KR20170120991A - Biomaterial for medical use comprising sulfated-hyaluronic acid - Google Patents

Abstract

The present invention relates to a medical biomaterial containing sulfated hyaluronic acid. More specifically, the sulfated hyaluronic acid of the present invention is free from cytotoxicity, reduces antigen-antibody reactions and inflammation when injected into tissues, and does not act as a foreign substance owing to higher solubility than natural hyaluronic acid. In addition, the sulfated hyaluronic acid inhibits activities of inflammatory cytokines and inflammation-associated factors. Accordingly, the sulfated hyaluronic acid can be useful as anti-inflammation compositions as well as materials for regenerative medicine and tissue engineering.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention [0001] The present invention relates to a biomaterial comprising a sulfated hyaluronic acid,

The present invention relates to a medical biomaterial including sulfated hyaluronic acid.

Hyaluronic acid (HA) or hyaluronan is a non-sulfated glycosaminoglycan which is a natural non-sulfated glycosaminoglycan in which D-glucuronic acid (GlcUA) and N- acetyl-D-glucosamine (GlcNAc) It is a polysaccharide. The hyaluronic acid exists in various parts such as vitreous humor, cartilage, synovial fluid, placenta and skin of an animal and is in the form of a mucous polysaccharide.

Hyaluronic acid is involved in the extracellular matrix that is responsible for absorbing moisture or imparting intercellular flexibility and signaling, wound healing, and morphogenesis of cells. In particular, hyaluronic acid inhibits phagocytic action of macrophages and exhibits anti-inflammatory activity. However, low-molecular-weight hyaluronic acid degradation products in which polymer hyaluronic acid is degraded not only promote the inflammatory response of macrophages, but also increase the collagen and fibrosis involved in wound healing (Girish KS et al. , Life Sci . , 2007 May 1: 80 (21): 1921-43).

Because of this activity, hyaluronic acid has been used as an adjuvant in the treatment of arthritis, wound healing, and eye and middle ear surgery. In addition, hyaluronic acid is excellent in biocompatibility and its application in tissue engineering and regenerative medicine is increasing. Accordingly, recently, various hyaluronic acid derivatives having superior solubility than natural hyaluronic acid, having no antigenicity, and prolonging the time of decomposition by enzymes in vivo have been studied.

On the other hand, hyaluronic acid is produced through in vitro synthesis using animal tissues, bacteria or microbial enzymes. Industrially produced hyaluronic acid from chicken crest or Streptococcus genus microorganisms. In the past, a method of extracting hyaluronic acid from chicken crests has been mainly used, but it has a disadvantage in that it takes a long time and cost in purification because of low production yield and a large amount of impurities. Currently, hyaluronic acid is produced through cultivation of microorganisms, which is advantageous in terms of low cost and high production yield.

 Girish K. S. et al., Life Sci., May 1, 80 (21): 1921-43.

It is an object of the present invention to provide a medical biomaterial including sulfated hyaluronic acid.

Another object of the present invention is to provide a pharmaceutical composition for the treatment of inflammatory diseases comprising sulfated hyaluronic acid.

Another object of the present invention is to provide a cosmetic composition for improving inflammatory diseases, which comprises sulfated hyaluronic acid.

Furthermore, another object of the present invention is to provide a method for producing sulfated hyaluronic acid.

In order to accomplish the above object, the present invention provides a medical material for medical use comprising sulfated hyaluronic acid.

The present invention also provides a pharmaceutical composition for the treatment of inflammatory diseases containing sulfated hyaluronic acid as an active ingredient.

The present invention also provides a cosmetic composition for the treatment of inflammatory diseases containing sulfated hyaluronic acid as an active ingredient.

Further, the present invention provides a method for producing a microorganism, comprising: separating hyaluronic acid from a microorganism; Preparing a solution containing sulfur compounds; Adding the separated hyaluronic acid to the solution to prepare a mixture; And a step of reacting the mixture with an organic solvent containing sulfur and reacting the sulfurized hyaluronic acid.

The sulfated hyaluronic acid of the present invention has no cytotoxicity, and when injected into tissues, it reduces the inflammatory reaction and the antigen-antibody reaction, and does not act as a foreign substance because it is more soluble than natural hyaluronic acid. In addition, the sulfated hyaluronic acid inhibits the activity of inflammation-related factors and inflammatory cytokines. Therefore, the sulfated hyaluronic acid can be used not only as a material for tissue engineering and regenerative medicine but also as a composition for anti-inflammation.

Figure 1 illustrates the structure of purified water-soluble hyaluronic acid (HA-WS), water-insoluble hyaluronic acid (HA-WI) and sulfated hyaluronic acid (S-HA) in one embodiment of the present invention by FT-IR spectrophotometer It is a graph.
FIG. 2 is a flowchart sequentially showing the steps of purifying HA-WS, HA-WI and S-HA.
FIG. 3 is a graph showing the structures of HA, HA-WS, and S-HA by an NMR spectrophotometer.
FIG. 4 is a graph of MTT analysis results for confirming whether HA-WS, HA-WI and S-HA show cytotoxicity.
Figure 5 is a graph of ELISA results to confirm that HA-WS, HA-WI and S-HA inhibit nitrogen monoxide (NO) increased by lipopolysaccharide (LPS).
6 is an ELISA result graph for confirming whether HA-WS, HA-WI, and S-HA suppress TNF-? Increased by LPS.
FIG. 7 is an ELISA result graph for confirming whether HA-WS, HA-WI, and S-HA inhibit IL-6 increased by LPS.
FIG. 8 is a graph showing real-time PCR results confirming that HA-WS, HA-WI and S-HA inhibit the levels of mRNA expression of inducible nitric oxide synthase (iNOS) and COX-2 (cyclooxygenase-2) .

Hereinafter, the present invention will be described in detail.

The present invention provides a medical material for medical use comprising sulfated hyaluronic acid.

The sulfated hyaluronic acid may be a compound represented by the following Formula 1:

[Chemical Formula 1]

The sulfated hyaluronic acid of the present invention can be prepared from water-insoluble hyaluronic acid. The sulfated hyaluronic acid may have a sulfate group bound to the sugar residue. The sulfated hyaluronic acid may be one in which the methyl group is substituted with a sulfate group.

The hyaluronic acid of the present invention can be produced by in vitro synthesis using an animal tissue, a bacterium or a microbial enzyme, or by chemical synthesis. The in vitro synthesis may be a method using a chicken crest or a microorganism belonging to the genus Streptococcus , and may be obtained from a Streptococcus dysgalactia strain according to an embodiment of the present invention.

The sulfated hyaluronic acid of the present invention can be used as a known biomaterial for tissue engineering and regenerative medicine.

As used herein, the term "biomaterial" is a type of medical material used to diagnose or treat a disease, and includes, in the form of synthetic, natural, or complexes thereof excluding medicines, Means a material that can replace some or all of it.

Examples of the biomaterial include fillers, coating agents, eye drops, injections for knee joints, and anti-adhesion agents.

The term "filler" refers to a material that is inserted into a specific area of skin tissue to expand soapy tissue and thereby used for wrinkle correction or contour fixation.

The term "coating agent" refers to a substance that improves biocompatibility so that when a medical implant such as an implant, a screw, or a bone substitute is inserted into the body, the implant is stably positioned without causing an immune or inflammatory reaction.

The present invention also provides a pharmaceutical composition for the treatment of inflammatory diseases containing sulfated hyaluronic acid as an active ingredient.

The sulfated hyaluronic acid may be a compound represented by the general formula (1).

The inflammatory disease may be selected from the group consisting of degenerative arthritis, multiple sclerosis, sepsis, shock, bronchitis, dermatitis, allergy, retinitis, gastritis, hepatitis, enteritis, pancreatitis and nephritis.

The pharmaceutical composition of the present invention may further contain one or more substances known to have an effect of treating inflammatory diseases in the composition of the present invention.

In addition, the composition of the present invention may further contain one or more pharmaceutically acceptable additives selected from the group consisting of excipients, lubricants, wetting agents, sweeteners, fragrances, and preservatives.

The composition of the present invention can be formulated according to a conventional method. And may be formulated employing methods known in the art to provide rapid, sustained or delayed release of the active ingredient, especially after administration to a mammal. According to the formulation, the composition of the present invention can be administered to an individual as appropriate. Such administration may be oral or parenteral administration, and examples thereof include intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, and oral routes and the like.

Solid form preparations for oral administration may be tablets, pills, soft or hard capsules, pills, powders or granules. On the other hand, forms for parenteral administration may include creams, lotions, ointments, alerts, solutions, patches or injections.

The composition of the present invention can be suitably administered by a person skilled in the art according to the age, sex, weight, degree of pathology and administration route of the patient. The administration may be once a day or several times a day.

The present invention also provides a cosmetic composition for the treatment of inflammatory diseases containing sulfated hyaluronic acid as an active ingredient.

The sulfated hyaluronic acid may be a compound represented by the above formula (1) having the above characteristics.

The cosmetic composition of the present invention may contain sulfated hyaluronic acid having the above-mentioned characteristics, and may further contain substances known to have an inflammatory disease-improving effect.

The cosmetic composition may be prepared into cosmetic formulations conventionally produced in the art. Examples of the cosmetic formulations may include solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, oils, foundations and sprays. The formulations may contain suitable carrier ingredients which may be included in the cosmetic preparations according to the formulation.

The cosmetic composition of the present invention may further comprise, in addition to the carrier component, an adjuvant selected from the group consisting of an antioxidant, a stabilizer, a solubilizer, a moisturizer, a pigment, a perfume, a sunscreen, a colorant, a surfactant and a combination thereof. The adjuvant is not limited as long as it is an adjuvant commonly used in the production of a cosmetic composition.

The present invention also provides a method for producing a microorganism, comprising: 1) separating hyaluronic acid from a microorganism; 2) preparing a solution containing sulfur compounds; 3) adding the separated hyaluronic acid to the solution to prepare a mixture; And 4) adding an organic solvent containing sulfur to the mixture and reacting the sulfurized hyaluronic acid.

The microorganism may be a Streptococcus sp., And according to one embodiment of the present invention, Streptococcus dysgalactiae .

The hyaluronic acid may be a compound represented by the above formula (1) having the above-mentioned characteristics.

The sulfur compound can be used without limitation as long as it is a compound containing sulfur. Specifically, the sulfur compound may be dimethyl sulfoxide. The sulfur compound may be added to a solution in which urea is dissolved to be used for the reaction.

The hyaluronic acid in step 3) may be added in an amount of 1 to 10 wt%, 2 to 8 wt%, or 3 to 5 wt%.

The sulfur-containing organic solvent may be sulfuric acid. The sulfur-containing organic solvent may be used in admixture with dimethyl sulfoxide and the mixing ratio of sulfur-containing organic solvent and dimethyl sulfoxide may be 1: 5 to 1:20, 1: 7 to 1: 15 or 1: 9 to 1: 12. According to one embodiment of the present invention, the mixing ratio of the sulfur-containing organic solvent and dimethyl sulfoxide may be 1:10.

The sulfur-containing organic solvent and the mixture in the step 4) may be mixed in a volume ratio of 0.1: 1 to 10: 1, 0.5: 1 to 5: 1 or 0.8: 1 to 3: 1.

The method of producing sulfated hyaluronic acid of the present invention may further comprise a dialysis step.

Hereinafter, the present invention will be described in detail by the following examples. However, the following examples are intended to illustrate the present invention, but the present invention is not limited thereto.

Example  1. Separation and purification of water-soluble hyaluronic acid

To isolate water-soluble hyaluronic acid, Streptococcus dysgalactiae (KCTC11818BP, KCTC, Korea) was inoculated into the brain heart infusion (BHI, Difco, USA) medium to obtain 2 x 10 ⁷ cells / . The prepared strains were inoculated into BHI medium and cultured at 37 ° C and 5% CO ₂ . The cultured strain was centrifuged at 8,000 x g for 10 minutes to obtain a supernatant. Trichloroacetic acid (TCA) was added to the obtained supernatant to a final concentration of 4.0% (v / v), 99% ethanol was added thereto to a final concentration of 70% (v / v) For a day. The cold mixture was centrifuged again at 9,600 x g for 10 minutes to obtain precipitated crude hyaluronic acid (crude HA). 300 ml of 1 M NaOH was added to the crude hyaluronic acid and dissolved using an ultrasonic mill. The dissolved crude hyaluronic acid was diluted in 25 ml of sterilized water and dialysed for 5 days in running water by placing it in a dialysis membrane (cut-off molecular weight: 10,000 Da) to remove low-molecular substances. The finally obtained water-soluble hyaluronic acid (HA-WS) was stored by freeze drying.

Example  2. Separation and purification of non-aqueous hyaluronic acid

To isolate the water-insoluble hyaluronic acid, Streptococcus dysgalactia strain was cultured in the same manner as in Example 1. The cultured strain was centrifuged at 8,000 x g for 10 to obtain a pellet. 300 ml of 1M NaOH was added to the obtained pellet, and reacted at 95 캜 for 2 hours or longer, and then cooled at room temperature. Thereafter, after vortexing for 15 minutes, it was centrifuged at 2,500 x g for 20 minutes to obtain supernatant. Three times 95% ethanol was added to the volume of the supernatant obtained, reacted at 4 占 폚 for one day, and centrifuged at 2,500x and 4 占 폚 for 20 minutes. The supernatant was taken out, and 20 ml of sterilized distilled water was added thereto. The dialyzed membrane (molecular weight cut off: 10,000 Da) was dialyzed against running water for 5 days to remove low molecular weight substances. The finally obtained water-insoluble hyaluronic acid (HA-WI) was lyophilized and stored.

Example  3. Isolation and purification of sulfated hyaluronic acid

Sulfated hyaluronic acid (S-HA) was synthesized and separated and purified using HA-WI prepared in Example 2 as follows.

First, 3.6 g of urea (8 M) was dissolved in 10 ml of dimethyl sulfoxide (Me ₂ SO) to prepare a Me ₂ SO-urea solution. In addition, Me ₂ SO ₄ solution was prepared by reacting 5 mL of Me ₂ SO and 500 μL of H ₂ SO ₄ . To 5 ml of Me ₂ SO-urea solution, 0.2 g of HA-WI was added, and 8 ml of Me ₂ SO ₄ solution was added thereto, followed by reaction at 100 ° C for 4 hours using a constant temperature water bath. After completion of the reaction, the reaction product was cooled at room temperature, 200 ml of tertiary distilled water was added thereto, and the low molecular weight material was removed by dialyzing for 5 days in flowing water in a dialysis membrane (fractional molecular weight: 10,000 Da). The finally obtained sulfated hyaluronic acid (HA-WI) was stored by lyophilization.

As a result, 0.288 g of S-HA was obtained from 0.32 g of HA-WI, and the yield of the obtained S-HA was calculated to be 90% using the following equation (1).

Example  4. Structural analysis of hyaluronic acid

4-1. Structural analysis using FT-IR

The structures of HA-WS, HA-WI and S-HA isolated and purified in the above Examples 1 to 3 were analyzed through Fourier transform infrared spectroscopy (FT-IR) analysis in which the intermolecular chemical bonding state was identified through vibration.

Specifically, the obtained HA-WS, HA-WI and S-HA were measured at 350-4,500 cm ^-1 by a known method using an FT-IR spectrophotometer (FTIR-4100, PerkinElmer, UK) Are shown in Table 1 and Fig. At this time, hyaluronic acid (HA, Ildong Pharmaceutical Co., Ltd., Central Research Laboratory, Korea) was used as a standard substance.

Functional group Wavelength (cm ^-1 ) HA standard HA-WS HA-WI S-HA C-O-C stretching 1041.37 1050.05 1086.69 1020.16 C-O, C-O 1409.71 1405.85 - 1482.99 Amide II group 1608.34 - - - OH stretching 3357.64 3283.21 - 3339.14 S-O-C group - - - 781.029 950.734 1020.16

As shown in Table 1 and Fig. 1, the FT-IR pattern of S-HA showed a pattern similar to that of HA, HA-WS and HA-WI. The structural difference between HA and S-HA indicates that sulfate groups are bound to sugar residues, and that S-HA is bound to sulfate groups by FT-IR.

Specifically, COC stretching, CO, C = O group, amide II group and OH stretching peak were confirmed in all hyaluronic acids, and SOC group peaks were confirmed in S-HA. In addition, all hyaluronic acid had a typical ring-and-groove bonding structure.

4-2. NMR structure analysis

HA-WS, HA-WI and S-HA isolated and purified in the above Examples 1 to 3 were analyzed by NMR to confirm the morphology and structural properties of hyaluronic acid.

Specifically, we analyzed the ¹ H / ¹³ C-NMR spectrum of the resulting HA-WS, WI-HA and HA-S by a known method using a 400 ㎒ spectrophotometer (Bruker, AM-200, Germany). At this time, as a solvent, a solution in which 100 mg of HA was dissolved in 1 ml of D ₂ O was used. As a result, the results of ¹ H / ¹³ C NMR spectra of HA, HA-WS and S-HA are shown in Fig.

As shown in FIG. 3, it was found that sulfation occurred as the specific peak position of S-HA shifted compared to HA and HA-SW. Specifically, the peak located at 2.0 ppm shifted to a position of 1.4 ppm in the ¹ H NMR spectrum. From this, it was confirmed that the methyl group of HA was replaced with a sulfate group, which was similar to the results of the conventional studies.

Test Example  1. Cytotoxicity of S-HA

MTT analysis was performed to confirm that the HA-WS, HA-WI, and S-HA separated and purified in Examples 1 to 3 and HA showed cytotoxicity.

First, RAW 264.7 cells (Korean Cell Line Bank, Korea) were inoculated in DMEM (Dulbecco Modified Eagle's Medium, Life Technologies, USA) supplemented with 10% fetal bovine serum, 100 μg / ml streptomycin and 100 U / , And 5% CO ₂ . Prepared cells were plated in 96-well plates at 2xlO < ⁵ > cells / ml per well and cultured for 24 hours under the same conditions. The supernatant was then removed and HA, HA-WS, HA-WI or S-HA were added to the plates to a concentration of 12.5, 50 or 200 ug / ml and further incubated for 24 hours under the same conditions. At this time, physiological saline was used as a control group. After the incubation, 100 μl of the supernatant was removed, 10 μl of the MTT solution of 5 mg / ml was added, and the reaction was allowed to proceed at 37 ° C and 5% CO ₂ for 4 hours. After the reaction, the supernatant was removed, and 100 μl of DMSO was added. Then, the absorbance was measured at 540 nm wavelength using an ELISA flit reader (Epoch, BioTek Instruments Inc., USA). As a result, cell differentiation ratios of HA, HA-WS, HA-WI, or S-HA were calculated based on the cell differentiation rate of the control group and shown in FIG.

As shown in Fig. 4, HA, HA-WS, HA-WI, or S-HA added groups did not show cytotoxicity as compared with the control group.

Test Example  2. Identification of inhibitory effect of nitrogen monoxide by S-HA

In order to confirm the anti-inflammatory effect of S-HA, the effect of inhibiting nitrogen monoxide was confirmed.

First, RAW 264.7 cells were divided into 96-well plates under the same conditions and the same manner as in Test Example 1, and cultured for 24 hours. HA, HA-WS, HA-WI or S-HA diluted to a concentration of 12.5, 50 or 200 / / ml in a medium of 1 ㎍ / Lt; / RTI > At this time, as a control group, a negative control group treated with only 1 쨉 g / ml of lipopolysaccharide (LPS) and an untreated control group were used. After culturing for 24 hours, 100 占 퐇 of the culture solution was put into a new 96-well plate and 100 占 퐇 of griess reagent [1% of sulphanilamide and 0.1% of naphthyl-ethylenediamine ) Was added and reacted at room temperature for 10 minutes. Then, the absorbance was measured at 540 nm wavelength using an ELISA flit reader. At this time, sodium nitrate (NaNO ₂ ) was diluted by concentration as a standard substance and used as a standard calibration curve for NO concentration.

As a result, it was confirmed that the amount of NO increased by the LPS treatment was suppressed by adding HA, HA-WS, HA-WI or S-HA as shown in FIG.

Test Example  3. Inhibitory effect of S-HA on the expression of inflammatory cytokines

In addition to inflammatory mediators such as NO and PGE ₂ , inflammatory cytokines such as TNF-α and IL-6 are involved in the inflammatory response in the human body. The inflammatory cytokine is a mediator of NO production, which causes local inflammation to activate T cells, B cell maturation, and activation of natural killer cells. Thus, ELISA was performed to confirm whether S-HA was involved in their expression.

Specifically, RAW 264.7 cells were divided into 96-well plates under the same conditions and the same manner as in Test Example 1, and cultured for 4 hours to attach the cells to the plates. The supernatant of the cultured cells was removed and 1 μg / ml of LPS and HA, HA-WS, HA-WI or S-HA were added to the cells and cultured for 24 hours. Then, supernatant was obtained to obtain an inflammatory cytokine Were measured. In order to measure the expression level of TNF-α, each sample was prepared to a concentration of 10, 100 or 1,000 μg / ml in 200 μl of medium. For the measurement of the expression level of IL-6, 200 占 퐂 / ml. Measurement of TNF-a and IL-6 was performed according to the manufacturer's protocol using an ELISA kit (Minneapolis, USA). At this time, as a control group, a negative control group treated with only 1 μg / ml of LPS and an untreated control group were used. As a result, the amounts of TNF-α and IL-6 produced are shown in FIGS. 6 and 7, respectively.

As shown in FIG. 6, the production of TNF-α was increased to 2,584 pg / ml by LPS, but decreased to 150 pg / ml when HA, HA-WS, HA-WI or S-HA was treated. In particular, treatment with S-HA at a concentration of 10, 100, or 1,000 占 퐂 / ml resulted in reduction to 60.64, 73.31, or 80.64 pg / ml, respectively. This is 54.13%, 49.97% or 45.59% reduction compared to HA and 28.86%, 18.72% or 14.69% reduction compared to HA-WI, respectively.

7, the production of IL-6 decreased to 62.20, 69.18, or 90.69 pg / ml, respectively, when S-HA was added at a concentration of 12.5, 50 or 200 占 퐂 / ml. This was 52.02%, 49.92%, or 40.88% reduction compared to HA and 9.51%, 7.88% or 11.02%, respectively, as compared to HA-WI.

From the above, it was found that S-HA significantly inhibited the expression of inflammatory cytokines in RAW 264.7 macrophages than HA or HA-WI.

Test Example  4. By S-HA iNOS  And COX-2 mRNA Confirming the inhibitory effect of

Generally, when an inflammatory reaction is initiated, NOS is expressed by an inducible nitric oxide synthase (iNOS), which transforms L-arginine into L-citrullin to produce NO It promotes the inflammatory reaction while generating. On the other hand, COX-2 (cyclooxygenase-2) promotes the formation of PGE ₂ . Thus, changes in gene expression levels of iNOS and COX-2 by S-HA were confirmed by the following method.

First, RAW 264.7 cells were placed in a 100 mm culture dish under the same conditions and in the same manner as in Test Example 1, and cultured for 4 hours to attach the cells to the plate. The supernatants of the cultured cells were removed and HA, HA-WS, HA-WI or S-HA diluted to a concentration of 1 / / ml of LPS and 10 / / ml were added to the cells, respectively. At this time, as a control group, a negative control group treated with only 1 μg / ml of LPS and an untreated control group were used. After culturing for 24 hours, the cells were collected and total RNA was isolated according to the manufacturer's protocol using RNeasy MiniKit (Qiagen, USA). The isolated RNA was quantitated using an RNA nano kit (2100 Bioanalyser system, Agilent Technologies, USA) and diluted with RNase-free water to a total RNA concentration of 500 ng / μl. cDNA was synthesized from the isolated RNA using iScript ™ Selectc DNA synthesis kit (Bio-Rad Laboratories, USA) and stored at -70 ° C.

Real-time PCR was performed to confirm the expression levels of iNOS and COX-2 using the synthesized cDNA. Specifically, the PCT by mixing each 1 ㎕ of a forward primer and a reverse primer of 1 ㎕ for the gene, the 2 ㎕ cDNA, and 16 ㎕ of ^{SsoFast ™ EvaGreen ® Supermix with low ROX} (Bio-Rad Laboratories, USA) Respectively. The sequences of the primers used are shown in Table 2 below. The cycle of reacting PCT at 95 캜 for 3 minutes, at 95 캜 for 10 seconds, at 55 캜 for 10 seconds, and at 72 캜 for 30 seconds was repeated 40 times. The extracted RNA was analyzed in Table 3, and the GAPDH gene was corrected in the internal control. The results are shown in FIG.

Name of the primer The sequence (5 '- > 3') Size (bp) SEQ ID NO: GAPDH forward primer cgtgccgcctggagaaacc 129 SEQ ID NO: 1 GAPDH reverse primer tgctgttgaagtcgcaggagac SEQ ID NO: 2 iNOS forward primer tggaggttctggatgagagc 95 SEQ ID NO: 3 iNOS reverse primer aatgtccaggaagtaggtgagg SEQ ID NO: 4 COX-2 forward primer gccgactaaatcaagcaacagtaac 100 SEQ ID NO: 5 COX-2 reverse primer catttctaggacaatgggcataaagc SEQ ID NO: 6

sample RNA concentration
(ng / ml) rRNA ratio
(28s / 18s) RIN
(RNA integrity number) Untreated control group 656 2.0 10 The negative control (LPS) 575 2.1 9.40 HA (reference material) 549 1.9 9.30 HA-WS 418 2.2 9.40 HA-WI 620 2.0 10 S-HA 529 2.1 9.90

As shown in Table 3, all extracted RNAs were confirmed to have RNA ratio (28s / 18s) value of 1.7 or more and RIN value of 8.0 or more. On the other hand, as shown in FIG. 8, when hyaluronic acid was treated, the expression levels of iNOS and COX-2 increased by LPS were significantly decreased. Specifically, the expression levels of iNOS and COX-2 by LPS were increased to 19.3 and 7.11, respectively. However, when HA, HA-WS, HA-WI or S- And expression levels were reduced to 4.5 and 2.6, respectively.

Therefore, it can be seen from the above that hyaluronic acid is not involved in the inflammatory reaction as an antigenic substance.

<110> Soonchunhyang University Industry Academy Cooperation Foundation <120> BIOMATERIAL FOR MEDICAL USE COMPRISING SULFATED-HYALURONIC ACID <130> FPD / 201604-0019 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 1 cgtgccgcct ggagaaacc 19 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 2 tgctgttgaa gtcgcaggag ac 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> iNOS forward primer <400> 3 tggaggttct ggatgagagc 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> iNOS reverse primer <400> 4 aatgtccagg aagtaggtga gg 22 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> COX-2 forward primer <400> 5 gccgactaaa tcaagcaaca gtaac 25 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> COX-2 reverse primer <400> 6 catttctagg acaatgggca taaagc 26

Claims (13)

A medical biomaterial comprising sulphated hyaluronic acid.
2. The method of claim 1, wherein the sulfated hyaluronic acid has the structure of Formula 1:
[Chemical Formula 1]

.
The biomaterial according to claim 1, wherein the biomaterial is a filler, a coating agent, an eye drop, a knee joint injection agent, or an anti-adhesion agent.
A pharmaceutical composition for the treatment of inflammatory diseases containing sulfated hyaluronic acid as an active ingredient.
5. The composition of claim 4, wherein said inflammatory disease is selected from the group consisting of degenerative arthritis, multiple sclerosis, sepsis, shock, bronchitis, dermatitis, allergy, retinitis, gastritis, hepatitis, enteritis, pancreatitis and nephritis.
A cosmetic composition for the treatment of inflammatory diseases containing sulfated hyaluronic acid as an active ingredient.
1) separating hyaluronic acid from the microorganism;
2) preparing a solution containing sulfur compounds;
3) adding the separated hyaluronic acid to the solution to prepare a mixture; And
4) adding an organic solvent containing sulfur to the mixture and reacting the resultant mixture to prepare a sulfated hyaluronic acid.
8. The method according to claim 7, wherein the hyaluronic acid is a water-insoluble hyaluronic acid.
8. The method according to claim 7, wherein the microorganism is Streptococcus dysgalactiae .
8. The process according to claim 7, wherein the sulfur compound is a dimethyl sulfoxide.
8. The method according to claim 7, wherein the hyaluronic acid of step 3) is added in an amount of 1 to 10% by weight.
8. The process according to claim 7, wherein the sulfur-containing organic solvent is sulfuric acid.
The process according to claim 7, wherein the sulfur-containing organic solvent and the mixture are mixed in a volume ratio of 0.1: 1 to 10: 1 in the step 4).

Images