KR20180008836A - Kit for detecting intestinal parasites and detection method using the same - Google Patents

Abstract

The present invention relates to a kit for detecting intestinal parasites causing gastrointestinal disorders, and a method for detecting parasites using the same. According to the present invention, a primer, a probe, and a kit for amplifying a real-time polymerase chain reaction (PCR) including the same show excellent detection limit, specificity, and high reliability when used in detection of intestinal parasites, and also enable more sensitive detection than existing microscopic diagnosis methods, thereby being clinically useful.

Description

Kit for detecting intestinal parasites and detection method using the same}

The present invention relates to a kit for detecting intestinal parasites causing gastrointestinal disorders and a method for detecting parasites using the same.

With rapid industrialization, people are getting used to urban life, and overall quality of life has improved due to cultural and economic development. Now, the rate of parasite infection in Korea has decreased significantly compared to the past, around 0.04-0.07%, but recently, food that has not received attention in the past. The importance of vector parasites, common infectious parasites, and opportunistic infectious parasites is emerging.

Among them, the increase in food-borne parasitic infection is mainly due to reproduction of sashimi, shellfish, and crustaceans, and is closely related to dietary habits. In particular, a disease that exhibits intestinal symptoms caused by infection with flukes such as hepatic flukes, yokogawa flukes, and protozoa such as small follicle spores, ramble flagellum, ramble flagellum, dysentery amoeba, blastocytosis hominis, and protozoa such as dinuclear amoeba. It is a subject of interest because it shows a steady prevalence of.

There are various methods such as stool test, blood test, sputum test, cellophane tape method, and immunoserologic diagnosis method to diagnose a parasitic infection that causes intestinal symptoms. When performing, there is a problem that it is possible to observe even though special dyeing is required.

Accordingly, there is an urgent need to develop a new diagnostic protocol capable of simultaneously detecting parasites that cause intestinal symptoms.

The problem to be solved by the present invention is a primer set capable of simultaneously detecting a parasite that causes intestinal symptoms, a probe capable of solving the cumbersome problem of a conventional parasite infection diagnosis method, a kit for amplifying a real-time polymerase chain reaction including the same, and It is to provide a method for simultaneous detection of symptom-causing parasites.

1. (1) a first primer set comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2;

(2) a second primer set comprising a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4; And

(3) a third primer set comprising a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6; a primer set for detecting intestinal symptom-causing parasites comprising at least one selected from the group consisting of.

2. The primer set for detecting intestinal symptom-causing parasites according to the above 1, wherein the intestinal symptom-causing parasite is a trematode.

3. In the above 2, the fluke is a large mouth fluke (Gymnophalloides). seoi ), Yokogawa fluke ( Metagonimus yokogawai ) or liver fluke (Clonorchis sinensis ), a primer set for detecting intestinal symptom-causing parasites.

4. In the above 1, wherein the primer set for detecting intestinal symptom-causing parasites is (4) a fourth primer set comprising a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8;

(5) a fifth primer set comprising a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10;

(6) a sixth primer set comprising a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12;

(7) a seventh primer set comprising a forward primer of SEQ ID NO: 13 and a reverse primer of SEQ ID NO: 14; And

(8) an eighth primer set comprising a forward primer of SEQ ID NO: 15 and a reverse primer of SEQ ID NO: 16; a primer set for detecting intestinal symptom-causing parasites further comprising at least one selected from the group consisting of.

5. In the above 4, wherein the 4th to 8th primer sets are derived from protozoa, a primer set for detecting intestinal symptom-causing parasites.

6. In the above 5, the protozoa is small and sporidium ( Cryptosporidium parvum ), Giardia lamblia , Dientamoeba fragilis ), Entamoeba histolytica , Blastocystis hominis ) a primer set for detecting one or more intestinal symptom-causing parasites selected from the group consisting of.

7. A probe for detecting intestinal symptom-causing parasites comprising at least one probe selected from the group consisting of SEQ ID NOs: 17 to 19.

8. The probe for detecting intestinal symptom-causing parasites according to the above 7, wherein the intestinal symptom-causing parasite is a fluke.

9. The probe for detecting intestinal symptom-causing parasites according to the above 8, wherein the fluke is a large oyster fluke, a yokogawa fluke, or a liver fluke.

10. The intestinal symptom-causing parasite detection probe according to the above 9, wherein the probe for detecting intestinal symptoms-causing parasites further comprises one or more probes selected from the group consisting of SEQ ID NOs: 20 to 24.

11. In the above 10, wherein the probes of SEQ ID NOs: 20 to 24 are derived from protozoa, a probe for detecting intestinal symptom-causing parasites.

12. In the above 11, wherein the protozoa is a probe for detecting intestinal symptom-causing parasites, characterized in that at least one selected from the group consisting of small follicle spores, ramble flagellum, dinuclear amoeba, dysentery amoeba, and blastocytosis hominis.

13. Kit for amplifying a real-time multiple polymerase chain reaction of intestinal symptom-causing parasites, including the primer set of 1 and the probe of claim 8.

14. The kit for amplifying a real-time multiple polymerase chain reaction of the intestinal symptom-causing parasite according to the above 13, wherein the intestinal symptom-causing parasite is a fluke.

15. The kit for amplifying a real-time multiple polymerase chain reaction of parasites inducing symptoms according to the above 14, wherein the fluke is a large oyster fluke, a yokogawa fluke, or a liver fluke.

16. The kit for amplifying a real-time multiple polymerase chain reaction of intestinal symptom-causing parasites according to the above 13, wherein the intestinal symptom-causing parasite additionally includes a protozoan.

17. In the above 16, the protozoa is a real-time multiple polymerase chain of a parasite that causes intestinal symptoms, characterized in that at least one selected from the group consisting of small follicle spores, ramble flagellum, dinuclear amoeba, dysentery amoeba, and blastocytosis hominis. Kit for reaction amplification.

18. In the above 13, the kit for amplifying the real-time multiple polymerase chain reaction

(a) a first primer set comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2 in a first reaction vessel, a fifth primer set comprising a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10, And a first composition comprising an eighth primer set comprising a forward primer of SEQ ID NO: 15 and a reverse primer of SEQ ID NO: 16;

(b) a second primer set comprising a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4 in a second reaction vessel, a fourth primer set comprising a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8, And a second composition comprising a seventh primer set comprising a forward primer of SEQ ID NO: 13 and a reverse primer of SEQ ID NO: 14; And

(c) a third primer set comprising a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6 and a sixth primer set comprising a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12 in a third reaction vessel A kit for amplifying a real-time multiple polymerase chain reaction of intestinal symptom-causing parasites comprising a third composition comprising.

19. In the above 18, the first composition further comprises a probe of SEQ ID NO: 17, a probe of SEQ ID NO: 20, and a probe of SEQ ID NO: 21,

The second composition further comprises a probe of SEQ ID NO: 18, a probe of SEQ ID NO: 22, and a probe of SEQ ID NO: 23,

The third composition is a kit for amplifying a real-time multiple polymerase chain reaction of intestinal symptom-causing parasites further comprising a probe of SEQ ID NO: 19 and a probe of SEQ ID NO: 24.

20. In the above 18, wherein the first composition is for detection of large-mouthed trematodes,

The second composition is for detecting Yokogawa flukes,

The third composition is a kit for amplifying a real-time multiple polymerase chain reaction of intestinal symptom-causing parasites for detecting liver flukes.

21. In the above 18, wherein the first composition is small follicles or blastocytosis hominis, the second composition is a ramble flagellum or dysentery amoeba, and the third composition is to additionally detect a dinuclear amoeba. Kit for real-time multiple polymerase chain reaction amplification.

22. Using the real-time multiple polymerase chain reaction amplification kit of 13 above,

A method for simultaneous detection of intestinal symptom-causing parasites, comprising the step of performing a real-time polymerase chain reaction from a sample collected from a specimen.

23. The method of 22 above, wherein the intestinal symptom-causing parasite is a fluke intestinal symptom-causing parasite.

24. The method according to 23 above, wherein the fluke is a large oyster fluke, a yokogawa fluke, or a liver fluke.

25. The method of 22 above, wherein the intestinal symptom-causing parasite additionally comprises a protozoan. Intestinal symptom-causing parasite simultaneous detection method.

26. The method of the above 25, wherein the protozoa is at least one selected from the group consisting of small follicle spores, ramble flagellum, dinuclear amoeba, dysentery amoeba, and blastocytosis hominis.

27. In the above 22, in the real-time polymerase chain reaction, (i) a first primer set comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2 in a first reaction vessel, a forward primer of SEQ ID NO: 9, and A first composition comprising a fifth primer set comprising a reverse primer of SEQ ID NO: 10, and an eighth primer set comprising a forward primer of SEQ ID NO: 15 and a reverse primer of SEQ ID NO: 16, and

Hybridizing the probe of SEQ ID NO: 17, the probe of SEQ ID NO: 20, and the probe of SEQ ID NO: 21 to obtain a first hybridization product;

(ii) a second primer set comprising a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4 in a second reaction vessel; A second composition comprising a fourth primer set comprising a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8, and a seventh primer set comprising a forward primer of SEQ ID NO: 13 and a reverse primer of SEQ ID NO: 14, and

Hybridizing the probe of SEQ ID NO: 18, the probe of SEQ ID NO: 22, and the probe of SEQ ID NO: 23 to obtain a second hybridization product; And

(iii) a third primer set comprising a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6 and a sixth primer set comprising a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12 in a third reaction vessel A method for simultaneous detection of intestinal symptom-causing parasites further comprising the step of hybridizing a third composition comprising a probe of SEQ ID NO: 19 and a probe of SEQ ID NO: 24 to obtain a third hybridization product.

28. In the above 27, wherein the first hybridization product is for detection of large oyster fluke, the second hybridization product is for detection of Yokogawa fluke, and the third hybridization product is for detection of hepatic fluke. Detection method.

29. The intestinal symptom of the above 28, wherein the first hybridization product is a small follicle spore or blastocytosis hominis, the second hybridization product is a ramble flagellum or dysentery amoeba, and the third hybridization product additionally detects a dinuclear amoeba. Simultaneous detection of induced parasites.

The primer and probe according to the present invention, and the kit for amplifying the real-time polymerase chain reaction including the same, show excellent limits of detection, specificity, and high reliability when detecting parasites, which can be detected more sensitively than conventional microscopic diagnostic methods. It can be very useful as an enemy.

1 is a view showing the result of confirming the presence of parasites in diarrhea of a gastroenteritis patient using a primer and a probe according to an embodiment of the present invention.
2 is a diagram showing a sequencing result of a positive sample confirmed through a real-time PCR method according to an embodiment of the present invention.

Hereinafter, various aspects and various embodiments of the present invention will be described in more detail.

The present invention 1) a first primer set comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2;

(2) a second primer set comprising a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4; And

(3) A third primer set comprising a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6; It provides a primer set for detecting intestinal symptom-causing parasites comprising at least one selected from the group consisting of.

In the present specification, the term "detection" not only determines or predicts the presence, concentration, composition, or activity of a target strain in a specific target sample or individual, but also the sensitivity of the object to be analyzed to a disease or disease through such analysis results ( To determine susceptibility, to determine whether an object currently has a particular disease or condition, to determine the prognosis of an object to have a particular disease or condition, or therametrics ( For example, monitoring the condition of the subject to provide information on treatment efficacy).

As used herein, the term “primer” refers to a single template capable of serving as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in a suitable buffer at a suitable temperature. -It means a stranded oligonucleotide. The suitable length of the primer varies depending on various factors such as temperature and the application of the primer, but is typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form sufficiently stable hybrid complexes with the template.

The sequence of the primer does not need to have a sequence that is completely complementary to some of the sequences of the template, and it is sufficient to have sufficient complementarity within the range capable of hybridizing with the template to perform a unique function of the primer. Therefore, the primer in the present invention does not need to have a sequence that is completely complementary to the above-described nucleotide sequence as a template, and it is sufficient if it has sufficient complementarity within a range capable of hybridizing to this gene sequence to function as a primer. The design of such a primer can be easily carried out by a person skilled in the art by referring to the nucleotide sequence described above, for example, it can be done using a primer design program (eg, PRIMER 3 program).

In the present invention, the intestinal symptom-causing parasite may be a trematode, and preferably the fluke is, for example, Gymnophalloides seoi ), Metagonimus yokogawai or Clonorchis sinensis .

In addition, the primer set for detecting intestinal symptom-causing parasites of the present invention includes (4) a fourth primer set comprising a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8;

(5) a fifth primer set comprising a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10;

(6) a sixth primer set comprising a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12;

(7) a seventh primer set comprising a forward primer of SEQ ID NO: 13 and a reverse primer of SEQ ID NO: 14; And

(8) An eighth primer set comprising the forward primer of SEQ ID NO: 15 and the reverse primer of SEQ ID NO: 16; It may further include at least one selected from the group consisting of.

The fourth to eighth primer sets may be derived from protozoa, and the protozoa is, for example, Cryptosporidium parvum ), Giardia lamblia , Dientamoeba fragilis ), Entamoeba histolytica , Blastocystis hominis ) may be one or more selected from the group consisting of.

In addition, the present invention provides a probe for detecting intestinal symptom-causing parasites comprising at least one probe selected from the group consisting of SEQ ID NOs: 17 to 19.

The term "probe" as used herein refers to a linear oligomer of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, and capable of specifically hybridizing to a target nucleotide sequence, and naturally It exists or is artificially synthesized. The probe of the present invention is preferably single-chain and is an oligodeoxyribonucleotide.

In the present invention, the intestinal symptom-causing parasite may be a fluke, and the fluke may be, for example, a large oyster fluke, a yokogawa fluke, or a liver fluke.

In addition, the probe for detecting intestinal symptom-causing parasites according to the present invention may further include one or more selected from the group consisting of SEQ ID NOs: 20 to 24.

In the present invention, the probes of SEQ ID NOs: 20 to 24 may be derived from protozoa, and the protozoa is, for example, from the group consisting of small follicles, ramble flagellum, dinuclear amoeba, dysentery amoeba, and blastocytosis hominis. It may be one or more selected.

On the other hand, the nucleotide sequence of the marker of the present invention to be referenced when preparing a primer or probe can be confirmed in GenBank. Primers or probes can be designed with reference to the above sequence.

The present invention provides a kit for amplifying a real-time multiple polymerase chain reaction of intestinal symptom-causing parasites, including the primer set and the probe.

The term “amplification” as used herein refers to a reaction that amplifies a nucleic acid molecule. Various amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), ligase chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA, WO 88/10315), self sustained sequence replication , WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence primed polymerase chain reaction (CP-PCR), U.S. Patent No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR), U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA) , U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification (21, 22) and ring- Loop-mediated isothermal amplification; LAMP) 23, but is not limited thereto. Other amplification methods that can be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09/854,317.

PCR is the most well-known nucleic acid amplification method, and its many modifications and applications have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more information on PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-chain structure. Conditions for nucleic acid hybridization suitable for forming such a double-stranded structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization. , A Practical Approach, IRL Press, Washington, DC (1985).

Various DNA polymerases can be used for the amplification of the present invention, and include the "Klenow" fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from various bacterial species, which comprises Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). Includes.

When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with the components necessary for the reaction in excess. The excessive amount of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the component. To provide joinja, dATP, dCTP, dGTP and dTTP, such as Mg ^{+ 2} to the reaction mixtures to have a desired degree of amplification can be achieved is required. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approach optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

In the present invention, annealing is performed under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. Stringent conditions for annealing are sequence-dependent and vary according to environmental variables.

Instead of checking the amplified reaction product by gel electrophoresis, the Ct value of the amplified product is measured in a real-time polymerase chain reaction device. Relative quantification is possible through the amplification graph of the known concentration of DNA. Qualitative analysis is performed on the basis of the Ct value as to whether the result of the amplification reaction using the marker of the present invention is produced.

In the present invention, the intestinal symptom-causing parasite may be a fluke, and the fluke may be, for example, a large oyster fluke, a yokogawa fluke, or a liver fluke, and additionally, a protozoan, for example, a small follicle spore, a ramble flagellum, It may be one or more selected from the group consisting of dinuclear amoeba, heterologous amoeba, and blastocytosis hominis.

On the other hand, the kit for amplification of the real-time polymerase chain reaction according to the present invention is preferably (a) a first primer set comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2 in a first reaction vessel, and SEQ ID NO: 9 A first composition comprising a fifth primer set comprising a forward primer of SEQ ID NO: 10 and a reverse primer of SEQ ID NO: 10, and an eighth primer set comprising a forward primer of SEQ ID NO: 15 and a reverse primer of SEQ ID NO: 16;

(b) a second primer set comprising a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4 in a second reaction vessel, a fourth primer set comprising a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8, And a second composition comprising a seventh primer set comprising a forward primer of SEQ ID NO: 13 and a reverse primer of SEQ ID NO: 14; And

(c) a third primer set comprising a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6 and a sixth primer set comprising a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12 in a third reaction vessel By dividing into a third composition to be included, each of the primer sets can be distinguished by using a probe set having three types of fluorescence while preventing interference between the respective primer sets.

The first composition may further include a probe of SEQ ID NO: 17, a probe of SEQ ID NO: 20, and a probe of SEQ ID NO: 21, and the second composition includes a probe of SEQ ID NO: 18, a probe of SEQ ID NO: 22, and a probe of SEQ ID NO: 23. A probe may further be included, and the third composition may further include a probe of SEQ ID NO: 19 and a probe of SEQ ID NO: 24.

In this case, the first composition may be used for the detection of the first composition is for the detection of large oyster fluke, the second composition is for the detection of the yokogawa fluke, and the third composition may be for the detection of the liver fluke, and additionally, the first composition is Sporeworm or Blastocystis hominis, the second composition may detect a ramble flagellum or dysentery amoeba, and the third composition may detect a dinuclear amoeba.

The present invention uses the kit for amplifying the real-time multiple polymerase chain reaction, and includes performing a real-time polymerase chain reaction from a sample collected from a sample, and simultaneous intestinal symptom-causing parasites Provides a detection method.

In the present invention, the intestinal symptom-causing parasite may be a fluke, and the fluke may be, for example, a liver fluke, a yokogawa fluke, or a large oyster fluke, and additionally, a protozoan, for example, a small follicle spore, a ramble flagworm, It may be one or more selected from the group consisting of dinuclear amoeba, heterologous amoeba, and blastocytosis hominis.

Preferably, the real-time polymerase chain reaction according to the present invention is

(i) a first primer set comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2 in a first reaction vessel, a fifth primer set comprising a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10, And a first composition comprising an eighth primer set including a forward primer of SEQ ID NO: 15 and a reverse primer of SEQ ID NO: 16, a probe of SEQ ID NO: 17, a probe of SEQ ID NO: 21, and a probe of SEQ ID NO: 15 Obtaining a hybridization product;

(ii) a second primer set comprising a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4 in a second reaction vessel; A second composition and sequence comprising a fourth primer set comprising a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8, and a seventh primer set comprising a forward primer of SEQ ID NO: 13 and a reverse primer of SEQ ID NO: 14 Hybridizing the probe of SEQ ID NO: 18, the probe of SEQ ID NO: 20, and the probe of SEQ ID NO: 23 to obtain a second hybridization product; And

(iii) a third primer set comprising a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6 and a sixth primer set comprising a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12 in a third reaction vessel It may further include the step of hybridizing the third composition comprising the probe of SEQ ID NO: 19 and the probe of SEQ ID NO: 22 to obtain a third hybridization product.

By checking the presence or absence of the hybridization product thus obtained through a real-time polymerase reaction, it is possible to determine whether or not each parasite is infected, and in particular, it is possible to detect large oyster fluke by using the first hybridization product. Tocistis hominis can be detected.

In addition, the second hybridization product may be used to detect Yokogawa flukes, and additionally, a ramble flagellum or dysentery amoeba may be detected.

Furthermore, it is possible to detect liver fluke by using the third hybridization product, and additionally, a dinuclear amoeba can be detected.

Amplification can be determined by checking the Ct (threshold cycle) value of the product amplified by the real-time polymerase reaction without the procedure of confirming the amplified product by the electrophoresis.

Hereinafter, the present invention will be described in more detail through examples and the like, but the scope and contents of the present invention are reduced or limited by the following examples, and thus cannot be interpreted. In addition, if based on the disclosure of the present invention including the following examples, it is obvious that the present invention for which no specific experimental results are presented can be easily carried out by a person skilled in the art. It is natural to fall within the scope of the claims.

Example One: primer And Probe design

Primer 3 for diagnosing infections of five protozoa (small follicles, ramble flagellum, dysentery amoeba, blastocytic hominis, dinuclear amoeba) and three flukes (liver fluke, yokogawa fluke, and big oyster fluke) in diarrhea. It was designed using software (http://frodo.wi.mit.edu/primer3/), and the primer sequences are summarized in Table 1 below. In addition, the probe was designed using Primer 3 software (http://frodo.wi.mit.edu/primer3/) to correspond to the region amplified by the primer pair, and the probe sequence is summarized in Table 2 below.

Target organism Forward primer sequence
(5' → 3') Reverse primer sequence
(3' → 5') Target Amplicon size (bp) Cryptosporidium parvum TGTGTTCAATATCTCCCTGCAAA GCATGTCGATTCAATTTGTCA Cowp 1 151 Giardia lamblia GAGGTCAAGAAGTCCGCCG CAAGGGACTTGCGGAAGTTT beta
-giardin 85 Entamoeba histolytica GCGGACGGCTCATTATAACA TGTCGTGGCATCCTAACTCA 18S rRNA 171 Dientamoeba fragilis TTAGAACCTTAGACAACGGATGTCTTG TGTGCATTCAAAGATCGAACTTATC 18S rRNA 112 Blastocystis hominis GGAGAGGGAGCCTGAGAGAT AACATTGTTCCGCATTGTGA 18S rRNA 113 Clonorchis sinensis GGTGGTTTGAGCTCATCATATGT CGAGTTCCAGCAAGCATATATAATC CO1 138 Metagonimus yokogawai CTATGGCGGTTTAGTGTTGGC ACTGCCGTCTTCAAATCCAG CO1 102 Gymnophalloides seoi AGTGTTGTTTGGGCTCATCA AACCTTAATCGGTGGGAACA CO1 104 * CO1: cytochrome c oxidase subunit 1

Target organism Probe sequence Cryptosporidium parvum CCTCCTGGATTCAATTTGTCA Giardia lamblia ACGATCAAGGAGGAGATCGA Entamoeba histolytica AAATGGCCAATTCATTCAATG Dientamoeba fragilis TGTGATAAGCGGCTAGAATTGC Blastocystis hominis ATCCTGACACAGGGAGGTAGTG Clonorchis sinensis CGGTTACTATGATTATAGGTGTGCC Metagonimus yokogawai TGGGCGCATCACATGTTTATGGTG Gymnophalloides seoi TGTTTATGGTTGGTTGATGTTAAGACTTCGGT

Experimental example

For the performance of the previously developed real-time polymerization chain reaction diagnostic method, the recovery rate, detection limit, analysis specificity and diagnostic specificity, precision, linearity range, cross-reaction between 54 pathogens, and interference effects of clinical interfering substances were analyzed. .

(1) PCR efficiency test

The recovery rate was expressed as PCR efficiency (%) calculated according to the formula below (https://www.lifetechnologies.com/kr/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning- center/molecular-biology-resource-library/thermo-scientific-web-tools/qpcr-efficiency-calculator.html).

PCR efficiency (E) = 10-1 / slope

PCR efficiency (%) = (E-1) X 100%

Average Ct values according to DNA concentrations R ² slope Efficiency (%) Target organism 100 fg 10 fg 1 fg 100 ag 10 ag C. parvum 26.04 29.47 33.08 37.25 41.14 0.999 -3.80 83.3 G. lamblia 27.38 30.83 34.43 37.25 41.14 0.998 -3.39 97.1 E. histolytica 26.54 30 33.44 36.67 39.92 1.000 -3.34 99.1 D. fragilis 27.88 31.53 35.24 38.17 41.72 0.999 -3.43 95.6 B. hominis 30.3 33.72 37.17 40.91 42.95 0.992 -3.25 103.2 C. sinensis 25.72 29.3 32.75 36.13 39.47 1.000 -3.43 95.6 M. yokogawai 25.82 29.43 32.66 36.44 39.64 0.999 -3.47 94.3 G. seoi 30.92 34.13 37.57 40.8 43.16 0.996 -3.12 109.5 Abbreviations: C. parvum , Cryptosporidium parvum ; G. lamblia , Giardia lamblia ; E. histolytica, Entamoeba histolytica ; D. fragilis , Dientamoeba fragilis ; B. hominis , Blastocystis hominis ; C. sinensis , Clonorchis sinensis;M . yokogawai , Metagonimus yokogawai; G. seoi , Gymnophalloides seoi .

As shown in Table 2, between the DNA concentration and the Ct value of the eight parasites showed excellent correlation with ^{the R 2 value of 0.9924 to 0.9998.} The polymerization chain reaction efficiency of the developed real-time polymerization chain reaction method was 83.33%-109.45%, showing a high recovery rate.

(2) Analytical sensitivity and precision test

Each parasite DNA (3 ⅹ 10 ⁸ clones/mL) was diluted 10 times from 100 pg to 10 ag, and the prepared concentration substance was repeatedly measured 24 times, and the detection limit was investigated based on the Ct value detected for each concentration. The detection limit was determined as a Ct value showing 95% or more positive according to the CLSI standard EP17-A.

Target organism Average Ct values according to different copy number of target DNA Template (27,500-30,000 copies) ×10 ^-1 ×10 ^-2 ×10 ^-3 ×3 ^-1
×10 ^-3 ×6 ^-1
×10 ^-3 ×10 ^-4 N.C. C. parvum Average Ct value 26.05 29.2 32.9 36.26 39.31 39.41 39.96 - CV 0.41% 0.74% 1.37% 1.17% 5.65% 4.00% 1.31% - Detection Rate 100% 100% 100% 100% 67% 38% 54% - G. lamblia Average Ct value 27.46 30.77 34.15 37.24 40.98 39.26 40.11 - CV 0.83% 0.86% 1.34% 2.01% 5.45% 2.47% 4.66% - Detection Rate 100% 100% 100% 100% 100% 33% 58% 0% E. histolytica Average Ct value 26.52 30.02 33.36 36.94 39.28 39.01 40.6 - CV 0.64% 0.74% 1.16% 4.58% 4.37% 4.55% 4.81% - Detection Rate 100% 100% 100% 96% 54% 25% 29% 0% D. fragilis Average Ct value 27.73 31.15 34.7 37.53 40.72 41.44 41.61 - CV 1.40% 1.04% 1.86% 1.96% 5.19% 4.71% 3.99% - Detection Rate 100% 100% 100% 96% 63% 71% 50% 0% B. hominis Average Ct value 30.47 34.08 37.29 40.63 42.25 40.77 42.65 - CV 1.35% 1.51% 1.58% 2.01% 3.68% 3.43% 3.48% - Detection Rate 100% 100% 100% 100% 46% 17% 21% 0% C. sinensis Average Ct value 25.73 29.28 32.23 36.23 39.47 39.2 39.39 - CV 0.48% 0.97% 1.09% 2.96% 6.78% 4.70% 5.14% - Detection Rate 100% 100% 100% 100% 79% 50% 75% 0% M. yokogawai Average Ct value 25.88 29.39 32.24 35.65 38.38 39.51 38.98 - CV 0.35% 0.57% 2.02% 4.96% 3.42% 5.34% 4.15% - Detection Rate 100% 100% 100% 100% 100% 58% 50% 0% G. seoi Average Ct value 30.15 33.94 37.2 40.14 41.64 40.21 40.08 - CV 1.51% 0.97% 1.12% 1.89% 3.74% 4.12% - - Detection Rate 100% 100% 100% 100% 54.17% 12.50% 4.17% 0%

This diagnostic method was able to detect up to 30 ag concentration (10 copies) of the Rambla flagella and Yokogawa fluke, and up to 100 ag concentration (30 copies) of the remaining six parasites.

When repeated measurements were performed, all CV values from 0% to 7% were less than 10%, indicating excellent reproducibility.

(3) Cross-reactivity test

In order to confirm the specificity of the diagnosis, the cross-reactivity of 54 major pathogens (27 kinds of bacteria and fungi, 11 kinds of parasites, 16 kinds of viruses) with DNA was examined. To analyze the effect of interference with various clinical interfering substances such as red blood cells, leukocytes, bilirubin, bile acids, heparin, acetaminophen, and ibuprofen, a 200 mg negative stool sample was randomly mixed with 10 fg of a positive control substance and an interfering substance. I did.

No. Organisms Name Results One Bacteria Clostridium difficile U.D. 2 Yersinia enterocolitica U.D. 3 Salmonella typhimurium U.D. 4 Proteus mirabilis U.D. 5 Pseudomonas aeruginosa U.D. 6 Escherichia coli U.D. 7 Lactobacillus acidophilus U.D. 8 Bifidobacterium bifidum U.D. 9 Enterobacter aerogenes U.D. 10 Clostridium perfringens U.D. 11 Enterococcus faecalis U.D. 12 Shigella flexneri U.D. 13 Klebsiella pneumoniae U.D. 14 Campylobacter jejuni U.D. 15 Candida albicans U.D. 16 Filobasidiella neoformans U.D. 17 Staphylococcus epidermidis U.D. 18 Aspergillus fumigatus U.D. 19 Staphylococcus aureus U.D. 20 Myocobacterium tubercμLosis U.D. 21 M. intracellμLare U.D. 22 M. abscessus U.D. 23 M. hominis U.D. 24 Chlamydia trichomatis U.D. 25 Nisseria gornorae U.D. 26 Ureaplasma parvum U.D. 27 U. urealyticum U.D.

No. Organisms Name Results 28 Parasites Ascaris lumbricoides U.D. 29 Enterobius vermicμLaris U.D. 30 Taenia asiatica U.D. 31 Taenia solium U.D. 32 Taenia saginata U.D. 33 Diphyllobothrium nihonkaiense U.D. 34 Plasmodium falciparum U.D. 35 P. vivax U.D. 36 P. ovale U.D. 37 P. malariae U.D. 38 T. vaginalis U.D. 39 Virus
Noro virus U.D. 40 Rota virus U.D. 41 HSV1 U.D. 42 HSV -2 U.D. 43 HAV U.D. 44 HBV U.D. 45 HCV U.D. 46 EBV U.D. 47 JEV U.D. 48 Enterovirus 70 U.D. 49 Enterovirus 71 U.D. 50 BKV U.D. 51 Dengue virus 2 U.D. 52 Dengue virus 3 U.D. 53 Dengue virus 4 U.D. 54 Human adenovirus U.D.

Interferents Ct values of parasite PCR adding different concentration of interferents C. parvum G. lamblia E. histolytica D. fragilis B. hominis M. yokogawai C. sinensis G. seoi Erythrocyte 20% U.D. U.D. U.D. U.D. U.D. U.D. U.D. U.D. 4% 34.06 36.92 36.55 34.65 36.44 35.15 32.27 37.45 One% 34.18 36.21 36.57 35.32 36.76 35.43 32.32 37.31 Negative 33.87 36.01 36.11 35.15 36.51 35.76 32.20 37.04 Leucocyte 20% U.D. U.D. U.D. U.D. U.D. U.D. U.D. U.D. 4% 33.30 34.21 33.32 34.90 37.58 32.04 31.76 37.31 One% 32.63 33.84 33.10 34.93 37.69 32.12 31.80 37.47 Negative 33.09 34.06 33.24 34.70 37.65 32.05 31.96 37.26 Bilirubin 2ug/ml 32.94 34.56 36.60 34.84 37.23 33.82 36.49 37.48 1ug/ml 32.72 37.45 36.44 34.06 37.22 34.06 36.44 36.64 0.5ug/ml 32.75 37.31 36.76 34.18 37.09 34.18 36.76 37.46 Negative 32.91 37.04 36.51 34.12 37.18 33.87 36.51 37.19 Bile salts 1mg/ml 32.51 34.76 33.28 34.89 37.31 33.00 37.48 37.49 0.5mg/ml 32.81 34.44 32.78 34.96 37.45 32.49 36.64 37.28 0.1mg/ml 33.03 34.19 33.37 34.81 37.38 32.37 37.46 37.54 Negative 32.49 34.27 32.66 35.13 37.61 32.71 37.19 37.37 Heparin 0.2 IU 38.05 U.D. U.D. U.D. U.D. 37.51 U.D. 39.86 0.1 IU 32.73 33.47 33.35 33.30 37.13 32.20 32.56 36.75 0.05 IU 32.80 33.43 33.32 33.16 36.51 31.71 32.34 37.33 Negative 32.62 33.35 32.62 33.04 36.49 31.31 32.11 37.31 Acetaminophen 200ug/ml 34.12 34.27 32.98 34.75 33.71 32.73 32.62 33.66 100ug/ml 32.64 33.53 33.14 34.79 32.84 31.99 32.47 33.74 50ug/ml 32.42 32.88 33.20 33.37 32.46 31.29 30.02 33.37 Negative 32.71 32.52 33.73 32.95 32.38 32.85 32.81 32.98 Ibuprofen 200ug/ml 34.12 34.27 32.98 34.75 33.71 32.73 32.62 33.66 100ug/ml 32.64 33.53 33.14 34.79 32.84 31.99 32.47 33.74 50ug/ml 32.42 32.88 33.20 33.37 32.46 31.29 30.02 33.37 Negative 32.71 32.52 33.73 32.95 32.38 32.85 32.81 32.98

As shown in Tables 5 and 6, there was no cross-reaction with 54 major pathogens. As shown in Table 7, the interference effect with various clinical interfering substances was not observed in the case of low concentration, but it was found that polymerization chain reaction was suppressed when high concentration of red blood cells and white blood cells or 0.2 IU of heparin were mixed with a concentration of 20% or more. .

(4) Validation of the multiplex qPCR assay using stool samples obtained from gastroenteritis patients

In order to verify the developed real-time polymerization chain reaction diagnostic kit, a microscopic diagnosis method was conducted for a total of 126 diarrheal stools, including 6 positive control samples made by mixing laboratory-cultivated heterogeneous amoeba, ramble flagellum, and stool with feces. Real-time polymerization chain reaction diagnostic methods were compared.

Final identification No. of specimens Microscopy multiplex real-time PCR Correct ID Incorrect ID Correct ID Incorrect ID Blastocystis hominis 8 0 8 8 0 Cryptosporidium parvum 3 One 2 3 0 Clonorchis sinensis 3 2 One 3 0 Entamoeba histolytica 2 2 0 2 0 Giardia lamblia 2 2 0 2 0 Gymnophalloides seoi 2 0 2 2 0 Negative for parasites 106 106 0 106 0 Total No.(%) 126 113(89.7) 13(10.3) 126(100.0) 0(0.0)

Methods Results No. of specimens with Positive for the parasites Negative for the parasites Subtotal Microscopic examination Positive 7 0 7 Negative 13 106 119 Subtotal 20 106 - Multiplex
real-time PCR Positive 20 0 20 Negative 0 106 106 Subtotal 20 106 -

Methods Diagnostic performance
[95% confidence interval] Sensitivity Specificity Positive predictive value Negative predictive value Microscopic examination
(Subtotal) 35.0%
[15.39-59.22] 100.0%
[96.58-100.0] 100.0%
[59.04-100.0] 89.1%
[82.04-94.05] Multiplex
real-time PCR
(Subtotal) 100.0%
[83.16-100.0] 100.0%
[96.58-100.0] 100.0%
[83.16-100.0] 100.0%
[96.58-100.0]

As shown in Tables 8 to 10, when compared to 126 clinical specimens, 20 positive specimens were diagnosed by the real-time polymerization chain reaction method developed in this study, whereas 7 positive specimens were diagnosed by the microscopic diagnostic method. Could only diagnose.

In addition to 6 positive control samples, the real-time polymerization chain reaction method was able to diagnose 8 blastocytic hominis, 3 small follicles, and 3 positive hepatic flukes.

To find out whether they were false positives, sequencing was performed on all 14 cases that were positive only in the real-time polymerization chain reaction method, and all were confirmed as positive.

The real-time polymerization chain reaction diagnosis method (100%) had a higher rate of more accurate identification than the microscopic diagnosis method (89.7%). Overall, the real-time polymerization chain reaction diagnosis method (100%) showed higher sensitivity than the microscopic diagnosis method (35%), and both methods were confirmed to exhibit a specificity of 100%.

<110> Chonnam National University <120> Kit for detecting intestinal parasites and detection method using the same <130> 18P01028 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gymnophalloides seoi Forward primer sequence <400> 1 agtgttgttt gggctcatca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gymnophalloides seoi Reverse primer sequence <400> 2 aaccttaatc ggtgggaaca 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Metagonimus yokogawai Forward primer sequence <400> 3 ctatggcggt ttagtgttgg c 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Metagonimus yokogawai Reverse primer sequence <400> 4 actgccgtct tcaaatccag 20 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Clonorchis sinensis Forward primer sequence <400> 5 ggtggtttga gctcatcata tgt 23 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Clonorchis sinensis Reverse primer sequence <400> 6 cgagttccag caagcatata taatc 25 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Cryptosporidium parvum Forward primer sequence <400> 7 tgtgttcaat atctccctgc aaa 23 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cryptosporidium parvum Reverse primer sequence <400> 8 gcatgtcgat tcaatttgtc a 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Blastocystis hominis Forward primer sequence <400> 9 ggagagggag cctgagagat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Blastocystis hominis Reverse primer sequence <400> 10 aacattgttc cgcattgtga 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Giardia lamblia Forward primer sequence <400> 11 gaggtcaaga agtccgccg 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Giardia lamblia Reverse primer sequence <400> 12 caagggactt gcggaagttt 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Entamoeba histolytica Forward primer sequence <400> 13 gcggacggct cattataaca 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Entamoeba histolytica Reverse primer sequence <400> 14 tgtcgtggca tcctaactca 20 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Dientamoeba fragilis Forward primer sequence <400> 15 ttagaacctt agacaacgga tgtcttg 27 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Dientamoeba fragilis Reverse primer sequence <400> 16 tgtgcattca aagatcgaac ttatc 25 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Gymnophalloides seoi Probe sequence <400> 17 tgtttatggt tggttgatgt taagacttcg gt 32 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Metagonimus yokogawai Probe sequence <400> 18 tgggcgcatc acatgtttat ggtg 24 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Clonorchis sinensis Probe sequence <400> 19 cggttactat gattataggt gtgcc 25 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Cryptosporidium parvum Probe sequence <400> 20 cctcctggat tcaatttgtc a 21 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Blastocystis hominis Probe sequence <400> 21 atcctgacac agggaggtag tg 22 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Giardia lamblia Probe sequence <400> 22 acgatcaagg aggagatcga 20 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Entamoeba histolytica Probe sequence <400> 23 aaatggccaa ttcattcaat g 21 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Dientamoeba fragilis Probe sequence <400> 24 tgtgataagc ggctagaatt gc 22

Claims (10)

(1) a first primer set comprising the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, and the probe of SEQ ID NO: 17;
(2) a second primer set comprising the forward primer of SEQ ID NO: 3, the reverse primer of SEQ ID NO: 4, and the probe of SEQ ID NO: 18; And
(3) a kit for detecting parasitic parasites comprising at least one selected from the group consisting of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe of SEQ ID NO: 19.
The method according to claim 1,
Wherein the parasitic symptom-inducing parasite is a trematode.
The method of claim 2,
The flukes were identified as Gymnophalloides seoi), Yokogawa Fluke (Metagonimus yokogawai) or sinensis (Clonorchis sinensis) caused the symptoms Minister parasite detection kit.
The method according to claim 1,
The kit
(4) a fourth primer set comprising the forward primer of SEQ ID NO: 7, the reverse primer of SEQ ID NO: 8, and the probe of SEQ ID NO: 20;
(5) a fifth primer set comprising the forward primer of SEQ ID NO: 9, the reverse primer of SEQ ID NO: 10, and the probe of SEQ ID NO: 21;
(6) a sixth primer set comprising the forward primer of SEQ ID NO: 11, the reverse primer of SEQ ID NO: 12, and the probe of SEQ ID NO: 22;
(7) a seventh primer set comprising the forward primer of SEQ ID NO: 13, the reverse primer of SEQ ID NO: 14, and the probe of SEQ ID NO: 23; And
(8) an eighth primer set comprising a forward primer of SEQ ID NO: 15, a reverse primer of SEQ ID NO: 16, and a probe of SEQ ID NO: 24, wherein the parasitic induction parasite is selected from the group consisting of A kit for detecting parasitic parasites which further comprises protozoa.
The method of claim 4,
Wherein the fourth to eighth primer sets are derived from protozoa.
The method of claim 5,
The protozoa are Cryptosporidium parvum , Giardia lamblia , and Dientamoeba fragilis , Entamoeba histolytica , Blastocystis &lt; RTI ID = 0.0 &gt; hominis ). &lt; / RTI &gt;
The method of claim 4,
Wherein the protozoan is at least one selected from the group consisting of a small papillomae, a gambia biloba, a dinuclear amoeba, a heterozygous amoeba, and a blastocyst's fominis.
The method according to claim 1,
The kit
(a) a first primer set comprising the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2, a fifth primer set including the forward primer of SEQ ID NO: 9 and the reverse primer of SEQ ID NO: 10, A first composition comprising an eighth primer set comprising a forward primer of SEQ ID NO: 15 and a reverse primer of SEQ ID NO: 16, a probe of SEQ ID NO: 17, a probe of SEQ ID NO: 20, and a probe of SEQ ID NO: 21;
(b) a second primer set comprising the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4, the fourth primer set comprising the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 8, A second composition comprising a seventh primer set comprising a forward primer of SEQ ID NO: 13 and a reverse primer of SEQ ID NO: 14, a probe of SEQ ID NO: 18, a probe of SEQ ID NO: 22, and a probe of SEQ ID NO: 23; And
(c) a third primer set comprising the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6, the sixth primer set including the forward primer of SEQ ID NO: 11 and the reverse primer of SEQ ID NO: And a third composition comprising a probe of SEQ ID NO: 19 and a probe of SEQ ID NO: 24.
The method of claim 8,
Wherein the first composition is for detection of bull litterfly,
The second composition is for detection of Yokogawa fluke,
Wherein the third composition is for detecting clonorchiasis.
The method of claim 8,
Wherein the first composition additionally detects a small papilloma virus or blastoschitic hominis, the second composition is a gambling bacterium or a heterozygous amoeba, and the third composition further detects a dinuclear amoeba.

Images