KR101975017B1 - Composition for lowering cholesterol comprising a mixture culture of Ginseng Berry-hongguk - Google Patents

Abstract

The present invention provides a composition for lowering cholesterol comprising a ginseng fruit-red flounder mixed culture or containing it as an active ingredient. The mixed culture of the ginseng fruit-red flounder mixed culture or the ginseng fruit-thistle mushroom mycelium according to the present invention is characterized in that the content of rare ginsenoside is increased by the treatment and the mixed culture of the ginseng fruit and the physiological activity And therefore has an excellent cholesterol-lowering effect. Thus, the mixed culture of ginseng fruit-red flounder mixture or ginseng fruit-thistle mushroom mycelium according to the present invention can be used for the treatment of obesity, fatty liver, type 2 diabetes, hypertriglyceridemia, hypercholesterolemia, hyperlipidemia, dyslipidemia, Or a metabolic syndrome in which at least two of the above-mentioned diseases occur simultaneously, and the like.

Description

[0001] The present invention relates to a composition for lowering cholesterol comprising a mixture culture of Ginseng Berry-hongguk,

The present invention relates to a composition for lowering cholesterol, wherein the composition of the present invention is characterized by comprising a ginseng fruit-derived substrate and a product obtained by mixed culture of red ginseng or as an active ingredient.

Ginseng (Panax ginseng C.A. Meyer) is a Korean medicinal herb that is native to the Korean peninsula and has been widely used for over 2,000 years. Red ginseng, which has been produced by repeated heat treatment and drying of ginseng, has a new activity of ginsenoside which is different from ginseng. From the studies on the physiological activity of ginseng, various pharmacological effects of ginseng are known to be mainly due to saponin, ginsenoside, which is a key ingredient of ginseng. Ginsenoside is a glycoside structure with a sugar number of 30 in the triterpene skeleton, such as glucose, arabinose and rhamnose. Depending on its structure, it is divided into protopanaxadiol (PPD) and protopanaxatriol (PPT). Like other glycosides, ginsenoside, which is a ginseng glycoside, is easily absorbed through the process of elimination of sugar by the degrading enzyme of microorganisms present in the digestive tract during ingestion. A large number of Koreans have reported that the enzymes in the intestinal tract have no activity or are so weak that they do not receive the efficacy of ginseng.

Therefore, in order to maximize the effect of ginsenoside, it is desirable to increase the absorption rate of the ginsenoside by low molecular weight before ingestion of the ginsenoside. For example, recent research on biological treatment methods using microorganisms or enzymes capable of various conversions according to the reaction and selectively producing specific low molecular weight glycosides, rather than physical and chemical treatment methods such as heat treatment and acid / base treatment . Until now, studies on these ginsenosides have mainly used roots of ginseng underground. However, recent research has shown that ginsenosides are also found in the upper parts of ginseng leaves and ginseng fruits in addition to the ginseng undergrowths of ginseng (Attele AS et al, Biochem Pharmacol, 58, 1685-1693, 1999). Ginseng is usually harvested for 4-6 years, and it is commercialized as ginseng, red ginseng and various products using it. In the process, ginseng leaves and fruits have been treated as waste.

Ginseng fruit is more than 240 mg per gram of crude saponin, which is three times higher than 80 mg per g of 6-year-old ginseng, which is a good resource for saponin production. However, in ginseng cultivator, seeds were harvested at the age of 4 years to promote the growth of ginseng roots at the time of cultivation for 6 years, and at the end of 3, 5, and 6 years, 3,000 tons of fruit are being abandoned annually. Ginsenoside of ginseng root is different according to cultivation soil and climatic conditions, while ginseng fruit is known to have little difference in composition and content. The ginseng fruit has recently been developed as a beverage due to its high saponin content. The ginseng fruit extract has been shown to improve male sexual function (Korean Patent No. 10-1241050), Parkinson's disease / Alzheimer's disease prevention and treatment (Korean Patent No. 10-1581497) , And type 2 diabetes treatment (Korean Patent No. 10-1484502). Recently, a method of recovering saponins having excellent activity from ginseng fruit has been studied. For example, Korean Patent Registration No. 10-1330935 discloses a process for producing ginseng pulp by transplanting flesh from ginseng fruit; Allowing the ginseng flesh fluid to stand for 30 minutes to 2 hours on an ultrasonic wave to elute the components of the flesh of the ginseng fruit and then centrifuging; Filtering the centrifuged supernatant; And ultrafiltering said filtrate to a molecular weight of 1000-2000 to remove water, ionic material and water-soluble low molecular weight material and to obtain a concentrate at 15-30%. A method for producing a ginseng fruit extract is disclosed. Korean Patent Registration No. 10-1416669 discloses a method for preparing a ginseng extract, which comprises: 1 part by weight of ginseng fruit into 5 to 300 parts by weight of distilled water and sonicating at a temperature within a range of 90 ° C to 110 ° C for a period of time ranging from 35 minutes to 45 minutes; And a step of concentrating and freeze-drying the ultrasonic treated ginseng fruit under reduced pressure to increase the content of ginsenosides Rg2, Rg3, Rh1, Rk1 and F4. . Korean Patent No. 10-1051519 also discloses a method for producing a ginseng extract, comprising the steps of: after ginseng fruit is dried, pulverizing the ginseng fruit so as to have a moisture content of 12 3%; Dissolving the pulverized ginseng fruit powder in a water-soluble solvent or a solvent in which a water-soluble solvent and an organic solvent are mixed to cause an enzyme reaction with one or more selected from alpha-galactosidase, pectinase, cellulase and lactase ; And a step of mixing and extracting EM (Effective Micro-organisms) fermented green tea solution into the enzyme-reacted composition, thereby producing a ginseng fruit extract. Korean Patent No. 10-1182741 discloses a ginseng saponin component ginsenoside Rb1 derived from Aspergillus niger KCCM 11239 strain having a molecular weight of 123 kDa and having an optimal temperature stability of 70 캜 and an optimal pH stability of 4.0 using a β-glucosidase enzyme. , F2 and Rg3. Korean Patent No. 10-0443411 also discloses a method for producing ginsenoside F1 from ginsenoside Re or ginsenoside Rg1 using beta-glycosidase derived from genus Pennicylium or Ubumetium Method is disclosed.

As the recent income level increases, the intake of high-calorie foods increases in the dietary culture, and the incidence of obesity and various adult diseases is increasing. Among the factors causing adult diseases, the most important factor is hyperlipidemia of blood due to excessive intake of animal fat, which is a risk index for diseases such as hyperlipidemia, arteriosclerosis and lipid-related metabolic syndrome. Functional materials having cholesterol lowering effect include red yeast and mushroom mycelium. Red yeast rice (red koji) is a red yeast rice produced by inoculating a grain of the genus Monascus, which is a red mold, into the cereals. It is produced by the second metabolite produced by Hong Kook-gum, mebynolin (lovastatin, Monacolin K or mevacor] strongly inhibits HMG-CoA (3-hydroxy-methyl-3-glutaryl-coenzyme) reductase, which is a cholesterol biosynthesis enzyme, (Wang IK et al., J. Agri. Food Chem. 48: 3183-3189 2000; Endo A. et al., J. Antibiotechnol. 38: 420-422 1985 Manzoni M & Rollini M. App. Microbiol. Biotechnol. 58: 555-564 2002; Wei W. et al., J. Nutri. Biochem. 14: 314-318 2003) . In addition, throat mushroom is a substance recognized as improving the intestinal health by a pharmacopeia, and it is known that it has anti-diabetic, antioxidant and cholesterol-lowering effects.

The present invention has been made under the background of the prior art, and an object of the present invention is to provide a composition for lowering cholesterol based on a ginseng fruit-derived substrate.

The present inventors have found that ginseng fruit has a sufficient amount of ginsenosides Rd and Rd, which are effective substrates for producing rare ginsenoside, that the ginseng fruit is pretreated by steam milling and the ginsenoside present in ginseng fruit is identified It has been confirmed that the treatment with a single enzyme or a combination of specific enzymes can produce a variety of rare ginsenosides in high content. Further, the inventors of the present invention found that the product obtained by mixing the substrate derived from ginseng fruit with the mycelia of Hong jung or throat mushroom has an excellent cholesterol-lowering effect and contains various physiologically active ingredients, so that it is very useful value as a medicine material or health functional food material And the present invention has been completed.

In order to solve the above-mentioned problems, the present invention provides a composition for lowering cholesterol comprising or mixed with a ginseng fruit-red flounder mixed culture. The ginseng fruit-red flounder mixed culture is a product obtained by mixing ginseng fruit-derived substrate with red ginseng or red yeast. The ginseng fruit-derived substrate may be selected from ginseng fruit juice extract, ginseng fruit extract, ginseng fruit pulp extract or ginseng fruit pulp extract, or ginseng fruit juice extract, ginseng fruit extract, ginseng fruit pulp extract, ginseng fruit pulp extract or And the products obtained by the reaction of these concentrates with enzymes. In addition, the enzyme is selected from beta-glucosidase, hemicellulase, or a mixed enzyme thereof.

The mixed culture of the ginseng fruit-red flounder mixed culture or the ginseng fruit-thistle mushroom mycelium according to the present invention is characterized in that the content of rare ginsenoside is increased by the treatment and the mixed culture of the ginseng fruit and the physiological activity And therefore has an excellent cholesterol-lowering effect. Thus, the mixed culture of ginseng fruit-red flounder mixture or ginseng fruit-thistle mushroom mycelium according to the present invention can be used for the treatment of obesity, fatty liver, type 2 diabetes, hypertriglyceridemia, hypercholesterolemia, hyperlipidemia, dyslipidemia, Or a metabolic syndrome in which at least two of the above-mentioned diseases occur simultaneously, and the like.

Figure 1 shows the content of ginsenosides in the reaction product when the juice concentrate of matured ginseng fruit was reacted with purified DT-BGL and purified CS-BGL.
FIG. 2 is a graph showing the effect of the saponin content of ginseng fruit juice on the matured ginseng fruit when steamed for 15 hours under various pressures (atmospheric pressure (1 atm) + gauge pressure) at normal pressure (equivalent to 0 atm in terms of gauge pressure) Yield change.
FIG. 3 shows changes in saponin yield of ginseng fruit juice when matured ginseng was steamed for 15 hours under various pressure conditions and temperature conditions of 60 ° C.

Hereinafter, terms used in the present invention will be described.

As used herein, the term " rare ginsenoside " is a concept that includes all of ginsenosides that are present in trace amounts in ginseng or that are newly produced through separate physical, chemical, or biological treatments.

The term " culture product " used in the present invention means a product obtained by culturing a microorganism in a known liquid medium or solid medium, and includes a microorganism.

As used herein, the terms " pharmaceutically acceptable " and " pharmaceutically acceptable " are intended to mean not significantly irritating the organism and not interfering with the biological activity and properties of the administered active substance.

As used herein, the term " prophylactic " means any act that inhibits the symptoms of a particular disease or delays its progress by administration of the composition of the present invention.

The term " treatment " as used herein refers to any action that improves or alleviates the symptoms of a particular disease upon administration of the composition of the present invention.

As used herein, the term " improvement " means any action that at least diminishes or alleviates the parameters associated with the condition being treated, for example, the severity of the condition.

The term " administering " as used herein is meant to provide any desired composition of the invention to an individual by any suitable method. The term " individual " means any animal such as a human, a monkey, a dog, a goat, a pig, or a mouse having a disease in which symptoms of a specific disease can be improved by administering the composition of the present invention.

The term " pharmaceutically effective amount " as used herein means an amount sufficient to treat a disease at a reasonable benefit or risk rate applicable to medical treatment, including the type of disease, severity, activity of the drug, The time of administration, the route and rate of excretion of the drug, the duration of the treatment, factors including drugs used simultaneously and other factors well known in the medical arts.

The term " composition " as used in the present invention means a material in which two or more components are uniformly mixed, and includes not only an article but also an intermediate material for producing an article.

Hereinafter, the present invention will be described in detail.

The present invention relates to a composition for lowering cholesterol based on a ginseng fruit-derived substrate. The composition for lowering cholesterol according to one embodiment of the present invention comprises or is contained as an active ingredient in a mixed culture of ginseng fruit-red flounder. In addition, the ginseng fruit-red flounder mixed culture is a product obtained by mixing ginseng fruit-derived substrate with red ginseng or red yeast.

Ginseng fruit-derived substrate

In the present invention, a substrate derived from ginseng fruit means a ginsenoside-containing substrate obtained from ginseng fruit. The ginseng fruit-derived substrate may be selected from ginseng fruit juice extract, ginseng fruit extract, ginseng fruit pulp juice extract or ginseng fruit pulp extract. In consideration of the content of rare ginsenoside, the ginseng fruit-derived substrate is preferably selected from the group consisting of ginseng fruit juice extract, ginseng fruit extract, ginseng fruit pulp juice extract, ginseng fruit pulp extract, Can be selected from the obtained products. The enzyme may be selected from beta-glucosidase, hemicellulase, or a mixed enzyme thereof.

The ginseng as a source of the ginseng fruit is not particularly limited in terms of the variety, origin, and the like. For example, the ginseng fruit may be selected from various kinds of ginseng such as Korean ginseng, Korean ginseng, Korean ginseng, Chinese ginseng, American ginseng, Chinese ginseng, Chinese ginseng , Vietnamese samphire, and mandarin oranges can be used.

In addition, the ginseng fruit may be selected from immature fruit or mature fruit, and it is preferable that the ginseng fruit is a mature fruit considering the composition ratio of ginsenoside present in the ginseng fruit.

In addition, the ginseng fruit is preferably pretreated by the steaming process in consideration of the production of various rare ginsenosides and the increase of the content. The pretreatment of the ginseng fruit by the steaming process preferably comprises treating the fruit of ginseng with steam at a gauge pressure of 0.4 to 1 atm and a temperature of 50 to 70 ° C for 2 to 24 hours and considering the saponin yield, It is more preferable that the fruit is treated with steam at a gauge pressure of 0.5 to 1 atm and at a temperature of 55 to 70 DEG C for 10 to 20 hours.

In addition, considering the reaction efficiency and the physiological activity and diversity of the rare ginsenosides in the conversion of ginsenoside present in ginseng fruit to rare ginsenosides, the beta-glucosidase is a beta-glucosidase, -Glucosidase is preferably derived from Clostridium stercorarium and is preferably derived from Clostridium stercorarium subsp. Stercorarium DSM 8532 strain Is more preferable. The β-glucosidase derived from the Clostridium stercorarium subsp. Stercorarium strain DSM 8532 is composed of the amino acid sequence of SEQ ID NO: 1.

In addition, the hemicellulase is selected from enzymes that decompose plant cell wall components xylan, β-1,3-1,4-glucan, xyloglucan, glucomannan and the like, preferably xylanase ), Galactanase, mannanase, or arabinase, and is characterized in that the substrate availability to the ginsenosides present in the ginseng fruit and that of the rare ginsenosides A combination of xylanase and galactanase is preferable in view of the conversion efficiency and the synergistic action by combination with beta-glucosidase.

In addition, the mixing weight ratio of beta-glucosidase to hemicellulase in the mixed enzyme of beta-glucosidase and hemicellulase is not limited to a great extent, May be selected from 0.1: 99.9 to 99.9: 0.1. However, it is preferable that the mixing weight ratio of β-glucosidase to hemicellulase is 1: 4 to 4: 1 in consideration of the increased level of rare ginsenoside by enzyme treatment.

In addition, the ginseng fruit-derived substrate has at least one rare ginsenoside selected from Rg1, Rg2, Rg3, Rh1, Rh2, F2, Compound Mc, Compound K or Compound Y, , Preferably at least one rare ginsenoside selected from Rg3, Rh1, Rh2, F2, Compound Mc, Compound K or Compound Y is increased compared to before the reaction.

Hongkuk  Etc

In the present invention, red yeast is produced by inoculating a monascus bacterium, which is a red mold filamentous fungus, into a cereal. Preferably, the bacterium belonging to the genus Monascus, which is a red mold filament, is inoculated into steamed rice and fermented. Hongkuk is sold in Korea as cereal processed food, enzyme food in functional food, and functional rice, and Hongkong pigment and Hongkuk yellow cow are designated as food additives for pigment applications.

In the present invention, the kind of the microorganism belonging to the genus Monascus which is used in the production of red ginseng or mixed with the substrate derived from ginseng fruit is not limited as long as it is a microorganism capable of producing monocholine K as a secondary metabolite. For example, the microorganisms belonging to the genus Pseudomonas aeruginosa used in the present invention are Monascus pilosus), Pseudomonas carcass rubber (Monascus ruber), Pseudomonas coarse frame buffer mouse (Monascus purpureus , Monascus kaoliang , Monascus, barykery), Pseudomonas coarse Anka (Monascus anka) when such is and, considering the low productivity, high productivity an optical choline K and sheet rinin (citrinin) Pseudomonas coarse suspension Philo (Monascus pilosus , and Monascus ruber . The citrinin is a mycotoxin produced by a strain of the genus Monascus, which is known to affect the function of the kidney and liver.

Ginseng fruit-derived substrate and Hongkuk  Mixed cultures

In one example of the present invention, the ginseng fruit-red flounder mixed culture, which is an effective ingredient of the composition for lowering cholesterol, is a product obtained by mixing ginseng fruit-derived substrate with red yeast. At this time, the mixing weight ratio of the ginseng fruit-derived substrate to red ginseng is not particularly limited and is preferably selected from 1: 9 to 5: 5 and selected from 2: 8 to 4: 6. In addition, the mixed culture temperature of ginseng fruit-derived substrate and red yeast is selected at 25 to 35 ° C, and the incubation time can be selected from 24 to 36 hr.

The composition for lowering cholesterol according to another embodiment of the present invention may further comprise a mixed culture of ginseng fruit-thistle mushroom mycelium in addition to the ginseng fruit-red ginseng mixed culture as an active ingredient. The mixed culture of the ginseng fruit-thistle mushroom mycelium is a product obtained by mixing ginseng fruit-derived substrate with thymus mycelia and culturing. The ginseng fruit-derived substrate used in the preparation of the mixed culture of ginseng fruit-thymus mushroom mycelium has the same technical characteristics as those used for the production of ginseng fruit-red ginseng mixed culture, and thus its explanation is omitted.

Throat mushroom mycelium

Thirsty mushroom (( Auricularia auricula - judae ) is a fungus belonging to the fungus family. It has a diameter of 3 ~ 12㎝ and has a bell - shaped or ear - like shape. Mycelia of mycelia of the thymus can be produced by culturing the spores in a predetermined medium, which is an aggregate of mycelia formed by germination of spores. The thymus mushroom mycelium is a major physiologically active ingredient and includes beta-glucan and the like.

Mixed culture of ginseng fruit-derived substrate and thrips mushroom mycelium

In another example of the present invention, a mixed culture of a ginseng fruit-thistle mushroom mycelium, which is an effective ingredient of a composition for lowering cholesterol, is a product obtained by mixing ginseng fruit-derived substrate with thymus mushroom mycelium. At this time, the mixing weight ratio of the ginseng fruit-derived substrate and the thymus mushroom mycelium is not particularly limited, is preferably selected from 1: 9 to 5: 5, and is selected from 2: 8 to 4: 6. Also, the mixed culture temperature of the ginseng fruit-derived substrate and the thymus mushroom mycelium is selected at 20 to 30 ° C, and the incubation time can be selected from 48 to 72 hr.

The composition of the present invention may be formulated into a pharmaceutical composition, a food additive, a food composition (particularly, a health functional food), a feed additive, or the like depending on the intended use or aspect. The content of ginseng fruit-red flounder mixed culture, ginseng fruit-thistle mushroom mycelial mixed culture, etc., which is an effective ingredient, can also be adjusted in various ranges depending on the specific form of the composition, the purpose of use, and the manner.

The content of the active ingredient in the pharmaceutical composition according to the present invention is not particularly limited and is, for example, 0.01 to 99% by weight, preferably 0.5 to 50% by weight, more preferably 1 to 30% by weight, Lt; / RTI > In addition, the pharmaceutical composition according to the present invention may further contain, in addition to the active ingredient, an additive such as a pharmaceutically acceptable carrier, excipient or diluent. Examples of carriers, excipients and diluents that can be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate , Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the pharmaceutical composition of the present invention may further contain one or more known active ingredients having cholesterol-lowering activity. The pharmaceutical composition of the present invention can be formulated into a formulation for oral administration or parenteral administration by a conventional method, and can be formulated into a pharmaceutical composition such as a filler, an extender, a binder, a wetting agent, a disintegrant, Diluents or excipients. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose ), Lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions and syrups. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA. The pharmaceutical composition of the present invention may be administered orally or parenterally to a mammal including a human according to a desired method. Examples of the parenteral administration method include external dermal application, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravenous injection, Intravenous injection or intra-thoracic injection. The dosage of the pharmaceutical composition of the present invention is not limited as long as it is a pharmacologically effective amount and is not limited as long as it depends on the body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, Varies. The typical daily dose of the pharmaceutical composition of the present invention is not particularly limited, but is preferably 0.1 to 3000 mg / kg, more preferably 1 to 2000 mg / kg, based on the active ingredient, once a day Or may be administered in divided doses.

The content of the active ingredient in the food composition according to the present invention is 0.01 to 99% by weight, preferably 0.1 to 50% by weight, more preferably 0.5 to 25% by weight based on the total weight of the composition, no. The food composition of the present invention may be in the form of a pill, a powder, a granule, an infusion, a tablet, a capsule, or a liquid preparation. Examples of the food include meat, sausage, bread, chocolate, candy, snack, Other noodles, gums, dairy products including ice cream, various soups, drinks, tea, functional water, drinks, alcoholic beverages and vitamin complexes. In addition to the active ingredient, the food composition of the present invention may contain a pharmaceutically acceptable carrier, various flavors or natural carbohydrates as an additional ingredient. In addition, the food composition of the present invention can be used as a food composition containing various nutrients, vitamins, electrolytes, flavors, colorants, pectic acids and salts thereof, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, , A carbonating agent used in carbonated drinks, and the like. In addition, the food composition of the present invention may contain flesh for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The above-mentioned natural carbohydrates are sugar alcohols such as monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and xylitol, sorbitol and erythritol. Natural flavors such as tau Martin and stevia extract, and synthetic flavors such as saccharin and aspartame may be used as the flavor.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are intended to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.

1. Preparation of juice of ginseng fruit and analysis of ginsenoside composition

One of the immature ginseng fruits collected at the end of July and one of the mature ginseng fruits collected at the end of August from the farms in Pocheon area were supplied with 40 kg of each, and the seeds were squeezed without removing the seeds to produce ginseng fruit juice Respectively. The above-mentioned immature ginseng fruit is named GBG (ginseng berry green) with the epidermis being mainly green, and ginseng berry red is named GBR (ginseng berry red) because the mature ginseng fruit has a reddish color. Then, the ginseng juice was concentrated about 15 times to prepare a concentrate of ginseng fruit juice having a solid concentration of about 60 brix.

10 g of juice concentrate of ginseng fruit juice was diluted with methanol 5 times and filtered with 0.2 ㎛ membrane filter. The filtrate was used as a sample for high performance liquid chromatography (HPLC) analysis. The HPLC analysis conditions are shown below.

* Complete system: Agilent 1200 HPLC system

* Detector and analysis wavelength: UV detector, 203 nm

* Mobile phase solvent: Acetonitrile (solvent A) and water (solvent B)

* Concentration gradient of mobile phase solvent: The ratio of solvent A starts at the initial 25% and progressively increases until it reaches 100% over a total of 45 minutes.

* Standard: purchased from Facechem and Sigma

Table 1 below shows the results of HPLC analysis of the ginsenoside composition of GBG juice concentrate and GBR juice concentrate. The total ginsenoside content of the GBG juice concentrate and the GBR juice concentrate was 135.34 mg and 174.32 mg per g, respectively. The content of ginsenoside Rd was the highest in GBG juice concentrate and the content of ginsenoside Re was the highest in GBR juice concentrate. In the subsequent experiments, a GBR juice concentrate was used as a substrate for the enzyme reaction.

Gin Senocide classification GBG juice concentrate (mg / g) GBR juice concentrate (mg / g) Rb1 8.35 14.75 Rb2 5.15 9.6 Rb3 5.94 10.2 Rc 10.68 12.96 Rd 47.46 38.28 Re 39.48 61.36 Rf 1.21 1.34 Rg1 8.67 9.9 Rg2 6.32 12.3 Rg3 0.45 0.53 Rh1 0.97 1.09 Rh2 0.0 0.0 F1 0.0 0.0 F2 0.0 0.0 Compound Mc 0.0 0.0 Compound Mc1 0.0 0.0 Compound Y 0.0 0.0 Compound K 0.0 0.0 APPD 0.0 0.0 APPT 0.0 0.0

2. Recombinant beta-glucosidase (&bgr; glucosidase )of Cloning  And production

(1) Dictyoglomus Cloning and production of recombinant beta-glucosidase derived from turgidum DSM 6724 strain

Dictyoglomus DNA of the turgidum DSM 6724 strain-derived recombinant beta-glucosidase (GenBank number: ACK415480; dubbed DT-BGL) was prepared by the method of Lee et al. (Biotechnol. Lett. 2012, 34 (9): 1679) Then, the transformant strain was diluted with citrate-phosphate buffer, disrupted using ultrasonic waves, and centrifuged to collect DT-BGL expression supernatant. The supernatant was purified with a peptide tag The DT-BGL expression supernatant and the purified DT-BGL were selectively used in the experiments described below. DT-BGL was synthesized from the ginsenoside Rb1 as the substrate, Rd, F2, and Compound K, And the compound Mc from the substrate Ginsenoside Rc The optimal reaction conditions for DT-BGL were: citrate-phosphate buffer 50 mM, pH 5.5, reaction Temperature 80 ℃ .

(2) Cloning and production of recombinant beta-glucosidase derived from Clostridium stercorarium subsp. Stercorarium DSM 8532 strain

Clostridium stercorarium subsp. Stercorarium DSM 8532 strain recombinant beta-glucosidase (GenBank number: AGC67337; designated 'CS-BGL') is an amino acid of SEQ ID NO: 1 Dictyoglomus The amino acid sequence homology difference with turgidum DSM 6724 strain-derived recombinant beta-glucosidase DT-BGL is 67%. A CS-BGL DNA fragment consisting of the nucleotide sequence of SEQ ID NO: 2 was amplified by polymerase chain reaction (PCR). The primers used for the PCR were as follows. For the cloning, restriction enzymes NheI and XhoI were used.

Forward primer: 5 '-CGGCGCTAGCGTAATACCAATTGTTGCAAGAGTGTC-3'

Reverse primer: 5 '- AGTACTCGAGAGCCTGTTCAGCTTTTCCTCGTTCAGTTCC -3'

The template DNA used in the PCR was obtained by the following method. Clostridium stercorarium subsp. Stercorarium strain DSM 8532 was inoculated in Clostridium medium (DSM medium No. 255) at an agar concentration of 15 g / l and cultured for 2 days in anaerobic condition Colonies were formed. After removing oxygen by replacing nitrogen with vial (Wheaton, 10 ml capacity) containing 5 ml of Clostridium medium (DSM medium No. 255), Clostridium stercorarium ( Clostridium stercorarium) subsp. stercorarium DSM 8532 colonies were inoculated and sealed, and then cultured for 30 hours at a temperature of 60 ° C and a stirring condition of 150 rpm. Cells were recovered by centrifuging the culture, and template DNA was obtained from the recovered cells using a genomic DNA isolation kit (Bioneer).

Polymerase chain reaction (PCR) was performed using the Phusion® High-Fidelity DNA Polymerase kit (NEB), predenaturation at 98 ° C for 2 minutes, denaturation at 98 ° C for 10 seconds; annealing 55 캜, 30 sec; Extension A total of 30 cycles were performed at 72 ° C for 130 seconds as one cycle, and the reaction was finally performed at 72 ° C for 10 minutes. After amplification of the DNA fragments on the agarose gel electrophoresis, the DNA fragments were eluted and then separated by gel elution kit (Qiagen). The isolated DNA fragment was digested with NheI and XhoI restriction enzymes and cloned into pET-24a vector (Novagen) treated with the same restriction enzymes and the nucleotide sequence was confirmed. The pET-24a vector in which CS-BGL was cloned was designated as pCSBG plasmid, and 50 ng of the plasmid was transformed into E. coli ER2566 strain by electroporation and single colonies were obtained in LB-kanamycin agar medium. Then, the obtained single colonies were inoculated into LB broth having a kanamycin concentration of 50 μg / ml and cultured overnight, and used as seeds. The seeds were inoculated into 500 ml of LB broth at a concentration of 50 μg / ml of kanamycin and stirred at 230 rpm in a shaking incubator at 37 ° C. When the optical density at 600 nm reached 0.5, IPTG The final concentration was 1 mM to induce the expression of the target enzyme and further cultured for 15 hours at a temperature of 16 DEG C and a stirring condition of 150 rpm. After the cultivation was completed, the culture medium of the transformant was centrifuged at 3000 rpm for 20 minutes to recover the cells. The recovered cells were washed with physiological saline 20 times and diluted in citrate-phosphate buffer. Subsequently, the diluted cells were disrupted using a sonicator (Branson, model 100), and the cell lysate was centrifuged at 14,000 rpm for 20 minutes to remove the insoluble protein portion and collect the CS-BGL expression supernatant. Further, the supernatant was purified by a histidine tag contained in the pET-24a vector to obtain purified CS-BGL. Purified CS-BGL was solubilized in Citrate-Phosphate Buffer and used in the experiments described below. Purification was carried out using metal ion affinity chromatography (IMAC) cartridge (Bio-Rad) and immidazole.

3. Increased content of rare ginsenosides by recombinant beta-glucosidases

1 g of the GBR juice concentrate obtained above was added to citrate-phosphate buffer (50 mM, pH 5.5), and 2 ml of the enzyme-expressed supernatant (total amount of protein: 4 mg) was added thereto and reacted at 65 ° C for 1 hour. The ginsenoside composition of the reaction product was analyzed by HPLC and the results are shown in Table 2 below.

Gin Senocide classification
GBR juice concentrate (mg / g) Before enzyme reaction After reaction with CS-BGL After reaction with DT-BGL Rb1 14.75 0.0 0.20 Rb2 9.60 7.78 7.80 Rb3 10.20 5.36 10.12 Rc 12.96 9.42 9.56 Rd 38.28 50.34 48.24 Re 61.36 49.22 54.76 Rf 1.34 0.89 0.96 Rg1 9.90 10.94 7.32 Rg2 12.3 11.57 5.11 Rg3 0.53 4.55 0.0 Rh1 1.09 2.83 2.46 Rh2 0.0 2.12 0.0 F1 0.0 0.0 0.0 F2 0.0 3.64 1.55 Compound Mc 0.0 2.35 2.43 Compound Mc1 0.0 0.0 0.0 Compound Y 0.0 1.58 1.64 Compound K 0.0 0.78 0.68 APPD 0.0 0.0 0.0 APPT 0.0 0.0 0.0

As shown in Table 2, beta-glucosidase CS-BGL was similar to beta-glucosidase DT-BGL in terms of the amount of ginsenoside Rh1, Compound MC, Compound Y and Compound K produced. However, beta-glucosidase CS-BGL newly produced ginsenosides Rg3 and Rh2 as compared to beta-glucosidase DT-BGL, and the amount of ginsenosides Rg1 and F2 was also very high. In addition, since the content of ginsenoside Rb1, which is a substrate, was completely degraded by beta-glucosidase CS-BGL, the content of ginsenoside Rd was rather increased, and the reaction rate of beta-glucosidase CS- protopanaxadiol) family of ginsenosides. In addition, the content of Rg1, which is a reaction product of ginsenoside Re, was increased by the reaction with beta-glucosidase CS-BGL. As a result, beta-glucosidase CS-BGL was found to contain protopanaxatriol (PPT) It is presumed that the glucose present at the carbon position is decomposed.

Rg1, Rg2, Rg3, Rh1, Rh2 and F2 of the reaction product were reacted under the same conditions as the enzyme expression supernatant using purified DT-BGL and purified CS-BGL in place of the enzyme expression supernatant. Were compared. Figure 1 shows the content of ginsenosides in the reaction product when the juice concentrate of matured ginseng fruit was reacted with purified DT-BGL and purified CS-BGL. As shown in FIG. 1, the content of ginsenosides Rg3 and Rh1 in the juice concentrate of mature ginseng juice was 8 times and 2 times higher than that in the case of the reaction with purified CS-BGL, respectively. In addition, purified CS-BGL produced more ginsenosides Rh2 and F2 than purified DT-BGL, and the other trace ginsenosides produced were also higher. As a result, it is considered that beta-glucosidase CS-BGL can react with ginsenoside in the concentrate of ginseng fruit juice concentrate to increase the content of trace ginsenoside evenly.

4. Hemicellulase  Increased content of rare ginsenosides by

1 g of the GBR juice concentrate obtained above was added to citrate-phosphate buffer (50 mM, pH 5.5), 2 ml of hemicellulase as a commercial enzyme was added thereto, and the mixture was reacted at 35 ° C for 1 hour. The ginsenoside composition of the reaction product was analyzed by HPLC and the results are shown in Table 3 below. The hemicellulase, which is a commercial enzyme, is composed of xylanase and galactanase, and is a product of Japanese company Amno.

Gin Senocide classification GBR juice concentrate (mg / g) Before enzyme reaction After reaction with hemicellulase R2 2.21 0.0 Rb1 14.75 10.27 Rb2 9.6 7.78 Rb3 10.2 5.19 Rc 12.96 9.42 Rd 38.28 55.10 Re 61.36 50.37 Rf 1.34 1.29 Rg1 9.90 13.01 Rg2 12.3 16.78 Rg3 0.53 1.13 Rh1 1.09 3.54 Rh2 0.0 1.33 F1 0.0 0.0 F2 0.0 3.36 Compound Mc 0.0 2.01 Compound Mc1 0.0 0.0

As shown in Table 3, hemicellulase was effective in decomposing ginsenosides Rb2, Rb3, Rc, or R2 containing arabinose or xylose to increase contents of ginsenoside Rd, Rh1 or Compound Mc . In addition, the hemicellulase completely decomposed ginsenoside R2 and converted it into ginsenoside Rh1. As a result, Rh1 increased about 3.2 times after the reaction. In addition, the content of ginsenosides Rg1 and Rg2, which are reaction products of ginsenoside Re, increased by 1.3 times after the reaction of GBR juice concentrate and hemicellulase. In addition, after the reaction of GBR juice concentrate with hemicellulase, ginsenoside Rc was converted to Compound Mc by more than 30%. Hemicellulase also decomposed ginsenosides Rb2 and Rb3 in GBR juice concentrate by 23% and 50.8%, respectively, and decomposed more than 30% of ginsenoside Rb1 into all Rd. In conclusion, hemicellulase effectively decomposes arabinose and xylose of ginsenoside, which is difficult to degrade by conventional enzyme treatment, and can significantly increase various trace ginsenoside contents in ginseng fruit juice concentrate.

5. Beta-glucosidase and Hemicellulase  Increased content of rare ginsenosides by mixed enzymes

1 g of the GBR juice concentrate obtained above was added to citrate-phosphate buffer (50 mM, pH 5.5), and 2 ml of a mixed enzyme of beta-glucosidase and hemicellulase was added thereto, followed by reaction at 65 ° C for 1 hour. The ginsenoside composition of the reaction product was analyzed by HPLC and the results are shown in Table 4 below. The beta-glucosidase is a CS-BGL expression supernatant. The hemicellulase, which is a commercial enzyme, is composed of xylanase and galactanase, and is a product of Amno, a Japanese company. As shown in Table 4 below, the mixed enzyme of beta-glucosidase and hemicellulase significantly increased the content of trace ginsenosides in the GBR juice concentrate. It is considered that the mixed enzyme was caused by the decomposition of both the PPD series of ginsenosides and the PPT series of ginsenosides both as substrates and evenly.

Gin Senocide classification GBR juice concentrate (mg / g) Before enzyme reaction After reaction with mixed enzyme 1 After reaction with mixed enzyme 2 After reaction with mixed enzyme 3 R2 2.21 0.0 0.0 0.0 Rb1 14.75 9.14 9.12 5.54 Rb2 9.6 7.28 5.55 3.21 Rb3 10.2 3.39 5.98 7.37 Rc 12.96 6.21 7.42 8.99 Rd 38.28 57.20 50.10 45.10 Re 61.36 41.17 47.35 49.86 Rf 1.34 0.73 0.73 0.41 Rg1 9.90 17.23 15.08 12.45 Rg2 12.3 21.34 16.54 13.10 Rg3 0.53 1.13 3.93 4.98 Rh1 1.09 3.78 3.63 3.33 Rh2 0.0 2.21 2.45 2.83 F1 0.0 0.0 0.0 0.0 F2 0.0 3.64 3.98 4.53 Compound Mc 0.0 4.95 4.71 2.95 Compound Mc1 0.0 0.0 0.0 0.0

Mixed enzyme 1: Mixed weight ratio of beta-glucosidase to hemicellulase is 1: 4

Mixed Enzyme 2: Mixture weight ratio of 1: 1 beta-glucosidase to hemicellulase

Mixed enzyme 3: Mixture weight ratio of beta-glucosidase to hemicellulase is 4: 1

6. Steam  Steaming procee ) To increase the content of rare ginsenosides

(1) Establishment of optimal steaming process conditions based on saponin yield

The immature ginseng fruit or the mature ginseng fruit was steamed for 15 hours under a predetermined pressure and a predetermined temperature condition, and pressed to produce a ginseng fruit juice. Then, the sap of the ginseng fruit juice was concentrated and analyzed for its saponin content by high performance liquid chromatography (HPLC).

FIG. 2 is a graph showing the effect of the saponin content of ginseng fruit juice on the matured ginseng fruit when steamed for 15 hours under various pressures (atmospheric pressure (1 atm) + gauge pressure) at normal pressure (equivalent to 0 atm in terms of gauge pressure) Yield change. In FIG. 2, the saponin yield is shown as 100% when the steaming temperature is 60 ° C. As shown in FIG. 2, the saponin yield of the juice of ginseng fruit juice was highest when the boiling temperature was 50 to 70 ° C.

FIG. 3 shows changes in saponin yield of ginseng fruit juice when matured ginseng was steamed for 15 hours under various pressure conditions and temperature conditions of 60 ° C. In Fig. 3, the air pressure on the X axis represents the gauge pressure. In FIG. 3, the saponin yield is expressed as 100% when the boiling pressure condition is atmospheric pressure (equivalent to 0 atm in terms of gauge pressure, absolute pressure = atmospheric pressure (1 atm) + gauge pressure). As shown in FIG. 3, the saponin yield of the ginseng fruit juice was highest when the boiling pressure was 0.4 to 1 atm based on the gauge pressure.

From FIGS. 2 to 3, it was confirmed that the optimal processing conditions of the ginseng fruit on the basis of the saponin yield were a temperature of 50 to 70 DEG C, a gauge pressure of 0.4 to 1 atm and a treatment time of 2 to 24 hr. Since the processing of ginseng berries according to the present invention is carried out at a relatively low temperature, harmful components such as benzopyran are reduced and the content of rare ginsenosides is increased compared to the conventional high-temperature steaming process.

(2) Ginsenoside composition analysis of ginseng fruit juice pretreated with optimal steaming conditions

Immature ginseng fruit or mature ginseng fruit was steamed for 15 hours at a gauge pressure of 1 atm and temperature of 60 ℃, and pressed to produce ginseng fruit juice. Then, the sap of the ginseng fruit was concentrated and analyzed for its saponin content by high performance liquid chromatography (HPLC). The results are shown in Table 5 below.

Gin Senocide classification Before the boiling, GBG juice concentrate (mg / g) After boiling, GBG juice concentrate (mg / g) GBR juice concentrate (㎎ / g) After boiling, the GBR juice concentrate (mg / g) Rb1 8.35 8.15 14.75 13.25 Rb2 5.15 4.94 9.6 7.74 Rb3 5.94 5.45 10.2 9.28 Rc 10.68 10.68 12.96 12.96 Rd 47.46 42.43 38.28 33.32 Re 39.48 32.78 61.36 55.44 Rf 1.21 1.21 1.34 1.34 Rg1 8.67 9.8 9.9 11.71 Rg2 6.32 6.53 12.3 12.9 Rg3 0.45 1.34 0.53 1.72 Rh1 0.97 1.84 1.09 2.78 Rh2 0.0 0.0 0.0 0.0 F1 0.0 2.85 0.0 2.98 F2 0.0 1.99 0.0 2.51 Compound Mc 0.0 0.0 0.0 0.0 Compound Mc1 0.0 0.0 0.0 0.0 Compound Y 0.0 0.0 0.0 0.0 Compound K 0.0 0.0 0.0 0.0 APPD 0.0 0.0 0.0 0.0 APPT 0.0 0.0 0.0 0.0

As shown in Table 5, the ginsenoside contents such as Rg1, Rg2, Rg3, Rh1, Rh2, F1, and F2 of the ginseng fruit were significantly increased compared to those before the boiling.

7. Ginseng fruit - Hongkuk  Mixed culture, preparation of mixed culture of ginseng fruit-throat mushroom mycelium and analysis of active ingredient

(1) Production of red yeast

From the Korean Culture Center of Microorganisms (KCCM), a deposit and conservation organization of the Korean Federation of Culture Collections (KFCC), Monascus pilosus IFO 4480 (same strain as KCCM 60396 strain). Monascus pilosus IFO 4480 (the same strain as KCCM 60396 strain) was cultured in a potato dextrose agar medium (Difco, MI, USA) at a temperature of 30 ° C for 8 days, and the spore and mycelium were suspended in a liquid medium, Spore suspension. Thereafter, the white rice grown by high pressure steam sterilization treatment at 121 ° C for 30 minutes was spontaneously cooled, and the sprout suspension of Hongwook gonococci was inoculated in an amount of 0.2 g / kg in terms of dry cell weight. For 12 days. During the production of Hongkuk, the Hongkuk culture broth was shaken twice a day to prevent lump formation.

(2) Preparation of ginseng fruit-red yeast mixed culture

300 g of the red ginseng fruit juice concentrate prepared as above and 300 g of the mature ginseng fruit juice concentrate pretreated with optimal steaming conditions (treated at a gauge pressure of 1 atm and a temperature of 60 ° C for 15 hours) were uniformly mixed and heated at a temperature of 30 ° C. and a humidity of 70% For 30 hours to prepare a ginseng fruit - red yeast mixed culture.

(3) Preparation of mycelia of throat mushroom

The spore culture of the thymus mushroom was inoculated into PDA medium (Difco, MI, USA) and stored at 4 ° C and subcultured every 3 months. From the agar medium which had been sufficiently cultivated, about 10 pieces of the spore mushroom spores were cut and separated into liquid medium (pH 5.0), and the mixture was incubated at 25 ° C And seed culture was carried out for about 7 days under the condition of 130 rpm. Thereafter, the culture medium of the seed culture was cultured in a liquid medium (glucose 20 g / L, MgSO ₄ .7H ₂ O 0.5 g / L, KH ₂ PO ₄ 0.46 g / L, K ₂ HPO ₄ 1 g / L, yeast extract 2 g / L) and peptone (2 g / L; pH before sterilization was 5.0) in an amount of 5% (v / v) and incubated for about 10 days at 25 ° C. and 120 rpm in a rotary shaking incubator Mushroom mycelia were prepared.

(4) Preparation of mixed culture of ginseng fruit-thymus mushroom mycelium

700 g of the mushroom mycelia prepared above and 300 g of the mature ginseng fruit juice concentrate which had been pretreated with the optimal steaming processing conditions (treatment at 1 atm gauge pressure and temperature of 60 ° C. for 15 hours) were uniformly mixed and heated at 25 ° C. and 120 rpm For about 60 hours to prepare a mixed culture of ginseng fruit-thistle mushroom mycelium.

(5) Analysis of content of monocholin K

To 0.2 g of the sample was added 1 ml of 100% methanol as an extraction solvent, sonicated at 25 ° C for 20 minutes, and then centrifuged at 8,000 × g for 10 minutes to obtain a supernatant. In addition, 1 mL of the extraction solvent was added to the precipitate obtained by centrifugation, monacolin-K was extracted in the same manner as above, and repeated 5 times to obtain 5 mL of the final extract. Then, the extract was filtered with a syringe filter, and 10 μl of the filtered extract was injected into an HPLC apparatus and analyzed under the following conditions.

* Analysis Column: Merck LiChrospher 100 RP-18

* Developing solvent: acetonitrile: 0.1% trifluoacetic acid (60:40)

* Developed flow rate: 1 ml / min

Thereafter, the assay results were compared with a standard monocholine-K (Sigma-aldrich Co., USA) to determine the amount of the inactive monacolin-K (Lactone form) contained in each sample.

(6) Analysis of beta-glucan content

The liquid culture sample was centrifuged at 10,447 x g for 20 minutes to obtain a precipitate, which was dried and concentrated. Then, 2,000 ml of distilled water was added as an extraction solvent to 100 g of the precipitate, and the mixture was extracted with a hot bath at 100 ° C for 24 hours, followed by centrifugation to obtain a supernatant. Further, 2,000 ml of distilled water was further added as an extraction solvent to the remaining residue after centrifugation, and the mixture was extracted with a hot bath at 100 ° C for 24 hours, and extracted three times to obtain an extract. Thereafter, the extract was concentrated under reduced pressure to obtain 100 ml of a concentrated solution. Thereafter, the temperature of the concentrate was maintained at 4 캜, 300 ml ethanol ice-cooled at -20 캜 was added thereto, and the mixture was allowed to stand at 4 캜 for 4 hours. Then, the precipitate was separated from the concentrate and the content of β-glucan was measured using a Beta-glucan assay kit (Megazyme. Co.).

(7) Analysis of active components of mixed cultures

Table 6 shows the results of the analysis of the active ingredients contained in the mixed cultures of red ginseng, ginseng fruit-red ginseng mixed culture, throat mushroom mycelium, and ginseng fruit-thistle mushroom mycelium.

Active ingredient Analytical sample Hongkuk Ginseng fruit - red yeast mixed culture Throat mushroom mycelium Ginseng fruit-throat mushroom mycelium mixed culture Mona Colin K
(Mg / kg) 3,200 1,600 ND ND Total saponin
(Mg / kg) ND 80,100 ND 86,200 Beta-glucan
(Mg / L) ND ND 3,000 1,500

As shown in Table 6, various active ingredients such as monacolin K, saponin, and beta-glucan were produced in a mixed culture of ginseng fruit-red flounder mixed culture or ginseng fruit-thistle mushroom mycelium.

8. Hongkuk , Ginseng fruit - Hongkuk  Mixed culture, mycelium of mushroom, mixed culture of ginseng fruit - thistle mushroom mycelium, ginseng fruit - Hongkuk - In-vivo experiment for checking cholesterol lowering effect of mixed culture of mycelia

SD rats were purchased and adapted to the feeding environment by feeding only basic diets for 1 week. The crude diet contained crude porothe- tan (minimum) 18%, crude fat (minimum 5%, fiber 5%, maximum 5%, ash (maximum)) with 5 L79 Rat / Mouse Formula 18% (PMI Nutrition LLC, Po Box 19798 Brentwood Mo 63144, USA) 8% and carbohydrate 64%. The temperature of the incubation room was adjusted to 22 ± 2 ° C, the humidity to 60 ± 5%, and the light-dark cycle to 12 hours.

Thereafter, animals were randomly selected to be environmentally adapted for 1 week, divided into 8 groups of 6 animals per group. In the experimental animals except for the normal diet group, high cholesterol diet containing 1% cholesterol and 0.25% sodium cholate For 4 weeks to induce hyperlipemia. The animals in the normal diet group were fed a basic diet. Then, drug samples were dissolved in 1% Tween-80 for 1 week and then administered orally at a dose of 10 ㎎ / ㎏ bw. Drug samples administered to each experimental group were as follows.

* Normal diet group: Only basic diet is fed without drug sample

* Positive Control: After taking a high cholesterol diet, the patient is given cholesterol lowering drug, probucol.

* Group A: Red ginseng is administered as a drug sample after high cholesterol diet

* Group B: After taking high cholesterol diet, ginseng fruit-red mixed culture was administered as a drug sample.

* Group C: After taking a high cholesterol diet, mycelium of throat mushroom was administered as a drug sample.

* Group D: After taking high cholesterol diet, mixed culture of ginseng fruit-throat and mushroom mycelium was administered as a drug sample.

* Group E: After ingesting high cholesterol diet, mixed culture of ginseng fruit - red ginseng - thymus mushroom mycelium was administered as a drug sample

* Mixed culture of ginseng fruit - red ginseng - thymus mushroom mycelium: mixed ginseng fruit - red ginseng mixed culture and ginseng fruit - thistle mushroom mycelium mixed culture

After the administration, the rats were lightly anesthetized with CO ₂ , the blood was collected from the abdominal aorta, left at room temperature for 30 minutes, and centrifuged at 3,000 rpm for 10 minutes to separate the serum. The content of high density lipoprotein cholesterol (HDL-C) in serum was measured using a kit (Sigma, USA) prepared by the enzyme method such as Noma and the content of LDL-C (low density lipoprotein cholesterol) Method. Table 7 shows the results of the drug samples on the blood cholesterol content of the experimental animals.

Experimental group Total cholesterol (㎎ / ㎗) HDL-C (mg / dL) LDL-C (mg / dl) Normal diet group 130.1 82.2 43.0 Positive control group 230.3 125.1 104.5 Group A 193.2 118.4 55.0 Group B 190.3 119.3 54.1 Group C 198.1 121.0 61.3 Group D 193.8 123.1 58.5 Group E 181.8 128.8 48.9

As shown in Table 7, the mixed cultures of the ginseng fruit-red flounder mixed cultures and the ginseng fruit-thistle mushroom mycelial cultures further reduced the cholesterol of the experimental animals compared with the mycelia of the red and thrips mushrooms, respectively, and the ginseng fruit-red ginseng- In the case of the culture, the cholesterol of the experimental animals was remarkably reduced.

9. Ginseng fruit - Hongkuk  Mixed culture, ginseng fruit-throat mushroom mycelial mixed culture Hemicellulase  Changes in the content of rare ginsenosides by treatment

To the citrate-phosphate buffer solution (50 mM, pH 5.5), 1 g of the mixed culture of the ginseng fruit-red ginseng mixture or the ginseng fruit-thistle mushroom mycelium prepared above was added and 2 ml of hemicellulase, a commercial enzyme, was added thereto. And reacted for 1 hour. The ginsenoside composition of the reaction product was analyzed by HPLC and the results are shown in Tables 8 and 9 below. The hemicellulase, which is a commercial enzyme, is composed of xylanase and galactanase, and is a product of Japanese company Amno.

Gin Senocide classification Converted to the concentration of GBR juice concentrate (㎎ / g) after boiling for the preparation of ginseng fruit - Ginseng fruit before fermentation with enzyme - red yeast mixed culture Ginseng fruit - red yeast mixed culture after reaction with hemicellulase Rb1 8.0 7.2 Rb2 4.9 4.7 Rb3 5.4 5.19 Rc 10.6 9.42 Rd 41.4 25.1 Re 32.7 30.3 Rf 1.2 1.2 Rg1 9.8 11.0 Rg2 6.5 12.7 Rg3 1.3 1.9 Rh1 1.8 3.7 Rh2 0 1.3 F1 2.8 4.0 F2 1.9 3.3 Compound Mc 0.0 2.0 Compound Mc1 0.0 0.0

Gin Senocide classification (Mg / g) converted to GBR juice concentrate after boiling used in the preparation of mixed cultures of ginseng and thymus mushroom mycelium Ginseng fruit before the reaction with the enzyme - Mixed culture of mycelium of throat and mushroom Ginseng fruit after reaction with hemicellulase - Mixed culture of mycelia of throat and mushroom Rb1 10.7 7.2 Rb2 9.6 7.7 Rb3 6.2 5.1 Rc 12.9 8.2 Rd 38.2 25.1 Re 61.3 30.3 Rf 1.3 1.3 Rg1 10.7 18.0 Rg2 10.3 16.7 Rg3 1.5 2.3 Rh1 1.9 3.9 Rh2 0.0 1.3 F1 0.0 4.4 F2 0.0 3.6 Compound Mc 0.0 2.1 Compound Mc1 0.0 0.0

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Accordingly, the scope of protection of the present invention is not limited to the specific embodiments but should be construed as including all embodiments belonging to the claims attached hereto.

<110> Global Hub Co., Ltd. <120> Composition for lowering cholesterol comprising a mixture culture          of Ginseng Berry-hongguk <130> DP-17-466 <160> 2 <170> KoPatentin 3.0 <210> 1 <211> 794 <212> PRT <213> Unknown <220> <223> beta-glucosidase derived from Clostridium stercorarium subsp.          stercorarium DSM 8532 <400> 1 Met Val Ile Pro Ile Val Ala Arg Val Ser Glu Lys Val Ile Ile Tyr   1 5 10 15 Tyr Ala Gly Thr Val Tyr Glu Asn Leu Asn Asp Lys Gly Ile Thr Gly              20 25 30 Val Ile Lys Met Gln Arg Asp Ile Lys Lys Ile Ser Ser Gln Met Thr          35 40 45 Leu Glu Glu Lys Ala Ser Leu Cys Ser Gly Leu Asp Ala Trp Asn Leu      50 55 60 Lys Ser Val Glu Arg Leu Gly Ile Pro Ser Ile Met Val Ser Asp Gly  65 70 75 80 Pro His Gly Leu Arg Lys Glu Thr Thr Asp Pro Thr Asp Pro Gly Lys                  85 90 95 Lys Thr Thr Val Ala Thr Cys Phe Pro Thr Ala Val Gly Leu Ala             100 105 110 Ser Ser Trp Asn Arg Glu Leu Val Glu Lys Val Gly Ala Ala Leu Gly         115 120 125 Glu Cys Gln Ala Glu Gly Ile Ala Val Leu Leu Gly Pro Gly Thr     130 135 140 Asn Ile Lys Arg Ser Pro Leu Cys Gly Arg Asn Phe Glu Tyr Phe Ser 145 150 155 160 Glu Asp Pro Tyr Leu Ser Ser Glu Met Ala Ala Ser His Ile Lys Gly                 165 170 175 Val Gln Ser Arg Gly Val Gly Thr Ser Leu Lys His Phe Ala Ala Asn             180 185 190 Asn Gln Glu His Arg Arg Met Ser Val Asp Ala Val Ile Asp Glu Arg         195 200 205 Thr Leu Arg Glu Ile Tyr Leu Ala Ser Phe Glu Gly Ala Val Lys Lys     210 215 220 Ala Lys Pro Trp Thr Ile Met Cys Ser Tyr Asn Arg Val Asn Gly Glu 225 230 235 240 Tyr Ala Ser Glu Asn Lys Phe Leu Leu Thr Asp Val Leu Arg Asn Glu                 245 250 255 Trp Gly Phe Glu Gly Ile Val Val Ser Asp Trp Gly Ala Val Asn Glu             260 265 270 Arg Val Lys Gly Leu Glu Ala Gly Leu Asp Leu Glu Met Pro Ser Ser         275 280 285 Phe Gly Ile Gly Asp Gln Lys Ile Val Glu Ala Val Lys Lys Gly Glu     290 295 300 Leu Pro Glu Glu Val Leu Asp Arg Thr Val Glu Arg Ile Leu Asn Leu 305 310 315 320 Ile Phe Lys Ala Val Asp Asn Arg Lys Glu Asn Ala Gly Tyr Asp Arg                 325 330 335 Glu Ala His His Lys Leu Ala Arg Glu Ala Ala Arg Glu Cys Met Val             340 345 350 Leu Leu Lys Asn Glu Asp Lys Ile Leu Pro Leu Arg Lys Gln Gly Thr         355 360 365 Ile Ala Val Ile Gly Glu Phe Ala Lys Arg Pro Arg Tyr Gln Gly Gly     370 375 380 Gly Ser Ser His Val Asn Pro Thr Ile Met Asp Ser Pro Tyr Glu Glu 385 390 395 400 Ile Lys Lys Ser Ala Gly Asn Asn Ala Asp Val Ile Tyr Ala Gln Gly                 405 410 415 Tyr Phe Ile Glu Lys Asp Glu Pro Asp Glu Lys Leu Leu Glu Glu Ala             420 425 430 Lys Gln Ala Ala Leu Lys Ala Asp Val Ala Val Ile Phe Ala Gly Leu         435 440 445 Pro Glu His Tyr Glu Cys Glu Gly Tyr Asp Arg Gln His Met Arg Met     450 455 460 Pro Glu Ser His Cys Thr Leu Ile Glu Glu Val Ala Lys Val Gln Pro 465 470 475 480 Asn Val Val Val Leu Cys Asn Gly Ser Pro Val Glu Met Pro Trp                 485 490 495 Ile Asp Lys Val Lys Gly Leu Leu Gly Aly Tyr Leu Gly Gly Gln Ala             500 505 510 Met Gly Gly Ala Ile Ala Asp Leu Leu Phe Gly Asp Ala Asn Pro Ser         515 520 525 Gly Lys Leu Ala Glu Thr Phe Pro Lys Gln Leu Ser Asp Asn Pro Ser     530 535 540 Tyr Leu Asn Phe Pro Gly Glu Gly Asp Arg Val Glu Tyr Arg Glu Gly 545 550 555 560 Ile Phe Val Gly Tyr Arg Tyr Tyr Asp Lys Lys Asn Met Glu Pro Leu                 565 570 575 Phe Pro Phe Gly Tyr Gly Leu Ser Tyr Thr Thr Phe Glu Tyr Gly Asp             580 585 590 Leu Lys Ile Ser Arg Lys Glu Ile Ser Asp Asn Glu Thr Val Thr Val         595 600 605 Ser Val Lys Val Lys Asn Thr Gly Asp Met Ala Gly Lys Glu Ile Val     610 615 620 Gln Leu Tyr Val Arg Asp Ile Glu Ser Ser Val Ile Arg Pro Glu Lys 625 630 635 640 Glu Leu Lys Gly Phe Glu Lys Val Glu Leu Lys Pro Gly Glu Glu Lys                 645 650 655 Thr Val Phe Glu Leu Asp Lys Arg Ala Phe Ala Tyr Tyr Asn Thr             660 665 670 Gly Ile Arg Asp Trp His Val Glu Thr Gly Glu Phe Glu Ile Leu Ile         675 680 685 Gly Arg Ser Ser Arg Asp Ile Val Leu Lys Asp Lys Ile Phe Val Lys     690 695 700 Ser Thr Val Thr Ile Lys Lys Pro Val Asp Arg Asn Thr Leu Val Gly 705 710 715 720 Asp Leu Leu Ser Asp Arg Val Leu Glu Pro Val Phe Arg Glu Phe Ile                 725 730 735 Ile Asn Glu Ile Lys Asn Arg Tyr Leu Leu Asp Leu Leu Glu Asn Glu             740 745 750 Asp Lys Ser Leu Leu Ser Val Trp Met Arg Tyr Thr Pro Leu Arg Ser         755 760 765 Leu Ala Asn Ser Thr Gly Gly Glu Leu Asn Glu Glu Lys Leu Asn Arg     770 775 780 Leu Ile Asp Thr Leu Asn Ala Asn Ile Lys 785 790 <210> 2 <211> 2385 <212> DNA <213> Unknown <220> <223> DNA fragment encoding beta-glucosidase derived from Clostridium          stercorarium subsp. stercorarium DSM 8532 <400> 2 gtggtaatac caattgttgc aagagtgtct gagaaagtta taatttatta tgccggaacg 60 gtttacgaaa atttgaacga taaaggcata acaggagtga taaaaatgca aagggacatc 120 aaaaaaatta tttcacaaat gacgctggaa gaaaaggcga gcttatgctc gggccttgac 180 gcctggaacc ttaaaagcgt agaacgtttg ggcattccgt ccattatggt atctgacggc 240 ccccatggtc tcagaaaaga gacaacggat cccactgatc ccggtaagaa aaccactgtc 300 ccggccacat gtttccccac tgcggttggc cttgcaagct catggaaccg tgaactggtg 360 gagaagtag gcgccgcatt gggggaagaa tgccaggctg aaggaatagc agtgcttctt 420 gggccgggaa ccaatataaa acgttcccct ctttgcggaa gaaactttga atatttttcg 480 gaagacccgt acctttcttc ggagatggca gcaagccata taaaaggagt gcagagccgg 540 ggagtgggga cgtccctgaa gcattttgcg gcaaataacc aggaacaccg cagaatgagc 600 gtggatgcgg taattgacga aagaacgctg cgtgaaattt acctcgccag tttcgaaggg 660 gcggttaaaa aggcgaagcc gtggacgatc atgtgttcat acaacagggt aaacggcgag 720 tatgcatctg aaaataaatt tctgttaaca gatgtactga gaaatgaatg gggttttgaa 780 ggcattgtgg tatccgactg gggagcggtg aatgagaggg taaagggact ggaagccgga 840 cttgatcttg aaatgccgtc aagcttcggt attggagacc aaaaaatagt tgaagccgta 900 aagaagggtg agctgcccga agaggtattg gacagaaccg ttgaaaggat acttaattta 960 atttttaaag cggtggataa caggaaagaa aatgccggat atgaccggga agctcatcac 1020 aaactggcca gagaagcggc aagggagtgc atggtgctgc ttaagaacga ggacaaaata 1080 cttccgctta ggaagcaggg aaccatagcc gtaataggcg aatttgctaa aagaccacgg 1140 tatcagggcg gaggaagctc ccatgtaaat cccacaatca tggatagtcc atatgaagaa 1200 atcaaaaaat cagcgggaaa caatgcagat gttatatatg cgcaaggtta ttttattgaa 1260 aaggacgagc cagatgaaaa actcctggag gaagcaaagc aggcggcgct gaaggcagat 1320 gtcgccgtga tatttgcagg gcttcccgag cattatgaat gcgagggcta tgaccgtcag 1380 catatgagaa tgcccgaaag ccactgcacg cttatcgaag aagtggcgaa agtacaaccc 1440 aatgtggtgg tggtattatg caacggttca ccggtggaga tgccgtggat tgacaaagtg 1500 aagggattgc tggaggctta cctgggcgga caagccatgg gcggagccat tgccgatctt 1560 ctgttcggag acgccaatcc cagcgggaag ctcgccgaga ctttcccgaa acagttaagc 1620 gataaccctt catatttgaa ttttcccggg gaaggggaca gggttgaata cagggaaggc 1680 atattcgtgg gctacaggta ttatgacaaa aagaatatgg aaccgctgtt cccgttcgga 1740 tacgggctc gctacactac gtttgagtac ggcgatctga aaataagcag gaaagaaata 1800 tctgataacg aaacggtgac tgtgagcgta aaggttaaga ataccggaga tatggcgggt 1860 aaggagattg tgcagcttta cgtaagggat attgaaagct cggtaataag accggagaag 1920 gaactgaagg gttttgaaaa agttgaactt aagcccggcg aggaaaaaac ggtggtgttt 1980 gaacttgaca agagggcgtt tgcttattac aacaccggta taagggactg gcatgttgaa 2040 accggtgaat ttgagatttt aataggcaga tcctcaaggg acatagtgct taaagacaag 2100 atattcgtca aatcaaccgt taccataaaa aaaccggtgg acagaaacac gctggtgggg 2160 gatttgcttt ctgatcgggt tcttgagcct gtattcagag agtttattat taacgagata 2220 aaaaacaggt acttgttgga tttactggag aacgaggata aatccctcct gagtgtgtgg 2280 atgaggtata ctcctctgcg ttcattggcg aacagtacgg gtggggaact gaacgaggaa 2340 aagctgaaca ggctgattga tacactgaat gcaaatatta aataa 2385

Claims (10)

A mixed culture of ginseng fruit-red flounder and a mixed culture of ginseng fruit-thistle mushroom mycelium, or a composition comprising these as an active ingredient,
The ginseng fruit-red flounder mixed culture is a product obtained by mixing ginseng fruit-derived substrate with red ginseng or red yeast,
The mixed culture of the ginseng fruit-thistle mushroom mycelium is a product obtained by mixing the ginseng fruit-derived substrate with the mycelium of throat mushroom,
Wherein the substrate derived from the ginseng fruit is selected from a ginseng fruit juice extract, a ginseng fruit extract or a concentrate thereof, or a product obtained by reacting a ginseng fruit extract, a ginseng fruit pulp juice extract or a concentrate thereof with an enzyme,
Wherein the enzyme is selected from beta-glucosidase, hemicellulase, or a mixed enzyme thereof.
The composition for lowering cholesterol according to claim 1, wherein the ginseng fruit is mature fruit.
The composition for lowering cholesterol according to claim 1, wherein the beta-glucosidase is derived from Clostridium stercorarium .
4. The composition for lowering cholesterol according to claim 3, wherein the beta-glucosidase is an amino acid sequence of SEQ ID NO: 1.
The hemicellulase according to claim 1, wherein the hemicellulase is at least one selected from the group consisting of xylanase, galactanase, mannanase, and arabinase. Wherein the cholesterol-lowering composition is a composition for reducing cholesterol.
The composition for lowering cholesterol according to claim 1, wherein the weight ratio of the β-glucosidase to the hemicellulase is 1: 4 to 4: 1.
The ginseng fruit-derived substrate according to claim 1, wherein the ginseng fruit-derived substrate comprises at least one rare ginsenoside selected from Rg1, Rg2, Rg3, Rh1, Rh2, F2, Compound Mc, Wherein the cholesterol-lowering agent is added to the composition.
The composition for lowering cholesterol according to claim 1, wherein the ginseng fruit is pretreated by boiling.
[Claim 9] The method according to claim 8, wherein the pretreatment of ginseng fruit by the steaming process comprises treating the fruit of ginseng with steam at a gauge pressure of 0.4 to 1 atm and a temperature of 50 to 70 DEG C for 2 to 24 hours / RTI &gt;
10. The method according to any one of claims 1 to 9, wherein the substrate derived from ginseng fruit is selected from the group consisting of ginseng fruit pulp juice extract, ginseng fruit pulp extract or concentrate thereof, or ginseng fruit pulp extract, ginseng fruit pulp extract, And a product obtained by a reaction between a concentrate and an enzyme.

Images