.0 F2 0.0 3.36 Compound Mc 0.0 2.01 Compound Mc1 0.0 0.0

As shown in Table 3, hemicellulase was effective in decomposing ginsenosides Rb2, Rb3, Rc, or R2 containing arabinose or xylose to increase contents of ginsenoside Rd, Rh1 or Compound Mc . In addition, the hemicellulase completely decomposed ginsenoside R2 and converted it into ginsenoside Rh1. As a result, Rh1 increased about 3.2 times after the reaction. In addition, the content of ginsenosides Rg1 and Rg2, which are reaction products of ginsenoside Re, increased by 1.3 times after the reaction of GBR juice concentrate and hemicellulase. In addition, after the reaction of GBR juice concentrate with hemicellulase, ginsenoside Rc was converted to Compound Mc by more than 30%. Hemicellulase also decomposed ginsenosides Rb2 and Rb3 in GBR juice concentrate by 23% and 50.8%, respectively, and decomposed more than 30% of ginsenoside Rb1 into all Rd. In conclusion, hemicellulase effectively decomposes arabinose and xylose of ginsenoside, which is difficult to degrade by conventional enzyme treatment, and can significantly increase various trace ginsenoside contents in ginseng fruit juice concentrate.

5. Beta-glucosidase and Hemicellulase  Increased content of rare ginsenosides by mixed enzymes

1 g of the GBR juice concentrate obtained above was added to citrate-phosphate buffer (50 mM, pH 5.5), and 2 ml of a mixed enzyme of beta-glucosidase and hemicellulase was added thereto, followed by reaction at 65 ° C for 1 hour. The ginsenoside composition of the reaction product was analyzed by HPLC and the results are shown in Table 4 below. The beta-glucosidase is a CS-BGL expression supernatant. The hemicellulase, which is a commercial enzyme, is composed of xylanase and galactanase, and is a product of Amno, a Japanese company. As shown in Table 4 below, the mixed enzyme of beta-glucosidase and hemicellulase significantly increased the content of trace ginsenosides in the GBR juice concentrate. It is considered that the mixed enzyme was caused by the decomposition of both the PPD series of ginsenosides and the PPT series of ginsenosides both as substrates and evenly.

Gin Senocide classification GBR juice concentrate (mg / g) Before enzyme reaction After reaction with mixed enzyme 1 After reaction with mixed enzyme 2 After reaction with mixed enzyme 3 R2 2.21 0.0 0.0 0.0 Rb1 14.75 9.14 9.12 5.54 Rb2 9.6 7.28 5.55 3.21 Rb3 10.2 3.39 5.98 7.37 Rc 12.96 6.21 7.42 8.99 Rd 38.28 57.20 50.10 45.10 Re 61.36 41.17 47.35 49.86 Rf 1.34 0.73 0.73 0.41 Rg1 9.90 17.23 15.08 12.45 Rg2 12.3 21.34 16.54 13.10 Rg3 0.53 1.13 3.93 4.98 Rh1 1.09 3.78 3.63 3.33 Rh2 0.0 2.21 2.45 2.83 F1 0.0 0.0 0.0 0.0 F2 0.0 3.64 3.98 4.53 Compound Mc 0.0 4.95 4.71 2.95 Compound Mc1 0.0 0.0 0.0 0.0

Mixed enzyme 1: Mixed weight ratio of beta-glucosidase to hemicellulase is 1: 4

Mixed Enzyme 2: Mixture weight ratio of 1: 1 beta-glucosidase to hemicellulase

Mixed enzyme 3: Mixture weight ratio of beta-glucosidase to hemicellulase is 4: 1

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Accordingly, the scope of protection of the present invention is not limited to the specific embodiments but should be construed as including all embodiments belonging to the claims attached hereto.

&Lt; 110 > Kbiopharm Co., Ltd. <120> Method for producing rare ginsenosides from ginseng berry <130> DP-16-742 <160> 2 <170> KoPatentin 3.0 <210> 1 <211> 794 <212> PRT <213> Unknown <220> <223> beta-glucosidase derived from Clostridium stercorarium subsp.          stercorarium DSM 8532 <400> 1 Met Val Ile Pro Ile Val Ala Arg Val Ser Glu Lys Val Ile Ile Tyr   1 5 10 15 Tyr Ala Gly Thr Val Tyr Glu Asn Leu Asn Asp Lys Gly Ile Thr Gly              20 25 30 Val Ile Lys Met Gln Arg Asp Ile Lys Lys Ile Ser Ser Gln Met Thr          35 40 45 Leu Glu Glu Lys Ala Ser Leu Cys Ser Gly Leu Asp Ala Trp Asn Leu      50 55 60 Lys Ser Val Glu Arg Leu Gly Ile Pro Ser Ile Met Val Ser Asp Gly  65 70 75 80 Pro His Gly Leu Arg Lys Glu Thr Thr Asp Pro Thr Asp Pro Gly Lys                  85 90 95 Lys Thr Thr Val Ala Thr Cys Phe Pro Thr Ala Val Gly Leu Ala             100 105 110 Ser Ser Trp Asn Arg Glu Leu Val Glu Lys Val Gly Ala Ala Leu Gly         115 120 125 Glu Cys Gln Ala Glu Gly Ile Ala Val Leu Leu Gly Pro Gly Thr     130 135 140 Asn Ile Lys Arg Ser Pro Leu Cys Gly Arg Asn Phe Glu Tyr Phe Ser 145 150 155 160 Glu Asp Pro Tyr Leu Ser Ser Glu Met Ala Ala Ser His Ile Lys Gly                 165 170 175 Val Gln Ser Arg Gly Val Gly Thr Ser Leu Lys His Phe Ala Ala Asn             180 185 190 Asn Gln Glu His Arg Arg Met Ser Val Asp Ala Val Ile Asp Glu Arg         195 200 205 Thr Leu Arg Glu Ile Tyr Leu Ala Ser Phe Glu Gly Ala Val Lys Lys     210 215 220 Ala Lys Pro Trp Thr Ile Met Cys Ser Tyr Asn Arg Val Asn Gly Glu 225 230 235 240 Tyr Ala Ser Glu Asn Lys Phe Leu Leu Thr Asp Val Leu Arg Asn Glu                 245 250 255 Trp Gly Phe Glu Gly Ile Val Val Ser Asp Trp Gly Ala Val Asn Glu             260 265 270 Arg Val Lys Gly Leu Glu Ala Gly Leu Asp Leu Glu Met Pro Ser Ser         275 280 285 Phe Gly Ile Gly Asp Gln Lys Ile Val Glu Ala Val Lys Lys Gly Glu     290 295 300 Leu Pro Glu Glu Val Leu Asp Arg Thr Val Glu Arg Ile Leu Asn Leu 305 310 315 320 Ile Phe Lys Ala Val Asp Asn Arg Lys Glu Asn Ala Gly Tyr Asp Arg                 325 330 335 Glu Ala His His Lys Leu Ala Arg Glu Ala Ala Arg Glu Cys Met Val             340 345 350 Leu Leu Lys Asn Glu Asp Lys Ile Leu Pro Leu Arg Lys Gln Gly Thr         355 360 365 Ile Ala Val Ile Gly Glu Phe Ala Lys Arg Pro Arg Tyr Gln Gly Gly     370 375 380 Gly Ser Ser His Val Asn Pro Thr Ile Met Asp Ser Pro Tyr Glu Glu 385 390 395 400 Ile Lys Lys Ser Ala Gly Asn Asn Ala Asp Val Ile Tyr Ala Gln Gly                 405 410 415 Tyr Phe Ile Glu Lys Asp Glu Pro Asp Glu Lys Leu Leu Glu Glu Ala             420 425 430 Lys Gln Ala Ala Leu Lys Ala Asp Val Ala Val Ile Phe Ala Gly Leu         435 440 445 Pro Glu His Tyr Glu Cys Glu Gly Tyr Asp Arg Gln His Met Arg Met     450 455 460 Pro Glu Ser His Cys Thr Leu Ile Glu Glu Val Ala Lys Val Gln Pro 465 470 475 480 Asn Val Val Val Leu Cys Asn Gly Ser Pro Val Glu Met Pro Trp                 485 490 495 Ile Asp Lys Val Lys Gly Leu Leu Gly Aly Tyr Leu Gly Gly Gln Ala             500 505 510 Met Gly Gly Ala Ile Ala Asp Leu Leu Phe Gly Asp Ala Asn Pro Ser         515 520 525 Gly Lys Leu Ala Glu Thr Phe Pro Lys Gln Leu Ser Asp Asn Pro Ser     530 535 540 Tyr Leu Asn Phe Pro Gly Glu Gly Asp Arg Val Glu Tyr Arg Glu Gly 545 550 555 560 Ile Phe Val Gly Tyr Arg Tyr Tyr Asp Lys Lys Asn Met Glu Pro Leu                 565 570 575 Phe Pro Phe Gly Tyr Gly Leu Ser Tyr Thr Thr Phe Glu Tyr Gly Asp             580 585 590 Leu Lys Ile Ser Arg Lys Glu Ile Ser Asp Asn Glu Thr Val Thr Val         595 600 605 Ser Val Lys Val Lys Asn Thr Gly Asp Met Ala Gly Lys Glu Ile Val     610 615 620 Gln Leu Tyr Val Arg Asp Ile Glu Ser Ser Val Ile Arg Pro Glu Lys 625 630 635 640 Glu Leu Lys Gly Phe Glu Lys Val Glu Leu Lys Pro Gly Glu Glu Lys                 645 650 655 Thr Val Phe Glu Leu Asp Lys Arg Ala Phe Ala Tyr Tyr Asn Thr             660 665 670 Gly Ile Arg Asp Trp His Val Glu Thr Gly Glu Phe Glu Ile Leu Ile         675 680 685 Gly Arg Ser Ser Arg Asp Ile Val Leu Lys Asp Lys Ile Phe Val Lys     690 695 700 Ser Thr Val Thr Ile Lys Lys Pro Val Asp Arg Asn Thr Leu Val Gly 705 710 715 720 Asp Leu Leu Ser Asp Arg Val Leu Glu Pro Val Phe Arg Glu Phe Ile                 725 730 735 Ile Asn Glu Ile Lys Asn Arg Tyr Leu Leu Asp Leu Leu Glu Asn Glu             740 745 750 Asp Lys Ser Leu Leu Ser Val Trp Met Arg Tyr Thr Pro Leu Arg Ser         755 760 765 Leu Ala Asn Ser Thr Gly Gly Glu Leu Asn Glu Glu Lys Leu Asn Arg     770 775 780 Leu Ile Asp Thr Leu Asn Ala Asn Ile Lys 785 790 <210> 2 <211> 2385 <212> DNA <213> Unknown <220> <223> DNA fragment encoding beta-glucosidase derived from Clostridium          stercorarium subsp. stercorarium DSM 8532 <400> 2 gtggtaatac caattgttgc aagagtgtct gagaaagtta taatttatta tgccggaacg 60 gtttacgaaa atttgaacga taaaggcata acaggagtga taaaaatgca aagggacatc 120 aaaaaaatta tttcacaaat gacgctggaa gaaaaggcga gcttatgctc gggccttgac 180 gcctggaacc ttaaaagcgt agaacgtttg ggcattccgt ccattatggt atctgacggc 240 ccccatggtc tcagaaaaga gacaacggat cccactgatc ccggtaagaa aaccactgtc 300 ccggccacat gtttccccac tgcggttggc cttgcaagct catggaaccg tgaactggtg 360 gagaagtag gcgccgcatt gggggaagaa tgccaggctg aaggaatagc agtgcttctt 420 gggccgggaa ccaatataaa acgttcccct ctttgcggaa gaaactttga atatttttcg 480 gaagacccgt acctttcttc ggagatggca gcaagccata taaaaggagt gcagagccgg 540 ggagtgggga cgtccctgaa gcattttgcg gcaaataacc aggaacaccg cagaatgagc 600 gtggatgcgg taattgacga aagaacgctg cgtgaaattt acctcgccag tttcgaaggg 660 gcggttaaaa aggcgaagcc gtggacgatc atgtgttcat acaacagggt aaacggcgag 720 tatgcatctg aaaataaatt tctgttaaca gatgtactga gaaatgaatg gggttttgaa 780 ggcattgtgg tatccgactg gggagcggtg aatgagaggg taaagggact ggaagccgga 840 cttgatcttg aaatgccgtc aagcttcggt attggagacc aaaaaatagt tgaagccgta 900 aagaagggtg agctgcccga agaggtattg gacagaaccg ttgaaaggat acttaattta 960 atttttaaag cggtggataa caggaaagaa aatgccggat atgaccggga agctcatcac 1020 aaactggcca gagaagcggc aagggagtgc atggtgctgc ttaagaacga ggacaaaata 1080 cttccgctta ggaagcaggg aaccatagcc gtaataggcg aatttgctaa aagaccacgg 1140 tatcagggcg gaggaagctc ccatgtaaat cccacaatca tggatagtcc atatgaagaa 1200 atcaaaaaat cagcgggaaa caatgcagat gttatatatg cgcaaggtta ttttattgaa 1260 aaggacgagc cagatgaaaa actcctggag gaagcaaagc aggcggcgct gaaggcagat 1320 gtcgccgtga tatttgcagg gcttcccgag cattatgaat gcgagggcta tgaccgtcag 1380 catatgagaa tgcccgaaag ccactgcacg cttatcgaag aagtggcgaa agtacaaccc 1440 aatgtggtgg tggtattatg caacggttca ccggtggaga tgccgtggat tgacaaagtg 1500 aagggattgc tggaggctta cctgggcgga caagccatgg gcggagccat tgccgatctt 1560 ctgttcggag acgccaatcc cagcgggaag ctcgccgaga ctttcccgaa acagttaagc 1620 gataaccctt catatttgaa ttttcccggg gaaggggaca gggttgaata cagggaaggc 1680 atattcgtgg gctacaggta ttatgacaaa aagaatatgg aaccgctgtt cccgttcgga 1740 tacgggctc gctacactac gtttgagtac ggcgatctga aaataagcag gaaagaaata 1800 tctgataacg aaacggtgac tgtgagcgta aaggttaaga ataccggaga tatggcgggt 1860 aaggagattg tgcagcttta cgtaagggat attgaaagct cggtaataag accggagaag 1920 gaactgaagg gttttgaaaa agttgaactt aagcccggcg aggaaaaaac ggtggtgttt 1980 gaacttgaca agagggcgtt tgcttattac aacaccggta taagggactg gcatgttgaa 2040 accggtgaat ttgagatttt aataggcaga tcctcaaggg acatagtgct taaagacaag 2100 atattcgtca aatcaaccgt taccataaaa aaaccggtgg acagaaacac gctggtgggg 2160 gatttgcttt ctgatcgggt tcttgagcct gtattcagag agtttattat taacgagata 2220 aaaaacaggt acttgttgga tttactggag aacgaggata aatccctcct gagtgtgtgg 2280 atgaggtata ctcctctgcg ttcattggcg aacagtacgg gtggggaact gaacgaggaa 2340 aagctgaaca ggctgattga tacactgaat gcaaatatta aataa 2385

Claims (7)

Ginseng fruit juice extract, ginseng fruit extract, ginseng fruit pulp juice extract, ginseng fruit pulp extract, or a concentrate thereof is reacted with β-glucosidase, hemicellulase, A method for producing rare ginsenoside from a ginseng fruit characterized by increasing the content of senoside.
The method of claim 1, wherein the ginseng fruit is mature fruit.
3. The method of claim 1, wherein the beta-glucosidase is derived from Clostridium stercorarium . 2. The method of claim 1, wherein the beta-glucosidase is derived from Clostridium stercorarium .
4. The method of claim 3, wherein the beta-glucosidase is composed of the amino acid sequence of SEQ ID NO: 1.
The hemicellulase according to claim 1, wherein the hemicellulase is at least one selected from the group consisting of xylanase, galactanase, mannanase, and arabinase. A method for producing rare ginsenoside from ginseng fruit characterized.
The method according to claim 1, wherein the mixed weight ratio of the β-glucosidase to the hemicellulase is 1: 4 to 4: 1. The method for producing rare ginsenosides from the ginseng fruit .
The method according to claim 1, wherein the rare ginsenoside is at least one selected from Rg1, Rg2, Rg3, Rh1, Rh2, F2, Compound Mc, Compound K or Compound Y. Lt; / RTI &gt;

Images