KR20180004400A - Composition for preventing or treating intractable epilepsy comprising mTOR inhibitor - Google Patents

Abstract

The present invention relates to a composition for preventing, alleviating, or treating intractable epilepsy, for example, focal cortical dysplasia (FCD). The present invention further relates to a pharmaceutical composition for the prevention or treatment of type 2 focal cortical dysplasia (FCD type II) caused by cerebral somatic mutation, including an mTOR inhibitor for inhibiting the overactivation of mTOR as an effective component.

Description

Composition for preventing or treating intractable epilepsy comprising mTOR inhibitor {Composition for preventing or treating intractable epilepsy comprising mTOR inhibitor}

The present invention relates to the prevention, amelioration or treatment of refractory epilepsy, such as focal cortical dysplasia (FCD).

Epilepsy is a chronic disease group in which some of the nerve cells generate excessive electricity in a short period of time, causing repetitive seizures, and is a serious neurological disease that involves neurobiological, mental, cognitive, and social changes.

Among epilepsy, epilepsy that does not respond to antiepileptic drugs developed so far is called intractable epilepsy, and accounts for about 20% of all epilepsy. The causative diseases of refractory epilepsy include Malformations of Cortical Developments, such as focal cortical dysplasia (FCD), hemimegalencephaly (HME), and tuberous sclerosis complex (TSC). MCD), hippocampal sclerosis (HS), or Sturge weber syndrome (SWS), and the like are known.

Refractory epilepsy does not respond to existing antiepileptic drugs and requires neurosurgical treatment to excise brain lesions to control epilepsy. There is a need to develop a molecular biological diagnostic technology specific to hippocampal sclerosis.

One of the important causes of refractory epilepsy that is not controlled by antiepileptic drugs is focal cortical dysplasia. This amounts to 50% of patients undergoing surgery due to epilepsy. Focal cortical dysplasia is one of the sporadic cortical developmental malformations and is accompanied by structural abnormalities in the cerebral cortex and cytological abnormalities in neurons in the affected area.

Surgical resection of focal cortical dysplasia frees 60% of patients from seizures, but there is still a problem that epileptic seizures persist after surgery in many patients. In addition, since the molecular genetic cause of focal cortical dysplasia is not known, it is difficult to develop a new and effective treatment for focal cortical dysplasia. Until now, many studies have hypothesized that focal cortical dysplasia occurs due to the influence of somatic mutations during cerebral development, but such somatic mutations have not yet been confirmed.

Focal cortical dysplasia is divided into several types by pathological criteria. Among them, FCDII appears to be a homogeneous pathologic finding, and it is possible to identify cortical layering abnormalities and dysmorphic neurons or balloon cells (Epilepsia 52, 158-174　 (2011)). Between 29 and 39% of FCD patients undergoing epilepsy surgery fall under FCDII (Brain 129, 1907-1916 (2006)). Although the association between human papiloma virus and FCDII has been reported, the molecular genetic cause of FCDII is still insufficiently understood. Interestingly, the brain magnetic resonance imaging of FCDII patients sometimes shows normal findings, but when microscopic examination of the operated tissue is performed, abnormal neurons surrounded by many normal cells are observed. Combining these radiological and histopathological findings, it is possible that the operated tissue contains very few neurons, including somatic mutations, but such low-frequency somatic mutations are classical Sanger sequencing. However, it is difficult to find effectively with a typical whole exome sequencing method with a read depth of 100 to 150x.

Under this background, the present inventors of the brain tissue sample (brain tissue) of a patient for focal cortical dysplasia surgery, the whole exome sequencing method, hybrid capture sequencing method (hybrid capture sequencing), amplicon sequencing method (amplicon sequencing). A variety of deep sequecing techniques were used to identify brain lesion-specific somatic mutations of focal cortical dysplasia, and transgenic animals exhibiting focal cortical dysplasia were established using these somatic mutations, and mTOR inhibitors were administered to the transgenic animals. In this case, the present invention was completed by confirming that the symptoms for local cortical dysplasia can be effectively suppressed.

An object of the present invention is, refractory epilepsy, or focal cortical dysplasia (FCD), unilateral megaencephalopathy (HME) due to brain somatic mutations of genes related to the PI3K-AKT-mTOR signaling pathway, including an mTOR inhibitor as an active ingredient. , Hippocampal sclerosis (HS) or Sturge Weber syndrome (SWS) to provide a kit for the prevention, improvement or treatment of intractable epilepsy caused by, or a method.

A further object of the present invention relates to a use for preventing, improving, or treating diseases causing epilepsy or epilepsy, comprising an mTOR inhibitor as an active ingredient, wherein refractory epilepsy may be due to local cortical dysplasia, and in detail Focal cortical dysplasia may be focal cortical dysplasia associated with cerebral somatic mutations.

Another object of the present invention is intractable epilepsy, or focal cortical dysplasia (FCD), unilateral megaencephalopathy (HME), hippocampal sclerosis (HS) or Ster, caused by brain somatic mutations of genes related to the PI3K-AKT-mTOR signaling pathway. It is to provide a pharmaceutical composition or food composition for the prevention, improvement or treatment of refractory epilepsy caused by Gweber syndrome (SWS).

An object of the present invention relates to a use of preventing, improving, or treating diseases causing epilepsy or epilepsy, comprising an mTOR inhibitor as an active ingredient, wherein refractory epilepsy may be due to local cortical dysplasia, and in detail, local Cortical dysplasia may be focal cortical dysplasia associated with brain somatic mutations.

Hereinafter, the present invention will be described in more detail.

The present inventors analyzed brain tissue samples of patients with refractory epilepsy surgery due to focal cortical dysplasia (FCD), unilateral giant encephalopathy (HME), hippocampal sclerosis (HS) or Sturge Weber syndrome (SWS), PI3K-AKT- It was confirmed that brain somatic mutations of genes involved in the mTOR signaling pathway exist specifically, and it was confirmed that these mutations can be used as a biomarker panel for diagnosing refractory epilepsy. Furthermore, the present inventors confirmed that when the mutant was introduced into cells, mTOR was overactivated, and thus refractory epilepsy could be induced, and thus local cortical dysplasia (FCD), nodular sclerosis, unilateral giant encephalopathy (HME), hippocampal sclerosis (HS ) Or the prevention, improvement or treatment of refractory epilepsy caused by Sturgeweber syndrome (SWS), and local cortical dysplasia (FCD), nodular sclerosis (TSC), unilateral giant encephalopathy (HME), which are the causes of these refractory epilepsy. The present invention was completed by developing a use for preventing, improving or treating hippocampal sclerosis (HS) or Sturge Weber syndrome (SWS).

* The present inventors obtained brain tissue, saliva, and blood samples from patients undergoing refractory epilepsy due to focal cortical dysplasia, and through sequencing analysis, mTOR specifically present in patients with refractory epilepsy due to focal cortical dysplasia. Genetic mutations of the gene and the resulting mTOR protein mutations were identified, as well as gene mutations involved in the PI3K-AKT-mTOR signaling pathway, and six protein mutations (Table 1).

turn gene
Kinds mTOR gene
transition mTOR protein
transition Remark One mTOR C616T R206C Cytosine at position 616 (C) -> thymine (T)
Arginine 206 (R) -> Cysteine (C) 2 mTOR G1871A R624H 1871 Guanine (G) -> Adenine (A)
Arginine 624 (R) -> Histidine (H) 3 mTOR T4348G Y1450D 4348 thymine (T) -> guanine (G)
1450 Tyrosine (Y) -> Aspartic acid (D) 4 mTOR T4447C C1483R 447 thymine (T) -> cytosine (C)
Cysteine 483 (C) -> Arginine (R) 5 mTOR G5126A R1709H 126 Guanine (G) -> Adenine (A)
1709 Arginine (R) -> Histidine (H) 6 mTOR C5930A T1977K Cytosine 5930 (C) -> Adenine (A)
1977 Threonine (T) -> Lysine (K) 7 mTOR C6577T R2193C Cytosine 6577 (C) -> Thymine (T)
2193 Arginine (R) -> Cysteine (C) 8 mTOR C6644T S2215F Cytosine 6644 (C) -> Thymine (T)
Serine No. 2215 (S) -> Phenylalanine (F) 9 mTOR T7280C L2427P 7280 thymine (T) -> cytosine (C)
Leucine No. 2427 (L) -> Proline (P) 10 mTOR T7280A L2427Q 7280 thymine (T) -> adenine (A)
Leucine 427 (L) -> Glutamine (Q) 11 TSC1 C64T R22W Cytosine 64 (C) -> Thymine (T)
22nd Arginine (R) -> Tryptophan (W) 12 TSC1 C610T R204C Cytosine 610 (C) -> Thymine (T)
204th Arginine (R) -> Cysteine (C) 13 TSC1 G2432T R811L 2432 guanine (G) -> thymine (T)
811th Arginine (R) -> Leucine (L) 14 TSC2 G4639A V1547I 4639th guanine (G) -> adenine (A)
1547th valine (V) -> Isoleucine (I) 15 AKT3 G740A R247H 740th guanine (G) -> adenine (A)
247th Arginine (R) -> Histidine (H) 16 PIK3CA G3052A D1018N 3052 Guanine (G) -> Adenine (A)
1018 Aspartic Acid (D) -> Asparagine (N)

The mTOR mutation was not found in saliva, but was specifically found in brain tissue samples. In addition, it was confirmed that one or more of the 10 genetic variants existed in the sample of patients with focal cortical dysplasia, and the genetic mutation rate was also found to exist in a ratio from 1.26% to 12.6%.

In a specific embodiment of the present invention, an mTOR mutant construct capable of expressing the genetic mutation is prepared and transfected into cells to determine the change in mTOR protein activity, and phosphorylation of S6 protein. mTOR kinase activity was measured. As a result, it was confirmed that the phosphorylation of the S6 protein, which shows the change in mTOR protein activity, increases (Fig. 2a), and the mTOR kinase activity increases (Fig. 2b). Through this, it was confirmed that the phosphorylated S6 protein increased due to hyperactivation of the mTOR protein.

In addition, when the mTOR mutant construct was introduced and treated with rapamycin, everolimus, and compounds of Formulas 1 to 4 in cells overactivated with mTOR protein, it was confirmed that phosphorylation of increased S6 protein was inhibited (Fig. 9a to 9c).

On the other hand, the mTOR mutation provided in the present invention induces focal cortical dysplasia, the increase in phosphorylated S6 protein and the size of neurons in brain pathology samples of patients with refractory epilepsy caused by focal cortical dysplasia (confirmation of mTOR genetic mutation). Significantly increased (Figs. 2c to 2e), and a serious impairment in the movement of neurons in the cerebral cortex of mice injected with the mTOR mutant construct on the 14th day of embryonic phase and phosphorylated S6 protein significantly increased (Figs. 11b and 11c) Confirmed once again by

Thus, in another embodiment of the present invention, the mTOR mutant construct capable of expressing the genetic mutation is electroporated into the lateral ventricle of an embryonic mouse on the 14th day of embryonic period (E14), and then from 3 weeks after birth. As a result of performing video-Electroencephalography (video-EEG) monitoring, spontaneous seizures accompanied by epilepsy were confirmed in mice injected with the plasmid inserting the mTOR mutant gene in which the sequence mutation of the present invention occurred (Fig. 12a). And 12b), further, it was confirmed that the cell size of the GFP-positive cells in the cerebral region electroporated with the mTOR variant construct was very increased to show an abnormal neuronal morphology such as a giant neuron (FIG. 3D).

In addition, when rapamycin was administered to the animal model showing spontaneous seizures or abnormal neurons, the number of behavioral seizures and EEG attacks decreased (Fig. 3c), and it was confirmed that the size of abnormal neurons decreased (Fig. 3D). ).

As described above, in the present invention, it was proved that the protein in which the gene or amino acid sequence in which the genetic mutation has occurred is specifically detected in a patient sample with focal cortical dysplasia, and that the mutations can induce focal cortical dysplasia. In addition, in the present invention, mTOR inhibitors, such as rapamycin, everolimus, compounds of formulas 1 to 4, are overactivated mTOR protein in refractory epilepsy associated with the mTOR mutation, such as focal cortical dysplasia, spontaneous seizures, and behavioral seizures. , EEG seizures and abnormal neuronal cell generation were demonstrated to be able to alleviate.

In a specific embodiment of the present invention, a mutant construct capable of expressing each of the somatic mutations was prepared, transduced into cells, and as a result, the S6K protein, which shows the change in mTOR protein activity. It was confirmed that phosphorylation of was increased, and phosphorylation was decreased after treatment with rapamycin. These results show that the mTOR, TSC1, TSC2, AKT3 and PIK3CA genes or proteins in which the above mutations have occurred can activate the mTOR signaling system, suggesting that epilepsy can be caused accordingly.

The mTOR, TSC1, TSC2, AKT3 and PIK3CA genes or proteins containing the mutations are provided as biomarker panel genes or proteins for diagnosing refractory epilepsy. In addition, the present invention provides a diagnostic kit for detecting the biomarker panel gene or protein from a sample of an individual, and a diagnostic method using the same. Furthermore, the present invention provides a technique for constructing an epilepsy model by inducing refractory epilepsy using the genetic mutation and protein mutation.

The present invention prevents, ameliorates, or treats refractory epilepsy and prevents and improves cortical developmental anomalies such as focal cortical dysplasia, unilateral macroencephalopathy and nodular sclerosis, hippocampal sclerosis, or Sturgeweber syndrome, which are the causative diseases of these refractory epilepsy. Or to provide a therapeutic composition, kit, or method. Preferably, the refractory epilepsy relates to a prevention, treatment and/or amelioration use for refractory epilepsy associated with brain somatic genetic variation.

Specifically, the intractable epilepsy according to the present invention is epilepsy caused by brain somatic mutations of genes involved in the PI3K-AKT-mTOR signaling pathway, or cerebral cortical development such as focal cortical dysplasia, unilateral megaencephalopathy, and nodular sclerosis. Malformations, hippocampal sclerosis, or epilepsy due to Sturgeweber syndrome.

In the present invention, the term "epilepsy" refers to a chronic disease in which seizures occur repeatedly due to some of the nerve cells generating excessive electricity in a short time, and the term "refractory epilepsy" means antiepileptic that has been developed to date. It means epilepsy that does not respond to drugs. The refractory epilepsy is characterized by malformations of cortical developments (MCD) such as focal cortical dysplasia (FCD), hemigalencephaly (HME) and tuberous sclerosis complex (TSC), hippocampus. It may be hippocampal sclerosis (HS), or refractory epilepsy caused by Sturge weber syndrome (SWS).

In the present invention, the term "focal cortical dysplasia (FCD)" means that during the normal development of the cerebral cortex, neurons move from one area of the brain to another to form a layered structure. It refers to a disease that occurs due to failure to form a normal layer structure. This may be a case in which some areas of the entire cerebral area fail to develop normally, and may be a disease caused by pathologically some cells showing an abnormal cell shape even in areas that appear to have developed normally on a radiographic image. These, focal cortical dysplasia occur sporadically in the cerebrum, show dysmorphic neurons, and may accompany the destruction of the lamination of the affected area.

The brain somatic mutation associated with the focal cortical dysplasia may be a genetic mutation of the mTOR gene or an amino acid mutation of the mTOR protein.

The mTOR (mammalian target of rapamycin) protein is expressed by the FRAP1 gene in humans and is a serine/threonine protein kinase that functionally regulates cell growth, cell proliferation, cell death, cell survival, protein synthesis and transcription. ), belongs to the phosphatidylinositol 3-kinase-related kinase protein family. In the present invention, the base sequence of the wild-type mTOR gene is shown in SEQ ID NO: 1, and the amino acid sequence of the mTOR protein is shown in SEQ ID NO: 2.

In the present invention, the term "brain somatic mutation" means that a nucleotide sequence mutation has occurred at one or more positions in a wild-type gene. For example, mTOR, TSC1, TSC2, AKT3 and PIK3CA genes or amino acid mutations of proteins corresponding to these genes. As a specific example, it means that a mutation has occurred in the nucleotide sequence of the gene of SEQ ID NO: 1, which is a wild-type mTOR gene. As shown in Table 1, selected from the group consisting of 616, 1871, 4348, 4447, 5126, 5930, 6577, 6644, 7280 and 7280 of the nucleotide sequence of SEQ ID NO: 1 It may be a gene consisting of a nucleotide sequence containing a mutation in which base substitution has occurred in one or more bases.

As another example, the brain somatic mutation in the present invention may be a mutation in the amino acid sequence of the protein of SEQ ID NO: 2, which is a wild-type mTOR protein. For example, arginine (R) at position 206 of the amino acid sequence of SEQ ID NO: 2 is substituted with cysteine (C), R at position 624 is substituted with H, Y at position 1450 is substituted with D, and 1483 C at position is substituted with R, R at position 1709 is substituted with H, T at position 1977 is substituted with K, R at position 2193 is substituted with C, S at position 2215 is substituted with F, and 2427 It may be a protein consisting of an amino acid sequence comprising one or more mutations selected from the group consisting of substitution of L at position L with P and substitution at L at position 2427 with Q. The substituted amino acid may be one that is encoded by a gene containing a nucleotide sequence mutation at a corresponding position in the nucleotide sequence of SEQ ID NO: 1. The nucleotide sequence including each mutant base and the corresponding amino acid mutation are shown in Table 1 above.

In the present invention, the term "TSC1 mutant gene" means that a mutation occurs in the nucleotide sequence of the gene of SEQ ID NO: 3, which is a wild-type TSC1 gene. Preferably, in the nucleotide sequence of SEQ ID NO: 3, the 64th cytosine (C) is substituted with thymine (T), the 610th cytosine (C) is substituted with thymine (T), and the 2432th guanine (G) is thymine ( It may be a gene consisting of a nucleotide sequence containing one or more mutations selected from the group consisting of substitution with T).

In the present invention, the term "TSC1 mutant protein" means that a mutation has occurred in the amino acid sequence of the protein of SEQ ID NO: 4, which is a wild-type TSC1 protein. Preferably, in the amino acid sequence of SEQ ID NO: 4, the 22nd arginine (R) is substituted with tryptophan (W), the 204th arginine (R) is substituted with cysteine (C), and the 811th arginine (R) It may be a protein consisting of an amino acid sequence containing one or more mutations selected from the group consisting of substitutions with leucine (L).

In the present invention, the term "TSC2 mutant gene" means that a mutation has occurred in the nucleotide sequence of the gene of SEQ ID NO: 5, which is a wild-type TSC2 gene. Preferably, in the nucleotide sequence of SEQ ID NO: 5, the 4639 th guanine (G) may be a gene consisting of a nucleotide sequence including a substitution with adenine (A).

In the present invention, the term "TSC2 mutant protein" means that a mutation occurs in the amino acid sequence of the protein of SEQ ID NO: 6, which is a wild-type TSC2 protein. Preferably, in the amino acid sequence of SEQ ID NO: 6, the 1547 th valine (V) may be a protein consisting of an amino acid sequence including substitution with isoleucine (I).

In the present invention, the term "AKT3 mutant gene" means that a mutation occurs in the nucleotide sequence of the gene of SEQ ID NO: 7, which is a wild-type AKT3 gene. Preferably, in the nucleotide sequence of SEQ ID NO: 7, the 740 th guanine (G) may be a gene consisting of a nucleotide sequence including a substitution with adenine (A).

In the present invention, the term "AKT3 mutant protein" means that a mutation has occurred in the amino acid sequence of the protein of SEQ ID NO: 8, which is a wild-type AKT3 protein. Preferably, in the amino acid sequence of SEQ ID NO: 8, the 247th arginine (R) may be a protein consisting of an amino acid sequence including a substitution with histidine (H).

In the present invention, the term "PIK3CA mutant gene" means that a mutation occurs in the nucleotide sequence of the gene of SEQ ID NO: 9, which is a wild-type PIK3CA gene. Preferably, in the nucleotide sequence of SEQ ID NO: 9, the 3052 th guanine (G) may be a gene consisting of a nucleotide sequence including a substitution with adenine (A).

In the present invention, the term "PIK3CA mutant protein" means that a mutation has occurred in the amino acid sequence of the protein of SEQ ID NO: 10, which is a wild-type PIK3CA protein. Preferably, in the amino acid sequence of SEQ ID NO: 10, the 1018th aspartic acid (D) may be a protein consisting of an amino acid sequence including substitution with asparagine (N).

In addition, the mutant protein may contain additional mutations within a range that does not change the activity of the molecule as a whole. Amino acid exchanges in proteins and peptides that do not totally alter the activity of the molecule are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). In some cases, the mTOR mutant protein may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, or the like.

Examples of the mTOR inhibitor applicable to the present invention may include the mTOR inhibitor described in the application of the following application number: PCT/US09/005656 of Danaferber cancer institute; US14/400469 of Dolcetta, Diego; Exelixis PCT/US10/030354, US13/989,366, US12/784,254, US13/322,160, US13/988,948, US13/988,903, US13/989,156, US13/989,330, PCT/US12/042582, PCT/US10/035638, PCT/ US10/035639; US13/381571 to Sanofi, US14/374838; US12/199,689, US11/965,688, KR20097015914 from Infinity Pharmaceuticals; Intellikine's US12/586,241, PCT/US09/005958, PCT/US09/005959, PCT/US09/049983, PCT/US09/049969, US14/238,426, US12/920,970, US12/920,966, US14/619556; PCT/US10/000234, US12/841,940, US12/657,853, US12/657,854 from Takeda Pharmaceutical Company Limited; US13/001,099 from S*Bio Pte Ltd; PCT/US10/030350 from Schering Corporation; EP2012175019 of The Reagents of The University of California; EP2013836950 from Xuanzhu Pharma Corporation Limited; KR20130049854 of the Industrial-Academic Cooperation Foundation of Pohang University of Science and Technology; EP2009703974 of Signal RX Pharmaceuticals; US11/962,612, US11/111201, US10/818,145 to Semafore Pharmaceuticals; US13/014,275, US13/307,342, US11/842,927, US11/361,599, US11/817,134, PCT/GB06/000671 from Kudos Pharmaceuticals; US11/667,064, US11/842,930, US11/844,092, US12/160,752, US12/170,128, US12/668,056, US12/668,059, US12/252,081, US12/301722, US12/299,369, US12/299,359, US12/441,298, from AstraZeneca US12/441,305, US12/441299, US12/441,301, US12/668,060, PCT/GB07/003414, PCT/GB07/003417, PCT/GB07/003454, PCT/GB07/003493, PCT/GB07/003497; US10/862,149, US13/463,951, US14/266291 to Ariad Pharmaceuticals; US13/263,193, US13/379,685, US13/520,274, US13/818,153, US13/818,177, US13/876,192, US14/234,837, PCT/US12/047522 from Merck Sharp & Dohme Limited; Wyeth's US12/251,712, US12/354,027, US12/470,521, US13/950,584, US13/718,928, US14/477,650, US12/470,525, US12/050,445, US12/044,500, US12/473,605, US12/276,459, US12/363,013, US12/361,607, US12/397,590, US12/473,658, US12/506,291, US12/556,833, US12/558,661; Norvartis, US12/599,131, US12/792,471, US12/792,187, US13/073,652; EP2012177885, US13/738,829, US12/890,810, US13/568,707, EP2010769036, PCT/EP10/067162 from F. Hoffmann-La-Roche AG; US11/951,203, US12/821,998, US12/943,284 from Genentech Inc.

Specifically, examples of mTOR inhibitors applicable to the present invention may include mTOR inhibitors having the following substance names, development names or trade names: AMG954, AZD8055, AZD2014, BEZ235, BGT226, rapamycin, Everolimus, Sirolimus, CC- 115, CC-223, LY3023414, P7170, DS-7423, OSI-027, GSK2126458, PF-04691502, PF-05212384, Temsirolimus, INK128, MLN0128, MLN1117, Ridaforolimus, Metformin, XL765, SAR245409, SF1126, VS5584, GDC0980, GSK2126458. In addition, additional examples of the mTOR inhibitor may be those described in the patent documents of WO2012/104776, KR 10-1472607B, WO2010/039740, US8846670, US8263633, or WO2010/002954.

Specific examples of the mTOR inhibitor according to the present invention include Rapamycin or a salt thereof, Everolimus or a salt thereof, a compound of Formula 1 or a salt thereof, a compound of Formula 2 or a salt thereof, a compound of Formula 3 Or a salt thereof, and a compound of Formula 4 or a salt thereof may include one or more selected from the group consisting of.

In the present invention, the term "rapamycin" is a macrolide lactone compound, also known as sirolimus, and refers to a drug having immunosuppressive activity. Rapamycin has been commercialized as an inhibitor of transplant rejection in conventional organ transplant patients, and in addition, treatments for immune-inflammatory skin diseases such as pneumonia, systemic lupus erythematosus, and psoriasis, immune-inflammatory bowel disease, eye inflammation, restenosis, rheumatoid arthritis, etc. It is used as an anticancer agent. However, rapamycin has never been used for the prevention or treatment of focal cortical dysplasia associated with brain somatic mutations.

In the present invention, the term "everolimus" is a drug used to treat kidney cancer and is effective against drugs such as sunitinib or sorafenib, which are drugs that inhibit angiogenesis. It is used when there is no. It is also used in patients with crystalline sclerosis who have subventricular giant cell astrocytoma that cannot be operated. However, everolimus has never been used for the prevention or treatment of focal cortical dysplasia associated with brain somatic mutations.

In the present invention, "compounds of Formulas 1 to 4" are compounds known as inhibitors for mTOR. However, the relevance to the prevention or treatment of focal cortical dysplasia associated with brain somatic mutations is not known at all.

In the present invention, rapamycin, everolimus, and compounds of Formulas 1 to 4 include all derivatives or analogs thereof and pharmaceutically acceptable salts or hydrates.

The pharmaceutically acceptable salt or hydrate may be a salt or hydrate derived from an inorganic or organic acid.For example, as a salt, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, acetic acid, glycolic acid, lactic acid, pyruvic acid, mal Ronic acid, succinic acid, glutaric acid, fumaric acid, malic acid, mandelic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, benzoic acid, hydroxybenzoic acid, phenylacetic acid, cinnamic acid, salicylic acid, methanesulfur It may be phonic acid, benzene sulfonic acid, toluene sulfonic acid, but is not limited thereto. The hydrate may mean that rapamycin, everolimus, and compounds of Formulas 1 to 4 are combined with water molecules.

In the present invention, "treatment" refers to relief or improvement of symptoms, reduction of the range of the disease, delay or alleviation of disease progression, improvement of disease state, alleviation or stabilization, partial or complete recovery, prolongation of survival, and other beneficial treatment results. It can be used in an inclusive sense. The present invention includes alleviating, ameliorating, alleviating, or treating symptoms related to cerebral somatic mutation-associated focal cortical dysplasia by administering an mTOR inhibitor to a patient showing cerebral somatic mutation-related focal cortical dysplasia.

Symptoms related to focal cortical dysplasia associated with brain somatic mutations are caused by failure of nerve cells to move to appropriate brain regions during brain development.Spontaneous seizures, behavioral seizures, EEG seizures, and abnormal neurons in the cerebrum The occurrence of, etc. can be illustrated.

Therefore, the treatment in the present invention is by administering an mTOR inhibitor, for example, rapamycin, everolimus, and/or a compound of Formulas 1 to 4, to a patient with focal cortical dysplasia associated with such brain somatic mutation, spontaneous seizures, behavior It may mean significantly reducing the number of occurrences of seizures or EEG seizures, and reducing the number or size of abnormal neurons in the cerebrum.

Depending on the mode of use and method of use of the pharmaceutical composition of the present invention, the effective amount of the mTOR inhibitor may be appropriately adjusted and used according to the choice of a person skilled in the art.

For example, the pharmaceutical composition may contain an mTOR inhibitor in an amount of 0.1 to 10% by weight, more preferably 0.5 to 5% by weight, based on the total weight of the total composition.

The mTOR inhibitor may be included alone in the pharmaceutical composition, or may further include other pharmacologically acceptable additives. The pharmaceutically acceptable additives are commonly used at the time of formulation, and are lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose , Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, and as pharmaceutically acceptable excipients Includes, but is not limited to, lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, preservatives, and the like. That is, the pharmaceutically acceptable additives that can be added to the pharmaceutical composition of the present invention can be selected and made by a person skilled in the art without difficulty depending on the purpose of use, and the amount added is within a range that does not impair the object and effect of the present invention. Can be chosen from.

The preferred dosage of the pharmaceutical composition of the present invention to a patient varies depending on the condition and weight of the patient, the degree of disease, the form of the drug, the route of administration and the duration, but may be appropriately selected by a person skilled in the art. However, for a desirable effect, the extract of the present invention is 1 mg/kg to 1000 mg/kg per day, preferably 50 mg/kg to 500 mg/kg, more preferably 150 mg/kg to 300 mg/kg. It is good to administer. Administration may be administered once a day or may be divided several times. Therefore, the above dosage does not limit the scope of the present invention in any way.

The composition of the present invention can be administered to mammals such as rats, mice, livestock, and humans by various routes. All modes of administration can be expected and may be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, or intracerebroventricular injection.

In another aspect, the present invention provides an mTOR inhibitor, for example, rapamycin or a salt thereof, everolimus or a salt thereof, a compound of formula 1 or a salt thereof, a compound of formula 2 or a salt thereof, a compound of formula 3 or a salt thereof. It relates to a food composition for preventing or improving local cortical dysplasia associated with brain somatic genetic mutation, including at least one selected from the group consisting of a compound of Formula 4 or a salt thereof. The compounds of Formulas 1 to 4 are the same as those described above.

The food composition may be used together with ingredients of other conventional food compositions, and may be appropriately used according to a conventional method. The mTOR inhibitor can be appropriately determined depending on the purpose of use (prophylaxis, health or therapeutic treatment). In general, when preparing a food composition, it may be added in an amount of 0.01 to 10 parts by weight, preferably 0.05 to 1 part by weight, based on the raw material of the active ingredient. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above range.

The food composition may be contained in a health food for the purpose of preventing or improving local cortical dysplasia associated with brain somatic genetic mutation, and there is no particular limitation on the type thereof. Examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and may include all health foods in the usual sense. In addition to the above, the food composition of the present invention may further include a food pharmaceutically acceptable additive. Although the proportion of these additives is not very important, it is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

According to the present invention, by administering an mTOR inhibitor, for example, rapamycin, everolimus, and/or a compound of Formulas 1 to 4, to a patient exhibiting focal cortical dysplasia associated with cerebral somatic mutation, refractory epilepsy or its causative disease , For example, it is possible to significantly reduce the number of spontaneous seizures, behavioral seizures, or EEG seizures due to refractory epilepsy associated with brain somatic mutations, and reduce the number or size of abnormal neurons in the cerebrum.

FIG. 1A shows the results of performing H&E staining on MR images and pathological tissue samples after surgery for patients with mTOR genetic mutations (named FCD4 and FCD6). The white arrow indicates the brain area removed from the postoperative magnetic resonance image, and the black arrow indicates the giant neuron (Scale bar = 50um).
1B shows the location of mTOR-related somatic genetic mutations found in patients with focal cortical dysplasia through deep sequencing.
1C shows the result of confirming that the amino acid residues in which mTOR-related somatic mutations appear among the mTOR amino acid sequences are evolutionarily preserved.
2A shows the results of analysis of S6 phosphorylation by Western blot in HEK293T cells expressing the mTOR genetic mutation of the present invention. "P-S6" represents a phosphorylated S6 protein, "S6" represents an S6 protein, and "Flag" represents a flag protein. "20% serum" was exposed to 20% serum for 1 hour and was used as a positive control showing mTOR activity.
2B shows the results of measuring the activity of mTOR kinase in HEK293T cells expressing the mTOR genetic mutation of the present invention.
2C shows the results of immunohistochemistry to confirm the size of phosphorylated S6 protein and cells on pathological tissue samples of patients with refractory epilepsy caused by focal cortical dysplasia.
2D shows the average number of S6 proteins phosphate-assembled in a representative area of the cerebral cortex of patients with refractory epilepsy caused by focal cortical dysplasia. (number of counted cells=197-1182 per case).
Figure 2e shows the average of the size of nerve cells in a representative area of the cerebral cortex of patients with refractory epilepsy caused by focal cortical dysplasia.
3A is a plasmid into which the mTOR gene in which the nucleotide sequence of the present invention has undergone mutation was introduced, and after the embryo was born electroporated on the 14th day of embryonic period (E14), only mice expressing fluorescence were classified by flashlight (Electron Microscopy Science, USA). A schematic diagram showing the effect of measuring video-electroencephalography (video-EEG) and administering rapamycin after seizure is shown. "In utero electroporation (E14)" is a schematic diagram of injecting a plasmid into which the mTOR gene of the present invention has undergone a nucleotide sequence mutation on the 14th day of embryonicity, and "GFP screening at birth (P0)" is to give birth to an embryo injected with the plasmid. A schematic diagram of classifying only mice that express fluorescence by flashlight (Electron Microscopy Science, USA), and "Video-EEG monitoring (>3weeks)" means that after the mouse is wet (>3weeks), seizure is confirmed through video monitoring only. A schematic diagram of measuring an electroencephalogram (video-EEG) is shown.
3B shows the presence or absence of spontaneous seizures based on the video electroencephalogram monitoring results in mice into which the mTOR gene in which the nucleotide sequence mutation of the present invention has occurred. "No. of GFP+pups" refers to the number of mice expressing GFP through the introduction of the mTOR gene in which the sequence mutation has occurred, and "No. of mice with seizure" refers to the mice that cause seizures due to the introduction of the mTOR gene with the base sequence mutation. Represents the number of individuals.
3C shows the results of measuring the number of spontaneous seizures after administration of rapamycin to a mouse that causes spontaneous seizures due to the introduction of the mTOR gene in which the nucleotide sequence mutation of the present invention occurs. *p<0.05 and **p<0.01 (n=7-17 for each group, one-way ANOVA with Bonferroni's post test)
Figure 3d shows the result of confirming the change in size of GFP-positive cells after administration of rapamycin to a mouse causing spontaneous seizures by introducing the mTOR gene in which the nucleotide sequence mutation of the present invention has occurred.
4 shows an outline of an experiment in which deep sequencing analysis is performed using a sample obtained from a patient with focal cortical dysplasia, and then cell and biological function analysis is performed.
Figure 5a shows the discovery of brain-specific genetic mutations using Virmid (Genome Biology, 14(8), R90 (2013)) and MuTect software (Nature Biotechnology, 31, 213 (2013)) for the results of performing Deep sequencing at the same time. Represents the algorithm.
5B shows the reference allele (Ref), mutated allele (Mut), and mutation rate from Deep whole exome sequencing and amplicon sequencing for samples of patients with focal cortical dysplasia.
FIG. 6 shows the somatic genetic variation in focal cortical dysplasia found in deep whole exome sequencing by visualizing with colored bars using the collapsed mode of the Integrative Genomic Viewer (IGV).
7 shows magnetic resonance images for patients with focal cortical dysplasia. Arrows indicate areas affected by the disease.
8 shows the three-dimensional structure and region configuration of mTOR kinase confirmed using pymol (The PyMOL Molecular Graphics System, Schrodinger, LLC). "FAT" represents the FRAP, ATM, and TRRAP regions of mTOR, "FRB" represents the FKBP12-rapamycin attachment region, and "KD" represents the N and C-terminals of the phosphorylation region. The catalyst and active loops are shown in blue and red, respectively. ATPrS is represented by a bar and Mg2+ is represented by a sphere. The regions of genetic variation found in patients with FCD are shown in red.
9A shows the results of treatment with rapamycin for HEK293T cells expressing the mTOR genetic mutation of the present invention.
9B shows the results of treatment with rapamycin for HEK293T cells expressing the mTOR genetic mutation of the present invention. “P-S6K” refers to phosphorylated S6 protein, and “S6K” refers to S6 protein.
9C shows the results of treatment with compounds of Formulas 1 to 4 and everolimus with respect to HEK293T cells expressing the mTOR genetic mutation of the present invention. "P-S6" refers to phosphorylated S6 protein, and "S6" refers to S6 protein.
FIG. 10 is a micro-dissection of giant neurons with increased phosphorylation of S6 protein from pathological tissues of patients with refractory epilepsy due to focal cortical dysplasia who underwent epilepsy surgery, and through sanger sequencing, the genetic variant allele of the present invention is from mTOR gene It shows the result confirming that it was amplified. The yellow dot represents a giant neuron with increased phosphorylation of S6 protein while being positive for NeuN, and "LCM" represents a giant cell microdissected using the laser capture cell detachment method. As a control group, genomic DNA extracted from the patient's brain tissue without amplification was used. Scale bar, 100 um
FIG. 11A is a plasmid into which the mTOR gene in which the nucleotide sequence of the present invention has undergone mutation was introduced, shows an overview showing the process of analyzing after coronary cutting on the 18th day of embryonicity (E18) after electroporation on the 14th day of embryonic period (E14).
11B is a mouse embryonic period 18 days (E18) into which the mTOR gene in which the nucleotide sequence mutation occurred in the present invention was introduced in order to confirm the neuronal mobilization disorder and mTOR activity in the mouse into which the mTOR gene was introduced with the nucleotide sequence mutation of the present invention. The coronal section of the brain is shown. "CP" is the cortical plate, "IZ" is the cerebral intermediate zone, "SVZ" is the subventricular zone, "VZ" is the ventricular zone, "Wild type" When the wild-type mTOR plasmid is inserted, "Relative intensity value" represents the relative intensity of GFP (green fluorescent protein) in each case.
11C shows the result of confirming the change in mTOR activity during the development of the embryonic cortex of the mouse into which the mTOR gene in which the nucleotide sequence mutation occurred of the present invention was introduced. (Scale bars, 20 um, Error bars, sem)
12A shows video EEG monitoring results for spontaneous seizures in mice into which the mTOR gene in which the nucleotide sequence mutation has occurred of the present invention has been introduced. “LF” means left frontal, “RF” means right frontal, “LT” means left temporal, and “RT” means right temporal.
12B shows an interictal spike and an electrographic seizure in a mouse into which the mTOR gene in which the nucleotide sequence mutation of the present invention has occurred is introduced.
FIG. 12C shows the frequency of seizure gap waves in mice into which the mTOR gene in which the nucleotide sequence mutation occurred of the present invention was introduced, and changes in the frequency of seizure gap waves after administration of rapamycin to the mice.
12D shows the frequency of nonconvulsant EEG seizures in mice into which the mTOR gene in which the nucleotide sequence mutation of the present invention has occurred, and the frequency of nonconvulsant EEG attacks after administration of rapamycin to the mice.
12E shows seizure timing in mice into which the wild-type mTOR gene has been introduced and mice into which the mTOR gene has undergone a nucleotide sequence mutation of the present invention. (n=8-20 for each group). Error bars, sem
13 and 14 show the results of treatment with various mTOR inhibitors on HEK293T cells expressing the mTOR genetic mutation of the present invention. “P-S6K” refers to phosphorylated S6 protein, and “S6K” refers to S6 protein.
15 shows the results of Western blot for HEK293T cells expressing the TSC-1 wild type and the genetic mutation. (-) denotes control, and (+) denotes rapamycin treatment (200 nM). “P-S6K” indicates phosphorylated S6K protein, and “S6K” indicates S6K protein.
Figure 16 shows the results of Western blot for HEK293T cells expressing the TSC-2 wild type and the genetic mutation. (-) denotes control, and (+) denotes rapamycin treatment (200 nM). “P-S6K” indicates phosphorylated S6K protein, and “S6K” indicates S6K protein.
FIG. 17 shows Western blot results for HEK293T cells expressing AKT3 wild type and genetic mutation. (-) denotes control, and (+) denotes rapamycin treatment (200 nM). “P-S6K” indicates phosphorylated S6K protein, and “S6K” indicates S6K protein.
18 shows that the p.Arg22Trp and p.Arg204Cys variants of TSC-1 are associated with mTOR hyperactivation according to Example 9. Immunoprecipitation results for confirming the mechanism by which the TSC1 mutant induces mTOR overactivity is shown. Empty represents cells that have not been treated with anything.
19 shows a GTP-agarose pull down assay according to Example 9. Specifically, the degree of activation of the TSC complex is measured by measuring the amount of GTP-bound Rheb protein, a substrate of the TSC complex.
20 shows the results of treatment with rapamycin for HEK293T cells expressing the mTOR genetic mutation of the present invention. **p<0.01 and ***p<0.001 (compared to wild type, n=3-5 for each group, one-way ANOVA with Bonferroni's post test)
21 shows the results of treatment with rapamycin for HEK293T cells expressing the mTOR genetic mutation of the present invention. “P-S6K” refers to phosphorylated S6 protein, and “S6K” refers to S6 protein.
22 shows the results of treatment with compounds of Formulas 1 to 4 and everolimus with respect to HEK293T cells expressing the mTOR genetic mutation of the present invention. "P-S6" refers to phosphorylated S6 protein, and "S6" refers to S6 protein.
23A and 23B show Western blot results confirming changes before and after treatment with six drugs for HEK293T cells expressing mTOR wild-type and genetic mutations according to Example 10. (-) represents control, (+) represents drug treatment (200 nM). “P-S6K” indicates phosphorylated S6K protein, and “S6K” indicates S6K protein.
24A and 24B show Western blot results confirming changes before and after treatment with six drugs for HEK293T cells expressing the TSC1 wild type and the genetic mutation. (-) represents control, (+) represents drug treatment (200 nM). “P-S6K” indicates phosphorylated S6K protein, and “S6K” indicates S6K protein.
25A and 25B show Western blot results confirming changes before and after treatment with six drugs for HEK293T cells expressing the TSC2 wild type and the genetic mutation. (-) represents control, (+) represents drug treatment (200 nM). “P-S6K” indicates phosphorylated S6K protein, and “S6K” indicates S6K protein.
26A and 26C show pathological samples of all focal cortical dysplasia patients in which mTOR mutation was confirmed to be mutations in TSC1 and TSC2. "Non-FCD" is a sample with normal brain, not focal cortical dysplasia, "P-S6" is a result of phosphorylation of S6 protein, "NeuN" is a neuronal marker, "Merge" is P-S6 and This is the merged image of NeuN.
26B and 26D show the proportion of cells in which phosphorylation of S6 protein occurs in 4 to 5 parts of the cortical region,
26E and 26F show the size of a neuronal marker (NeN) positive cell. *p<0.05, **P<0.001, ***P<0.0001 [relative to Non-FCD samples, one-way ANOVA with Bonferroni posttest]. Error bars, sem Scale bars, 50 um.
Figure 27a shows the occurrence of nerve cell migration disorder in the TSC mouse model and the resulting cortical developmental deformity. "Control" indicates the case where sgRNA is not inserted, and red text indicates the proportion of cells expressing the plasmid. Scale bars, 250 um.
27B shows the distribution of electroporated cells within the cortex. *p<0.05, ***P<0.0001 [Two-way ANOVA with Bonferroni posttest]. Error bars, sem
Figure 28 shows the results of measuring the number of spontaneous seizures after administration of rapamycin to a TSC2 mouse model causing spontaneous seizures. *p<0.05 and **p<0.01 (n=7-17 for each group, one-way ANOVA with Bonferroni?s post test)

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1: all Exome Sequencing gene discovery process and reconfirmation

Example 1-1: Total Exome Sequencing in 4 Patients Identification of 3 candidates for mTOR genetic mutation

Deep whole exom sequencing (read depth 412-668?) was performed on brain tissue samples of 4 FCDII patients (named FCD3, FCD4, FCD6, FCD23), and 3 candidate genetic variants found simultaneously in both Virmid and Mutect algorithms. I chose

As a specific method of obtaining whole exome sequencing data, a sequencing library was prepared using Agilent library preparation protocols (Agilent Human All Exon 50 Mb kit) according to the manufacturer's method. Sequencing was performed using Hiseq2000 (illumina), and sequencing was performed at ~500x, which was increased by 5 times from the general sequencing depth to perform the analysis more accurately. The data after sequencing was made into a file that can be analyzed using the Broad Institute best practice pipleline (https://www.broadinstitute.org/gatk/).

Example 1-2: Confirmation of one genetic mutation (L2427P) through reconfirmation of three candidate genetic variants using position-specific amplicon sequencing

Next, position-specific amplicon sequencing was performed for these candidate genetic variants (read depth, 100-347,499?). Since the sample used for this was obtained through biological replication from the same patient's tissue, sequencing errors that could be mistaken for low-frequency genetic mutations could be minimized. In the site-specific amplicon sequencing, the mutation was determined only when the genetic mutation rate exceeded 1%.

Site-specific amplicon sequencing (Site-specific amplicon sequencing) mTOR target gene codon site (a site containing amino acids Cys1483, Leu2427) to include two pairs of primers having two targets were prepared (Table 2) .

Target site primer Sequence number Chr1:11174301
~Chr1:11174513 Forward direction 5'-TAGGTTACAGGCCTGGATGG-3' 11 Reverse 5'-CTTGGCCTCCCAAAATGTTA-3' 12 Chr1:11217133
~Chr1:11217344 Forward direction 5'-TCCAGGCTACCTGGTATGAGA-3' 13 Reverse 5'-GCCTTCCTTTCAAATCCAAA-3' 14

Each primer contains a patient-specific index, and one marker per patient sample was used to determine which patient the nucleotide sequence was derived from when analyzing the genetic variation. Using the thus prepared primers, PCR of the target site was performed to amplify two target site nucleotide sequences. After that, a DNA library was prepared using the Truseq DNA kit (Illumina), and the target gene was resequencing using the Miseq sequencer (Illumina) (central read depth 135,424x). It was made into a bam file that can be analyzed using the Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) program.

Example 1-3: Sequence analysis result

As a result of using two sequencing methods and performing biological replication, as can be seen in FIG. 5A, mTOR c.7280T>C p.Leu2427Pro was repeatedly reproduced in two patients. As can be seen from FIG. 5B, the genetic mutation rate was 9.6 to 12.6% in FCD4 patients and 6.9 to 7.3% in FCD6 patients.

In addition, as can be seen in FIGS. 5B and 6, it was confirmed that the genetic mutation was not found in blood samples.

Example 2: In the enlarged patient group mTOR Search for specific genetic mutations

Based on the result of searching for mTOR-specific genetic mutations in 4 patient groups in Example 1, the patient group was expanded to investigate MTOR-specific genetic mutations in 73 additional patients.

Example 2-1: patient sample collection and Genomic DNA extraction

Brain tissue (1-2g), saliva (1-2ml), blood (about 5ml) formalin-fixed paraffin-embedded brain tissue of the patient with the consent of 73 patients undergoing refractory epilepsy due to focal cortical dysplasia (FCD) (Department of Pediatric Neurosurgery and Pediatric Neurology, Severance Hospital). The following DNA extraction kits were extracted from the patient's brain tissue, blood, saliva, and formalin-fixed paraffin-embedded brain tissue using the manufacturer's instructions:

Brain tissue: Qiamp mini DNA kit (Qiagen, USA), blood: Flexigene DNA kit (Qiagen, USA), saliva: prepIT2P purification kit (DNAgenotek, USA), formalin-fixed paraffin-embedded brain tissue: Qiamp mini FFPE DNA kit (Qiagen, USA).

Example 2-2: sequencing

Hybrid capture sequencing (read depth, 100-17,700?) was performed on brain tissue samples from 73 additional FCDII patients, and PCR-based amplicon sequencing was performed on site-specific amplicon sequencing (read depth, 100-347,499?, 73 patients). And mTOR amplicon sequencing (read depth, 100-20,210?, 59 patients) were performed.

As hybrid capture sequencing, an mTOR-specific probe was prepared using SureDesign online tools (Agilent Technologies). Sequencing libraries were prepared using Agilent library preparation protocols according to the manufacturer's method. Sequencing was performed using Hiseq2500 (illumina) (central read depth 515x). The data after sequencing was made into a bam file that can be analyzed using the Broad Institute best practice pipleline (https://www.broadinstitute.org/gatk/).

mTOR amplicon sequencing), mTOR amplicon (Truseq custom amplicon kit, illumina) produced by illumina design studio (http://designstudio.illumina.com) was used, and a library was produced according to the manufacturer's method. Sequencing was performed using a Miseq sequencer (Illumina) (central read depth 1,647x). It was made into a bam file that can be analyzed using the BWA-MEM algorithm (http://bio-bwa.sourceforge.net).

Example 2-3: Sequence analysis experiment result

Blood-brain tissue paired with Virmid (http://sourceforge.net/projects/virmid/) and Mutect (http://www.broadinstitute.org/) to find brain tissue-specific de novo somatic mutations cancer/cga/mutect), each assay was used for total exome sequencing data. Only somatic mutations found in both assays were used for later experiments.

In addition, among the genetic variants found in both hybrid capture sequencing and PCR-based amplicon sequencing, only those genetic variants that satisfy the selection criteria (depth 100 or more mutated calls 3 or more (mapping quality 30 or more)) are candidates for disease-related genes. Was selected as.

Accordingly, the nine somatic mutation sites found (chr1:11298590 for c.1871G>A, chr1:11217330 for c.4348T>G, chr1:11217231 for c.4447T>C, chr1:11199365 for c.5126G>A) , chr1:11188164 for c.5930C>A, chr1:11184640 for c.6577C>T, chr1:11184573 for c.6644C>T, chr1:11174395 for c.7280T>C and c.7280T>A) 1000 genomes This was confirmed from 2508 CRAMs (compressed BAM) implemented by the project. As a result, no somatic mutation was found that satisfies the above screening conditions at all of the nine genetic mutation sites. Accordingly, it was confirmed that the genetic variation identified in the present invention is disease-specific.

Example 2- 4: sequence analysis result

Hybrid capture sequencing (73 people) and mTOR amplicon sequencing (59 people) were used to select only the genetic mutations from both of them as the true genetic mutation candidates.As a result, a total of 9 true genetic mutation candidates were obtained ( Including the genetic variation found in Example 1)

In order to reliably eliminate sequencing errors, only those with a genetic mutation rate of 1% or more were considered positive, and only those found in both hybrid capture and PCR-based amplicon sequencing and reconfirmed in various samples were selected as true genetic mutations.

As a result, as can be seen in FIG. 1B, 8 different mTOR genetic mutations were observed in another 10 FCDII patients: mTOR c.1871G>A (p.Arg624His), c. 4348T>G (p.Tyr1450Asp), c.4447T>C (p.Cys1483Arg), c.5126G>A (p.Arg1709His), c.5930C>A (p.Thr1977Lys), c.6577C>T (p. Arg2193Cys), c.6644C>T (p.Ser2215Phe), and c.7280T>A (p.Leu2427Gln). Finally, 9 different mTOR genetic mutations were found in 15.6% (12/77) of patients (Table 3).

patient Age of operation gender pathology mTOR gene mutation mTOR protein mutation FCD 4 5 years 2 months female Matched with FCDIIa
(Cortical dyslamination / nerve cell dysplasia)
(Dysmorphic neurons) c.7280T>C p.Leu2427Pro FCD 6 5 years female Homology c.7280T>C p.Leu2427Pro FCD 91 7 years and 1 month female Homology c.6577C>T p.Arg2193Cys FCD 104 1 year and 2 months male Homology c.1871G>A p.Arg624His FCD 105 3 years 7 months male Homology c.5126G>A p.Arg1709His FCD 107 7 years 3 months female Matched with FCDIIb
(Cortical abnormal layering / neuronal dysplasia / balloon cells) c.6644C>T p.Ser2215Phe FCD 113 10 years female Homology c.7280T>A p.Leu2427Gln FCD 116 7 years 9 months male Homology c.5930C>A p.Thr1977Lys FCD 121 11 months male Homology c.4348T>G p.Tyr1450Asp FCD 128 4 years 4 months female Homology c.4447T>C p.Cys1483Arg FCD 143 2 years 10 months female Homology c.6644C>T p.Ser2215Phe FCD 145 4 years and 1 month female Homology c.5930C>A p.Thr1977Lys

All genetic mutations found were negative in both saliva and blood of patients with genetic mutations. The genetic variations found were all negative in the 1000 genome database. Among the genetic variants found, p.Thr1977Lys, p.Ser2215Phe, and p.Leu2427Pro were repeatedly detected in 2 patients. It was confirmed that all patients had one mTOR genetic mutation. The genetic mutation rate was 1.26% to 12.6%, and as can be seen in Figure 1c, the amino acid residues of the genetic mutation site were evolutionarily conserved.

Example 3: using cells mTOR Genetically modified mTOR Overactive Confirm

To confirm whether the p.Tyr1450Asp, p.Cys1483Arg, p.Leu2427Gln, and p.Leu2427Pro genetic mutations overactivate mTOR, HEK293T cells were transduced with wild-type and mutant mTOR vectors, and the S6 protein, a well-known marker of the mTOR gene The phosphorylation of the S6K protein was confirmed by Western blot.

Examples 3-1: mutagenesis and mutant constructs mTOR (mTOR mutant construct) productions

The pcDNA3.1 flag-tagged wild-type mTOR construct (pcDNA3.1 flag-tagged wild-type mTOR construct) was obtained from Dr. Kun-Liang Guan at the University of California, Sandiego. Was provided. The construct was used to prepare mTOR variant vectors (Y1450D, C1483R, L2427Q and L2427P) together with the QuikChange site-directed mutagenesis kit (200523, Stratagene, USA).

To make the pCIG-mTOR mutant-IRES-EGFP vector, first use the following annealing primer [forward primer 5'-AATTCCAATTGCCCGGGCTTAAGATCGATACGCGTA-3' (Serial Code 15) and reverse primer 5'-ccggtacgcgtatcgatcttaagcccgggcaattgg-3' (SEQ ID NO: 16)]. Thus, pCIG-C1 was made by inserting the MfeI and MluI restriction enzyme cleavage sites into pCIG2 (CAG promoter-MCS-IRES-EGFP). The following primers [hmTOR-MfeI-flag-F; subcloning was performed using gATcACAATTGTGGCCACCATGGACTACAAGGACGACGATGACAAGatgc (SEQ ID NO: 17), hmTOR-MluI-R;tgatcaACGCGTttaccagaaagggcaccagccaatatagc (SEQ ID NO: 18)]. pCIG-mTOR wild type-IRES-EGFP and. The pCIG-mTOR mutant-IRES-EGFP vector was made. Primers used for mutagenesis are shown in Table 4.

name primer Sequence number Y1450D Forward direction 5'-tcgtgcagtttctcatcccaggtagcctggatc-3' 19 Reverse 5'-gatccaggctacctgggatgagaaactgcacga-3' 20 C1483R Forward direction 5'-GGCCTCGAGGCGGCGCATGCGGC-3' 21 Reverse 5'-GCCGCATGCGCCGCCTCGAGGCC-3' 22 L2427Q Forward direction 5'-GTCTATGACCCCTTGCAGAACTGGAGGCTGATG-3' 23 Reverse 5'-CATCAGCCTCCAGTTCTGCAAGGGGTCATAGAC-3' 24 L2427P Forward direction GTCTATGACCCCTTGCCGAACTGGAGGCTGATG 25 Reverse CATCAGCCTCCAGTTCGGCAAGGGGTCATAGAC 26

Example 3-2. Wild type and variant The mTOR vector transduction (transfection) and western blot turn

HEK293T cells (thermoscientific) were cultured in DMEM (Dulbecco's Modified Eagle's Medium) medium containing 10% FBS under 37, 5% CO ₂ conditions. Cells were transduced with an empty flag-tagged vector, a flag-tagged mTOR wild type, and a flag-tagged mTOR variant using a jetPRIME transfection reagent (Polyplus, France). Cells were serum-starved with 0.1% FBS in DMEM medium for 24 hours after transduction, and cultured for 1 hour _{in PBS containing 1 mM MgCl 2} and CaCl ₂ under 37, 5% CO _{2 conditions.} Cells were lyseed in PBS containing 1% of Triton X-100, Halt protease, and phosphatase inhibitor cocktail (78440, Thermo Scientific, USA).

The protein was resolved by SDS-PAGE and transferred to a PVDF membrane (Milipore, USA). The membrane was blocked with 3% BSA in TBS containing 0.1% Tween 20 (TBST). Then, washing was repeated 4 times with TBST. The membrane was anti-phospho-S6-ribosomal protein (5364, Cell Signaling Technology, USA) diluted to 1/1000, anti-S6 ribosomal protein (2217, Cell Signaling Technology, USA) and anti-flag M2 (8164, Cell Signaling Technology). , USA) in TBST with a primary antibody containing 4, respectively, overnight incubation. After incubation, the membrane was repeatedly washed 4 times with TBST. Then, it was incubated for 2 hours at room temperature with HRP-linked anti-rabbit or anti-mouse secondary antibodies (7074, Cell Signaling Technology, USA) diluted to 1/5000. TBST was washed, and immunodetection was performed using ECL reaction reagent.

Example 3-3. Variant Confirmation of changes in phosphorylation of S6 protein in mTOR-expressing cells

To measure the in vitro mTOR kinase activity (in vitro mTOR kinase assay), the phosphorylation activity of mTOR was measured according to the manufacturer's protocol using the K-LISA mTOR activity kit (CBA055, Calbiochem, USA). The transduced cells (HEK293T cells) were lysed in TBS containing 1% of Tween 20, Halt protease and phosphatase inhibitor cocktail. 1 mg of the total lysate was pre-cleared by adding 15 ul of protein G-beads (10004D, Life technologies, USA) and incubated for 4 to 15 minutes. Anti-flag antibody was added to the pre-cleared lysate and incubated at 4 overnight. Then, 50 ul of 20% slurry protein G-bead was added and incubated at 4 for 90 minutes. The supernatant was carefully removed. The pelleted beads were washed 4 times with 500 ul of lysis buffer, and 1X kinase buffer provided from the K-LISA mTOR activity kit. Washed twice. The pellet beads were resuspended in 50 ul of 2X kinase buffer and 50 ul of mTOR substrate (p70S6K-GST fusion protein), followed by incubation for 30 to 30 minutes. The reaction mixture was incubated on a glutathione-coated 96-well plate and incubated for 30 to 30 minutes. A phosphorylated substrate was detected using an Anti-p70S6K-pT389 antibody, an HRP antibody-conjugate, and a TMB substrate. Relative activity was measured by reading the absorbance at 450 nm.

2A and 9B, phosphorylation of S6 protein was increased in cells expressing the mutant mTOR.

In addition, wild-type and mutant mTOR proteins were isolated from HEK293T cells expressing wild-type and mutant, respectively, and mTOR phosphorylation enzyme activity was measured in vitro. As can be seen in Figure 2b, it was confirmed that the mTOR protein having the pCys1483Arg, p.Leu2427Gln, and p.Leu2427Pro mutations exhibited high phosphorylation enzyme activity.

Example 3-4. After drug treatment S6K Confirmation of changes in protein phosphorylation

The mutant mTOR-expressing cells were treated with drugs (rapamycin, everolimus, compounds of Formulas 1 to 4), and then the change in phosphorylation of the S6K protein was confirmed.

In the same manner as in 3-2, HEK293T cells were transduced with mTOR mutant, serum-starved with 0.1% FBS in DMEM medium for 24 hours, and 37, 5 in PBS containing _{1 mM MgCl 2} and CaCl ₂ After incubation for 1 hour under% CO ₂ conditions, rapamycin, everolimus, compounds of formulas 1 to 4 (Torin1, INK128, AZD8055, GSK2126458) were treated: Torin was obtained from TOCRIS, INK128, AZD8055, GSK2126458 Was obtained from Selleckchem, and Everolimus was obtained from LC laboratory. Thereafter, Western blot was performed in the same manner as in Example 9.

9A and 9B, it was confirmed that phosphorylation of the S6K protein was inhibited by rapamycin in cells expressing the mutant mTOR.

Cells expressing the mutant mTOR were treated with everolimus and compounds of Formulas 1 to 4, respectively, and then the phosphorylation of the S6K protein was confirmed.

As can be seen in Figure 9c, it was confirmed that phosphorylation of S6K protein in cells expressing the mutant mTOR was inhibited by everolimus and compounds of Formulas 1 to 4.

Example 3-5. variety mTOR Inhibitor treatment S6K Confirmation of changes in protein phosphorylation

In the same manner as in Example 3-2, cells expressing various mutant mTOR were treated with rapamycin, everolimus, compounds of Formulas 1 to 4) as drugs, and then phosphorylation of the S6K protein was confirmed. Specifically, the mTOR variants used in the experiment were R624H, Y1450D, C1483R, R1709H, Y1977K, S2215F, L2427P and L2427Q.

Specifically, cells expressing the mutant mTOR were treated with everolimus and compounds of Formulas 1 to 4, respectively, and then a change in phosphorylation of the S6K protein was confirmed. As can be seen from the figure, it was confirmed that phosphorylation of S6K protein in all cells expressing the mutant mTOR was inhibited by everolimus and compounds of Formulas 1 to 4, and the results are shown in FIGS. 13 and 14.

Example 4: Patient sample Used mTOR Genetically modified mTOR Overactive Confirm

Example 4-1: FCD Immunostaining of sections of patient's brain tissue

To determine whether FCDII patients with genetic mutation exhibit mTOR overactivity, immunostaining was performed on brain tissue sections of FCD patients with p.Leu2427Pro genetic mutation with antibodies against S6 phosphorylated protein and NeuN (neural cell marker).

Non-MCD brain specimens were collected in the operating room from the tumor free margin of patients with glioblastoma and confirmed pathologically as normal brain without tumors. Surgical tissue block was fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 20% buffered sucrose, and gelatin-embedded tissue block (7.5% gelatin in 10%). sucrose/PB) and stored at -80. The cryostat-cut section (10 um thick) is collected and placed on a glass slide, and blocked with PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) for one hour at room temperature ( block) and stained with the following antibodies: rabbit antibody to phosphorylated S6 ribosomal protein (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology) and Mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Samples were washed with PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and rabbit. Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen). DAPI contained in a mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Leica DMI3000 B inverted microscope. The number of cells positive for NeuN was measured using a 10x objective lens; 4 to 5 fields per subject were obtained within a neuron-rich regine, and more than 100 cells per area were recorded. The number of DAPI-positive cells represents the total number of cells. Neuronal cell size was measured in NeuN-positive cells using an automated counting protocol of ImageJ software (http://rsbweb.nih.gov/ij/).

As can be seen in Figure 2c, it was confirmed that the number of neurons with phosphorylated S6 protein was increased in FCD4 and 6 patients with the p.Leu2427Pro genetic mutation. On the other hand, as can be seen in Figure 2d, this increase was not observed in the non-FCD brain tissue. In addition, as can be seen in Figure 2e, the size of the neuron with increased phosphorylation of S6 protein in the pathological tissue was measured, and it was confirmed that the size was increased.

Example 4-2: Microdissection and sanger sequencing of giant neurons with increased phosphorylation of S6 protein in brain tissue sections of FCD patients

Surgical tissue block was fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 20% buffered sucrose, and gelatin-embedded tissue block (7.5% gelatin in 10%). sucrose/PB) and stored at -80. The cryostat-cut section (10 um thick) is collected and placed on a glass slide, and blocked with PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) for one hour at room temperature ( block) and stained with the following antibodies: rabbit antibody to phosphorylated S6 ribosomal protein (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology) and Mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Samples were washed with PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and rabbit. Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen).

DAPI contained in a mounting solution (P36931, Life technology) was used for nuclear staining. Only cells (about 20 cells) positive for phosphorylated S6 protein staining were cut out from the fluorescently-stained slides using a PALM Laser capture system (Carl zeiss, Germany) and an adhesive cap (Carl zeiss, Germany).

Thereafter, genomic DNA was extracted using QiAamp microkit (Qiagen, USA), and PCR was performed using the following primer to amplify the genetic mutation site (mTOR c.7280T>C) (Sense 5'-CCCAGGCACTTGATGATACTC-3' (sequence Number 27) and antisense, 5'-CTTGCTTTGGGTGGAGAGTT-3' (SEQ ID NO: 28)).

The amplified PCR product was purified with a MEGAquick spin total fragment purification kit (Intron, Korea), and then Sanger sequencing was performed using a BioDye Terminator and automatic sequencer system (Applied Biosystems).

As can be seen in FIG. 10, micro-dissection of giant neurons with increased phosphorylation of S6 protein in the same pathological tissue and sanger sequencing confirmed that the p.Leu2427Pro genetic variant allele was amplified. Through this, it was proved that the discovered genetic mutations abnormally regulate mTOR gene overactivity and cell growth.

Example 5: in animal models mTOR Overactive Effects on cerebral development

The frequently observed p.Leu2427Pro genetic mutation was selected to perform functional analysis in an animal model. The mTOR mutant construct was introduced into mouse embryos by electroporation to investigate cerebral nerve cell migration and phosphorylation of S6 protein.

Example 5-1: animal model manufacturing

Pregnant mice (E14) (Damul Science) were anesthetized with isoflurane (0.4L/min of oxygen and isoflurane vaporizer gauge 3 during surgery operation).

Fast combined with 2 to 3 ug of plasmids expressing mTOR C1483Y, mTOR E2419K, and mTOR L2427P variants prepared in Example 3-1 in the lateral ventricle of the uterine horn exposed and individual embryos Green (F7252, Sigma, USA) 2ug/ml was injected using a pulled glass capillary. The plasmid was electroporated by discharging 50V to the embryo's head with an ECM830 eletroporator (BTX-harvard apparatus), which is a 5th electric pulse of 100 ms at an interval of 900 ms.

Example 5-2: image analysis of mouse model

Embryonic mice were electroporated on the 14th day of embryonic period (E14), and the brains were harvested 4 days after development (E18), and fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, and in 30% buffered sucrose. Freeze-protected overnight and stored at -80 as a gelatin-embedded tissue mass (7.5% gelatin in 10% sucrose/PB).

Frozen sections (30 um thick) were collected and placed on a glass slide. DAPI contained in a mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Leica DMI3000 B inverted microscope or a Zeiss LSM510 confocal microscope. Fluorescence intensity, which shows the distribution of electroporated cells in the cortex, is converted to a gray value, and from the ventricular zone (VZ) to the cortical plate (CP), ImageJ software ( It was measured using http://rsbweb.nih.gov/ij/). Mander's co-localization analysis (http://fiji.sc/wiki/index.php/Colocalization_Analysis) was performed using Fiji software.

Example 5-3: Experiment result

As shown in FIG. 11A, the mTOR wild-type and p.Leu2427Pro mutant constructs having the IRES-GFP marker were introduced by electroporation on the 14th day of the developing cerebral embryo, and then cerebral neuron migration and GFP-positive neurons on the 18th day of the embryo. The phosphorylation of S6 was measured.

As can be seen in Figure 11b, GFP-positive neurons in the brain tissue sections of mice expressing the mTOR mutant construct are reduced in the cortical plate, and the cerebral intermediate zone and subventricular zone (subventricular) zone) It was confirmed that it was increased in the ventricular zone. Through this, it was proved that there is a problem in the movement of nerve cells.

In addition, as can be seen in Fig. 11c, it was confirmed that GFP-positive cells expressing the mTOR mutant construct coexist with cells with increased phosphorylation of the S6 protein. Through this, it was demonstrated that the discovered genetic mutation increases the activity of mTOR phosphorylation enzyme and inhibits the development of cerebral cortex in animals.

Example 6: in animal models mTOR Overactive Confirmation of the disease phenotype of the patient by

Example 6-1. Identification of spontaneous seizures or abnormal neurons in animal models

As shown in Fig. 3a, in order to confirm whether mice expressing the mTOR variant construct by electroporation show spontaneous seizures, the construct was introduced by electroporation on the 14th day of the embryonic period, and immediately after the embryo was born, the construct was Rat fetuses expressing well were selected for the presence or absence of GFP expression.

Video EEG monitoring was performed after 3 weeks of age. After separating the fetus from the mother, it was confirmed whether tense-convulsive seizures began through video surveillance for 12 hours a day. After that, the mice showing seizures were subjected to video-electroencephalogram monitoring for 6 hours a day for more than 2 days to investigate spontaneous seizures showing epilepsy.

Specifically, after the mouse was wet (>3 weeks), after checking whether seizure occurred through video monitoring only, an operation was performed to place an electrode to measure EEG. Electrodes were placed on the epidural layer, and based on the zenith (Bregma), two in the frontal lobe (AP+2.8mm, ML?1.5 mm) and two in the temporal lobe (AP-2.4mm, ML? 2.4 mm), a total of 5 electrodes were placed in the cerebellum. After a recovery period of 4 days, measurements were performed for 2 to 5 days per mouse (6 hours a day) from 6 pm to 2 am. The signal was amplified by an amplifier (GRASS model 9 EEG/Polysomnograph, GRASS technologies, USA) and analyzed using the pCLAMP program (Molecular Devices, USA). Or it was analyzed using RHD2000 amplifier, board (Intan technoloties, USA) and MATLAB EEGLAB (http://sccn.ucsd.edu/eeglab).

In order to measure the frequency of seizure gap waves and nonconvulsive EEG seizures, video EEG data taken for 10 to 12 hours was used, and 1 minute of data was extracted and analyzed from this data at 1 hour intervals.

The incidence of seizure gap waves and nonconvulsant EEG was measured by an observer who did not know the genotype of mice. The seizure gap wave was defined as a case where an epileptic wave of 200 ms or less appears at regular intervals and has an amplitude of more than twice that of a background EEG. It was defined as the case where it was expressed with an amplitude of more than twice that of the EEG, and observed in all four electrodes.

3B and 12A, surprisingly, more than 90% of mice expressing the mutant mTOR construct exhibited spontaneous seizures accompanied by epileptic waves, and epileptic waves are high-frequency high-amplitude, high-amplitude ultra-slow waves, It showed a high frequency with low amplitude. As can be seen in Fig. 12b, it was confirmed that seizure gap waves also appeared in mice expressing the mutant construct. Mice exhibiting such spontaneous seizures showed systemic tonic-interstitial seizures consisting of tense and post-interticular seizures, which were confirmed to be similar to those of FCDII patients. In addition, it was confirmed that the tension EEG shows a low-voltage and high-frequency tuned multi-frequency, the interphase EEG shows a constant form of a high voltage, and the post-seizure shows a tuned attenuation amplitude. However, as can be seen in Figure 3b, mice expressing the wild-type mTOR construct did not show spontaneous seizures or epileptic waves.

Rats expressing the p.Leu2427Pro mutant construct started seizure at about 6 weeks of age on average (Fig. 12e), which was similar to the time when seizures appeared in FCDII patients (about 4 years old) when converted to humans. As can be seen in Figure 3c, the frequency of seizures was about 6 times a day.

After confirming the seizure, we investigated whether mice expressing the mTOR mutant construct showed abnormal neuronal morphology such as giant neurons.

As a result, it was observed that the cell size of the GFP-positive cells in the cerebral region subjected to electroporation of the mTOR mutant construct was significantly increased (FIG. 3D).

Example 6-2. Check for spontaneous seizures or abnormal neuronal changes caused by drug administration

Changes were confirmed after rapamycin was administered to the animal model showing spontaneous seizures or abnormal neurons.

Specifically, rapamycin and everolimus (LC Labs, USA) were diluted to 20 mg/ml in 100% ethanol to prepare a stock solution and then stored at -20. Before rapamycin injection, the stock solution was diluted in 5% polyethleneglycol400 and 5% Tween80 to prepare a 1mg/ml rapamycin and 4% ethanol solution. The prepared solution was administered by intraperitoneal injection at a concentration of 1 to 10 mg/kg for 2 weeks (10 mg/kg/d intraperitoneal injection, for 2 weeks).

As can be seen in FIGS. 3c, 12c and 12d, it was confirmed that spontaneous seizures hardly appeared in the animal model due to the administration of rapamycin, and the frequency of seizure gap waves and nonconvulsive EEG attacks dramatically decreased.

Furthermore, as can be seen in FIG. 3D, it was confirmed that the size of abnormal cells in the animal model was also reduced due to the administration of rapamycin.

Example 7: Refractory through sequencing Epilepsy Confirmation of genetic variation in the patient group

For a total of 77 patients described in Examples 1 and 2, genomic DNA was extracted from the patient sample in substantially the same manner as in Example 2, and amplicon sequencing based on hybrid capture sequencing and PCR was performed. As a result of selecting a genetic mutation that satisfies the selection criteria (depth 100 or higher, mutated call 3 or higher, mapping quality 30 or higher) among the genetic variants found in all branches, genetic mutations were observed in TSC1, TSC2, AKT3, and PIK3CA, respectively.

Among the genetic variants found in both hybrid capture sequencing and PCR-based amplicon sequencing, a genetic mutation that satisfies the selection criteria (depth 100 or higher, mutated call 3 or higher, mapping quality 30 or higher) was selected as a result of selection, SC1, TSC2. , AKT3 and PIK3CA, respectively, showed genetic mutations. TSC1 c.64C>T (p.Arg22Trp), c.610C>T (p.Arg204Cys), c.2432G>T (p.Arg811Leu); TSC2 c.4639C>T (p.Val1547Ile); AKT3 c.740G>A (p.Arg247His), PIK3CA c.3052G>A (p.Asp1018Asn). Among 51 patients without MTOR genetic mutation, 8 patients had brain lesion-specific genetic mutations in the TSC1, TSC2, AKT3 and PIK3CA genes.

Patient/Gender/Operation Age pathology protein
Kinds gene
transition protein
transition Hybrid Capture
% Mutated allele PCR amplicon sequencing
% Mutated allele FCD 64/Female/6yr 9m Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa TSC1
c.610C>T p.Arg204Cys 1.75% 1.0% HME 66/M/2yr 8m Cortical laminar disturbance with large giant neurons PIK3CA c.3052G>A p.Asp1018Asn 1.03% 2.30% FCD 81/Female/12yr Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa TSC1 c.64C>T p.Arg22Trp 2.81% 2.0% HS86/M Hippocampal sclerosis AKT3 c.740G>A p.Arg247His 1.72% 10% 13yr 2m Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa TSC2 c.4639C>T p.Val1547Ile 1.19% 1.55% 10yr 3m/14yr 3m Cortical dyslaminati on, Dysmorphic neurons,
consistent with FCDIIa TSC1 c.64C>T p.Arg22Trp 2.52% 1.98% FCD 123/Female/12yr 4m Cortical dyslamination, dysmorphic neurons, balloon cells, consistent with FCDIIb TSC1 c.64C>T p.Arg22Trp 2.21% 1.37% HME141/Female/1yr 9m Cortical laminar disturbance with large giant neurons TSC1 c.2432G>T p.Arg811Leu 1.03% 1.68%

Example 8: using cells mTOR Overactive Confirm

8-1. Mutagenesis and TSC1 , TSC2 , AKT3 Variant Construct making

The wild-type TSC1, TSC2 or AKT3 construct was HA-tagged pcDNA3 (pcDNA3 HA-tagged wild-type TSC1, TSC2, AKT3 construct) was purchased from Addgene (USA) and a QuikChange site-directed mutagenesis kit (200523, Stratagene, USA). ) Was used to prepare a variant vector.

PCDNA3 (pcDNA3 HA-tagged wild-type TSC1, TSC2, AKT3 construct) with a wild-type TSC1, TSC2 or AKT3 construct HA-tagged was purchased from Addgene (USA). For mutagenesis of TSC-1 R22W and R204C in pcDNA3 TSC1, TSC2, AKT3 wild-type vector, TSC-1 R22W-F and R22W-R primers were used for R22W, and TSC-1 R204C-F for R204C. , R204C-R primer was used. TSC-2 V1547I-F and V1547I-R primers were used for mutagenesis of TSC-2 V1547I in pcDNA3 TSC2 wild-type vector. R247H-F, R247H-R for mutagenesis of AKT3 R247H in pcDNA3 AKT3 wild-type vector A primer was used.

Point mutations were made using the QuikChange II site-directed mutagenesis kit (200523, Stratagene, USA). Each primer contains a site specific point mutation sequence, so mutations occur in the cloned sequence during PCR. Primers used for mutagenesis are shown in Table 6 below.

gene Mutation location primer Sequence number TSC-1 C64T R22W TSC-1 R22W-F gtcacgtcgtcccacacacccagcatg 29 TSC-1 R22W-R catgctgggtgtgtgggacgacgtgac 30 C610T R204C TSC-1 R204C-F ctttcatactgtaatgagaacacaaaaaggagacgaagttgca 31 TSC-1 R204C-R tgcaacttcgtctcctttttgtgttctcattacagtatgaaag 32 TSC-2 G4639A V1547I TSC-2 V1547I-F tctccaacatacaggatggcgatcttgtgggtg 33 TSC-2 V1547I-R cacccacaagatcgccatcctgtatgttggaga 34 AKT3 G740A R247H AKT3 R247H-F caccatagaaacgtgtgtggtcctcagagaacacc 35 AKT3 R247H-R ggtgttctctgaggaccacacacgtttctatggtg 36

8-2. Cell culture, transduction ( transfection ) And Western Blot

In order to confirm whether the TSC-1, TSC-2 and AKT3 genetic mutations overactivate mTOR, HEK293T cells were transduced with wild-type and mutant vectors, and phosphorylation of the S6K protein, a well-known marker of the mTOR gene, was confirmed by Western blot.

Specifically, HEK293T cells (thermoscientific) were cultured in DMEM (Dulbecco's Modified Eagle's Medium) medium containing 10% FBS under 37, 5% CO2 conditions. The cells were empty flag-tagged vector, HA-tagged TSC1 wild type, HA-tagged TSC2 wild type, HA-tagged AKT3 wild type, HA-tagged TSC1 mutant, HA using jetPRIME transfection reagent (Polyplus, France). -tagged TSC2 mutant and HA-tagged AKT3 mutant were respectively transduced.

Cells were serum-starved with 0.1% FBS in DMEM medium for 24 hours after transduction, and cultured for 1 hour _{in PBS containing 1 mM MgCl 2} and CaCl ₂ under 37, 5% CO _{2 conditions.} Cells were lyseed in PBS containing 1% of Triton X-100, Halt protease, and phosphatase inhibitor cocktail (78440, Thermo Scientific, USA). The protein was resolved by SDS-PAGE and transferred to a PVDF membrane (Milipore, USA). The membrane was blocked with 3% BSA in TBS containing 0.1% Tween 20 (TBST). Then, washing was repeated 4 times with TBST. The membrane was anti-phospho-S6-ribosomal protein (5364, Cell Signaling Technology, USA) diluted to 1/1000, anti-S6 ribosomal protein (2217, Cell Signaling Technology, USA) and anti-flag M2 (8164, Cell Signaling Technology). , USA) and incubated overnight at 4 in TBST, respectively. After incubation, the membrane was repeatedly washed 4 times with TBST. Then, it was incubated for 2 hours at room temperature with HRP-linked anti-rabbit or anti-mouse secondary antibodies (7074, Cell Signaling Technology, USA) diluted to 1/5000. TBST was washed, and immunodetection was performed using ECL reaction reagent.

8-3. Variant To expressing cells Rapamycin Processing and Western Blot

In Example 8-2, the cells expressing the mutant were treated with rapamycin, and then the change in phosphorylation of the S6K protein was confirmed.

Specifically, in the same manner as in Example 8-2, mTOR, TSC1, TSC2, and AKT3 mutants were each transduced into HEK293T cells, starved for 24 hours with Empty DMEM in DMEM medium for 24 hours, and 1 mM MgCl ₂ and CaCl ₂ Rapamycin was treated with incubation for 1 hour under conditions of 37, 5% CO _{2 in PBS containing.} Thereafter, Western blot was performed in the same manner as in Example 2-2.

8- 4. Experiment result

According to Examples 8-2 and 8-3, the p.Arg22Trp and p.Arg204Cys genetic mutations of TSC-1, the p.Val1547Ile genetic mutation of TSC-2, and the p.Arg247His genetic mutation of AKT3 induce the activation of mTOR. To confirm, a vector containing TSC1, TSC2, AKT3 wild type and mutant were transduced into HEK293T cells, and phosphorylation of S6K protein, a well-known marker of mTOR gene, was confirmed by Western blot, and rapamycin was added to cells expressing the mutant. The results of confirming the change in phosphorylation of the S6K protein after treatment are shown in FIGS. 15 to 17, and the results for each mutant gene are as follows.

(1) Confirmation of TSC-1 mutant activity in cells

As can be seen in FIG. 15, it was confirmed that phosphorylation of S6K protein was increased in cells expressing the variant TSC-1, and phosphorylation was decreased after treatment with rapamycin.

(2) Confirmation of TSC-2 mutant activity in cells

As can be seen from FIG. 16, it was confirmed that phosphorylation of S6K protein was increased in cells expressing mutant TSC-2, and phosphorylation was decreased after treatment with rapamycin.

(3) Confirmation of the activity of the AKT3 variant in cells

As can be seen from FIG. 17, it was confirmed that phosphorylation of S6K protein was increased in cells expressing the variant AKT3, and phosphorylation was decreased after treatment with rapamycin.

Example 9: TSC1 And TSC2 Mutant mTOR Confirmation of activation of signaling

9-1: Immunoprecipitation assay

Immunoprecipitation assay was performed to determine whether the TSC1 and TSC2 variants inhibited the formation of the TSC complex. Protein A after overnight incubation with an anti-TSC2 antibody (3990, Cell signaling Technology, USA) or an anti-myc antibody (2276, cell signaling technology, USA) prepared in the same manner as in Example 8-3. +G magnetic bead was added and incubated for 2 hours. After washing 3 times with PBS containing 1% Triton-X100 and incubated for 10 minutes in 37 SDS buffer. After elution of the protein, it was dissolved in SDS/PAGE gel and adsorbed onto the PVDF membrane. Blotting was performed in the same manner as in Example 2-3.

Fig. 18 shows the experimental results. It was confirmed that the p.Arg22Trp and p.Arg204Cys variants of TSC-1 had weakened binding to the wild-type TSC-2 protein. Through this, it was found that the TSC1 mutant inhibited the formation of the TSC complex and induces mTOR overactivity.

9-2: GTP - agarose pull down assay

After using lysis buffer (20 mM Tris-HCl pH: 7.5, 5 mM MgCl2, 2 mM PMSF, 20 ?g/mL leupeptin, 10 ?g/mL aprotinin, 150 mM NaCl and 0.1% Triton X-100), Cells were lysed by adding 15 seconds. Thereafter, the cells were centrifuged at 4° C. and 13000 g to separate the supernatant. This supernatant was incubated for 30 minutes in GTP-agarose beads (Sigma-Aldrich, cat no. G9768) at a temperature of 4°C and 100 ul. After that, the bead was washed with lysis buffer and incubated overnight. After extracting the GTP-bound protein, it was confirmed by immunoblot.

When TSC2 is overexpressed, the GTP-bound Rheb protein, which is the substrate of TSC2, should be reduced, but in the case of the TSC2 p.Val1547Ile variant, the function of the GAP (GTPase activating protein) of TSC2 decreases, so that the GTP-bound Rheb protein does not decrease. It could be confirmed (Fig. 19). Through this, it was found that the TSC2 mutant induces GAP domain dysfunction and induces mTOR pathway activity.

Example 10: Variant Confirmation of changes in phosphorylation of S6K protein by drugs using mTOR-expressing cells

10-1. Variant mTOR Expressing cells

The mutant mTOR-expressing cells were treated with drugs (rapamycin, everolimus, compounds of Formulas 1 to 4), and then the change in phosphorylation of the S6K protein was confirmed.

In the same manner as in Examples 8-2 and 8-3, HEK293T cells were transduced, serum-starved with 0.1% FBS in DMEM medium for 24 hours, and 37 in PBS containing 1 mM MgCl2 and CaCl2. , After incubation for 1 hour under 5% CO2 conditions, rapamycin, everolimus, compounds of formulas 1 to 4 (Torin1, INK128, AZD8055, GSK2126458) were treated: Torin was obtained from TOCRIS, INK128, AZD8055, GSK2126458 was obtained from Selleckchem, and Everolimus was obtained from LC laboratory. Thereafter, Western blot was performed in the same manner as in Example 2-4.

As can be seen in FIGS. 20 and 21, it was confirmed that phosphorylation of the S6K protein was inhibited by rapamycin in cells expressing the mutant mTOR. Specifically, FIG. 20 shows the results of phosphorylation of S6K protein after rifamycin treatment for mTOR variants C1483R, L2427P, and L2427Q. 21 shows the results of phosphorylation of S6K protein after treatment with rifamycin in cells expressing mTOR variant Y1450D.

22 shows the results of phosphorylation of S6 protein after treatment with a concentration of rifamycin in cells expressing mTOR variant L2427P at 0, 25, 50, 100, 200 nanomolar (nM).

After each treatment with everolimus and the compounds of Formulas 1 to 4, changes in phosphorylation of the S6K protein were confirmed. As can be seen in FIG. 22, it was confirmed that phosphorylation of S6 protein in cells expressing the mutant mTOR was inhibited by everolimus and compounds of Formulas 1 to 4. It was confirmed that phosphorylation of the S6 protein was clearly reduced at a concentration of 50 nM or more.

10-2. variety mTOR Inhibitor treatment S6K Confirmation of changes in protein phosphorylation

In the same manner as in Example 9-1, a change in phosphorylation of the S6K protein was confirmed after treatment with rapamycin, everolimus, compounds of Formulas 1 to 4) as drugs to cells expressing various mutant mTORs. Specifically, the mTOR variants used in the experiment were R624H, Y1450D, C1483R, R1709H, Y1977K, S2215F, L2427P and L2427Q.

Specifically, cells expressing the mutant mTOR were treated with everolimus and compounds of Formulas 1 to 4, respectively, and then a change in phosphorylation of the S6K protein was confirmed. As can be seen from the figure, it was confirmed that phosphorylation of S6K protein in all cells expressing the mutant mTOR was inhibited by everolimus and compounds of Formulas 1 to 4, and the results are shown in FIGS. 23A and 23B.

Example 11: Confirmation of changes in phosphorylation of S6K protein by drugs using cells expressing TSC1 or TSC 2 mutant

In the same manner as in Example 8, HEK293T cells were transduced with TSC1 or TSC 2 variants, serum-starved with 0.1% FBS in DMEM medium for 24 hours, and 37, 5% in PBS containing 1 mM MgCl2 and CaCl2. Incubated for 1 hour under CO2 conditions.

Then, rapamycin, everolimus, compounds of formulas 1 to 4 (Torin1, INK128, AZD8055, GSK2126458) were treated: Torin was obtained from TOCRIS, INK128, AZD8055, GSK2126458 were obtained from Selleckchem, and everolimus Was obtained from the LC laboratory. Thereafter, Western blot was performed in the same manner as in Example 10.

After treatment with rapamycin in the cells expressing the mutant TSC1 or TSC2, the change in phosphorylation of the S6K protein was confirmed, and the results for the mutant TSC1 are shown in Figs. 24A and 24B, and the results for the mutant TSC2 are shown. It is shown in 25a and 25b.

As shown in FIGS. 24A and 24B and FIGS. 25A and 25B, it was confirmed that phosphorylation of S6K protein was inhibited by rapamycin in cells expressing mutant TSC1 or TSC2. Cells expressing the mutant TSC1 or TSC2 were treated with everolimus and compounds of Formulas 1 to 4, respectively, and changes in phosphorylation of the S6K protein were confirmed. As can be seen from the figure, it was confirmed that phosphorylation of S6K protein in cells expressing mutant TSC1 or TSC2 was inhibited by everolimus and compounds of Formulas 1 to 4.

Example 12: FCD Immunostaining of sections of patient's brain tissue

To determine whether FCDII patients with genetic mutation exhibit mTOR overactivity, immunostaining was performed on brain tissue sections of FCD patients with p.Leu2427Pro genetic mutation with antibodies against S6 phosphorylated protein and NeuN (neural cell marker).

Non-MCD brain specimens were collected in the operating room from the tumor free margin of patients with glioblastoma and confirmed pathologically as normal brain without tumors. Surgical tissue block was fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 20% buffered sucrose, and gelatin-embedded tissue block (7.5% gelatin in 10%). sucrose/PB) and stored at -80°C. The cryostat-cut section (10 μm thick) was collected and placed on a glass slide. Paraffin-removed FFPE slides were recovered with citrate buffer. After that, it was blocked with PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) for one hour at room temperature and stained with the following antibodies: Rabbit antibody against phosphorylated S6 ribosomal protein ( rabbit antibody to phosphorylated S6 ribosomal protein) (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology) and mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Samples were washed with PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and rabbit. Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen). DAPI contained in a mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Leica DMI3000 B inverted microscope. The number of cells positive for NeuN was measured using a 10x objective lens; 4 to 5 fields per subject were obtained within a neuron-rich regine, and more than 100 cells per area were recorded. The number of DAPI-positive cells represents the total number of cells. Neuronal cell size was measured using an automated counting protocol of ImageJ software (http://rsbweb.nih.gov/ij/) in NeuN-positive cells, and the experimental results are shown in FIGS. 26A to 26A. Shown in 26f.

26A to 26F, it was confirmed that the number of neurons with phosphorylated S6 protein was increased in FCD64,81,94,98,123 patients with TSC1 and TSC2 genetic mutations. On the other hand, this increase was not observed in the non-FCD brain tissue. As can be seen in FIGS. 26b and 26d, the proportion of cells with increased S6 phosphorylation increased, and as can be seen in FIGS. 26e and 26f, the size of neurons with increased phosphorylation of S6 protein in the pathological tissue was measured It was confirmed that it increased.

Example 13: TSC1 or TSC2 mouse Model making

13-1: TSC1 or TSC2 Target doing CRISPR / Cas9 vector production

The pX330 plasmid (Addgene, #42230) was purchased and used as an initial template. The BbsI restriction enzyme site (GAAGAC) of the sgRNA (single guide ribonucleotide) cloning site was converted to BsaI (GGTCTC) using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Thereafter, sgRNA targeting TSC1 and TSC2 was inserted, respectively, and the base sequence is as follows.

TSC1: 5'-TGCTGGACTCCTCCACACTG-3' (SEQ ID NO: 37)

TSC2: 5'-AATCCCAGGTGTGCAGAAGG-3' (SEQ ID NO: 38)

Subsequently, to make a plasmid (U6-sgRNA-Cas9-IRES-mCherry) containing an mcherry fluorescent reporter, the IRES3-mCherry-CL plasmid was used as a template and after PCR amplification, it was inserted between the Cas9 sequence and the NLS sequence of the pX330 plasmid.

13-2. Mouse model production

Pregnant mice (E14) (Damul Science) were anesthetized with isoflurane (0.4 L/min of oxygen and isoflurane vaporizer gauge 3 during surgery operation). U6-sgRNA-Cas9-IRES-mCherry plasmid targeting TSC1 or TSC2 prepared in Example 19-1 and red fluorescence in the lateral ventricle of an individual embryo with the uterine horn exposed To enhance the pCAG-Dsred plasmid (addgene #11151) was purchased and diluted at a ratio of 3:1 and used. 2 ug/ml of Fast Green (F7252, Sigma, USA) combined with 2 to 3 ug of the diluted two plasmids were injected using a pulled glass capillary. The plasmid was electroporated by discharging 50V to the embryo's head with an ECM830 eletroporator (BTX-harvard apparatus), which is a 5th electric pulse of 100ms at an interval of 900ms. After the electroporated embryo was born, only mice expressing fluorescence were classified by flashlight (Electron Microscopy Science, USA).

13-3: TSC1 or TSC2 Neuron migration analysis in mouse model

Brains were harvested from adult mice (P>56) prepared in Example 13-2, fixed in phosphate-buffered (PB) 4% paraformaldehyde prepared overnight, and frozen overnight in 30% buffered sucrose, and gelatin-embedded tissue It was stored at -80 as a lump (7.5% gelatin in 10% sucrose/PB).

Frozen sections (30 um thick) were collected and placed on a glass slide. DAPI contained in a mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Zeiss LSM780 confocal microscope. Fluorescence intensity, which shows the distribution of electroporated cells in the cortex, is converted to a gray value and from LayerII/III to LayerV/VI ImageJ software (http://rsbweb.nih.gov/) It was measured using ij/).

As can be seen in FIGS. 27A and 27B, it was confirmed that dsRed-positive neurons in the brain tissue section of the TSC mouse model were decreased in Layer II/III and increased in cerebral Layer IV and Layer V/VI. Through this, it was proved that there is a problem in the movement of nerve cells.

13-4: Video-Electroencephalography (Video- Electroencephalography monitoring)

After the mouse was wet (>3 weeks), after checking whether seizure occurred through video monitoring only, an operation was performed to place an electrode to measure EEG. The electrodes were positioned on the epidural layer, and based on the zenith (Bregma), two in the frontal lobe (AP+1.8mm, ML?1.5mm) and two in the temporal lobe (AP-2.4mm, ML? 2.4mm), a total of 5 electrodes were placed in the cerebellum. After a recovery period of 4 days, measurements were performed for 2 to 5 days per mouse (6 hours a day) from 6 pm to 2 am. The signal was amplified using an RHD2000 amplifier, board (Intan technoloties, USA) and analyzed using MATLAB EEGLAB (http://sccn.ucsd.edu/eeglab).

Rats with CRISPR/Cas9 plasmid removed TSC1 or TSC2 gene locally showed spontaneous seizures with epileptic waves, and epileptic waves showed high-amplitude high-frequency, high-amplitude ultra-slow, and low-amplitude high-frequency. Mice exhibiting such spontaneous seizures showed systemic tonic-interstitial seizures consisting of tense and post-interticular seizures, which were confirmed to be similar to those of FCDII patients. In addition, it was confirmed that the tension EEG shows a low-voltage and high-frequency tuned multi-frequency, the interphase EEG shows a constant form of a high voltage, and the post-seizure shows a tuned attenuation amplitude. The seizure frequency was about 10 times a day.

13-5: TSC1 or TSC2 Neuron size analysis in mouse model

After EEG monitoring, the brain was excised by perfusion with phosphate-buffered (PB) 4% paraformalde-hyde using Masterflex compact peristaltic pump (cole-parmer internation-al, USA). It was fixed in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, protected from freezing overnight in 30% buffered sucrose, and stored at -80 °C as a gelatin-embedded tissue mass (7.5% gelatin in 10% sucrose/PB). Frozen sections (30 um thick) were collected and placed on a glass slide. Blocked with PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) for one hour at room temperature and stained with the following antibodies: mouse antibody to NeuN (1:500 dilution; MAB377, Millipore). Samples were washed with PBS and stained with the following secondary antibody: Alexa Fluor 488-conjugated goat antibody to mouse (1:200 dilution; A11008, Invitrogen), Mounting DAPI contained in a mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Zeiss LSM510 confocal microscope. The size of nerve cells was measured using ImageJ soft-ware (http://rsbweb.nih.gov/ij/).

In mice with the TSC1 or TSC2 gene removed locally using the CRISPR/Cas9 plasmid, the size of the neurons increased significantly compared to the normal neurons, but the mouse neurons electroporated only the plasmid without sgRNA showed no change in size. Confirmed. This is the same pattern as the dysmorphic neuron in patients with cortical developmental malformations.

Example 14: TSC2 Confirmation of spontaneous seizure changes caused by drug administration in mouse model

Changes were confirmed after rapamycin was administered to the animal model showing spontaneous seizures. Specifically, rapamycin (LC Labs, USA) was diluted to 20 mg/ml in 100% ethanol to prepare a stock solution and then stored at -20. Before the injection of rapamycin, the stock solution was diluted in 5% polyethleneglycol400 and 5% Tween80 to prepare a 1 mg/ml rapamycin and 4% ethanol solution. The prepared solution was administered by intraperitoneal injection at a concentration of 1 to 10 mg/kg for 2 weeks (10 mg/kg/d intraperitoneal injection, for 2 weeks).

As can be seen from FIG. 28, it was confirmed that spontaneous seizures hardly occurred in the animal model due to the administration of rapamycin.

<110> KOREA ADVANCED INSTITUTE OF SCIENCE AND TECHNOLOGY Yonsei University, University-Industry Foundation (UIF) <120> Composition for diagnosis or treatment of intractable epilepsy <130> DPP20177584KR <160> 38 <170> KopatentIn 1.71 <210> 1 <211> 7650 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1)..(7650) <223> wild type mTOR <400> 1 atgcttggaa ccggacctgc cgccgccacc accgctgcca ccacatctag caatgtgagc 60 gtcctgcagc agtttgccag tggcctaaag agccggaatg aggaaaccag ggccaaagcc 120 gccaaggagc tccagcacta tgtcaccatg gaactccgag agatgagtca agaggagtct 180 actcgcttct atgaccaact gaaccatcac atttttgaat tggtttccag ctcagatgcc 240 aatgagagga aaggtggcat cttggccata gctagcctca taggagtgga aggtgggaat 300 gccacccgaa ttggcagatt tgccaactat cttcggaacc tcctcccctc caatgaccca 360 gttgtcatgg aaatggcatc caaggccatt ggccgtcttg ccatggcagg ggacactttt 420 accgctgagt acgtggaatt tgaggtgaag cgagccctgg aatggctggg tgctgaccgc 480 aatgagggcc ggagacatgc agctgtcctg gttctccgtg agctggccat cagcgtccct 540 accttcttct tccagcaagt gcaacccttc tttgacaaca tttttgtggc cgtgtgggac 600 cccaaacagg ccatccgtga gggagctgta gccgcccttc gtgcctgtct gattctcaca 660 acccagcgtg agccgaagga gatgcagaag cctcagtggt acaggcacac atttgaagaa 720 gcagagaagg gatttgatga gaccttggcc aaagagaagg gcatgaatcg ggatgatcgg 780 atccatggag ccttgttgat ccttaacgag ctggtccgaa tcagcagcat ggagggagag 840 cgtctgagag aagaaatgga agaaatcaca cagcagcagc tggtacacga caagtactgc 900 aaagatctca tgggcttcgg aacaaaacct cgtcacatta cccccttcac cagtttccag 960 gctgtacagc cccagcagtc aaatgccttg gtggggctgc tggggtacag ctctcaccaa 1020 ggcctcatgg gatttgggac ctcccccagt ccagctaagt ccaccctggt ggagagccgg 1080 tgttgcagag acttgatgga ggagaaattt gatcaggtgt gccagtgggt gctgaaatgc 1140 aggaatagca agaactcgct gatccaaatg acaatcctta atttgttgcc ccgcttggct 1200 gcattccgac cttctgcctt cacagatacc cagtatctcc aagataccat gaaccatgtc 1260 ctaagctgtg tcaagaagga gaaggaacgt acagcggcct tccaagccct ggggctactt 1320 tctgtggctg tgaggtctga gtttaaggtc tatttgcctc gcgtgctgga catcatccga 1380 gcggccctgc ccccaaagga cttcgcccat aagaggcaga aggcaatgca ggtggatgcc 1440 acagtcttca cttgcatcag catgctggct cgagcaatgg ggccaggcat ccagcaggat 1500 atcaaggagc tgctggagcc catgctggca gtgggactaa gccctgccct cactgcagtg 1560 ctctacgacc tgagccgtca gattccacag ctaaagaagg acattcaaga tgggctactg 1620 aaaatgctgt ccctggtcct tatgcacaaa ccccttcgcc acccaggcat gcccaagggc 1680 ctggcccatc agctggcctc tcctggcctc acgaccctcc ctgaggccag cgatgtgggc 1740 agcatcactc ttgccctccg aacgcttggc agctttgaat ttgaaggcca ctctctgacc 1800 caatttgttc gccactgtgc ggatcatttc ctgaacagtg agcacaagga gatccgcatg 1860 gaggctgccc gcacctgctc ccgcctgctc acaccctcca tccacctcat cagtggccat 1920 gctcatgtgg ttagccagac cgcagtgcaa gtggtggcag atgtgcttag caaactgctc 1980 gtagttggga taacagatcc tgaccctgac attcgctact gtgtcttggc gtccctggac 2040 gagcgctttg atgcacacct ggcccaggcg gagaacttgc aggccttgtt tgtggctctg 2100 aatgaccagg tgtttgagat ccgggagctg gccatctgca ctgtgggccg actcagtagc 2160 atgaaccctg cctttgtcat gcctttcctg cgcaagatgc tcatccagat tttgacagag 2220 ttggagcaca gtgggattgg aagaatcaaa gagcagagtg cccgcatgct ggggcacctg 2280 gtctccaatg ccccccgact catccgcccc tacatggagc ctattctgaa ggcattaatt 2340 ttgaaactga aagatccaga ccctgatcca aacccaggtg tgatcaataa tgtcctggca 2400 acaataggag aattggcaca ggttagtggc ctggaaatga ggaaatgggt tgatgaactt 2460 tttattatca tcatggacat gctccaggat tcctctttgt tggccaaaag gcaggtggct 2520 ctgtggaccc tgggacagtt ggtggccagc actggctatg tagtagagcc ctacaggaag 2580 taccctactt tgcttgaggt gctactgaat tttctgaaga ctgagcagaa ccagggtaca 2640 cgcagagagg ccatccgtgt gttagggctt ttaggggctt tggatcctta caagcacaaa 2700 gtgaacattg gcatgataga ccagtcccgg gatgcctctg ctgtcagcct gtcagaatcc 2760 aagtcaagtc aggattcctc tgactatagc actagtgaaa tgctggtcaa catgggaaac 2820 ttgcctctgg atgagttcta cccagctgtg tccatggtgg ccctgatgcg gatcttccga 2880 gaccagtcac tctctcatca tcacaccatg gttgtccagg ccatcacctt catcttcaag 2940 tccctgggac tcaaatgtgt gcagttcctg ccccaggtca tgcccacgtt ccttaacgtc 3000 attcgagtct gtgatggggc catccgggaa tttttgttcc agcagctggg aatgttggtg 3060 tcctttgtga agagccacat cagaccttat atggatgaaa tagtcaccct catgagagaa 3120 ttctgggtca tgaacacctc aattcagagc acgatcattc ttctcattga gcaaattgtg 3180 gtagctcttg ggggtgaatt taagctctac ctgccccagc tgatcccaca catgctgcgt 3240 gtcttcatgc atgacaacag cccaggccgc attgtctcta tcaagttact ggctgcaatc 3300 cagctgtttg gcgccaacct ggatgactac ctgcatttac tgctgcctcc tattgttaag 3360 ttgtttgatg cccctgaagc tccactgcca tctcgaaagg cagcgctaga gactgtggac 3420 cgcctgacgg agtccctgga tttcactgac tatgcctccc ggatcattca ccctattgtt 3480 cgaacactgg accagagccc agaactgcgc tccacagcca tggacacgct gtcttcactt 3540 gtttttcagc tggggaagaa gtaccaaatt ttcattccaa tggtgaataa agttctggtg 3600 cgacaccgaa tcaatcatca gcgctatgat gtgctcatct gcagaattgt caagggatac 3660 acacttgctg atgaagagga ggatcctttg atttaccagc atcggatgct taggagtggc 3720 caaggggatg cattggctag tggaccagtg gaaacaggac ccatgaagaa actgcacgtc 3780 agcaccatca acctccaaaa ggcctggggc gctgccagga gggtctccaa agatgactgg 3840 ctggaatggc tgagacggct gagcctggag ctgctgaagg actcatcatc gccctccctg 3900 cgctcctgct gggccctggc acaggcctac aacccgatgg ccagggatct cttcaatgct 3960 gcatttgtgt cctgctggtc tgaactgaat gaagatcaac aggatgagct catcagaagc 4020 atcgagttgg ccctcacctc acaagacatc gctgaagtca cacagaccct cttaaacttg 4080 gctgaattca tggaacacag tgacaagggc cccctgccac tgagagatga caatggcatt 4140 gttctgctgg gtgagagagc tgccaagtgc cgagcatatg ccaaagcact acactacaaa 4200 gaactggagt tccagaaagg ccccacccct gccattctag aatctctcat cagcattaat 4260 aataagctac agcagccgga ggcagcggcc ggagtgttag aatatgccat gaaacacttt 4320 ggagagctgg agatccaggc tacctggtat gagaaactgc acgagtggga ggatgccctt 4380 gtggcctatg acaagaaaat ggacaccaac aaggacgacc cagagctgat gctgggccgc 4440 atgcgctgcc tcgaggcctt gggggaatgg ggtcaactcc accagcagtg ctgtgaaaag 4500 tggaccctgg ttaatgatga gacccaagcc aagatggccc ggatggctgc tgcagctgca 4560 tggggtttag gtcagtggga cagcatggaa gaatacacct gtatgatccc tcgggacacc 4620 catgatgggg cattttatag agctgtgctg gcactgcatc aggacctctt ctccttggca 4680 caacagtgca ttgacaaggc cagggacctg ctggatgctg aattaactgc gatggcagga 4740 gagagttaca gtcgggcata tggggccatg gtttcttgcc acatgctgtc cgagctggag 4800 gaggttatcc agtacaaact tgtccccgag cgacgagaga tcatccgcca gatctggtgg 4860 gagagactgc agggctgcca gcgtatcgta gaggactggc agaaaatcct tatggtgcgg 4920 tcccttgtgg tcagccctca tgaagacatg agaacctggc tcaagtatgc aagcctgtgc 4980 ggcaagagtg gcaggctggc tcttgctcat aaaactttag tgttgctcct gggagttgat 5040 ccgtctcggc aacttgacca tcctctgcca acagttcacc ctcaggtgac ctatgcctac 5100 atgaaaaaca tgtggaagag tgcccgcaag atcgatgcct tccagcacat gcagcatttt 5160 gtccagacca tgcagcaaca ggcccagcat gccatcgcta ctgaggacca gcagcataag 5220 caggaactgc acaagctcat ggcccgatgc ttcctgaaac ttggagagtg gcagctgaat 5280 ctacagggca tcaatgagag cacaatcccc aaagtgctgc agtactacag cgccgccaca 5340 gagcacgacc gcagctggta caaggcctgg catgcgtggg cagtgatgaa cttcgaagct 5400 gtgctacact acaaacatca gaaccaagcc cgcgatgaga agaagaaact gcgtcatgcc 5460 agcggggcca acatcaccaa cgccaccact gccgccacca cggccgccac tgccaccacc 5520 actgccagca ccgagggcag caacagtgag agcgaggccg agagcaccga gaacagcccc 5580 accccatcgc cgctgcagaa gaaggtcact gaggatctgt ccaaaaccct cctgatgtac 5640 acggtgcctg ccgtccaggg cttcttccgt tccatctcct tgtcacgagg caacaacctc 5700 caggatacac tcagagttct caccttatgg tttgattatg gtcactggcc agatgtcaat 5760 gaggccttag tggagggggt gaaagccatc cagattgata cctggctaca ggttatacct 5820 cagctcattg caagaattga tacgcccaga cccttggtgg gacgtctcat tcaccagctt 5880 ctcacagaca ttggtcggta ccacccccag gccctcatct acccactgac agtggcttct 5940 aagtctacca cgacagcccg gcacaatgca gccaacaaga ttctgaagaa catgtgtgag 6000 cacagcaaca ccctggtcca gcaggccatg atggtgagcg aggagctgat ccgagtggcc 6060 atcctctggc atgagatgtg gcatgaaggc ctggaagagg catctcgttt gtactttggg 6120 gaaaggaacg tgaaaggcat gtttgaggtg ctggagccct tgcatgctat gatggaacgg 6180 ggcccccaga ctctgaagga aacatccttt aatcaggcct atggtcgaga tttaatggag 6240 gcccaagagt ggtgcaggaa gtacatgaaa tcagggaatg tcaaggacct cacccaagcc 6300 tgggacctct attatcatgt gttccgacga atctcaaagc agctgcctca gctcacatcc 6360 ttagagctgc aatatgtttc cccaaaactt ctgatgtgcc gggaccttga attggctgtg 6420 ccaggaacat atgaccccaa ccagccaatc attcgcattc agtccatagc accgtctttg 6480 caagtcatca catccaagca gaggccccgg aaattgacac ttatgggcag caacggacat 6540 gagtttgttt tccttctaaa aggccatgaa gatctgcgcc aggatgagcg tgtgatgcag 6600 ctcttcggcc tggttaacac ccttctggcc aatgacccaa catctcttcg gaaaaacctc 6660 agcatccaga gatacgctgt catcccttta tcgaccaact cgggcctcat tggctgggtt 6720 ccccactgtg acacactgca cgccctcatc cgggactaca gggagaagaa gaagatcctt 6780 ctcaacatcg agcatcgcat catgttgcgg atggctccgg actatgacca cttgactctg 6840 atgcagaagg tggaggtgtt tgagcatgcc gtcaataata cagctgggga cgacctggcc 6900 aagctgctgt ggctgaaaag ccccagctcc gaggtgtggt ttgaccgaag aaccaattat 6960 acccgttctt tagcggtcat gtcaatggtt gggtatattt taggcctggg agatagacac 7020 ccatccaacc tgatgctgga ccgtctgagt gggaagatcc tgcacattga ctttggggac 7080 tgctttgagg ttgctatgac ccgagagaag tttccagaga agattccatt tagactaaca 7140 agaatgttga ccaatgctat ggaggttaca ggcctggatg gcaactacag aatcacatgc 7200 cacacagtga tggaggtgct gcgagagcac aaggacagtg tcatggccgt gctggaagcc 7260 tttgtctatg accccttgct gaactggagg ctgatggaca caaataccaa aggcaacaag 7320 cgatcccgaa cgaggacgga ttcctactct gctggccagt cagtcgaaat tttggacggt 7380 gtggaacttg gagagccagc ccataagaaa acggggacca cagtgccaga atctattcat 7440 tctttcattg gagacggttt ggtgaaacca gaggccctaa ataagaaagc tatccagatt 7500 attaacaggg ttcgagataa gctcactggt cgggacttct ctcatgatga cactttggat 7560 gttccaacgc aagttgagct gctcatcaaa caagcgacat cccatgaaaa cctctgccag 7620 tgctatattg gctggtgccc tttctggtaa 7650 <210> 2 <211> 2549 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE <222> (1)..(2549) <223> wild type mTOR <400> 2 Met Leu Gly Thr Gly Pro Ala Ala Ala Thr Thr Ala Ala Thr Thr Ser 1 5 10 15 Ser Asn Val Ser Val Leu Gln Gln Phe Ala Ser Gly Leu Lys Ser Arg 20 25 30 Asn Glu Glu Thr Arg Ala Lys Ala Ala Lys Glu Leu Gln His Tyr Val 35 40 45 Thr Met Glu Leu Arg Glu Met Ser Gln Glu Glu Ser Thr Arg Phe Tyr 50 55 60 Asp Gln Leu Asn His His Ile Phe Glu Leu Val Ser Ser Ser Asp Ala 65 70 75 80 Asn Glu Arg Lys Gly Gly Ile Leu Ala Ile Ala Ser Leu Ile Gly Val 85 90 95 Glu Gly Gly Asn Ala Thr Arg Ile Gly Arg Phe Ala Asn Tyr Leu Arg 100 105 110 Asn Leu Leu Pro Ser Asn Asp Pro Val Val Met Glu Met Ala Ser Lys 115 120 125 Ala Ile Gly Arg Leu Ala Met Ala Gly Asp Thr Phe Thr Ala Glu Tyr 130 135 140 Val Glu Phe Glu Val Lys Arg Ala Leu Glu Trp Leu Gly Ala Asp Arg 145 150 155 160 Asn Glu Gly Arg Arg His Ala Ala Val Leu Val Leu Arg Glu Leu Ala 165 170 175 Ile Ser Val Pro Thr Phe Phe Phe Gln Gln Val Gln Pro Phe Phe Asp 180 185 190 Asn Ile Phe Val Ala Val Trp Asp Pro Lys Gln Ala Ile Arg Glu Gly 195 200 205 Ala Val Ala Ala Leu Arg Ala Cys Leu Ile Leu Thr Thr Gln Arg Glu 210 215 220 Pro Lys Glu Met Gln Lys Pro Gln Trp Tyr Arg His Thr Phe Glu Glu 225 230 235 240 Ala Glu Lys Gly Phe Asp Glu Thr Leu Ala Lys Glu Lys Gly Met Asn 245 250 255 Arg Asp Asp Arg Ile His Gly Ala Leu Leu Ile Leu Asn Glu Leu Val 260 265 270 Arg Ile Ser Met Glu Gly Glu Arg Leu Arg Glu Glu Met Glu Glu 275 280 285 Ile Thr Gln Gln Gln Leu Val His Asp Lys Tyr Cys Lys Asp Leu Met 290 295 300 Gly Phe Gly Thr Lys Pro Arg His Ile Thr Pro Phe Thr Ser Phe Gln 305 310 315 320 Ala Val Gln Pro Gln Gln Ser Asn Ala Leu Val Gly Leu Leu Gly Tyr 325 330 335 Ser Ser His Gln Gly Leu Met Gly Phe Gly Thr Ser Pro Ser Pro Ala 340 345 350 Lys Ser Thr Leu Val Glu Ser Arg Cys Cys Arg Asp Leu Met Glu Glu 355 360 365 Lys Phe Asp Gln Val Cys Gln Trp Val Leu Lys Cys Arg Asn Ser Lys 370 375 380 Asn Ser Leu Ile Gln Met Thr Ile Leu Asn Leu Leu Pro Arg Leu Ala 385 390 395 400 Ala Phe Arg Pro Ser Ala Phe Thr Asp Thr Gln Tyr Leu Gln Asp Thr 405 410 415 Met Asn His Val Leu Ser Cys Val Lys Lys Glu Lys Glu Arg Thr Ala 420 425 430 Ala Phe Gln Ala Leu Gly Leu Leu Ser Val Ala Val Arg Ser Glu Phe 435 440 445 Lys Val Tyr Leu Pro Arg Val Leu Asp Ile Ile Arg Ala Ala Leu Pro 450 455 460 Pro Lys Asp Phe Ala His Lys Arg Gln Lys Ala Met Gln Val Asp Ala 465 470 475 480 Thr Val Phe Thr Cys Ile Ser Met Leu Ala Arg Ala Met Gly Pro Gly 485 490 495 Ile Gln Gln Asp Ile Lys Glu Leu Leu Glu Pro Met Leu Ala Val Gly 500 505 510 Leu Ser Pro Ala Leu Thr Ala Val Leu Tyr Asp Leu Ser Arg Gln Ile 515 520 525 Pro Gln Leu Lys Lys Asp Ile Gln Asp Gly Leu Leu Lys Met Leu Ser 530 535 540 Leu Val Leu Met His Lys Pro Leu Arg His Pro Gly Met Pro Lys Gly 545 550 555 560 Leu Ala His Gln Leu Ala Ser Pro Gly Leu Thr Thr Leu Pro Glu Ala 565 570 575 Ser Asp Val Gly Ser Ile Thr Leu Ala Leu Arg Thr Leu Gly Ser Phe 580 585 590 Glu Phe Glu Gly His Ser Leu Thr Gln Phe Val Arg His Cys Ala Asp 595 600 605 His Phe Leu Asn Ser Glu His Lys Glu Ile Arg Met Glu Ala Ala Arg 610 615 620 Thr Cys Ser Arg Leu Leu Thr Pro Ser Ile His Leu Ile Ser Gly His 625 630 635 640 Ala His Val Val Ser Gln Thr Ala Val Gln Val Val Ala Asp Val Leu 645 650 655 Ser Lys Leu Leu Val Val Gly Ile Thr Asp Pro Asp Pro Asp Ile Arg 660 665 670 Tyr Cys Val Leu Ala Ser Leu Asp Glu Arg Phe Asp Ala His Leu Ala 675 680 685 Gln Ala Glu Asn Leu Gln Ala Leu Phe Val Ala Leu Asn Asp Gln Val 690 695 700 Phe Glu Ile Arg Glu Leu Ala Ile Cys Thr Val Gly Arg Leu Ser Ser 705 710 715 720 Met Asn Pro Ala Phe Val Met Pro Phe Leu Arg Lys Met Leu Ile Gln 725 730 735 Ile Leu Thr Glu Leu Glu His Ser Gly Ile Gly Arg Ile Lys Glu Gln 740 745 750 Ser Ala Arg Met Leu Gly His Leu Val Ser Asn Ala Pro Arg Leu Ile 755 760 765 Arg Pro Tyr Met Glu Pro Ile Leu Lys Ala Leu Ile Leu Lys Leu Lys 770 775 780 Asp Pro Asp Pro Asp Pro Asn Pro Gly Val Ile Asn Asn Val Leu Ala 785 790 795 800 Thr Ile Gly Glu Leu Ala Gln Val Ser Gly Leu Glu Met Arg Lys Trp 805 810 815 Val Asp Glu Leu Phe Ile Ile Ile Met Asp Met Leu Gln Asp Ser Ser 820 825 830 Leu Leu Ala Lys Arg Gln Val Ala Leu Trp Thr Leu Gly Gln Leu Val 835 840 845 Ala Ser Thr Gly Tyr Val Val Glu Pro Tyr Arg Lys Tyr Pro Thr Leu 850 855 860 Leu Glu Val Leu Leu Asn Phe Leu Lys Thr Glu Gln Asn Gln Gly Thr 865 870 875 880 Arg Arg Glu Ala Ile Arg Val Leu Gly Leu Leu Gly Ala Leu Asp Pro 885 890 895 Tyr Lys His Lys Val Asn Ile Gly Met Ile Asp Gln Ser Arg Asp Ala 900 905 910 Ser Ala Val Ser Leu Ser Glu Ser Lys Ser Ser Gln Asp Ser Ser Asp 915 920 925 Tyr Ser Thr Ser Glu Met Leu Val Asn Met Gly Asn Leu Pro Leu Asp 930 935 940 Glu Phe Tyr Pro Ala Val Ser Met Val Ala Leu Met Arg Ile Phe Arg 945 950 955 960 Asp Gln Ser Leu Ser His His His Thr Met Val Val Gln Ala Ile Thr 965 970 975 Phe Ile Phe Lys Ser Leu Gly Leu Lys Cys Val Gln Phe Leu Pro Gln 980 985 990 Val Met Pro Thr Phe Leu Asn Val Ile Arg Val Cys Asp Gly Ala Ile 995 1000 1005 Arg Glu Phe Leu Phe Gln Gln Leu Gly Met Leu Val Ser Phe Val Lys 1010 1015 1020 Ser His Ile Arg Pro Tyr Met Asp Glu Ile Val Thr Leu Met Arg Glu 1025 1030 1035 1040 Phe Trp Val Met Asn Thr Ser Ile Gln Ser Thr Ile Ile Leu Leu Ile 1045 1050 1055 Glu Gln Ile Val Val Ala Leu Gly Gly Glu Phe Lys Leu Tyr Leu Pro 1060 1065 1070 Gln Leu Ile Pro His Met Leu Arg Val Phe Met His Asp Asn Ser Pro 1075 1080 1085 Gly Arg Ile Val Ser Ile Lys Leu Leu Ala Ala Ile Gln Leu Phe Gly 1090 1095 1100 Ala Asn Leu Asp Asp Tyr Leu His Leu Leu Leu Pro Pro Ile Val Lys 1105 1110 1115 1120 Leu Phe Asp Ala Pro Glu Ala Pro Leu Pro Ser Arg Lys Ala Ala Leu 1125 1130 1135 Glu Thr Val Asp Arg Leu Thr Glu Ser Leu Asp Phe Thr Asp Tyr Ala 1140 1145 1150 Ser Arg Ile Ile His Pro Ile Val Arg Thr Leu Asp Gln Ser Pro Glu 1155 1160 1165 Leu Arg Ser Thr Ala Met Asp Thr Leu Ser Ser Leu Val Phe Gln Leu 1170 1175 1180 Gly Lys Lys Tyr Gln Ile Phe Ile Pro Met Val Asn Lys Val Leu Val 1185 1190 1195 1200 Arg His Arg Ile Asn His Gln Arg Tyr Asp Val Leu Ile Cys Arg Ile 1205 1210 1215 Val Lys Gly Tyr Thr Leu Ala Asp Glu Glu Glu Glu Asp Pro Leu Ile Tyr 1220 1225 1230 Gln His Arg Met Leu Arg Ser Gly Gln Gly Asp Ala Leu Ala Ser Gly 1235 1240 1245 Pro Val Glu Thr Gly Pro Met Lys Lys Leu His Val Ser Thr Ile Asn 1250 1255 1260 Leu Gln Lys Ala Trp Gly Ala Ala Arg Arg Val Ser Lys Asp Asp Trp 1265 1270 1275 1280 Leu Glu Trp Leu Arg Arg Leu Ser Leu Glu Leu Leu Lys Asp Ser Ser 1285 1290 1295 Ser Pro Ser Leu Arg Ser Cys Trp Ala Leu Ala Gln Ala Tyr Asn Pro 1300 1305 1310 Met Ala Arg Asp Leu Phe Asn Ala Ala Phe Val Ser Cys Trp Ser Glu 1315 1320 1325 Leu Asn Glu Asp Gln Gln Asp Glu Leu Ile Arg Ser Ile Glu Leu Ala 1330 1335 1340 Leu Thr Ser Gln Asp Ile Ala Glu Val Thr Gln Thr Leu Leu Asn Leu 1345 1350 1355 1360 Ala Glu Phe Met Glu His Ser Asp Lys Gly Pro Leu Pro Leu Arg Asp 1365 1370 1375 Asp Asn Gly Ile Val Leu Leu Gly Glu Arg Ala Ala Lys Cys Arg Ala 1380 1385 1390 Tyr Ala Lys Ala Leu His Tyr Lys Glu Leu Glu Phe Gln Lys Gly Pro 1395 1400 1405 Thr Pro Ala Ile Leu Glu Ser Leu Ile Ser Ile Asn Asn Lys Leu Gln 1410 1415 1420 Gln Pro Glu Ala Ala Ala Gly Val Leu Glu Tyr Ala Met Lys His Phe 1425 1430 1435 1440 Gly Glu Leu Glu Ile Gln Ala Thr Trp Tyr Glu Lys Leu His Glu Trp 1445 1450 1455 Glu Asp Ala Leu Val Ala Tyr Asp Lys Lys Met Asp Thr Asn Lys Asp 1460 1465 1470 Asp Pro Glu Leu Met Leu Gly Arg Met Arg Cys Leu Glu Ala Leu Gly 1475 1480 1485 Glu Trp Gly Gln Leu His Gln Gln Cys Cys Glu Lys Trp Thr Leu Val 1490 1495 1500 Asn Asp Glu Thr Gln Ala Lys Met Ala Arg Met Ala Ala Ala Ala Ala 1505 1510 1515 1520 Trp Gly Leu Gly Gln Trp Asp Ser Met Glu Glu Tyr Thr Cys Met Ile 1525 1530 1535 Pro Arg Asp Thr His Asp Gly Ala Phe Tyr Arg Ala Val Leu Ala Leu 1540 1545 1550 His Gln Asp Leu Phe Ser Leu Ala Gln Gln Cys Ile Asp Lys Ala Arg 1555 1560 1565 Asp Leu Leu Asp Ala Glu Leu Thr Ala Met Ala Gly Glu Ser Tyr Ser 1570 1575 1580 Arg Ala Tyr Gly Ala Met Val Ser Cys His Met Leu Ser Glu Leu Glu 1585 1590 1595 1600 Glu Val Ile Gln Tyr Lys Leu Val Pro Glu Arg Arg Glu Ile Ile Arg 1605 1610 1615 Gln Ile Trp Trp Glu Arg Leu Gln Gly Cys Gln Arg Ile Val Glu Asp 1620 1625 1630 Trp Gln Lys Ile Leu Met Val Arg Ser Leu Val Val Ser Pro His Glu 1635 1640 1645 Asp Met Arg Thr Trp Leu Lys Tyr Ala Ser Leu Cys Gly Lys Ser Gly 1650 1655 1660 Arg Leu Ala Leu Ala His Lys Thr Leu Val Leu Leu Leu Gly Val Asp 1665 1670 1675 1680 Pro Ser Arg Gln Leu Asp His Pro Leu Pro Thr Val His Pro Gln Val 1685 1690 1695 Thr Tyr Ala Tyr Met Lys Asn Met Trp Lys Ser Ala Arg Lys Ile Asp 1700 1705 1710 Ala Phe Gln His Met Gln His Phe Val Gln Thr Met Gln Gln Gln Ala 1715 1720 1725 Gln His Ala Ile Ala Thr Glu Asp Gln Gln His Lys Gln Glu Leu His 1730 1735 1740 Lys Leu Met Ala Arg Cys Phe Leu Lys Leu Gly Glu Trp Gln Leu Asn 1745 1750 1755 1760 Leu Gln Gly Ile Asn Glu Ser Thr Ile Pro Lys Val Leu Gln Tyr Tyr 1765 1770 1775 Ser Ala Ala Thr Glu His Asp Arg Ser Trp Tyr Lys Ala Trp His Ala 1780 1785 1790 Trp Ala Val Met Asn Phe Glu Ala Val Leu His Tyr Lys His Gln Asn 1795 1800 1805 Gln Ala Arg Asp Glu Lys Lys Lys Leu Arg His Ala Ser Gly Ala Asn 1810 1815 1820 Ile Thr Asn Ala Thr Thr Ala Ala Thr Thr Ala Ala Thr Ala Thr Thr 1825 1830 1835 1840 Thr Ala Ser Thr Glu Gly Ser Asn Ser Glu Ser Glu Ala Glu Ser Thr 1845 1850 1855 Glu Asn Ser Pro Thr Pro Ser Pro Leu Gln Lys Lys Val Thr Glu Asp 1860 1865 1870 Leu Ser Lys Thr Leu Leu Met Tyr Thr Val Pro Ala Val Gln Gly Phe 1875 1880 1885 Phe Arg Ser Ile Ser Leu Ser Arg Gly Asn Asn Leu Gln Asp Thr Leu 1890 1895 1900 Arg Val Leu Thr Leu Trp Phe Asp Tyr Gly His Trp Pro Asp Val Asn 1905 1910 1915 1920 Glu Ala Leu Val Glu Gly Val Lys Ala Ile Gln Ile Asp Thr Trp Leu 1925 1930 1935 Gln Val Ile Pro Gln Leu Ile Ala Arg Ile Asp Thr Pro Arg Pro Leu 1940 1945 1950 Val Gly Arg Leu Ile His Gln Leu Leu Thr Asp Ile Gly Arg Tyr His 1955 1960 1965 Pro Gln Ala Leu Ile Tyr Pro Leu Thr Val Ala Ser Lys Ser Thr Thr 1970 1975 1980 Thr Ala Arg His Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cys Glu 1985 1990 1995 2000 His Ser Asn Thr Leu Val Gln Gln Ala Met Met Val Ser Glu Glu Leu 2005 2010 2015 Ile Arg Val Ala Ile Leu Trp His Glu Met Trp His Glu Gly Leu Glu 2020 2025 2030 Glu Ala Ser Arg Leu Tyr Phe Gly Glu Arg Asn Val Lys Gly Met Phe 2035 2040 2045 Glu Val Leu Glu Pro Leu His Ala Met Met Glu Arg Gly Pro Gln Thr 2050 2055 2060 Leu Lys Glu Thr Ser Phe Asn Gln Ala Tyr Gly Arg Asp Leu Met Glu 2065 2070 2075 2080 Ala Gln Glu Trp Cys Arg Lys Tyr Met Lys Ser Gly Asn Val Lys Asp 2085 2090 2095 Leu Thr Gln Ala Trp Asp Leu Tyr Tyr His Val Phe Arg Arg Ile Ser 2100 2105 2110 Lys Gln Leu Pro Gln Leu Thr Ser Leu Glu Leu Gln Tyr Val Ser Pro 2115 2120 2125 Lys Leu Leu Met Cys Arg Asp Leu Glu Leu Ala Val Pro Gly Thr Tyr 2130 2135 2140 Asp Pro Asn Gln Pro Ile Ile Arg Ile Gln Ser Ile Ala Pro Ser Leu 2145 2150 2155 2160 Gln Val Ile Thr Ser Lys Gln Arg Pro Arg Lys Leu Thr Leu Met Gly 2165 2170 2175 Ser Asn Gly His Glu Phe Val Phe Leu Leu Lys Gly His Glu Asp Leu 2180 2185 2190 Arg Gln Asp Glu Arg Val Met Gln Leu Phe Gly Leu Val Asn Thr Leu 2195 2200 2205 Leu Ala Asn Asp Pro Thr Ser Leu Arg Lys Asn Leu Ser Ile Gln Arg 2210 2215 2220 Tyr Ala Val Ile Pro Leu Ser Thr Asn Ser Gly Leu Ile Gly Trp Val 2225 2230 2235 2240 Pro His Cys Asp Thr Leu His Ala Leu Ile Arg Asp Tyr Arg Glu Lys 2245 2250 2255 Lys Lys Ile Leu Leu Asn Ile Glu His Arg Ile Met Leu Arg Met Ala 2260 2265 2270 Pro Asp Tyr Asp His Leu Thr Leu Met Gln Lys Val Glu Val Phe Glu 2275 2280 2285 His Ala Val Asn Asn Thr Ala Gly Asp Asp Leu Ala Lys Leu Leu Trp 2290 2295 2300 Leu Lys Ser Pro Ser Ser Glu Val Trp Phe Asp Arg Arg Thr Asn Tyr 2305 2310 2315 2320 Thr Arg Ser Leu Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu 2325 2330 2335 Gly Asp Arg His Pro Ser Asn Leu Met Leu Asp Arg Leu Ser Gly Lys 2340 2345 2350 Ile Leu His Ile Asp Phe Gly Asp Cys Phe Glu Val Ala Met Thr Arg 2355 2360 2365 Glu Lys Phe Pro Glu Lys Ile Pro Phe Arg Leu Thr Arg Met Leu Thr 2370 2375 2380 Asn Ala Met Glu Val Thr Gly Leu Asp Gly Asn Tyr Arg Ile Thr Cys 2385 2390 2395 2400 His Thr Val Met Glu Val Leu Arg Glu His Lys Asp Ser Val Met Ala 2405 2410 2415 Val Leu Glu Ala Phe Val Tyr Asp Pro Leu Leu Asn Trp Arg Leu Met 2420 2425 2430 Asp Thr Asn Thr Lys Gly Asn Lys Arg Ser Arg Thr Arg Thr Asp Ser 2435 2440 2445 Tyr Ser Ala Gly Gln Ser Val Glu Ile Leu Asp Gly Val Glu Leu Gly 2450 2455 2460 Glu Pro Ala His Lys Lys Thr Gly Thr Thr Val Pro Glu Ser Ile His 2465 2470 2475 2480 Ser Phe Ile Gly Asp Gly Leu Val Lys Pro Glu Ala Leu Asn Lys Lys 2485 2490 2495 Ala Ile Gln Ile Ile Asn Arg Val Arg Asp Lys Leu Thr Gly Arg Asp 2500 2505 2510 Phe Ser His Asp Asp Thr Leu Asp Val Pro Thr Gln Val Glu Leu Leu 2515 2520 2525 Ile Lys Gln Ala Thr Ser His Glu Asn Leu Cys Gln Cys Tyr Ile Gly 2530 2535 2540 Trp Cys Pro Phe Trp 2545 <210> 3 <211> 3495 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1)..(3495) <223> wild type TSC1 <400> 3 atggcccaac aagcaaatgt cggggagctt cttgccatgc tggactcccc catgctgggt 60 gtgcgggacg acgtgacagc tgtctttaaa gagaacctca attctgaccg tggccctatg 120 cttgtaaaca ccttggtgga ttattacctg gaaaccagct ctcagccggc attgcacatc 180 ctgaccacct tgcaagagcc acatgacaag cacctcttgg acaggattaa cgaatatgtg 240 ggcaaagccg ccactcgttt atccatcctc tcgttactgg gtcatgtcat aagactgcag 300 ccatcttgga agcataagct ctctcaagca cctcttttgc cttctttact aaaatgtctc 360 aagatggaca ctgacgtcgt tgtcctcaca acaggcgtct tggtgttgat aaccatgcta 420 ccaatgattc cacagtctgg gaaacagcat cttcttgatt tctttgacat ttttggccgt 480 ctgtcatcat ggtgcctgaa gaaaccaggc cacgtggcgg aagtctatct cgtccatctc 540 catgccagtg tgtacgcact ctttcatcgc ctttatggaa tgtacccttg caacttcgtc 600 tcctttttgc gttctcatta cagtatgaaa gaaaacctgg agacttttga agaagtggtc 660 aagccaatga tggagcatgt gcgaattcat ccggaattag tgactggatc caaggaccat 720 gaactggacc ctcgaaggtg gaagagatta gaaactcatg atgttgtgat cgagtgtgcc 780 aaaatctctc tggatcccac agaagcctca tatgaagatg gctattctgt gtctcaccaa 840 atctcagccc gctttcctca tcgttcagcc gatgtcacca ccagccctta tgctgacaca 900 cagaatagct atgggtgtgc tacttctacc ccttactcca cgtctcggct gatgttgtta 960 aatatgccag ggcagctacc tcagactctg agttccccat cgacacggct gataactgaa 1020 ccaccacaag ctactctttg gagcccatct atggtttgtg gtatgaccac tcctccaact 1080 tctcctggaa atgtcccacc tgatctgtca cacccttaca gtaaagtctt tggtacaact 1140 gcaggtggaa aaggaactcc tctgggaacc ccagcaacct ctcctcctcc agccccactc 1200 tgtcattcgg atgactacgt gcacatttca ctcccccagg ccacagtcac accccccagg 1260 aaggaagaga gaatggattc tgcaagacca tgtctacaca gacaacacca tcttctgaat 1320 gacagaggat cagaagagcc acctggcagc aaaggttctg tcactctaag tgatcttcca 1380 gggtttttag gtgatctggc ctctgaagaa gatagtattg aaaaagataa agaagaagct 1440 gcaatatcta gagaactttc tgagatcacc acagcagagg cagagcctgt ggttcctcga 1500 ggaggctttg actctccctt ttaccgagac agtctcccag gttctcagcg gaagacccac 1560 tcggcagcct ccagttctca gggcgccagc gtgaaccctg agcctttaca ctcctccctg 1620 gacaagcttg ggcctgacac accaaagcaa gcctttactc ccatagacct gccctgcggc 1680 agtgctgatg aaagccctgc gggagacagg gaatgccaga cttctttgga gaccagtatc 1740 ttcactccca gtccttgtaa aattccacct ccgacgagag tgggctttgg aagcgggcag 1800 cctcccccgt atgatcatct ttttgaggtg gcattgccaa agacagccca tcattttgtc 1860 atcaggaaga ctgaggagct gttaaagaaa gcaaaaggaa acacagagga agatggtgtg 1920 ccctctacct ccccaatgga agtgctggac agactgatac agcagggagc agacgcgcac 1980 agcaaggagc tgaacaagtt gcctttaccc agcaagtctg tcgactggac ccactttgga 2040 ggctctcctc cttcagatga gatccgcacc ctccgagacc agttgctttt actgcacaac 2100 cagttactct atgagcgttt taagaggcag cagcatgccc tccggaacag gcggctcctc 2160 cgcaaggtga tcaaagcagc agctctggag gaacataatg ctgccatgaa agatcagttg 2220 aagttacaag agaaggacat ccagatgtgg aaggttagtc tgcagaaaga acaagctaga 2280 tacaatcagc tccaggagca gcgtgacact atggtaacca agctccacag ccagatcaga 2340 cagctgcagc atgaccgaga ggaattctac aaccagagcc aggaattaca gacgaagctg 2400 gaggactgca ggaacatgat tgcggagctg cggatagaac tgaagaaggc caacaacaag 2460 gtgtgtcaca ctgagctgct gctcagtcag gtttcccaaa agctctcaaa cagtgagtcg 2520 gtccagcagc agatggagtt cttgaacagg cagctgttgg ttcttgggga ggtcaacgag 2580 ctctatttgg aacaactgca gaacaagcac tcagatacca caaaggaagt agaaatgatg 2640 aaagccgcct atcggaaaga gctagaaaaa aacagaagcc atgttctcca gcagactcag 2700 aggcttgata cctcccaaaa acggattttg gaactggaat ctcacctggc caagaaagac 2760 caccttcttt tggaacagaa gaaatatcta gaggatgtca aactccaggc aagaggacag 2820 ctgcaggccg cagagagcag gtatgaggct cagaaaagga taacccaggt gtttgaattg 2880 gagatcttag atttatatgg caggttggag aaagatggcc tcctgaaaaa acttgaagaa 2940 gaaaaagcag aagcagctga agcagcagaa gaaaggcttg actgttgtaa tgacgggtgc 3000 tcagattcca tggtagggca caatgaagag gcatctggcc acaacggtga gaccaagacc 3060 cccaggccca gcagcgcccg gggcagtagt ggaagcagag gtggtggagg cagcagcagc 3120 agcagcagcg agctttctac cccagagaaa cccccacacc agagggcagg cccattcagc 3180 agtcggtggg agacgactat gggagaagcg tctgccagca tccccaccac tgtgggctca 3240 cttcccagtt caaaaagctt cctgggtatg aaggctcgag agttatttcg taataagagc 3300 gagagccagt gtgatgagga cggcatgacc agtagccttt ctgagagcct aaagacagaa 3360 ctgggcaaag acttgggtgt ggaagccaag attcccctga acctagatgg ccctcacccg 3420 tctcccccga ccccggacag tgttggacag ctacatatca tggactacaa tgagactcat 3480 catgaacaca gctaa 3495 <210> 4 <211> 1164 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE <222> (1)..(1164) <223> wild type TSC1 <400> 4 Met Ala Gln Gln Ala Asn Val Gly Glu Leu Leu Ala Met Leu Asp Ser 1 5 10 15 Pro Met Leu Gly Val Arg Asp Asp Val Thr Ala Val Phe Lys Glu Asn 20 25 30 Leu Asn Ser Asp Arg Gly Pro Met Leu Val Asn Thr Leu Val Asp Tyr 35 40 45 Tyr Leu Glu Thr Ser Ser Gln Pro Ala Leu His Ile Leu Thr Thr Leu 50 55 60 Gln Glu Pro His Asp Lys His Leu Leu Asp Arg Ile Asn Glu Tyr Val 65 70 75 80 Gly Lys Ala Ala Thr Arg Leu Ser Ile Leu Ser Leu Leu Gly His Val 85 90 95 Ile Arg Leu Gln Pro Ser Trp Lys His Lys Leu Ser Gln Ala Pro Leu 100 105 110 Leu Pro Ser Leu Leu Lys Cys Leu Lys Met Asp Thr Asp Val Val Val 115 120 125 Leu Thr Thr Gly Val Leu Val Leu Ile Thr Met Leu Pro Met Ile Pro 130 135 140 Gln Ser Gly Lys Gln His Leu Leu Asp Phe Phe Asp Ile Phe Gly Arg 145 150 155 160 Leu Ser Ser Trp Cys Leu Lys Lys Pro Gly His Val Ala Glu Val Tyr 165 170 175 Leu Val His Leu His Ala Ser Val Tyr Ala Leu Phe His Arg Leu Tyr 180 185 190 Gly Met Tyr Pro Cys Asn Phe Val Ser Phe Leu Arg Ser His Tyr Ser 195 200 205 Met Lys Glu Asn Leu Glu Thr Phe Glu Glu Val Val Lys Pro Met Met 210 215 220 Glu His Val Arg Ile His Pro Glu Leu Val Thr Gly Ser Lys Asp His 225 230 235 240 Glu Leu Asp Pro Arg Arg Trp Lys Arg Leu Glu Thr His Asp Val Val 245 250 255 Ile Glu Cys Ala Lys Ile Ser Leu Asp Pro Thr Glu Ala Ser Tyr Glu 260 265 270 Asp Gly Tyr Ser Val Ser His Gln Ile Ser Ala Arg Phe Pro His Arg 275 280 285 Ser Ala Asp Val Thr Thr Ser Pro Tyr Ala Asp Thr Gln Asn Ser Tyr 290 295 300 Gly Cys Ala Thr Ser Thr Pro Tyr Ser Thr Ser Arg Leu Met Leu Leu 305 310 315 320 Asn Met Pro Gly Gln Leu Pro Gln Thr Leu Ser Ser Pro Ser Thr Arg 325 330 335 Leu Ile Thr Glu Pro Pro Gln Ala Thr Leu Trp Ser Pro Ser Met Val 340 345 350 Cys Gly Met Thr Thr Pro Pro Thr Ser Pro Gly Asn Val Pro Pro Asp 355 360 365 Leu Ser His Pro Tyr Ser Lys Val Phe Gly Thr Thr Ala Gly Gly Lys 370 375 380 Gly Thr Pro Leu Gly Thr Pro Ala Thr Ser Pro Pro Pro Ala Pro Leu 385 390 395 400 Cys His Ser Asp Asp Tyr Val His Ile Ser Leu Pro Gln Ala Thr Val 405 410 415 Thr Pro Pro Arg Lys Glu Glu Arg Met Asp Ser Ala Arg Pro Cys Leu 420 425 430 His Arg Gln His His Leu Leu Asn Asp Arg Gly Ser Glu Glu Pro Pro 435 440 445 Gly Ser Lys Gly Ser Val Thr Leu Ser Asp Leu Pro Gly Phe Leu Gly 450 455 460 Asp Leu Ala Ser Glu Glu Asp Ser Ile Glu Lys Asp Lys Glu Glu Ala 465 470 475 480 Ala Ile Ser Arg Glu Leu Ser Glu Ile Thr Thr Ala Glu Ala Glu Pro 485 490 495 Val Val Pro Arg Gly Gly Phe Asp Ser Pro Phe Tyr Arg Asp Ser Leu 500 505 510 Pro Gly Ser Gln Arg Lys Thr His Ser Ala Ala Ser Ser Ser Gln Gly 515 520 525 Ala Ser Val Asn Pro Glu Pro Leu His Ser Ser Leu Asp Lys Leu Gly 530 535 540 Pro Asp Thr Pro Lys Gln Ala Phe Thr Pro Ile Asp Leu Pro Cys Gly 545 550 555 560 Ser Ala Asp Glu Ser Pro Ala Gly Asp Arg Glu Cys Gln Thr Ser Leu 565 570 575 Glu Thr Ser Ile Phe Thr Pro Ser Pro Cys Lys Ile Pro Pro Pro Thr 580 585 590 Arg Val Gly Phe Gly Ser Gly Gln Pro Pro Pro Tyr Asp His Leu Phe 595 600 605 Glu Val Ala Leu Pro Lys Thr Ala His His Phe Val Ile Arg Lys Thr 610 615 620 Glu Glu Leu Leu Lys Lys Ala Lys Gly Asn Thr Glu Glu Asp Gly Val 625 630 635 640 Pro Ser Thr Ser Pro Met Glu Val Leu Asp Arg Leu Ile Gln Gln Gly 645 650 655 Ala Asp Ala His Ser Lys Glu Leu Asn Lys Leu Pro Leu Pro Ser Lys 660 665 670 Ser Val Asp Trp Thr His Phe Gly Gly Ser Pro Pro Ser Asp Glu Ile 675 680 685 Arg Thr Leu Arg Asp Gln Leu Leu Leu Leu His Asn Gln Leu Leu Tyr 690 695 700 Glu Arg Phe Lys Arg Gln Gln His Ala Leu Arg Asn Arg Arg Leu Leu 705 710 715 720 Arg Lys Val Ile Lys Ala Ala Ala Leu Glu Glu His Asn Ala Ala Met 725 730 735 Lys Asp Gln Leu Lys Leu Gln Glu Lys Asp Ile Gln Met Trp Lys Val 740 745 750 Ser Leu Gln Lys Glu Gln Ala Arg Tyr Asn Gln Leu Gln Glu Gln Arg 755 760 765 Asp Thr Met Val Thr Lys Leu His Ser Gln Ile Arg Gln Leu Gln His 770 775 780 Asp Arg Glu Glu Phe Tyr Asn Gln Ser Gln Glu Leu Gln Thr Lys Leu 785 790 795 800 Glu Asp Cys Arg Asn Met Ile Ala Glu Leu Arg Ile Glu Leu Lys Lys 805 810 815 Ala Asn Asn Lys Val Cys His Thr Glu Leu Leu Leu Ser Gln Val Ser 820 825 830 Gln Lys Leu Ser Asn Ser Glu Ser Val Gln Gln Gln Met Glu Phe Leu 835 840 845 Asn Arg Gln Leu Leu Val Leu Gly Glu Val Asn Glu Leu Tyr Leu Glu 850 855 860 Gln Leu Gln Asn Lys His Ser Asp Thr Thr Lys Glu Val Glu Met Met 865 870 875 880 Lys Ala Ala Tyr Arg Lys Glu Leu Glu Lys Asn Arg Ser His Val Leu 885 890 895 Gln Gln Thr Gln Arg Leu Asp Thr Ser Gln Lys Arg Ile Leu Glu Leu 900 905 910 Glu Ser His Leu Ala Lys Lys Asp His Leu Leu Leu Glu Gln Lys Lys 915 920 925 Tyr Leu Glu Asp Val Lys Leu Gln Ala Arg Gly Gln Leu Gln Ala Ala 930 935 940 Glu Ser Arg Tyr Glu Ala Gln Lys Arg Ile Thr Gln Val Phe Glu Leu 945 950 955 960 Glu Ile Leu Asp Leu Tyr Gly Arg Leu Glu Lys Asp Gly Leu Leu Lys 965 970 975 Lys Leu Glu Glu Glu Lys Ala Glu Ala Ala Glu Ala Ala Glu Glu Arg 980 985 990 Leu Asp Cys Cys Asn Asp Gly Cys Ser Asp Ser Met Val Gly His Asn 995 1000 1005 Glu Glu Ala Ser Gly His Asn Gly Glu Thr Lys Thr Pro Arg Pro Ser 1010 1015 1020 Ser Ala Arg Gly Ser Ser Gly Ser Arg Gly Gly Gly Gly Ser Ser Ser 1025 1030 1035 1040 Ser Ser Ser Glu Leu Ser Thr Pro Glu Lys Pro Pro His Gln Arg Ala 1045 1050 1055 Gly Pro Phe Ser Ser Arg Trp Glu Thr Thr Met Gly Glu Ala Ser Ala 1060 1065 1070 Ser Ile Pro Thr Thr Val Gly Ser Leu Pro Ser Ser Lys Ser Phe Leu 1075 1080 1085 Gly Met Lys Ala Arg Glu Leu Phe Arg Asn Lys Ser Glu Ser Gln Cys 1090 1095 1100 Asp Glu Asp Gly Met Thr Ser Ser Leu Ser Glu Ser Leu Lys Thr Glu 1105 1110 1115 1120 Leu Gly Lys Asp Leu Gly Val Glu Ala Lys Ile Pro Leu Asn Leu Asp 1125 1130 1135 Gly Pro His Pro Ser Pro Pro Thr Pro Asp Ser Val Gly Gln Leu His 1140 1145 1150 Ile Met Asp Tyr Asn Glu Thr His His Glu His Ser 1155 1160 <210> 5 <211> 5424 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1)..(5424) <223> wild type TSC2 <400> 5 atggccaaac caacaagcaa agattcaggc ttgaaggaga agtttaagat tctgttggga 60 ctgggaacac cgaggccaaa tcccaggtct gcagagggta aacagacgga gtttatcatc 120 accgcggaaa tactgagaga actgagcatg gaatgtggcc tcaacaatcg catccggatg 180 atagggcaga tttgtgaagt cgcaaaaacc aagaaatttg aagagcacgc agtggaagca 240 ctctggaagg cggtcgcgga tctgttgcag ccggagcggc cgctggaggc ccggcacgcg 300 gtgctggctc tgctgaaggc catcgtgcag gggcagggcg agcgtttggg ggtcctcaga 360 gccctcttct ttaaggtcat caaggattac ccttccaacg aagaccttca cgaaaggctg 420 gaggttttca aggccctcac agacaatggg agacacatca cctacttgga ggaagagctg 480 gctgactttg tcctgcagtg gatggatgtt ggcttgtcct cggaattcct tctggtgctg 540 gtgaacttgg tcaaattcaa tagctgttac ctcgacgagt acatcgcaag gatggttcag 600 atgatctgtc tgctgtgcgt ccggaccgcg tcctctgtgg acatagaggt ctccctgcag 660 gtgctggacg ccgtggtctg ctacaactgc ctgccggctg agagcctccc gctgttcatc 720 gttaccctct gtcgcaccat caacgtcaag gagctctgcg agccttgctg gaagctgatg 780 cggaacctcc ttggcaccca cctgggccac agcgccatct acaacatgtg ccacctcatg 840 gaggacagag cctacatgga ggacgcgccc ctgctgagag gagccgtgtt ttttgtgggc 900 atggctctct ggggagccca ccggctctat tctctcagga actcgccgac atctgtgttg 960 ccatcatttt accaggccat ggcatgtccg aacgaggtgg tgtcctatga gatcgtcctg 1020 tccatcacca ggctcatcaa gaagtatagg aaggagctcc aggtggtggc gtgggacatt 1080 ctgctgaaca tcatcgaacg gctccttcag cagctccaga ccttggacag cccggagctc 1140 aggaccatcg tccatgacct gttgaccacg gtggaggagc tgtgtgacca gaacgagttc 1200 cacgggtctc aggagagata ctttgaactg gtggagagat gtgcggacca gaggcctgag 1260 tcctccctcc tgaacctgat ctcctataga gcgcagtcca tccacccggc caaggacggc 1320 tggattcaga acctgcaggc gctgatggag agattcttca ggagcgagtc ccgaggcgcc 1380 gtgcgcatca aggtgctgga cgtgctgtcc tttgtgctgc tcatcaacag gcagttctat 1440 gaggaggagc tgattaactc agtggtcatc tcgcagctct cccacatccc cgaggataaa 1500 gaccaccagg tccgaaagct ggccacccag ttgctggtgg acctggcaga gggctgccac 1560 acacaccact tcaacagcct gctggacatc atcgagaagg tgatggcccg ctccctctcc 1620 ccacccccgg agctggaaga aagggatgtg gccgcatact cggcctcctt ggaggatgtg 1680 aagacagccg tcctggggct tctggtcatc cttcagacca agctgtacac cctgcctgca 1740 agccacgcca cgcgtgtgta tgagatgctg gtcagccaca ttcagctcca ctacaagcac 1800 agctacaccc tgccaatcgc gagcagcatc cggctgcagg cctttgactt cctgttgctg 1860 ctgcgggccg actcactgca ccgcctgggc ctgcccaaca aggatggagt cgtgcggttc 1920 agcccctact gcgtctgcga ctacatggag ccagagagag gctctgagaa gaagaccagc 1980 ggcccccttt ctcctcccac agggcctcct ggcccggcgc ctgcaggccc cgccgtgcgg 2040 ctggggtccg tgccctactc cctgctcttc cgcgtcctgc tgcagtgctt gaagcaggag 2100 tctgactgga aggtgctgaa gctggttctg ggcaggctgc ctgagtccct gcgctataaa 2160 gtgctcatct ttacttcccc ttgcagtgtg gaccagctgt gctctgctct ctgctccatg 2220 ctttcaggcc caaagacact ggagcggctc cgaggcgccc cagaaggctt ctccagaact 2280 gacttgcacc tggccgtggt tccagtgctg acagcattaa tctcttacca taactacctg 2340 gacaaaacca aacagcgcga gatggtctac tgcctggagc agggcctcat ccaccgctgt 2400 gccagccagt gcgtcgtggc cttgtccatc tgcagcgtgg agatgcctga catcatcatc 2460 aaggcgctgc ctgttctggt ggtgaagctc acgcacatct cagccacagc cagcatggcc 2520 gtcccactgc tggagttcct gtccactctg gccaggctgc cgcacctcta caggaacttt 2580 gccgcggagc agtatgccag tgtgttcgcc atctccctgc cgtacaccaa cccctccaag 2640 tttaatcagt acatcgtgtg tctggcccat cacgtcatag ccatgtggtt catcaggtgc 2700 cgcctgccct tccggaagga ttttgtccct ttcatcacta agggcctgcg gtccaatgtc 2760 ctcttgtctt ttgatgacac ccccgagaag gacagcttca gggcccggag tactagtctc 2820 aacgagagac ccaagagtct gaggatagcc agacccccca aacaaggctt gaataactct 2880 ccacccgtga aagaattcaa ggagagctct gcagccgagg ccttccggtg ccgcagcatc 2940 agtgtgtctg aacatgtggt ccgcagcagg atacagacgt ccctcaccag tgccagcttg 3000 gggtctgcag atgagaactc cgtggcccag gctgacgata gcctgaaaaa cctccacctg 3060 gagctcacgg aaacctgtct ggacatgatg gctcgatacg tcttctccaa cttcacggct 3120 gtcccgaaga ggtctcctgt gggcgagttc ctcctagcgg gtggcaggac caaaacctgg 3180 ctggttggga acaagcttgt cactgtgacg acaagcgtgg gaaccgggac ccggtcgtta 3240 ctaggcctgg actcggggga gctgcagtcc ggcccggagt cgagctccag ccccggggtg 3300 catgtgagac agaccaagga ggcgccggcc aagctggagt cccaggctgg gcagcaggtg 3360 tcccgtgggg cccgggatcg ggtccgttcc atgtcggggg gccatggtct tcgagttggc 3420 gccctggacg tgccggcctc ccagttcctg ggcagtgcca cttctccagg accacggact 3480 gcaccagccg cgaaacctga gaaggcctca gctggcaccc gggttcctgt gcaggagaag 3540 acgaacctgg cggcctatgt gcccctgctg acccagggct gggcggagat cctggtccgg 3600 aggcccacag ggaacaccag ctggctgatg agcctggaga acccgctcag ccctttctcc 3660 tcggacatca acaacatgcc cctgcaggag ctgtctaacg ccctcatggc ggctgagcgc 3720 ttcaaggagc accgggacac agccctgtac aagtcactgt cggtgccggc agccagcacg 3780 gccaaacccc ctcctctgcc tcgctccaac acagtggcct ctttctcctc cctgtaccag 3840 tccagctgcc aaggacagct gcacaggagc gtttcctggg cagactccgc cgtggtcatg 3900 gaggagggaa gtccgggcga ggttcctgtg ctggtggagc ccccagggtt ggaggacgtt 3960 gaggcagcgc taggcatgga caggcgcacg gatgcctaca gcaggtcgtc ctcagtctcc 4020 agccaggagg agaagtcgct ccacgcggag gagctggttg gcaggggcat ccccatcgag 4080 cgagtcgtct cctcggaggg tggccggccc tctgtggacc tctccttcca gccctcgcag 4140 cccctgagca agtccagctc ctctcccgag ctgcagactc tgcaggacat cctcggggac 4200 cctggggaca aggccgacgt gggccggctg agccctgagg ttaaggcccg gtcacagtca 4260 gggaccctgg acggggaaag tgctgcctgg tcggcctcgg gcgaagacag tcggggccag 4320 cccgagggtc ccttgccttc cagctccccc cgctcgccca gtggcctccg gccccgaggt 4380 tacaccatct ccgactcggc cccatcacgc aggggcaaga gagtagagag ggacgcctta 4440 aagagcagag ccacagcctc caatgcagag aaagtgccag gcatcaaccc cagtttcgtg 4500 ttcctgcagc tctaccattc ccccttcttt ggcgacgagt caaacaagcc aatcctgctg 4560 cccaatgagt cacagtcctt tgagcggtcg gtgcagctcc tcgaccagat cccatcatac 4620 gacacccaca agatcgccgt cctgtatgtt ggagaaggcc agagcaacag cgagctcgcc 4680 atcctgtcca atgagcatgg ctcctacagg tacacggagt tcctgacggg cctgggccgg 4740 ctcatcgagc tgaaggactg ccagccggac aaggtgtacc tgggaggcct ggacgtgtgt 4800 ggtgaggacg gccagttcac ctactgctgg cacgatgaca tcatgcaagc cgtcttccac 4860 atcgccaccc tgatgcccac caaggacgtg gacaagcacc gctgcgacaa gaagcgccac 4920 ctgggcaacg actttgtgtc cattgtctac aatgactccg gtgaggactt caagcttggc 4980 accatcaagg gccagttcaa ctttgtccac gtgatcgtca ccccgctgga ctacgagtgc 5040 aacctggtgt ccctgcagtg caggaaagac atggagggcc ttgtggacac cagcgtggcc 5100 aagatcgtgt ctgaccgcaa cctgcccttc gtggcccgcc agatggccct gcacgcaaat 5160 atggcctcac aggtgcatca tagccgctcc aaccccaccg atatctaccc ctccaagtgg 5220 attgcccggc tccgccacat caagcggctc cgccagcgga tctgcgagga agccgcctac 5280 tccaacccca gcctacctct ggtgcaccct ccgtcccata gcaaagcccc tgcacagact 5340 ccagccgagc ccacacctgg ctatgaggtg ggccagcgga agcgcctcat ctcctcggtg 5400 gaggacttca ccgagtttgt gtga 5424 <210> 6 <211> 1807 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE <222> (1)..(1807) <223> wild type TSC2 <400> 6 Met Ala Lys Pro Thr Ser Lys Asp Ser Gly Leu Lys Glu Lys Phe Lys 1 5 10 15 Ile Leu Leu Gly Leu Gly Thr Pro Arg Pro Asn Pro Arg Ser Ala Glu 20 25 30 Gly Lys Gln Thr Glu Phe Ile Ile Thr Ala Glu Ile Leu Arg Glu Leu 35 40 45 Ser Met Glu Cys Gly Leu Asn Asn Arg Ile Arg Met Ile Gly Gln Ile 50 55 60 Cys Glu Val Ala Lys Thr Lys Lys Phe Glu Glu His Ala Val Glu Ala 65 70 75 80 Leu Trp Lys Ala Val Ala Asp Leu Leu Gln Pro Glu Arg Pro Leu Glu 85 90 95 Ala Arg His Ala Val Leu Ala Leu Leu Lys Ala Ile Val Gln Gly Gln 100 105 110 Gly Glu Arg Leu Gly Val Leu Arg Ala Leu Phe Phe Lys Val Ile Lys 115 120 125 Asp Tyr Pro Ser Asn Glu Asp Leu His Glu Arg Leu Glu Val Phe Lys 130 135 140 Ala Leu Thr Asp Asn Gly Arg His Ile Thr Tyr Leu Glu Glu Glu Leu 145 150 155 160 Ala Asp Phe Val Leu Gln Trp Met Asp Val Gly Leu Ser Ser Glu Phe 165 170 175 Leu Leu Val Leu Val Asn Leu Val Lys Phe Asn Ser Cys Tyr Leu Asp 180 185 190 Glu Tyr Ile Ala Arg Met Val Gln Met Ile Cys Leu Leu Cys Val Arg 195 200 205 Thr Ala Ser Ser Val Asp Ile Glu Val Ser Leu Gln Val Leu Asp Ala 210 215 220 Val Val Cys Tyr Asn Cys Leu Pro Ala Glu Ser Leu Pro Leu Phe Ile 225 230 235 240 Val Thr Leu Cys Arg Thr Ile Asn Val Lys Glu Leu Cys Glu Pro Cys 245 250 255 Trp Lys Leu Met Arg Asn Leu Leu Gly Thr His Leu Gly His Ser Ala 260 265 270 Ile Tyr Asn Met Cys His Leu Met Glu Asp Arg Ala Tyr Met Glu Asp 275 280 285 Ala Pro Leu Leu Arg Gly Ala Val Phe Phe Val Gly Met Ala Leu Trp 290 295 300 Gly Ala His Arg Leu Tyr Ser Leu Arg Asn Ser Pro Thr Ser Val Leu 305 310 315 320 Pro Ser Phe Tyr Gln Ala Met Ala Cys Pro Asn Glu Val Val Ser Tyr 325 330 335 Glu Ile Val Leu Ser Ile Thr Arg Leu Ile Lys Lys Tyr Arg Lys Glu 340 345 350 Leu Gln Val Val Ala Trp Asp Ile Leu Leu Asn Ile Ile Glu Arg Leu 355 360 365 Leu Gln Gln Leu Gln Thr Leu Asp Ser Pro Glu Leu Arg Thr Ile Val 370 375 380 His Asp Leu Leu Thr Thr Val Glu Glu Leu Cys Asp Gln Asn Glu Phe 385 390 395 400 His Gly Ser Gln Glu Arg Tyr Phe Glu Leu Val Glu Arg Cys Ala Asp 405 410 415 Gln Arg Pro Glu Ser Ser Leu Leu Asn Leu Ile Ser Tyr Arg Ala Gln 420 425 430 Ser Ile His Pro Ala Lys Asp Gly Trp Ile Gln Asn Leu Gln Ala Leu 435 440 445 Met Glu Arg Phe Phe Arg Ser Glu Ser Arg Gly Ala Val Arg Ile Lys 450 455 460 Val Leu Asp Val Leu Ser Phe Val Leu Leu Ile Asn Arg Gln Phe Tyr 465 470 475 480 Glu Glu Glu Leu Ile Asn Ser Val Val Ile Ser Gln Leu Ser His Ile 485 490 495 Pro Glu Asp Lys Asp His Gln Val Arg Lys Leu Ala Thr Gln Leu Leu 500 505 510 Val Asp Leu Ala Glu Gly Cys His Thr His His Phe Asn Ser Leu Leu 515 520 525 Asp Ile Ile Glu Lys Val Met Ala Arg Ser Leu Ser Pro Pro Pro Glu 530 535 540 Leu Glu Glu Arg Asp Val Ala Ala Tyr Ser Ala Ser Leu Glu Asp Val 545 550 555 560 Lys Thr Ala Val Leu Gly Leu Leu Val Ile Leu Gln Thr Lys Leu Tyr 565 570 575 Thr Leu Pro Ala Ser His Ala Thr Arg Val Tyr Glu Met Leu Val Ser 580 585 590 His Ile Gln Leu His Tyr Lys His Ser Tyr Thr Leu Pro Ile Ala Ser 595 600 605 Ser Ile Arg Leu Gln Ala Phe Asp Phe Leu Leu Leu Leu Arg Ala Asp 610 615 620 Ser Leu His Arg Leu Gly Leu Pro Asn Lys Asp Gly Val Val Arg Phe 625 630 635 640 Ser Pro Tyr Cys Val Cys Asp Tyr Met Glu Pro Glu Arg Gly Ser Glu 645 650 655 Lys Lys Thr Ser Gly Pro Leu Ser Pro Pro Thr Gly Pro Pro Gly Pro 660 665 670 Ala Pro Ala Gly Pro Ala Val Arg Leu Gly Ser Val Pro Tyr Ser Leu 675 680 685 Leu Phe Arg Val Leu Leu Gln Cys Leu Lys Gln Glu Ser Asp Trp Lys 690 695 700 Val Leu Lys Leu Val Leu Gly Arg Leu Pro Glu Ser Leu Arg Tyr Lys 705 710 715 720 Val Leu Ile Phe Thr Ser Pro Cys Ser Val Asp Gln Leu Cys Ser Ala 725 730 735 Leu Cys Ser Met Leu Ser Gly Pro Lys Thr Leu Glu Arg Leu Arg Gly 740 745 750 Ala Pro Glu Gly Phe Ser Arg Thr Asp Leu His Leu Ala Val Val Pro 755 760 765 Val Leu Thr Ala Leu Ile Ser Tyr His Asn Tyr Leu Asp Lys Thr Lys 770 775 780 Gln Arg Glu Met Val Tyr Cys Leu Glu Gln Gly Leu Ile His Arg Cys 785 790 795 800 Ala Ser Gln Cys Val Val Ala Leu Ser Ile Cys Ser Val Glu Met Pro 805 810 815 Asp Ile Ile Ile Lys Ala Leu Pro Val Leu Val Val Lys Leu Thr His 820 825 830 Ile Ser Ala Thr Ala Ser Met Ala Val Pro Leu Leu Glu Phe Leu Ser 835 840 845 Thr Leu Ala Arg Leu Pro His Leu Tyr Arg Asn Phe Ala Ala Glu Gln 850 855 860 Tyr Ala Ser Val Phe Ala Ile Ser Leu Pro Tyr Thr Asn Pro Ser Lys 865 870 875 880 Phe Asn Gln Tyr Ile Val Cys Leu Ala His His Val Ile Ala Met Trp 885 890 895 Phe Ile Arg Cys Arg Leu Pro Phe Arg Lys Asp Phe Val Pro Phe Ile 900 905 910 Thr Lys Gly Leu Arg Ser Asn Val Leu Leu Ser Phe Asp Asp Thr Pro 915 920 925 Glu Lys Asp Ser Phe Arg Ala Arg Ser Thr Ser Leu Asn Glu Arg Pro 930 935 940 Lys Ser Leu Arg Ile Ala Arg Pro Pro Lys Gln Gly Leu Asn Asn Ser 945 950 955 960 Pro Pro Val Lys Glu Phe Lys Glu Ser Ser Ala Ala Glu Ala Phe Arg 965 970 975 Cys Arg Ser Ile Ser Val Ser Glu His Val Val Arg Ser Arg Ile Gln 980 985 990 Thr Ser Leu Thr Ser Ala Ser Leu Gly Ser Ala Asp Glu Asn Ser Val 995 1000 1005 Ala Gln Ala Asp Asp Ser Leu Lys Asn Leu His Leu Glu Leu Thr Glu 1010 1015 1020 Thr Cys Leu Asp Met Met Ala Arg Tyr Val Phe Ser Asn Phe Thr Ala 1025 1030 1035 1040 Val Pro Lys Arg Ser Pro Val Gly Glu Phe Leu Leu Ala Gly Gly Arg 1045 1050 1055 Thr Lys Thr Trp Leu Val Gly Asn Lys Leu Val Thr Val Thr Thr Ser 1060 1065 1070 Val Gly Thr Gly Thr Arg Ser Leu Leu Gly Leu Asp Ser Gly Glu Leu 1075 1080 1085 Gln Ser Gly Pro Glu Ser Ser Ser Ser Pro Gly Val His Val Arg Gln 1090 1095 1100 Thr Lys Glu Ala Pro Ala Lys Leu Glu Ser Gln Ala Gly Gln Gln Val 1105 1110 1115 1120 Ser Arg Gly Ala Arg Asp Arg Val Arg Ser Met Ser Gly Gly His Gly 1125 1130 1135 Leu Arg Val Gly Ala Leu Asp Val Pro Ala Ser Gln Phe Leu Gly Ser 1140 1145 1150 Ala Thr Ser Pro Gly Pro Arg Thr Ala Pro Ala Ala Lys Pro Glu Lys 1155 1160 1165 Ala Ser Ala Gly Thr Arg Val Pro Val Gln Glu Lys Thr Asn Leu Ala 1170 1175 1180 Ala Tyr Val Pro Leu Leu Thr Gln Gly Trp Ala Glu Ile Leu Val Arg 1185 1190 1195 1200 Arg Pro Thr Gly Asn Thr Ser Trp Leu Met Ser Leu Glu Asn Pro Leu 1205 1210 1215 Ser Pro Phe Ser Ser Asp Ile Asn Asn Met Pro Leu Gln Glu Leu Ser 1220 1225 1230 Asn Ala Leu Met Ala Ala Glu Arg Phe Lys Glu His Arg Asp Thr Ala 1235 1240 1245 Leu Tyr Lys Ser Leu Ser Val Pro Ala Ala Ser Thr Ala Lys Pro Pro 1250 1255 1260 Pro Leu Pro Arg Ser Asn Thr Val Ala Ser Phe Ser Ser Leu Tyr Gln 1265 1270 1275 1280 Ser Ser Cys Gln Gly Gln Leu His Arg Ser Val Ser Trp Ala Asp Ser 1285 1290 1295 Ala Val Val Met Glu Glu Gly Ser Pro Gly Glu Val Pro Val Leu Val 1300 1305 1310 Glu Pro Pro Gly Leu Glu Asp Val Glu Ala Ala Leu Gly Met Asp Arg 1315 1320 1325 Arg Thr Asp Ala Tyr Ser Arg Ser Ser Ser Val Ser Ser Gln Glu Glu 1330 1335 1340 Lys Ser Leu His Ala Glu Glu Leu Val Gly Arg Gly Ile Pro Ile Glu 1345 1350 1355 1360 Arg Val Val Ser Ser Glu Gly Gly Arg Pro Ser Val Asp Leu Ser Phe 1365 1370 1375 Gln Pro Ser Gln Pro Leu Ser Lys Ser Ser Ser Ser Pro Glu Leu Gln 1380 1385 1390 Thr Leu Gln Asp Ile Leu Gly Asp Pro Gly Asp Lys Ala Asp Val Gly 1395 1400 1405 Arg Leu Ser Pro Glu Val Lys Ala Arg Ser Gln Ser Gly Thr Leu Asp 1410 1415 1420 Gly Glu Ser Ala Ala Trp Ser Ala Ser Gly Glu Asp Ser Arg Gly Gln 1425 1430 1435 1440 Pro Glu Gly Pro Leu Pro Ser Ser Ser Pro Arg Ser Pro Ser Gly Leu 1445 1450 1455 Arg Pro Arg Gly Tyr Thr Ile Ser Asp Ser Ala Pro Ser Arg Arg Gly 1460 1465 1470 Lys Arg Val Glu Arg Asp Ala Leu Lys Ser Arg Ala Thr Ala Ser Asn 1475 1480 1485 Ala Glu Lys Val Pro Gly Ile Asn Pro Ser Phe Val Phe Leu Gln Leu 1490 1495 1500 Tyr His Ser Pro Phe Phe Gly Asp Glu Ser Asn Lys Pro Ile Leu Leu 1505 1510 1515 1520 Pro Asn Glu Ser Gln Ser Phe Glu Arg Ser Val Gln Leu Leu Asp Gln 1525 1530 1535 Ile Pro Ser Tyr Asp Thr His Lys Ile Ala Val Leu Tyr Val Gly Glu 1540 1545 1550 Gly Gln Ser Asn Ser Glu Leu Ala Ile Leu Ser Asn Glu His Gly Ser 1555 1560 1565 Tyr Arg Tyr Thr Glu Phe Leu Thr Gly Leu Gly Arg Leu Ile Glu Leu 1570 1575 1580 Lys Asp Cys Gln Pro Asp Lys Val Tyr Leu Gly Gly Leu Asp Val Cys 1585 1590 1595 1600 Gly Glu Asp Gly Gln Phe Thr Tyr Cys Trp His Asp Asp Ile Met Gln 1605 1610 1615 Ala Val Phe His Ile Ala Thr Leu Met Pro Thr Lys Asp Val Asp Lys 1620 1625 1630 His Arg Cys Asp Lys Lys Arg His Leu Gly Asn Asp Phe Val Ser Ile 1635 1640 1645 Val Tyr Asn Asp Ser Gly Glu Asp Phe Lys Leu Gly Thr Ile Lys Gly 1650 1655 1660 Gln Phe Asn Phe Val His Val Ile Val Thr Pro Leu Asp Tyr Glu Cys 1665 1670 1675 1680 Asn Leu Val Ser Leu Gln Cys Arg Lys Asp Met Glu Gly Leu Val Asp 1685 1690 1695 Thr Ser Val Ala Lys Ile Val Ser Asp Arg Asn Leu Pro Phe Val Ala 1700 1705 1710 Arg Gln Met Ala Leu His Ala Asn Met Ala Ser Gln Val His His Ser 1715 1720 1725 Arg Ser Asn Pro Thr Asp Ile Tyr Pro Ser Lys Trp Ile Ala Arg Leu 1730 1735 1740 Arg His Ile Lys Arg Leu Arg Gln Arg Ile Cys Glu Glu Ala Ala Tyr 1745 1750 1755 1760 Ser Asn Pro Ser Leu Pro Leu Val His Pro Pro Ser His Ser Lys Ala 1765 1770 1775 Pro Ala Gln Thr Pro Ala Glu Pro Thr Pro Gly Tyr Glu Val Gly Gln 1780 1785 1790 Arg Lys Arg Leu Ile Ser Ser Val Glu Asp Phe Thr Glu Phe Val 1795 1800 1805 <210> 7 <211> 1398 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1)..(1398) <223> wild type AKT3 <400> 7 atgagcgatg ttaccattgt gaaagaaggt tgggttcaga agaggggaga atatataaaa 60 aactggaggc caagatactt ccttttgaag acagatggct cattcatagg atataaagag 120 aaacctcaag atgtggattt accttatccc ctcaacaact tttcagtggc aaaatgccag 180 ttaatgaaaa cagaacgacc aaagccaaac acatttataa tcagatgtct ccagtggact 240 actgttatag agagaacatt tcatgtagat actccagagg aaagggaaga atggacagaa 300 gctatccagg ctgtagcaga cagactgcag aggcaagaag aggagagaat gaattgtagt 360 ccaacttcac aaattgataa tataggagag gaagagatgg atgcctctac aacccatcat 420 aaaagaaaga caatgaatga ttttgactat ttgaaactac taggtaaagg cacttttggg 480 aaagttattt tggttcgaga gaaggcaagt ggaaaatact atgctatgaa gattctgaag 540 aaagaagtca ttattgcaaa ggatgaagtg gcacacactc taactgaaag cagagtatta 600 aagaacacta gacatccctt tttaacatcc ttgaaatatt ccttccagac aaaagaccgt 660 ttgtgttttg tgatggaata tgttaatggg ggcgagctgt ttttccattt gtcgagagag 720 cgggtgttct ctgaggaccg cacacgtttc tatggtgcag aaattgtctc tgccttggac 780 tatctacatt ccggaaagat tgtgtaccgt gatctcaagt tggagaatct aatgctggac 840 aaagatggcc acataaaaat tacagatttt ggactttgca aagaagggat cacagatgca 900 gccaccatga agacattctg tggcactcca gaatatctgg caccagaggt gttagaagat 960 aatgactatg gccgagcagt agactggtgg ggcctagggg ttgtcatgta tgaaatgatg 1020 tgtgggaggt tacctttcta caaccaggac catgagaaac tttttgaatt aatattaatg 1080 gaagacatta aatttcctcg aacactctct tcagatgcaa aatcattgct ttcagggctc 1140 ttgataaagg atccaaataa acgccttggt ggaggaccag atgatgcaaa agaaattatg 1200 agacacagtt tcttctctgg agtaaactgg caagatgtat atgataaaaa gcttgtacct 1260 ccttttaaac ctcaagtaac atctgagaca gatactagat attttgatga agaatttaca 1320 gctcagacta ttacaataac accacctgaa aaatgtcagc aatcagattg tggcatgctg 1380 ggtaactgga aaaaataa 1398 <210> 8 <211> 465 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE <222> (1)..(465) <223> wild type AKT3 <400> 8 Met Ser Asp Val Thr Ile Val Lys Glu Gly Trp Val Gln Lys Arg Gly 1 5 10 15 Glu Tyr Ile Lys Asn Trp Arg Pro Arg Tyr Phe Leu Leu Lys Thr Asp 20 25 30 Gly Ser Phe Ile Gly Tyr Lys Glu Lys Pro Gln Asp Val Asp Leu Pro 35 40 45 Tyr Pro Leu Asn Asn Phe Ser Val Ala Lys Cys Gln Leu Met Lys Thr 50 55 60 Glu Arg Pro Lys Pro Asn Thr Phe Ile Ile Arg Cys Leu Gln Trp Thr 65 70 75 80 Thr Val Ile Glu Arg Thr Phe His Val Asp Thr Pro Glu Glu Arg Glu 85 90 95 Glu Trp Thr Glu Ala Ile Gln Ala Val Ala Asp Arg Leu Gln Arg Gln 100 105 110 Glu Glu Glu Arg Met Asn Cys Ser Pro Thr Ser Gln Ile Asp Asn Ile 115 120 125 Gly Glu Glu Glu Met Asp Ala Ser Thr Thr His His Lys Arg Lys Thr 130 135 140 Met Asn Asp Phe Asp Tyr Leu Lys Leu Leu Gly Lys Gly Thr Phe Gly 145 150 155 160 Lys Val Ile Leu Val Arg Glu Lys Ala Ser Gly Lys Tyr Tyr Ala Met 165 170 175 Lys Ile Leu Lys Lys Glu Val Ile Ile Ala Lys Asp Glu Val Ala His 180 185 190 Thr Leu Thr Glu Ser Arg Val Leu Lys Asn Thr Arg His Pro Phe Leu 195 200 205 Thr Ser Leu Lys Tyr Ser Phe Gln Thr Lys Asp Arg Leu Cys Phe Val 210 215 220 Met Glu Tyr Val Asn Gly Gly Glu Leu Phe Phe His Leu Ser Arg Glu 225 230 235 240 Arg Val Phe Ser Glu Asp Arg Thr Arg Phe Tyr Gly Ala Glu Ile Val 245 250 255 Ser Ala Leu Asp Tyr Leu His Ser Gly Lys Ile Val Tyr Arg Asp Leu 260 265 270 Lys Leu Glu Asn Leu Met Leu Asp Lys Asp Gly His Ile Lys Ile Thr 275 280 285 Asp Phe Gly Leu Cys Lys Glu Gly Ile Thr Asp Ala Ala Thr Met Lys 290 295 300 Thr Phe Cys Gly Thr Pro Glu Tyr Leu Ala Pro Glu Val Leu Glu Asp 305 310 315 320 Asn Asp Tyr Gly Arg Ala Val Asp Trp Trp Gly Leu Gly Val Val Met 325 330 335 Tyr Glu Met Met Cys Gly Arg Leu Pro Phe Tyr Asn Gln Asp His Glu 340 345 350 Lys Leu Phe Glu Leu Ile Leu Met Glu Asp Ile Lys Phe Pro Arg Thr 355 360 365 Leu Ser Ser Asp Ala Lys Ser Leu Leu Ser Gly Leu Leu Ile Lys Asp 370 375 380 Pro Asn Lys Arg Leu Gly Gly Gly Pro Asp Asp Ala Lys Glu Ile Met 385 390 395 400 Arg His Ser Phe Phe Ser Gly Val Asn Trp Gln Asp Val Tyr Asp Lys 405 410 415 Lys Leu Val Pro Pro Phe Lys Pro Gln Val Thr Ser Glu Thr Asp Thr 420 425 430 Arg Tyr Phe Asp Glu Glu Phe Thr Ala Gln Thr Ile Thr Ile Thr Pro 435 440 445 Pro Glu Lys Cys Gln Gln Ser Asp Cys Gly Met Leu Gly Asn Trp Lys 450 455 460 Lys 465 <210> 9 <211> 3207 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1)..(3207) <223> wild type PIK3CA <400> 9 atgcctccac gaccatcatc aggtgaactg tggggcatcc acttgatgcc cccaagaatc 60 ctagtagaat gtttactacc aaatggaatg atagtgactt tagaatgcct ccgtgaggct 120 acattaataa ccataaagca tgaactattt aaagaagcaa gaaaataccc cctccatcaa 180 cttcttcaag atgaatcttc ttacattttc gtaagtgtta ctcaagaagc agaaagggaa 240 gaattttttg atgaaacaag acgactttgt gaccttcggc tttttcaacc ctttttaaaa 300 gtaattgaac cagtaggcaa ccgtgaagaa aagatcctca atcgagaaat tggttttgct 360 atcggcatgc cagtgtgtga atttgatatg gttaaagatc cagaagtaca ggacttccga 420 agaaatattc tgaacgtttg taaagaagct gtggatctta gggacctcaa ttcacctcat 480 agtagagcaa tgtatgtcta tcctccaaat gtagaatctt caccagaatt gccaaagcac 540 atatataata aattagataa agggcaaata atagtggtga tctgggtaat agtttctcca 600 aataatgaca agcagaagta tactctgaaa atcaaccatg actgtgtacc agaacaagta 660 attgctgaag caatcaggaa aaaaactcga agtatgttgc tatcctctga acaactaaaa 720 ctctgtgttt tagaatatca gggcaagtat attttaaaag tgtgtggatg tgatgaatac 780 ttcctagaaa aatatcctct gagtcagtat aagtatataa gaagctgtat aatgcttggg 840 aggatgccca atttgatgtt gatggctaaa gaaagccttt attctcaact gccaatggac 900 tgttttacaa tgccatctta ttccagacgc atttccacag ctacaccata tatgaatgga 960 gaaacatcta caaaatccct ttgggttata aatagtgcac tcagaataaa aattctttgt 1020 gcaacctacg tgaatgtaaa tattcgagac attgataaga tctatgttcg aacaggtatc 1080 taccatggag gagaaccctt atgtgacaat gtgaacactc aaagagtacc ttgttccaat 1140 cccaggtgga atgaatggct gaattatgat atatacattc ctgatcttcc tcgtgctgct 1200 cgactttgcc tttccatttg ctctgttaaa ggccgaaagg gtgctaaaga ggaacactgt 1260 ccattggcat ggggaaatat aaacttgttt gattacacag acactctagt atctggaaaa 1320 atggctttga atctttggcc agtacctcat ggattagaag atttgctgaa ccctattggt 1380 gttactggat caaatccaaa taaagaaact ccatgcttag agttggagtt tgactggttc 1440 agcagtgtgg taaagttccc agatatgtca gtgattgaag agcatgccaa ttggtctgta 1500 tcccgagaag caggatttag ctattcccac gcaggactga gtaacagact agctagagac 1560 aatgaattaa gggaaaatga caaagaacag ctcaaagcaa tttctacacg agatcctctc 1620 tctgaaatca ctgagcagga gaaagatttt ctatggagtc acagacacta ttgtgtaact 1680 atccccgaaa ttctacccaa attgcttctg tctgttaaat ggaattctag agatgaagta 1740 gcccagatgt attgcttggt aaaagattgg cctccaatca aacctgaaca ggctatggaa 1800 cttctggact gtaattaccc agatcctatg gttcgaggtt ttgctgttcg gtgcttggaa 1860 aaatatttaa cagatgacaa actttctcag tatttaattc agctagtaca ggtcctaaaa 1920 tatgaacaat atttggataa cttgcttgtg agatttttac tgaagaaagc attgactaat 1980 caaaggattg ggcacttttt cttttggcat ttaaaatctg agatgcacaa taaaacagtt 2040 agccagaggt ttggcctgct tttggagtcc tattgtcgtg catgtgggat gtatttgaag 2100 cacctgaata ggcaagtcga ggcaatggaa aagctcatta acttaactga cattctcaaa 2160 caggagaaga aggatgaaac acaaaaggta cagatgaagt ttttagttga gcaaatgagg 2220 cgaccagatt tcatggatgc tctacagggc tttctgtctc ctctaaaccc tgctcatcaa 2280 ctaggaaacc tcaggcttga agagtgtcga attatgtcct ctgcaaaaag gccactgtgg 2340 ttgaattggg agaacccaga catcatgtca gagttactgt ttcagaacaa tgagatcatc 2400 tttaaaaatg gggatgattt acggcaagat atgctaacac ttcaaattat tcgtattatg 2460 gaaaatatct ggcaaaatca aggtcttgat cttcgaatgt taccttatgg ttgtctgtca 2520 atcggtgact gtgtgggact tattgaggtg gtgcgaaatt ctcacactat tatgcaaatt 2580 cagtgcaaag gcggcttgaa aggtgcactg cagttcaaca gccacacact acatcagtgg 2640 ctcaaagaca agaacaaagg agaaatatat gatgcagcca ttgacctgtt tacacgttca 2700 tgtgctggat actgtgtagc taccttcatt ttgggaattg gagatcgtca caatagtaac 2760 atcatggtga aagacgatgg acaactgttt catatagatt ttggacactt tttggatcac 2820 aagaagaaaa aatttggtta taaacgagaa cgtgtgccat ttgttttgac acaggatttc 2880 ttaatagtga ttagtaaagg agcccaagaa tgcacaaaga caagagaatt tgagaggttt 2940 caggagatgt gttacaaggc ttatctagct attcgacagc atgccaatct cttcataaat 3000 cttttctcaa tgatgcttgg ctctggaatg ccagaactac aatcttttga tgacattgca 3060 tacattcgaa agaccctagc cttagataaa actgagcaag aggctttgga gtatttcatg 3120 aaacaaatga atgatgcaca tcatggtggc tggacaacaa aaatggattg gatcttccac 3180 acaattaaac agcatgcatt gaactga 3207 <210> 10 <211> 1068 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE <222> (1)..(1068) <223> wild type PIK3CA <400> 10 Met Pro Pro Arg Pro Ser Ser Gly Glu Leu Trp Gly Ile His Leu Met 1 5 10 15 Pro Pro Arg Ile Leu Val Glu Cys Leu Leu Pro Asn Gly Met Ile Val 20 25 30 Thr Leu Glu Cys Leu Arg Glu Ala Thr Leu Ile Thr Ile Lys His Glu 35 40 45 Leu Phe Lys Glu Ala Arg Lys Tyr Pro Leu His Gln Leu Leu Gln Asp 50 55 60 Glu Ser Ser Tyr Ile Phe Val Ser Val Thr Gln Glu Ala Glu Arg Glu 65 70 75 80 Glu Phe Phe Asp Glu Thr Arg Arg Leu Cys Asp Leu Arg Leu Phe Gln 85 90 95 Pro Phe Leu Lys Val Ile Glu Pro Val Gly Asn Arg Glu Glu Lys Ile 100 105 110 Leu Asn Arg Glu Ile Gly Phe Ala Ile Gly Met Pro Val Cys Glu Phe 115 120 125 Asp Met Val Lys Asp Pro Glu Val Gln Asp Phe Arg Arg Asn Ile Leu 130 135 140 Asn Val Cys Lys Glu Ala Val Asp Leu Arg Asp Leu Asn Ser Pro His 145 150 155 160 Ser Arg Ala Met Tyr Val Tyr Pro Pro Asn Val Glu Ser Ser Pro Glu 165 170 175 Leu Pro Lys His Ile Tyr Asn Lys Leu Asp Lys Gly Gln Ile Ile Val 180 185 190 Val Ile Trp Val Ile Val Ser Pro Asn Asn Asp Lys Gln Lys Tyr Thr 195 200 205 Leu Lys Ile Asn His Asp Cys Val Pro Glu Gln Val Ile Ala Glu Ala 210 215 220 Ile Arg Lys Lys Thr Arg Ser Met Leu Leu Ser Ser Glu Gln Leu Lys 225 230 235 240 Leu Cys Val Leu Glu Tyr Gln Gly Lys Tyr Ile Leu Lys Val Cys Gly 245 250 255 Cys Asp Glu Tyr Phe Leu Glu Lys Tyr Pro Leu Ser Gln Tyr Lys Tyr 260 265 270 Ile Arg Ser Cys Ile Met Leu Gly Arg Met Pro Asn Leu Met Leu Met 275 280 285 Ala Lys Glu Ser Leu Tyr Ser Gln Leu Pro Met Asp Cys Phe Thr Met 290 295 300 Pro Ser Tyr Ser Arg Arg Ile Ser Thr Ala Thr Pro Tyr Met Asn Gly 305 310 315 320 Glu Thr Ser Thr Lys Ser Leu Trp Val Ile Asn Ser Ala Leu Arg Ile 325 330 335 Lys Ile Leu Cys Ala Thr Tyr Val Asn Val Asn Ile Arg Asp Ile Asp 340 345 350 Lys Ile Tyr Val Arg Thr Gly Ile Tyr His Gly Gly Glu Pro Leu Cys 355 360 365 Asp Asn Val Asn Thr Gln Arg Val Pro Cys Ser Asn Pro Arg Trp Asn 370 375 380 Glu Trp Leu Asn Tyr Asp Ile Tyr Ile Pro Asp Leu Pro Arg Ala Ala 385 390 395 400 Arg Leu Cys Leu Ser Ile Cys Ser Val Lys Gly Arg Lys Gly Ala Lys 405 410 415 Glu Glu His Cys Pro Leu Ala Trp Gly Asn Ile Asn Leu Phe Asp Tyr 420 425 430 Thr Asp Thr Leu Val Ser Gly Lys Met Ala Leu Asn Leu Trp Pro Val 435 440 445 Pro His Gly Leu Glu Asp Leu Leu Asn Pro Ile Gly Val Thr Gly Ser 450 455 460 Asn Pro Asn Lys Glu Thr Pro Cys Leu Glu Leu Glu Phe Asp Trp Phe 465 470 475 480 Ser Ser Val Val Lys Phe Pro Asp Met Ser Val Ile Glu Glu His Ala 485 490 495 Asn Trp Ser Val Ser Arg Glu Ala Gly Phe Ser Tyr Ser His Ala Gly 500 505 510 Leu Ser Asn Arg Leu Ala Arg Asp Asn Glu Leu Arg Glu Asn Asp Lys 515 520 525 Glu Gln Leu Lys Ala Ile Ser Thr Arg Asp Pro Leu Ser Glu Ile Thr 530 535 540 Glu Gln Glu Lys Asp Phe Leu Trp Ser His Arg His Tyr Cys Val Thr 545 550 555 560 Ile Pro Glu Ile Leu Pro Lys Leu Leu Leu Ser Val Lys Trp Asn Ser 565 570 575 Arg Asp Glu Val Ala Gln Met Tyr Cys Leu Val Lys Asp Trp Pro Pro 580 585 590 Ile Lys Pro Glu Gln Ala Met Glu Leu Leu Asp Cys Asn Tyr Pro Asp 595 600 605 Pro Met Val Arg Gly Phe Ala Val Arg Cys Leu Glu Lys Tyr Leu Thr 610 615 620 Asp Asp Lys Leu Ser Gln Tyr Leu Ile Gln Leu Val Gln Val Leu Lys 625 630 635 640 Tyr Glu Gln Tyr Leu Asp Asn Leu Leu Val Arg Phe Leu Leu Lys Lys 645 650 655 Ala Leu Thr Asn Gln Arg Ile Gly His Phe Phe Phe Trp His Leu Lys 660 665 670 Ser Glu Met His Asn Lys Thr Val Ser Gln Arg Phe Gly Leu Leu Leu 675 680 685 Glu Ser Tyr Cys Arg Ala Cys Gly Met Tyr Leu Lys His Leu Asn Arg 690 695 700 Gln Val Glu Ala Met Glu Lys Leu Ile Asn Leu Thr Asp Ile Leu Lys 705 710 715 720 Gln Glu Lys Lys Asp Glu Thr Gln Lys Val Gln Met Lys Phe Leu Val 725 730 735 Glu Gln Met Arg Arg Pro Asp Phe Met Asp Ala Leu Gln Gly Phe Leu 740 745 750 Ser Pro Leu Asn Pro Ala His Gln Leu Gly Asn Leu Arg Leu Glu Glu 755 760 765 Cys Arg Ile Met Ser Ser Ala Lys Arg Pro Leu Trp Leu Asn Trp Glu 770 775 780 Asn Pro Asp Ile Met Ser Glu Leu Leu Phe Gln Asn Asn Glu Ile Ile 785 790 795 800 Phe Lys Asn Gly Asp Asp Leu Arg Gln Asp Met Leu Thr Leu Gln Ile 805 810 815 Ile Arg Ile Met Glu Asn Ile Trp Gln Asn Gln Gly Leu Asp Leu Arg 820 825 830 Met Leu Pro Tyr Gly Cys Leu Ser Ile Gly Asp Cys Val Gly Leu Ile 835 840 845 Glu Val Val Arg Asn Ser His Thr Ile Met Gln Ile Gln Cys Lys Gly 850 855 860 Gly Leu Lys Gly Ala Leu Gln Phe Asn Ser His Thr Leu His Gln Trp 865 870 875 880 Leu Lys Asp Lys Asn Lys Gly Glu Ile Tyr Asp Ala Ala Ile Asp Leu 885 890 895 Phe Thr Arg Ser Cys Ala Gly Tyr Cys Val Ala Thr Phe Ile Leu Gly 900 905 910 Ile Gly Asp Arg His Asn Ser Asn Ile Met Val Lys Asp Asp Gly Gln 915 920 925 Leu Phe His Ile Asp Phe Gly His Phe Leu Asp His Lys Lys Lys Lys 930 935 940 Phe Gly Tyr Lys Arg Glu Arg Val Pro Phe Val Leu Thr Gln Asp Phe 945 950 955 960 Leu Ile Val Ile Ser Lys Gly Ala Gln Glu Cys Thr Lys Thr Arg Glu 965 970 975 Phe Glu Arg Phe Gln Glu Met Cys Tyr Lys Ala Tyr Leu Ala Ile Arg 980 985 990 Gln His Ala Asn Leu Phe Ile Asn Leu Phe Ser Met Met Leu Gly Ser 995 1000 1005 Gly Met Pro Glu Leu Gln Ser Phe Asp Asp Ile Ala Tyr Ile Arg Lys 1010 1015 1020 Thr Leu Ala Leu Asp Lys Thr Glu Gln Glu Ala Leu Glu Tyr Phe Met 1025 1030 1035 1040 Lys Gln Met Asn Asp Ala His His Gly Gly Trp Thr Thr Lys Met Asp 1045 1050 1055 Trp Ile Phe His Thr Ile Lys Gln His Ala Leu Asn 1060 1065 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C1483 sense primer <400> 11 taggttacag gcctggatgg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C1483 antisense primer <400> 12 cttggcctcc caaaatgtta 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> L2427 sense primer <400> 13 tccaggctac ctggtatgag a 21 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> L2427 antisense primer <400> 14 gccttccttt caaatccaaa 20 <210> 15 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> annealing forward primer for pCIG-mTOR mutant-IRES-EGFP <400> 15 aattccaatt gcccgggctt aagatcgata cgcgta 36 <210> 16 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> annealing reverse primer for pCIG-mTOR mutant-IRES-EGFP <400> 16 ccggtacgcg tatcgatctt aagcccgggc aattgg 36 <210> 17 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> forward primer for pCIG-mTOR mutant-IRES-EGFP <400> 17 gatcacaatt gtggccacca tggactacaa ggacgacgat gacaagatgc 50 <210> 18 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for pCIG-mTOR mutant-IRES-EGFP <400> 18 tgatcaacgc gtttaccaga aagggcacca gccaatatag c 41 <210> 19 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Y1450D sense primer <400> 19 tcgtgcagtt tctcatccca ggtagcctgg atc 33 <210> 20 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Y1450D antisense primer <400> 20 gatccaggct acctgggatg agaaactgca cga 33 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> C1483R sense primer <400> 21 ggcctcgagg cggcgcatgc ggc 23 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> C1483R antisense primer <400> 22 gccgcatgcg ccgcctcgag gcc 23 <210> 23 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> L2427Q sense primer <400> 23 gtctatgacc ccttgcagaa ctggaggctg atg 33 <210> 24 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> L2427Q antisense primer <400> 24 catcagcctc cagttctgca aggggtcata gac 33 <210> 25 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> L2427P sense primer <400> 25 gtctatgacc ccttgccgaa ctggaggctg atg 33 <210> 26 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> L2427P antisense primer <400> 26 catcagcctc cagttcggca aggggtcata gac 33 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 7280T sense primer <400> 27 cccaggcact tgatgatact c 21 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7280T antisense primer <400> 28 cttgctttgg gtggagagtt 20 <210> 29 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> TSC-1 R22W-F primer <400> 29 gtcacgtcgt cccacacacc cagcatg 27 <210> 30 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> TSC-1 R22W-R primer <400> 30 catgctgggt gtgtgggacg acgtgac 27 <210> 31 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> TSC-1 R204C-F primer <400> 31 ctttcatact gtaatgagaa cacaaaaagg agacgaagtt gca 43 <210> 32 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> TSC-1 R204C-R primer <400> 32 tgcaacttcg tctccttttt gtgttctcat tacagtatga aag 43 <210> 33 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TSC-2 V1547I-F primer <400> 33 tctccaacat acaggatggc gatcttgtgg gtg 33 <210> 34 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TSC-2 V1547I-R primer <400> 34 cacccacaag atcgccatcc tgtatgttgg aga 33 <210> 35 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> AKT3 R247H-F primer <400> 35 caccatagaa acgtgtgtgg tcctcagaga acacc 35 <210> 36 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> AKT3 R247H-R primer <400> 36 ggtgttctct gaggaccaca cacgtttcta tggtg 35 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence corresponding to TSC1 targetting sgRNA <400> 37 tgctggactc ctccacactg 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence corresponding to TSC2 targetting sgRNA <400> 38 aatcccaggt gtgcagaagg 20

Claims (6)

A pharmaceutical composition for the prevention or treatment of type 2 cortical dysplasia (FCD type II) caused by brain genital mutation including mTOR and mTOR inhibitor as an active ingredient,
The brain somatic genetic mutation is due to the amino acid substitution of mTOR, TSC1, TSC2, AKT3, or PIK3CA protein,
Wherein said mTOR inhibitor is selected from the group consisting of the following compounds or a pharmaceutically acceptable salt thereof: (I) a pharmaceutical composition for the prevention or treatment of type 2 cortical dysplasia (FCD type II)
Rapamycin
AZD2014 (Vistusertib),
BEZ235 (Dactolysib),
Everolimus,
3-yl) -3,5-dihydropyrazino [2,3-b] pyridin-2-yl) ] pyrazin-2 (1H) -one),
3-yl) -1- ((1R, 4R) -4-methoxycyclohexyl) -3,4-dihydropyrazino [2,3- b] pyridin- ] pyrazin-2 (1H) -one),
LY3023414 ((S) -8- (5- (2-hydroxypropan-2-yl) pyridin-3- yl) -1- (2- methoxypropyl) -3-methyl-1H- imidazo [4,5- c] quinoline -2 (3H) -one),
Imidazo [5,1-f] [1,2,4] triazin-7-yl] -1H-pyrazolo [3,4-d] pyrimidin- cyclohexane-1-carboxylic acid),
PF-04691502 (2-amino-8- [4- (2-hydroxyethoxy) cyclohexyl] -6- (6-methoxypyridin-3- yl) -4-methylpyrido [2,3- d] pyrimidin-
PF-05212384 (Gedatolisib)
Temsirolimus,
Ridaforolimus,
Metformin,
XL765 (Voxtalisib),
Compounds of formula 1,
3-yl) -1, 3-benzoxazol-2-amine) of the following formula 2: INK128 (5- (4-amino-1-propan-2-ylpyrazolo [
4-yl] pyrido [2,3-d] pyrimidin-7-yl] -2-methoxyphenyl] methanol, And
4-ylquinolin-6-yl) pyridin-3-yl] benzenesulfonamide of the following formula 4: ???????? GSK2126458 ?????
[Chemical Formula 1]

(2)

(3)

[Chemical Formula 4]

The method according to claim 1, wherein the brain somatic genetic mutation is selected from the group consisting of 206, 624, 1450, 1483, 1709, 1977, 2193, 2215, 2427, and 2427 ,
In the amino acid sequence of SEQ ID NO: 4, 22, 204, and 811,
In the amino acid sequence of SEQ ID NO: 6,
247 in the amino acid sequence of SEQ ID NO: 8, and
A substitution occurring at amino acid 1018 in the amino acid sequence of SEQ ID NO: 10, and at least one mutation selected from the group consisting of substitutions occurring at amino acid 1018 in the amino acid sequence of SEQ ID NO: 10. The mTOR inhibitor of claim 1, wherein the mTOR inhibitor is rapamycin or a salt thereof, everolimus or a salt thereof, a compound of formula (1) or a salt thereof, a compound of formula (2) or a salt thereof, A salt thereof, and a compound of formula (4) or a salt thereof.
[Chemical Formula 1]

(2)

(3)

[Chemical Formula 4]

2. The method according to claim 1, wherein the brain-
(R) is substituted with cysteine (C), amino acid (R) is substituted with histidine (H) at position 624, tyrosine (Y) at position 1450 is replaced with aspartic acid D), the cysteine (C) at position 1483 is substituted with arginine (R), the arginine (R) at position 1709 is replaced by histidine (H), the threonine (T) at position 1977 is substituted by lysine (L) at position 2427 is substituted with proline (P), and position 2427 is substituted with cysteine (C), substitution of serine (S) at position 2215 with phenylalanine (L) is replaced with glutamine (Q)
(R) in the amino acid sequence of SEQ ID NO: 4 is substituted with tryptophan (W), the amino acid (R) is substituted with cysteine (C) &Lt; / RTI &
In the amino acid sequence of SEQ ID NO: 6, the valine (V) at position 1547 is substituted with isoleucine (I)
In the amino acid sequence of SEQ ID NO: 8, amino acid 247 (R) is substituted with histidine (H), and
Wherein the amino acid sequence of SEQ ID NO: 10 comprises at least one mutation selected from the group consisting of substitution of Aspartic acid (D) with Asparagine (N) at position 1018 aspartic acid. 2. The method according to claim 1, wherein the brain-
In the nucleotide sequence of SEQ ID NO: 1, the cytosine (C) at position 616 is substituted with thymine (T), the guanine (G) at position 1871 is substituted with adenine (A) Guanine (G), the thymine (T) at position 4447 is replaced by cytosine (C), the guanine at position 5126 is replaced by adenine (A), the cytosine at position 5930 is replaced by adenine A), the cytosine (C) at position 6577 is substituted with thymine (T), the cytosine (C) at position 6644 is substituted with thymine (T) , And that the thymine (T) at position 7280 is substituted with cytosine (C)
(C) is substituted with thymine (T) in the nucleotide sequence of SEQ ID NO: 3, cytosine (C) is replaced with thymine (T) at 610, guanine (G)
In the nucleotide sequence of SEQ ID NO: 5, the 4639th guanine is substituted with adenine (A)
In the nucleotide sequence of SEQ ID NO: 7, the 740th guanine (G) is substituted with adenine (A), and
Wherein the nucleotide sequence of SEQ ID NO: 9 comprises at least one mutation selected from the group consisting of substitution of guanine (G) at position 3052 with adenine (A). The pharmaceutical composition of claim 1, wherein the composition further comprises a compound selected from the group consisting of a pharmaceutically acceptable carrier, excipient, stabilizer, surfactant, gelling agent, pH adjusting agent, antioxidant and preservative.

Images