KR20170114479A - Composition for preventing or treating cancer comprising inducer or activator of KRT19 - Google Patents

Composition for preventing or treating cancer comprising inducer or activator of KRT19 Download PDF

Info

Publication number
KR20170114479A
KR20170114479A KR1020160041407A KR20160041407A KR20170114479A KR 20170114479 A KR20170114479 A KR 20170114479A KR 1020160041407 A KR1020160041407 A KR 1020160041407A KR 20160041407 A KR20160041407 A KR 20160041407A KR 20170114479 A KR20170114479 A KR 20170114479A
Authority
KR
South Korea
Prior art keywords
cancer
krt19
expression
cells
breast cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
KR1020160041407A
Other languages
Korean (ko)
Other versions
KR101863433B1 (en
Inventor
조쌍구
쿠마 사하 수보로토
Original Assignee
건국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 건국대학교 산학협력단 filed Critical 건국대학교 산학협력단
Priority to KR1020160041407A priority Critical patent/KR101863433B1/en
Publication of KR20170114479A publication Critical patent/KR20170114479A/en
Application granted granted Critical
Publication of KR101863433B1 publication Critical patent/KR101863433B1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/10Screening for compounds of potential therapeutic value involving cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/50Determining the risk of developing a disease

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 KRT19의 발현 또는 활성 촉진제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물에 관한 것이다. KRT19가 넉다운된 유방암 세포에서 증식, 전이, 침윤, 약물 내성 및 구형성능이 높아짐을 확인하였고, KRT19가 β-catenin/RAC1 복합체와 반응하여 β-catenin의 안정성 및 세포 내 위치를 조절하고, 상기 β-catenin은 NUMB 프로모터에 결합하여 NOTCH 신호전달 경로의 활성을 차단할 수 있음을 확인하였다. 또한, KRT19를 과발현시킨 경우, 유방암세포의 세포 증식, 전이, 침습, 약물 내성 및 구형형성을 감소시킴으로써, 이를 암 예방 또는 치료에 유용하게 사용할 수 있다.The present invention relates to a composition for preventing or treating cancer comprising an expression or activity promoting agent for KRT19 as an active ingredient. KRT19 was found to increase proliferation, metastasis, invasion, drug resistance and spherical performance in knockdown breast cancer cells. KRT19 reacted with β-catenin / RAC1 complex to regulate β-catenin stability and intracellular location, -catenin could bind to the NUMB promoter and block the activity of the NOTCH signaling pathway. In addition, KRT19 overexpression can be useful for preventing or treating cancer by decreasing cell proliferation, metastasis, invasion, drug resistance and spheroid formation of breast cancer cells.

Description

KRT19의 발현 또는 활성 촉진제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물{Composition for preventing or treating cancer comprising inducer or activator of KRT19}[0001] The present invention relates to a composition for preventing or treating cancer comprising an expression or activity promoter of KRT19 as an active ingredient,

본 발명은 KRT19의 발현 또는 활성 촉진제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for preventing or treating cancer comprising an expression or activity promoting agent for KRT19 as an active ingredient.

유방암은 유전자의 돌연변이, 만성 염증, 독성 물질에 노출 및 스트레스 등 다양한 질병의 원인으로 알려진 질병이다. 유방암은 전 세계인 관심을 가지고 있으나 아직 발병 메커니즘은 알려져 있지 않다.Breast cancer is a disease known to cause a variety of diseases such as gene mutations, chronic inflammation, exposure to toxins and stress. Breast cancer is of worldwide concern but the mechanism of onset is still unknown.

KRT(Keratin) 패밀리의 일부 유전자는 유방암 환자의 림프절, 말초혈액, 골수에 있는 중요한 암 표지자로서 RT-PCR 실험을 통해 확인할 수 있다. KRT는 중간섬유 단백질로서 상피 조직의 마커라는 사실이 알려져 있다. KRT는 키나아제, 수용체, 어댑터 및 이펙터 등과 상호 작용하며, 상기 반응들은 신호전달에 의해 활성화 되며 세포의 이동, 침습, 전이, 세포주기 및 세포사멸 등을 조절하는 것으로 알려져 있다. 또한, KRT17은 어댑터 단백질과 결합하여 AKT/mTOR 경로를 통해 단백질 합성 및 세포 성장을 상향 조절한다는 점이 알려져 있다. 특히, KRT19 넉다운 마우스에서 유도 골격 근육 병증이 나타나며, KRT19는 AKT 신호전달 활성화를 시킬 수 있다. Some genes in the KRT (Keratin) family can be identified by RT-PCR as an important cancer marker in lymph nodes, peripheral blood, and bone marrow in breast cancer patients. It is known that KRT is a marker of epithelial tissue as an intermediate fiber protein. KRT interacts with kinases, receptors, adapters, and effectors, and these reactions are activated by signal transduction and are known to regulate cell migration, invasion, metastasis, cell cycle and cell death. It is also known that KRT17 binds to the adapter protein and upregulates protein synthesis and cell growth through the AKT / mTOR pathway. In particular, KRT19 knockdown mice exhibit induced skeletal myopathy and KRT19 can activate AKT signaling.

그러나, KRT19가 유방암과 관련되어, KRT19의 발현 또는 활성 조절이 유방암을 치료할 수 있다는 사실에 대하여서는 알려진 바 없다. 이에 본 발명의 발명자는 KRT19를 넉다운시킨 유방암 세포에서의 증식, 이주, 침윤, 약물 내성 및 구형성이 높아짐을 확인하고, KRT19가 β-catenin/RAC1 복합체와 반응하여 β-catenin의 안정성 및 위치 전환성을 조절하고, β-catenin은 NUMB 프로모터에 결합하여 유방암 세포의 발현을 촉진하는 것을 확인하고, KRT19을 통한 NUMB 발현 조절이 NOTCH-매게 유방암 및 줄기세포의 특성 신호전달과 관련 있음을 확인함으로써, 본 발명을 확인하였다.However, there is no known fact that KRT19 is associated with breast cancer and that the expression or activity regulation of KRT19 can treat breast cancer. Therefore, the inventors of the present invention have confirmed that KRT19 increases proliferation, migration, invasion, drug resistance and globule formation in breast cancer cells knocked down by KRT19, and KRT19 reacts with β-catenin / RAC1 complex to improve β- Β-catenin binds to the NUMB promoter and promotes the expression of breast cancer cells. By confirming that the regulation of NUMB expression through KRT19 is related to NOTCH-mediated breast cancer and stem cell signal transduction, The invention was confirmed.

본 발명의 목적은 KRT19(Keratin 19)의 발현 또는 활성 촉진제를 유효성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.It is an object of the present invention to provide a pharmaceutical composition for preventing or treating cancer, which comprises KRT19 (Keratin 19) expression or activity promoting agent as an active ingredient.

본 발명의 다른 목적은, KRT19의 발현 또는 활성을 측정하여, 암의 진단의 정보를 제공하는 방법을 제공하는 것이다.It is another object of the present invention to provide a method for measuring the expression or activity of KRT19 and providing information on the diagnosis of cancer.

본 발명의 또 다른 목적은, KRT19 또는 이와 관련된 유전자의 발현 또는 활성을 측정하여, 항암물질을 스크리닝하는 방법을 제공하는 것이다.It is still another object of the present invention to provide a method for screening anticancer substances by measuring the expression or activity of KRT19 or a gene associated therewith.

KRT19(Keratin 19)의 발현 또는 활성 촉진제를 유효성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물을 제공한다.A pharmaceutical composition for preventing or treating cancer, which comprises KRT19 (Keratin 19) expression or activity promoting agent as an active ingredient.

이하, 본 발명을 상세하게 설명한다.Hereinafter, the present invention will be described in detail.

본 발명의 KRT19는 KRT19가 넉다운된 유방암세포에서 세포의 증식, 전이, 침습, 약물 내성 및 구형형성을 증가시키고, KRT19를 과발현시킨 경우, 유방암세포의 세포 증식, 전이, 침습, 약물 내성 및 구형형성을 감소시킴으로써, 이를 암 예방 또는 치료에 유용하게 사용할 수 있다.The KRT19 of the present invention increases cell proliferation, metastasis, invasion, drug resistance and spheroid formation in KRT19 knockdown breast cancer cells, and when KRT19 is overexpressed, the cell proliferation, metastasis, invasion, drug resistance, Can be usefully used for cancer prevention or treatment.

본 발명의 암은 구강암, 간암, 위암, 결장암, 유방암, 폐암, 골암, 췌장암, 피부암, 두부암, 경부암, 피부암, 자궁경부암, 난소암, 대장암, 소장암, 직장암, 나팔관암종, 항문부근암, 자궁내막암종, 질암종, 음문암종, 호지킨병(Hodgkin's disease), 식도암, 임파선암, 방광암, 담낭암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직육종, 요도암, 음경암, 전립선암, 만성 백혈병, 급성 백혈병, 림프구 림프종, 신장암, 수뇨관암, 신장세포암종, 신장골반암종, 중추신경계 종양, 1차 중추신경계 림프종, 척수 종양, 뇌간 신경교종 및 뇌하수체 선종 등을 포함하며, 바람직하게는 유방암일 수 있다.The cancer of the present invention may be used for the treatment of cancer such as oral cancer, liver cancer, stomach cancer, colon cancer, breast cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head cancer, head cancer, skin cancer, cervical cancer, ovarian cancer, , Endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, lymph node cancer, bladder cancer, gallbladder cancer, endocrine cancer, thyroid cancer, pituitary cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, , Chronic leukemia, acute leukemia, lymphocytic lymphoma, renal cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brain glioma glioma and pituitary adenoma May be breast cancer.

본 발명에서, "KRT19의 발현 또는 활성 촉진제"는 KRT19에 직접 또는 간접적으로 작용하여 KRT19의 발현을 개선, 유도, 자극, 증가시키는 물질을 의미한다. 이런 물질은 유기 또는 무기 화합물과 같은 단일 화합물, 펩타이드, 단백질, 핵산, 탄수화물 및 지질과 같은 생체 고분자 화합물 및 복수 화합물의 복합체 등을 포함한다. 상기 물질이 KRT182의 발현 또는 활성을 촉진시키는 기작은 특별히 제한되지 않는다. 예를 들어, 물질은 전사, 번역 등의 유전자 발현을 증대시키는 것을 말한다.In the present invention, "KRT19 expression or activity promoter" means a substance which directly or indirectly acts on KRT19 to improve, induce, stimulate or increase expression of KRT19. Such materials include single compounds such as organic or inorganic compounds, biopolymer compounds such as peptides, proteins, nucleic acids, carbohydrates and lipids, and complexes of multiple compounds. The mechanism by which the substance promotes the expression or activity of KRT182 is not particularly limited. For example, a substance refers to increasing gene expression such as transcription, translation, and the like.

바람직하게는, KRT19의 발현 또는 활성을 촉진시키는 물질은 펩타이드, 단백질, 핵산, 탄수화물 및 지질과 같은 생체 고분자 화합물이다. 핵산 및 단백질 서열이 이미 공지된 KRT19 서열에 대하여 당업자는 촉진제로 작용하는 유기 또는 무기 화합물과 같은 단일 화합물 펩타이드, 단백질, 핵산, 탄수화물 및 지질과 같은 생체 고분자 화합물 및 복수 화합물의 복합체 등을 당 분야의 기술을 이용하여 제조하거나 스크리닝할 수 있다.Preferably, the substance that promotes expression or activity of KRT19 is a biopolymer compound such as a peptide, protein, nucleic acid, carbohydrate and lipid. With respect to the KRT19 sequence for which the nucleic acid and protein sequence are already known, those skilled in the art will appreciate that a single compound peptide such as an organic or inorganic compound acting as an accelerator, a biopolymer compound such as a protein, a nucleic acid, a carbohydrate and a lipid, Technology or can be screened.

본 발명의 KRT19 활성 촉진제는 KRT19 단백질 자체일 수 있고, 상기 KRT19 단백질의 아미노산 서열은 서열번호 1인 것을 특징으로 한다.The KRT19 activity promoter of the present invention may be the KRT19 protein itself, and the amino acid sequence of the KRT19 protein is SEQ ID NO: 1.

본 발명의 KRT19의 발현 촉진제는 유전자 치료 등에 사용되기 위하여 세포내에서 KRT19를 발현할 수 있는 벡터의 형태로 제공될 수 있다.The expression promoter of KRT19 of the present invention may be provided in the form of a vector capable of expressing KRT19 in a cell for use in gene therapy or the like.

따라서, 본 발명은 KRT19를 코딩하는 핵산, 바람직하게는 이 핵산을 함유하는 재조합 벡터를 유효성분으로 포함하는 암의 예방 및 치료용 조성물을 제공한다.Accordingly, the present invention provides a composition for the prevention and treatment of cancer comprising a nucleic acid encoding KRT19, preferably a recombinant vector containing the nucleic acid as an active ingredient.

상기 KRT19를 코딩하는 핵산은 서열번호 2의 염기서열로 구성될 수 있다.The nucleic acid encoding KRT19 may comprise the nucleotide sequence of SEQ ID NO: 2.

KRT19를 코딩하는 핵산 서열은, 이와 동등한 활성을 갖는 단백질을 코딩하는 한, 하나 이상의 핵산 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 변이될 수 있다. 이러한 핵산 분자의 서열은 단쇄 또는 이중쇄일 수 있으며, DNA 분자 또는 RNA(mRNA) 분자일 수 있다.The nucleotide sequence encoding KRT19 may be mutated by substitution, deletion, insertion, or a combination thereof, as long as one or more nucleic acid bases encode a protein having equivalent activity. The sequence of such a nucleic acid molecule may be short or double-stranded, and may be a DNA molecule or an RNA (mRNA) molecule.

본 발명의 벡터는, 리포좀, 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터 및 바이러스 벡터 등을 포함하나, 이에 제한되지 않는다. 본 발명에서 바람직한 벡터는 바이러스 벡터이다.The vector of the present invention includes, but is not limited to, liposomes, plasmid vectors, cosmid vectors, bacteriophage vectors, and viral vectors. A preferred vector in the present invention is a viral vector.

본 발명에서, 바람직한 바이러스 벡터의 예로는 아데노바이러스(adenovirus), 아데노부속바이러스(adenoassociated virus), 레트로바이러스(retrovirus), 렌티바이러스(lentivirus), 단순포진바이러스(herpes simplex virus), 알파바이러스(alpha virus) 등이 있다. 본 발명에서는 렌티 바이러스 벡터가 특히 바람직하다.Examples of preferred viral vectors in the present invention include adenoviruses, adenoassociated viruses, retroviruses, lentiviruses, herpes simplex viruses, alpha viruses, ). Lentivirus vectors are particularly preferred in the present invention.

본 발명의 재조합 벡터는 KRT19를 코딩하는 핵산과 이의 전사 또는 해독을 위한 조절서열을 포함할 수 있다. 특히 중요한 조절서열은 프로모터, 인핸서와 같이 전사 개시를 조절하는 것이다. 또한, 개시코돈, 종결코돈, 폴리아데닐화 시그널, 코작(Kozak), 인핸서, 막 표적화 및 분비를 위한 신호서열, IRES(Internal Ribosome Entry Site) 등으로 이루어진 조절서열을 포함할 수 있다. 이러한 조절서열과 KRT19를 코딩하는 핵산은 작동가능하게 연결되어야 할 것이다.The recombinant vector of the present invention may contain a nucleic acid encoding KRT19 and a regulatory sequence for transcription or translation thereof. A particularly important regulatory sequence is the regulation of transcription initiation, such as promoters and enhancers. It may also contain regulatory sequences consisting of initiation codon, termination codon, polyadenylation signal, Kozak, signal sequence for enhancer, membrane targeting and secretion, IRES (Internal Ribosome Entry Site), and the like. Such a regulatory sequence and a nucleic acid encoding KRT19 should be operably linked.

여기서, 사용된 용어 '작동가능하게 연결된'이란 핵산 서열간의 결합이 기능적으로 연관되어 있는 것을 의미한다. 임의의 핵산서열이 작동가능하게 연결된 경우는 임의의 핵산서열이 다른 핵산서열과 기능적으로 관련성을 가지도록 위치해 있는 경우이다. 본 발명에 있어서, 임의의 전사 조절서열이 KRT19를 코딩하는 핵산분자의 전사에 영향을 미치는 경우, 상기 전사 조절서열이 상기 핵산분자와 작동가능하게 연결되어 있다고 말한다.The term " operably linked " as used herein means that the binding between nucleic acid sequences is functionally related. When any nucleic acid sequence is operably linked, any nucleic acid sequence is located so as to be functionally related to another nucleic acid sequence. In the present invention, it is said that when any transcriptional regulatory sequence affects the transcription of a nucleic acid molecule encoding KRT19, the transcriptional control sequence is operably linked to the nucleic acid molecule.

본 발명의 KRT19의 발현 또는 활성 촉진제는 통상적인 방법에 따라 약제학적으로 허용되는 담체와 혼합하여 사용할 수 있다. 적합한 담체의 예로는, 락토오스, 덱스트로오스, 수크로오스, 솔비톨, 만니톨, 자일리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀루로오스, 미정질셀루로오스, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 필요에 따라 상기 조성물에 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.The expression or activity promoting agent of KRT19 of the present invention can be used in admixture with a pharmaceutically acceptable carrier according to a conventional method. Examples of suitable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. If necessary, the composition may further contain a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, an antiseptic, and the like.

본 발명의 조성물은 개체에 투여된 후 유효 성분의 신속 또는 지연된 방출을 제공할 수 있도록 당업계에 잘 알려진 방법을 사용하여 제형화될 수 있다. 제형은 정제, 분말, 환제, 에멀전, 용액, 시럽, 에어로졸, 연질 또는 경질 젤라틴 캅셀, 멸균 주사용액, 멸균 분말 등의 형태일 수 있다. 상기 제형은 1회용 투약 형태가 편리할 것이다.The compositions of the present invention may be formulated using methods well known in the art so as to provide for rapid or delayed release of the active ingredient after administration to the individual. Formulations may be in the form of tablets, powders, pills, emulsions, solutions, syrups, aerosols, soft or hard gelatine capsules, sterile injectable solutions, sterile powders and the like. The formulations will conveniently be in a disposable dosage form.

본 발명의 조성물은 약제학적으로 유효한 양으로 투여한다. 본 발명에서 "약제학적으로 유효한 양"은 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 질환의 중증도; 환자의 연령, 체중, 건강, 성별; 환자의 약물에 대한 민감도; 투여 시간, 투여 경로 및 배출 비율; 치료 기간; 사용된 본 발명의 조성물과 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 알려진 요소에 따라 결정될 수 있다. 바람직하게는, 본 발명의 약학적 조성물은 질환의 정도에 따라 유효량을 달리할 수 있으나, 바람직하게는 1~10000/체중 kg/day, 더욱 바람직하게는 10~1000/체중kg/day의 유효량으로 하루에 수회 반복 투여될 수 있다.The composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" as used herein means an amount sufficient to treat a disease, and the effective dose level is the severity of the disease; Age, weight, health, sex of the patient; The sensitivity of the patient to the drug; Administration time, route of administration and rate of release; Treatment period; Factors including, but not limited to, the drugs used in combination with or contemporaneously with the composition of the present invention used, and other factors known in the medical field. Preferably, the effective amount of the pharmaceutical composition of the present invention may vary depending on the severity of the disease, but is preferably an effective amount of 1 to 10000 / kg body weight / day, more preferably 10 to 1000 / kg body weight / day It can be repeatedly administered several times a day.

또한, 본 발명은 KRT19의 발현 촉진제를 포유동물에 투여하여 암을 예방 또는 치료하는 방법을 제공한다.In addition, the present invention provides a method for preventing or treating cancer by administering an expression promoter of KRT19 to a mammal.

상기 KRT19의 발현 촉진제를 투여하는 경로는 국소 (협측(buccal), 설하, 피부 및 안내의 투여를 포함), 비경구(피하, 피내 근육내, 혈관내 및 관절내의 투여를 포함) 또는 경피성 투여를 포함한 여러 경로를 포함한다.The pathway for administering the KRT19 expression promoting agent may be administered locally (including buccal, sublingual, subcutaneous, intradermal), parenterally (including subcutaneous, intradermal, intravascular and intraarticular administration) And the like.

상기 포유동물은 인간, 개, 돼지, 소, 말, 고양이, 양, 염소, 마우스 등을 포함하나, 이에 한정되지 않는다.Such mammals include, but are not limited to, humans, dogs, pigs, cows, horses, cats, sheep, goats, mice and the like.

또한, 본 발명의 일시예에 따르면,In addition, according to a temporal example of the present invention,

1)피검개체로부터 분리된 시료로부터 KRT19의 발현 또는 활성을 측정하는 단계; 및1) measuring the expression or activity of KRT19 from a sample isolated from the subject; And

2)상기 1)단계의 KRT19의 발현 또는 활성이 정상 대조군에 비해 감소한 경우, 암에 대한 위험성이 있는 것으로 판정하는 단계를 포함하는, 암의 진단의 정보를 제공하는 방법을 제공한다.2) determining that there is a risk for cancer when the expression or activity of KRT19 in step 1) is reduced compared to a normal control.

상기 1)단계의 시료는 세포, 조직, 혈액, 혈청, 타액 및 소변을 포함한, 이에 제한되지 않는다.The sample of step 1) above is not limited to cells, tissues, blood, serum, saliva and urine.

상기 단계 1)의 KRT19의 발현 또는 활성 정도를 측정하는 방법으로는 조직면역염색, 방사능면역분석법(RIA), 효소면역분석법(ELISA), 웨스턴블럿(Western Blotting), 면역침전분석법(Immunoprecipitation Assay), 면역확산분석법(Immunodiffusion Assay), 보체고정분석법(Complement Fixation Assay), FACS(Fluorescence-activated cell sorter) 및 단백질칩(protein chip) 분석법 및 RT-PCR를 포함한다.Methods for measuring the expression or activity of KRT19 in the step 1) include tissue immuno staining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting, immunoprecipitation assay, Immunodiffusion Assay, Complement Fixation Assay, Fluorescence-activated cell sorter (FACS) and protein chip analysis, and RT-PCR.

본 발명의 다른 일시예에 따르면,According to another example of the present invention,

1)항암 후보 물질을 세포주에 처리하는 단계;1) treating the cell line with an anticancer candidate substance;

2)상기 세포주에서 a)KRT19의 발현양, b)NUMB의 발현량 및 c)β-catenin와 RAC1의 결합 및 핵 내 위치화 및 d)NOTCH 신호전달 경로의 불활성화로 구성된 군으로부터 선택되는 하나 이상을 측정하는 단계; 및2) a cell line selected from the group consisting of a) an expression amount of KRT19, b) an expression amount of NUMB, c) a combination of β-catenin and RAC1 and localization in nucleus and d) inactivation of NOTCH signal transduction pathway Or more; And

3) 상기 2)단계의 결과를 대조군으로서 항암 후보 물질을 처리하지 않은 세포주와 비교하여, a)KRT19의 발현량이 증가, b)NUMB의 발현량의 증가, c)β-catenin와 RAC1의 결합 및 핵 내 위치화를 증가 및 d)NOTCH 신호전달 경로를 불활성화 시키는 화합물을 선별하는 단계;를 포함하는, 항암 후보 물질의 스크리닝 방법을 제공한다.3) Comparing the results of step 2) with those of cells treated with no anticancer candidate substance as a control, it was found that a) increased expression of KRT19, b) increased expression of NUMB, c) And (d) selecting compounds that inactivate the NOTCH signal transduction pathway.

상기 2)단계의 측정하는 단계은 조직면역염색, 방사능면역분석법(RIA), 효소면역분석법(ELISA), 웨스턴블럿(Western Blotting), 면역침전분석법(Immunoprecipitation Assay), 면역확산분석법(Immunodiffusion Assay), 보체고정분석법(Complement Fixation Assay), FACS(Fluorescence-activated cell sorter) 및 단백질칩(protein chip) 분석법 및 RT-PCR 중 선택된 1 종 이상의 방법을 이용한 것일 수 있다.The step of measuring in step 2) may be performed by a method selected from the group consisting of tissue immunostaining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting, immunoprecipitation assay, immunodiffusion assay, A complement fixation assay, a fluorescence-activated cell sorter (FACS), a protein chip analysis and an RT-PCR.

KRT19가 넉다운된 유방암 세포에서 증식, 전이, 침윤, 약물 내성 및 구형성능이 높아짐을 확인하였고, KRT19가 β-catenin/RAC1 복합체와 반응하여 β-catenin의 안정성 및 세포 내 위치를 조절하고, 상기 β-catenin은 NUMB 프로모터에 결합하여 NOTCH 신호전달 경로의 활성을 차단할 수 있음을 확인하였다. 또한, KRT19를 과발현시킨 경우, 유방암세포의 세포 증식, 전이, 침습, 약물 내성 및 구형형성을 감소시킴으로써, 이를 암 예방 또는 치료에 유용하게 사용할 수 있다.KRT19 was found to increase proliferation, metastasis, invasion, drug resistance and spherical performance in knockdown breast cancer cells. KRT19 reacted with β-catenin / RAC1 complex to regulate β-catenin stability and intracellular location, -catenin could bind to the NUMB promoter and block the activity of the NOTCH signaling pathway. In addition, KRT19 overexpression can be useful for preventing or treating cancer by decreasing cell proliferation, metastasis, invasion, drug resistance and spheroid formation of breast cancer cells.

도 1은 KRT 패밀리의 유방암 세포에서 발현양상 및 KRT19가 넉다운된 유방암에서 KRT 패밀리의 발현양상을 확인한 도이다.
도 2는 KRT19 넉다운(knockdown) 유방암세포에서 세포증식, 전이, 침습, 약물 내성 및 구형형성(sphere formation)을 확인한 도이다.
도 3은 KRT19 발현을 억제시킨 경우, 유방암 세포의 신호 전달 관련 유전자의 발현 정도를 확인한 도이다.
도 4는 DAPT를 처리한 경우, KRT19이 넉다운된 유방암 세포의 증식, 전이, 침습 및 NOTCH 신호전달 경로에 주는 영향을 확인한 도이다.
도 5는 KRT19가 β-catenin 핵 내 위치화에 주는 영향을 확인한 도이다.
도 6은 KRT19가 β-catenin/RAC1 복합체 형성 및 핵 내 위치화에 주는 영향을 확인한 도이다.
도 7은 유방암 줄기세포에서 KRT19의 역할을 확인한 도이다.
도 8은 KRT19 과발현 또는 NOTCH1 넉다운된 경우, 유방암 줄기세포의 세포 증식, 전이, 약물 내성 및 구형성을 억제하는 것을 확인한 도이다.
도 9은 KRT19 매게 NUMB 유전자 발현 조절의 모식도를 나타낸 도이다.
Brief Description of the Drawings Fig. 1 is a view showing expression pattern of KRT family in breast cancer cells and expression pattern of KRT family in KRT19 knockdown breast cancer.
Figure 2 shows cell proliferation, metastasis, invasion, drug resistance and sphere formation in KRT19 knockdown breast cancer cells.
FIG. 3 shows the expression level of signal transduction-related genes in breast cancer cells when KRT19 expression is inhibited.
FIG. 4 shows the effect of KRT19 on the proliferation, metastasis, invasion and NOTCH signaling pathway of knockdown breast cancer cells treated with DAPT.
FIG. 5 is a graph showing the effect of KRT19 on the localization in the β-catenin nucleus.
FIG. 6 shows the effect of KRT19 on β-catenin / RAC1 complex formation and nuclear localization.
FIG. 7 shows the role of KRT19 in breast cancer stem cells.
FIG. 8 is a graph showing inhibition of cell proliferation, metastasis, drug resistance and sphere formation of breast cancer stem cells when KRT19 overexpression or NOTCH1 knockdown.
FIG. 9 is a schematic diagram of KRT19 agonistic NUMB gene expression regulation. FIG.

이하 본 발명의 이해를 돕기 위하여 바람직한 실시예, 실험예 및 제조예를 제시한다. 그러나 하기의 실시예, 실험예 및 제조예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 실시예, 실험예 및 제조예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred embodiments, experimental examples, and production examples are provided to facilitate understanding of the present invention. However, the following examples, experimental examples and production examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples, experimental examples and production examples.

[[ 실시예Example 1]유방암에서1] In breast cancer KRTKRT family의 발현 수준 확인 family expression levels

1. 세포 배양1. Cell culture

인간 유방암 세포주(MDA-MB231, SKBR3, and MCF7), 간암 세포주(HepG2), 신경모세포종양 세포주(SH-SY5Y), 피부 세포주(HaCaT), 배아신장세포주 (HEK293T), 유방암 환자에서 얻은 CD133high/CXCR4high/ALDH1high sphere-forming KU-CSLCs 세포들을 10% FBS high glucose-DMEM, RPMI 1640 (Sigma-Aldrich, Saint Louis, MO, USA), 5% CO2, 37℃의 조건에서 배양하였다. CD133high/CXCR4high/ALDH1high KU-CSLCs은 직접 서울 건국대학교 병원에 있는 유방암 환자 조직에서 분리하여 준비하였고, 상기 실험은 임상 시험 심사위원회(IRB, KUH 1020003)의 규정에 따라 진행하였다.CD133 high / low expression levels of human breast cancer cell lines (MDA-MB231, SKBR3, and MCF7), hepatocellular carcinoma cell line (HepG2), neuroblastoma cell line (SH-SY5Y), skin cell line (HaCaT), embryonic kidney cell line (HEK293T) CXCR4 high / ALDH1 high sphere-forming KU-CSLCs cells were cultured in 10% FBS high glucose-DMEM, RPMI 1640 (Sigma-Aldrich, Saint Louis, MO, USA), 5% CO 2 and 37 ° C. CD133 high / CXCR4 high / ALDH1 high KU-CSLCs were prepared separately from breast cancer patient tissues at Konkuk University Hospital of Seoul, Korea and the experiment was conducted according to the criteria of IRB (KUH 1020003).

2. RT-2. RT- PCRPCR 분석을 통한 유방암에서  Analysis of Breast Cancer KRTKRT 패밀리의Family 발현 확인. Expression confirmation.

유방암에서 KRT 패밀리의 발현 양상을 확인하기 위하여, 하기와 같이 RT-PCR을 수행하였다. 제조업체의 방법에 따라 Easy-Blue total RNA extraction kit (iNtRON Biotechnology, Republic of Korea)를 사용하여 Total RNA을 추출하였다. 전체 RNA의 농도는 Nanodrop (ND1000) 분광 광도계(Nanodrop Technologies Inc., Wilmington DE, USA)로 측정하였다. Total RNA 2μg 및 M-MLV 역전사효소를 사용하여 cDNA을 합성하였고, PCR 반응은 끝난 후 1% 또는 1.5 % 아가로스 젤에서 분석하였다. qPCR은 SYBR Green 마스터 믹스를 사용하여 분석하였고, mRNA 발현은 GAPDH(House keeping gene)을 기준 값으로 이용하여 계산하였다. 각 유전자에 대한 프라이머 서열은 하기 표 1에 나타낸 프라이머를 사용하였다. 이의 결과를 도 1의 b 및 c에 나타내었다.In order to confirm the expression pattern of the KRT family in breast cancer, RT-PCR was performed as follows. Total RNA was extracted using Easy-Blue total RNA extraction kit (iNtRON Biotechnology, Republic of Korea) according to the manufacturer's method. The total RNA concentration was measured with a Nanodrop (ND1000) spectrophotometer (Nanodrop Technologies Inc., Wilmington, DE). CDNA was synthesized using 2 μg of total RNA and M-MLV reverse transcriptase, and the PCR reaction was analyzed in 1% or 1.5% agarose gel. qPCR was analyzed using SYBR Green master mix and mRNA expression was calculated using GAPDH (House keeping gene) as a reference value. The primers shown in Table 1 below were used as primers for each gene. The results are shown in Figs. 1 (b) and 1 (c).

Accession no.Accession no. GeneGene Forward(5`-3`)Forward (5'-3`) Reverse(5`-3`)Reverse (5'-3`) NM_057088.2NM_057088.2 KRT3KRT3 GAGCGGGAACAGATCAAGACGAGCGGGAACAGATCAAGAC TCCACTTGGTCTCCAGGACTTCCACTTGGTCTCCAGGACT NM_002272.3NM_002272.3 KRT4KRT4 AGATACCTTGGGCAATGACAAGATACCTTGGGCAATGACA CTTGTTCAGGTAGGCAGCATCTTGTTCAGGTAGGCAGCAT NM_000424.3 NM_000424.3 KRT5KRT5 CACCAAGACTGTGAGGCAGACACCAAGACTGTGAGGCAGA CCTTGTTCATGTAGGCAGCACCTTGTTCATGTAGGCAGCA NM_005556.3 NM_005556.3 KRT7KRT7 CTCCGGAATACCCGGAATGAGCTCCGGAATACCCGGAATGAG ATCACAGAGATATTCACGGCTCCATCACAGAGATATTCACGGCTCC NM_153490.2NM_153490.2 KRT13KRT13 ACGCCAAGATGATTGGTTTCACGCCAAGATGATTGGTTTC CGACCAGAGGCATTAGAGGTCGACCAGAGGCATTAGAGGT NM_000224.2NM_000224.2 KRT18KRT18 AGATCGAGGCTCTCAAGGAGGAGATCGAGGCTCTCAAGGAGG CACGGTCAACCCAGAGCTGCACGGTCAACCCAGAGCTG NM_002276.4NM_002276.4 KRT19KRT19 GCGAGCTAGAGGTGAAGATCGCGAGCTAGAGGTGAAGATC CGGAAGTCATCTGCAGCCACGGAAGTCATCTGCAGCCA NM_002046.5NM_002046.5 GAPDHGAPDH AATCCCATCACCATCTTCCAGAATCCCATCACCATCTTCCAG CACGATACCAAAGTTGTCATGGCACGATACCAAAGTTGTCATGG

3. 3. 웨스턴Western 블롯을Blot 이용한 유방암에서  Using breast cancer KRTKRT 패밀리family 발현 양상 확인 Identification of expression pattern

유방암에서 KRT 패밀리의 발현 양상을 확인하기 위하여, 웨스턴 블롯을 수행하였다. 세포 분해 완충액 [1% Triton X-100 (Sigma-Aldrich), 100mM Tris-HCl (pH 7.5), 10mM NaCl, 10% 글리세롤(Amresco, Solon OH, USA), 50mM sodium fluoride (Sigma-Aldrich), 1mM phenylmethylsulfonyl fluoride (PMSF; Sigma-Aldrich), 1 mM p-nitrophenyl phosphate (Sigma-Aldrich), 및 1mM sodiumorthovanadate(Sigma-Aldrich)]을 사용하여 용해물을 4℃에서 15분 동안 13,000 rpm으로 원심 분리하였다. 단백질 상등액을 Bradford 단백질 시약으로 정량하였고, 단백질을 다시 SDS PAGE (10% 또는 12%)에 녹였다. 상기 분리한 단백질을 니트로 셀률로오스 막에 옮긴 후, TBS(Tris-buffered saline) 용액에 녹여 있는 5% 탈지분유로 1시간 정도 반응시킨 후, KRT 패밀리에 대한 항체(Santa Cruz Biotechnology, Dallas, TX, USA)를 이용하여 4℃에서 12 내지 18시간 멤브레인에 결합시켰다. 이 후, HRP-tagged anti-mouse, -goat, 또는 -rabbit 항체와 결합시켰다. ECL kit(Amersham Bioscience, Piscataway NJ, USA)을 사용하여 단백질 신호를 측정하였다. 이의 결과를 도 1의 c에 나타내었다.To confirm the expression pattern of the KRT family in breast cancer, Western blotting was performed. (Sigma-Aldrich), 100 mM Tris-HCl (pH 7.5), 10 mM NaCl, 10% glycerol (Amresco, Solon OH, USA), 50 mM sodium fluoride The lysates were centrifuged at 13,000 rpm for 15 min at 4 ° C using 1 mM p-nitrophenyl phosphate (Sigma-Aldrich), 1 mM sodiumorthovanadate (Sigma-Aldrich) Protein supernatants were quantified with Bradford protein reagents and proteins were resolved in SDS PAGE (10% or 12%). The separated proteins were transferred to an osmium membrane at a nitrocellular rate and reacted with 5% skimmed milk powder dissolved in TBS (Tris-buffered saline) for about 1 hour. Then, the KRT family antibody (Santa Cruz Biotechnology, Dallas TX , USA) at < RTI ID = 0.0 > 4 C < / RTI > for 12-18 hours. This was followed by binding to an HRP-tagged anti-mouse, -goat, or -rabbit antibody. Protein signal was measured using ECL kit (Amersham Bioscience, Piscataway NJ, USA). The results are shown in Fig. 1 (c).

4. 결론4. Conclusion

유전자 발현을 Oncomine사이트에서 확인한 후(도 1의 a), 여러 가지 KRT 패밀리들의 발현수준을 비교하였다. 침윤된 유방암에서 KRT18과 KRT19 발현 양이 높음을 확인하였다. 특히 KRT19는 다른 KRT 패밀리 들보다 유방암과 정상적인 세포의 발현이 현격한 차이가 있음을 확인하여, KRT19은 유방암과 연관성이 크다는 점을 확인하였다. After gene expression was confirmed on Oncomine site (FIG. 1 a), expression levels of various KRT families were compared. It was confirmed that KRT18 and KRT19 expression levels were high in invasive breast cancer. In particular, KRT19 confirmed that there is a marked difference in the expression of breast cancer and normal cells compared with other KRT families, confirming that KRT19 is highly related to breast cancer.

[[ 실시예Example 2]KRT192] KRT19 넉다운Knockdown (knockdown) 유방암세포에서 세포증식, 전이, 침습, 약물 내성 및 구형형성(sphere formation)확인.(knockdown) Identification of cell proliferation, metastasis, invasion, drug resistance and sphere formation in breast cancer cells.

1. One. KRT19KRT19 넉다운(knockdown)세포Knockdown cells 제조 Produce

암세포에서 KRT19를 넉다운의 효과를 확인하기 위하여, 콘트롤(scerambled), KRT19(shKRT19) shRNA의 BamHI와 EcoRI 제한효소 절단 부위를 이용하였다. 어닐링된 올리고 뉴클레오티드는 pGreenPuro 렌티바이러스 발현 벡터에 삽입하여 KRT19-넉다운 및 KRT19-control 백터를 구성하였다. 이 후, 인산칼슘형질주입 방법에 따라 HEK293T 세포를 특정 렌티 바이러스 벡터 및 바이러스 패키징 플라스미드(RRE, REV)로 형질도입 시키고, 5% CO2, 37℃에서 72시간에 배양한 후, 바이러스 초 원심 분리기(Optima L-90K, Beckman Coulter Inc., CA, USA)를 사용하여 수집하였다. MDA-MB231, KU-CSLCs 및 MCF7 세포를 scrambled shRNA 또는 shKRT19로 감염시킨 다음, 5% CO2, 37℃에서 12시간 배양하였다. 12 내지 18시간 후, 새로운 미디어(High-Glucose DMEM/RPMI 1640 with 10% FBS)로 바꿔주고, 렌티 바이러스 감염 효율은 <95 %로 계산되었고, 렌티 바이러스 발현 유무는 RT-PCR 및 웨스턴블럿으로 확인하였다.BamHI and EcoRI restriction sites of KRT19 (shKRT19) shRNA were used to confirm the effect of KRT19 knockdown in cancer cells. The annealed oligonucleotides were inserted into the pGreenPuro lentivirus expression vector to construct a KRT19-knockdown and KRT19-control vector. Subsequently, HEK293T cells were transfected with a specific lentiviral vector and a virus packaging plasmid (RRE, REV) according to the calcium phosphate transfection method, cultured at 37 ° C in 5% CO 2 for 72 hours, (Optima L-90K, Beckman Coulter Inc., CA, USA). MDA-MB231, KU-CSLCs, and MCF7 cells were infected with scrambled shRNA or shKRT19, and then cultured at 37 ° C in 5% CO 2 for 12 hours. After 12 to 18 hours, the cells were replaced with new media (High-Glucose DMEM / RPMI 1640 with 10% FBS) and the lentivirus infection efficiency was calculated to be <95%, and the presence or absence of lentivirus expression was confirmed by RT-PCR and Western blot Respectively.

2. 2. KRT19가KRT19 넉다운된Knocked down 유방암 세포의 증식 확인 Confirmation of proliferation of breast cancer cells

상기 실시예 2.1의 KRT19 넉다운 후, 세포 증식에 대해 분석하기 위해 2× 104 cells/well 세포를 12-well에 준비한 후, 4일동안 배양하면서 각 24시간 마다 세포의 수를 측정하였다.To analyze cell proliferation after KRT19 knockdown in Example 2.1, 2 × 10 4 cells / well cells were prepared in 12-wells, and the number of cells was measured every 24 hours while culturing for 4 days.

이의 결과를 도 2의 d에 나타내었다.The result is shown in Fig. 2d.

3. 3. KRT19가KRT19 넉다운된Knocked down 유방암 세포의  Of breast cancer cells 전이능Transferability 확인 Confirm

KRT19가 넉다운된 유방암 세포의 전이능을 확인하기 위하여, 세포 이동 및 상처 치유 실험을 수행하였다. 보다 구체적으로, 1×106 cells/well 세포를 60mm 배양 접시에 준비한 후, 세포의 수가 90% confluence 까지 배양 후 이 세포들을 미토마이신 C (10 μg/ml)를 처리하여 5% CO2, 37℃에서 2 내지 3 시간 배양한 후 세포 분화를 억제하였다. 그 후 200μl 파이펫 팁(pipette tip)로 세포 단층에 상처를 낸 후, 세포들을 PBS 완충액으로 세 번 씻어 시간별(0, 12, 24 시간)로 사진을 찍어 세포 이동을 확인하였다.In order to confirm the metastatic potential of KRT19 knockdown breast cancer cells, cell migration and wound healing experiments were performed. More specifically, 1 × 10 6 cells / after the well cell prepared in 60mm petri dish, after the culture the number of cells to 90% confluence of the cells mitomycin C (10 μg / ml) of 5% CO 2, 37 treated Lt; RTI ID = 0.0 &gt; C &lt; / RTI &gt; for 2 to 3 hours. The cells were then scratched with a 200 μl pipette tip and the cells were washed three times with PBS buffer and photographed at time (0, 12, 24 hours) to confirm cell migration.

이의 결과를 도 2의 e에 나타내었다.The results are shown in Fig. 2e.

4. 4. KRT19가KRT19 넉다운된Knocked down 유방암 세포의 침습 확인 Confirmation of Breast Cancer Cell Invasion

세포 침습을 분석하기 위하여, CytoSelect™96-Wells Cell Invasion Assay Kit (Cell Biolabs Inc., CA, USA)를 사용하였다. 1×105 cells/well 세포를 96-well에 준비한 후 제조 업체의 방법에 따라 측정하였다. 이의 결과를 도 2의 f에 나타내었다.For analysis of cell invasion, CytoSelect ™ 96-Wells Cell Invasion Assay Kit (Cell Biolabs Inc., CA, USA) was used. 1 × 10 5 cells / well cells were prepared in 96-wells and assayed according to the manufacturer's method. The results are shown in FIG. 2F.

5. 5. KRT19가KRT19 넉다운된Knocked down 유방암 세포의 약물 내성 확인 Identification of drug resistance in breast cancer cells

KRT19가 넉다운된 유방암 세포의 약물 내성 분석을 위하여, 1×105 cells/well 세포를 12-well에 준비 한 후, 5% CO2, 37℃에서 12 내지 16시간 배양한 후, 0.5μM의 독소루비신을 처리하여 48시간 배양해서 세포의 숫자를 측정하여 생존 세포의 백분율(%)로 표현하였다. 또한, 약물 내성 마커인 ABCG2, ABCC1 및 ABCB5에 대한 RT-PCR을 수행하였다. 이의 결과를 도 2의 g에 나타내었다.For the drug resistance analysis of KRT19 knockdown breast cancer cells, 1 × 10 5 cells / well cells were prepared in 12-wells, followed by culturing at 5% CO 2 at 37 ° C. for 12-16 hours. Then, 0.5 μM doxorubicin And cultured for 48 hours. The number of cells was measured and expressed as a percentage (%) of living cells. RT-PCR was also performed on the drug resistance markers ABCG2, ABCC1 and ABCB5. The result is shown in Fig. 2 (g).

6. KRT19가 넉다운된 유방암 세포의 구형 형성(Sphere formation) 확인 6. KRT19 Confirm sphere formation of knock down breast cancer cells

KRT19가 넉다운된 유방암 세포의 구형 형성을 확인하기 위하여, 1×104 세포를 코팅하지 않은 플레이트에 각각 20ng/ml EGF, 10μg/ml 인슐린, 0.4% BSA을 첨가한 GM[growth medium: DMEM/RPMI 1640 (Sigma-Aldrich) with 10% FBS], SM[sphere-formation medium: serum-free DMEM/F12 supplemented with B27-supplement (1:50; Invitrogen, Carlsbad, CA, USA)] 배양액에서 배양하였다. In order to confirm the spherical formation of KRT19 knockdown breast cancer cells , 1 × 10 4 cells were seeded on a plate not coated with GM [growth medium: DMEM / RPMI (DMEM / F12 supplemented with B27-supplement (1:50; Invitrogen, Carlsbad, CA, USA)] supplemented with 10% FBS and 1640 (Sigma-Aldrich) with 10% FBS.

in vitro 구형형성을 위하여, 0.25% trypsin-EDTA를 처리하여 싱글 세포로 해리한 다음, 구형을 얻기 위해 non-coated plate 에 세포를 배양하였다. MDA-MB231, MCF7, 및 KU-CSLCs 세포에 있는 구형을 5일 배양한 다음, 수집하여 크리스탈 바이올렛으로 염색한 후 콜로니 형성 전에 Nikon eclipse TE2000-U microscopy로 사진을 촬영하였다. 이의 결과를 도 2의 h에 나타내었다.For in vitro spheroidization, cells were treated with 0.25% trypsin-EDTA to dissociate into single cells and then cultured on non-coated plates to obtain spheroids. Spheres in MDA-MB231, MCF7, and KU-CSLCs cells were cultured for 5 days, then collected, stained with crystal violet, and photographed with Nikon eclipse TE2000-U microscopy before colony formation. The results are shown in FIG. 2 h.

7. 줄기세포 7. Stem cells 마커Marker 발현확인 Confirmation of expression

줄기세포 마커의 발현을 확인하기 위하여, OCT4, SOX2, NANOG 및 c-MYC 유전자의 발현을 RT-PCR을 이용하여 확인하였다. 이의 결과를 도 2의 i에 나타내었다.To confirm the expression of stem cell markers, the expression of OCT4, SOX2, NANOG and c-MYC genes was analyzed by RT-PCR Respectively. The result is shown in Fig. 2 (i).

8. 결론8. Conclusion

KRT19는 유방암 세포 MDA-MB231와 MCF7에서 높은 발현이 보여 있기 때문에 두 세포에서 KRT19을 감소시킨 결과, shKRT19의 형질도입을 통해서 KRT19의 발현을 80% 감소시킴을 확인하였고, KRT19의 넉다운이 유방암 세포주에 영향을 주는 것을 확인하였다. Since KRT19 is highly expressed in breast cancer cells MDA-MB231 and MCF7, KRT19 was reduced in both cells. As a result, KRT19 expression was reduced by 80% by shKRT19 transfection, and KRT19 knockdown was detected in breast cancer cell line Respectively.

특히, 암세포의 증식, 전이, 침윤률, 약물 내성 마커 유전자들 ABCG2, ABCC1, ABCB5의 발현이 증가하는 경향이 나타남을 확인하였고, 구형형성을 증가시킴을 확인하였다.In particular, it was confirmed that the proliferation, metastasis, invasion rate, and drug resistance marker genes ABCG2, ABCC1, and ABCB5 expression tended to increase in cancer cells, and it was confirmed that spheroidization was increased.

[[ 실시예Example 3]KRT193] KRT19 넉다운(knockdown)의Knockdown NOTCH 신호 전달 경로에 대한 영향 확인. Identifying the impact on the NOTCH signaling pathway.

1. RT-1. RT- PCR을PCR 통한 NOTCH 신호 전달 경로 관련 유전자  Of NOTCH signaling pathway 발현양Expression level 확인. Confirm.

실시예 1에서 실시한 방법과 동일한 방법으로, 하기 표 2의 프라이머 서열을 이용하여, RT-PCR을 수행하여, NOTCH 신호 전달 경로 관련 유전자의 발현양을 확인하였다. 이의 결과를 도 3의 a에 나타내었다.RT-PCR was performed using primer sequences shown in Table 2 below in the same manner as in Example 1 to confirm the expression level of NOTCH signal transduction pathway related genes. The results are shown in Fig. 3 (a).

Accession no.Accession no. GeneGene Forward(5`-3`)Forward (5'-3`) Reverse(5`-3`)Reverse (5'-3`) NM_001005743.1NM_001005743.1 NUMBNUMB TCCCACCTCTCCTACTTCTGTCCCACTCTCCTACTTCTG TGCCTCCCCTTCTACTTCTGTGCCTCCCCTTCTACTTCTG NM_005430.3NM_005430.3 WNT1WNT1 CTTCGGCCGGGAGTTCGTGGCTTCGGCCGGGAGTTCGTGG CACCGTGCATGAGCCGGACACACCGTGCATGAGCCGGACA NM_017617.3 NM_017617.3 NOTCH1NOTCH1 GGGTACAAGTGCGACTGTGAGGGTACAAGTGCGACTGTGA CGGCAACGTCGTCAATACACCGGCAACGTCGTCAATACAC NM_014757.4NM_014757.4 MAML1MAML1 CACCAGCCACCGAGTAACTTCACCAGCCACCGAGTAACTT AACAGGGAGTTCTGCTCGTGAACAGGGAGTTCTGCTCGTG NM_005349.3NM_005349.3 RBPjKRBPjK GAACAAATGGAACGCGATGGGAACAAATGGAACGCGATGG GATGACTTTTATCCGCTTGCTGGATGACTTTTATCCGCTTGCTG NM_005524.3NM_005524.3 HES1HES1 GGCTAAGGTGTTTGGAGGCTGGCTAAGGTGTTTGGAGGCT GGTGGGTTGGGGAGTTTAGGGGTGGGTTGGGGAGTTTAGG NM_001130442.1NM_001130442.1 HRASHRAS TTCTACACGTTGGTGCGTGATTCTACACGTTGGTGCGTGA CACAAGGGAGGCTGCTGACCACAAGGGAGGCTGCTGAC NM_053056.2NM_053056.2 CCND1CCND1 CACACGGACTACAGGGGAGTCACACGGACTACAGGGGAGT ATGGTTTCCACTTCGCAGCAATGGTTTCCACTTCGCAGCA

2. 2. 웨스턴Western 블롯을Blot 이용한 Used NOTCH 신호 전달 경로 관련 유전자 및 세포주기 조절 관련 유전자 발현양 확인Notch signal transduction pathway genes and cell cycle control genes

실시예 1에서 실시한 방법과 동일한 방법으로, 웨스턴 블롯을 수행하여, NOTCH 신호 전달 경로 관련 유전자 및 세포주기 조절 관련 유전자의 발현양을 확인하였다. 이의 결과를 도 3의 b에 나타내었다. 도 3의 c에 KRT19, NOTCH1 및 NUMB의 상대 발현 정도를 Oncomine database에서 확인한 결과를 나타내었다.Western blotting was performed in the same manner as in Example 1 to confirm the expression level of NOTCH signal transduction pathway related gene and cell cycle control related gene. The results are shown in Fig. 3 (b). FIG. 3C shows the relative expression levels of KRT19, NOTCH1 and NUMB in the Oncomine database.

3. 결론3. Conclusion

KRT19을 넉다운 한 후, 세포 내의 신호전달 변화를 조사하였고, 상기 결과는 KRT19가 NOTCH 신호전달에 영향을 주는 것을 확인하였다. 상기 NOTCH 신호가 세포의 운명, 분화 및 증식에 영향을 주는 것을 확인하였다.After kinetics of KRT19 knockdown, intracellular signal transduction changes were examined and the results confirmed that KRT19 affects NOTCH signaling. It was confirmed that the NOTCH signal affects the fate, differentiation and proliferation of cells.

상기 결과는 NOTCH1 세포내 도메인(intracellular domain)이 MAML1와 RBPjK와 결합해서 세포핵으로 이동이 일어나는 것을 나타낸다. 또한, NOTCH1의 표적인 HES1, CyclinD1 및 H-Ras의 발현이 증가하는 경향을 확인하였다. The results show that the NOTCH1 intracellular domain binds to MAML1 and RBPjK and migrates to the nucleus. In addition, it was confirmed that the expression of HES1, Cyclin D1 and H-Ras, which are targets of NOTCH1, increases.

[[ 실시예Example 4]DAPT4] DAPT 처리하는 경우, 유방암 세포 증식, 전이 및 침습 확인 If processed, confirm breast cancer cell proliferation, metastasis and invasion

KRT19가 넉다운된 유방암세포에 DAPT[N-[(3,5-Difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine-1,1-dimethylethyl ester)를 처리한 후, 상기 유방암 세포의 증식(도 4a), 전이(도 4b) 및 침습(도 4c)을 확인하였다. 이의 결과를 도 4에 나타내었다.KRT19 knockdown breast cancer cells were treated with DAPT [ N - [(3,5-Difluorophenyl) acetyl] -L-alanyl-2-phenyl] glycine-1,1-dimethylethyl ester, (Fig. 4A), metastasis (Fig. 4B) and invasion (Fig. 4C). The results are shown in Fig.

도 4에 나타난 바와 같이, DAPT를 KRT19 넉다운 세포에 처리하는 경우, KRT19 넉다운으로 발생했던 세포증식 및 NOTCH 신호변화가 모두 회복됨을 확인하였다.As shown in FIG. 4, when DAPT was treated on KRT19 knockdown cells, it was confirmed that both cell proliferation and NOTCH signal changes caused by KRT19 knockdown were restored.

[[ 실시예Example 5]KRT19의5] of KRT19 β- β- catenin의catenin 핵 내 이동 조절확인 Confirm movement control in nucleus

1. β-1. β- catenin의catenin 핵 내 이동 조절확인. Confirmation of movement control in the nucleus.

KRT19와 β-catenin-RAC1 복합체와의 관계를 확인하기 위하여, KRT19 넉다운 세포에서 인산화-AKT, AKT, 인산화-GSK3β 및 GSK3β에 대하여, 웨스턴 블롯(도 5a 및 도 5b)을 수행하였다. 또한, 면역세포화학법(immunocytochemistry)을 이용하여, 세포 내 β-catenin/RAC1의 위치를 확인하였다(도 5의 c). 상기 면역세포화학법은 하기와 같이 수행하였다.To confirm the relationship between KRT19 and β-catenin-RAC1 complex, KRT19 knockdown Western blots (Figs. 5A and 5B) were performed on phosphorylated-AKT, AKT, phosphorylated-GSK3? And GSK3? In the cells. Also, the location of β-catenin / RAC1 was confirmed by immunocytochemistry (FIG. 5C). The immunocytochemistry was performed as follows.

1×104 KRT19가 넉다운된 세포를 준비하여 5% CO2, 37℃에서 24시간 동안 배양하였고, 상기 세포들을 PBS로 씻어, 4% 파라포름알데하이드(paraformaldehyde)로 고정하여 10분 동안 0.2% Triton X-100로 침투시켰다. 상기 고정된 세포들을 PBS에서 10% 정상 염소 혈청으로 1시간 동안 코딩하였고, 이 후, 1차 항체와 같이 배양하여 PBS로 희석한 후 4℃에서 하룻밤 배양하였다. PBS로 세 번 세척한 후, 세포들을 1시간 동안 이차 항체와 함께 배양하였다. 세포핵은 TOPRO3 (10μg/㎖)로 추가로 10분 내지 15분동안 염색하였다. 이 후, 세포를 PBS로 세 번 세척하였고, 면역 형광 반응은 Leica TCS SP5 II laser scanning confocal microscope(Leica Microsystems, Wetzlar, Germany)로 모니터하였다. 이의 결과를 도 5(도 5의 a: Phospho(p)-AKT, AKT, p-GSK3β 및 GSK3β의 수준을 확인(웨스턴 블롯); 도 5의 b:핵 또는 세포질 내의 β-catenin 및 RAC1 수준을 확인(웨스턴 블롯); 도 5의 면역세포화학법을 이용하여 β-catenin 및 RAC1의 세포 내 위치 확인)에 나타내었다.1 × 10 4 KRT19 knockdown cells were prepared and cultured in 5% CO 2 at 37 ° C. for 24 hours. The cells were washed with PBS, fixed with 4% paraformaldehyde, and incubated with 0.2% Triton X-100. &Lt; / RTI &gt; The fixed cells were coded in PBS with 10% normal goat serum for 1 hour, then incubated with primary antibody, diluted with PBS and incubated overnight at 4 ° C. After washing three times with PBS, cells were incubated with secondary antibody for 1 hour. The nuclei were stained with TOPRO3 (10 μg / ml) for an additional 10 to 15 minutes. Cells were washed three times with PBS and immunofluorescence was monitored with a Leica TCS SP5 II laser scanning confocal microscope (Leica Microsystems, Wetzlar, Germany). The results are shown in FIG. 5 (b: nucleotide or cytoplasmic β-catenin and RAC1 levels in FIG. 5) (FIG. 5: a: Phospho (p) -AKT, AKT, p-GSK3β and GSK3β Confirmation (Western Blot): Intracellular localization of β-catenin and RAC1 using immunocytochemistry of FIG. 5).

도 5에 나타난 바와 같이, 신호 전달 유전자 AKT와 GSK3β의 발현이 거의 큰 차이가 없는 것을 확인하였다. 또한, 전체적으로 β-catenin와 RAC1는 약간 감소하는 경향이 나타났지만 핵 안에 두 가지의 단백질이 유의적으로 감소함을 확인하였다.As shown in Fig. 5, it was confirmed that the expression of the signal transduction gene AKT and GSK3? Is not substantially different from each other. Overall, β-catenin and RAC1 tended to decrease slightly, but both proteins were significantly decreased in the nucleus.

2. 2. KRT19KRT19 , β-, β- catenincatenin  And RAC1RAC1 복합체의 핵 내 이동 확인. Confirmation of movement of the complex in the nucleus.

KRT19가 β-catenin과 RAC1 복합체에 직접 영향을 주는지 확인하기 위하여, 면역침강법(Co-immunoprecipitation)을 수행하였다. 이의 결과를 도 6(도 6의 a: A/G sepharose; KRT19, β-catenin, RAC1에 대한 항체; IgG를 이용한 면역침강법; 도 6의 b:가시화 시킬 수 있는 표지가 부착한 항체를 이용한 면역침강법 수행 결과; 도 6의 c: MG132를 처리한 세포에서 KRT19, β-catenin 및 RAC1의 단백질 발현양 확인; 도 6의 d:MG132 처리 후, 가시화 시킬 수 있는 표지가 부착한 항체를 이용한 면역침강법 수행 결과)에 나타내었다. Co-immunoprecipitation was performed to confirm whether KRT19 directly affects β-catenin and RAC1 complexes. The results are shown in FIG. 6 (a: A / G sepharose in FIG. 6: KRT19, β-catenin, an antibody against RAC1; an immunoprecipitation method using IgG; 6: c: FIG. 6: Expression of KRT19, β-catenin and RAC1 protein expression in cells treated with MG132; d in FIG. 6: labeled antibody that can be visualized after MG132 treatment Immunoprecipitation method results).

도 6에 나타난 바와 같이, KRT19가 직접 β-catenin과 RAC1 복합체에 영향을 주는 것으로 확인하였다. 그러나, KRT19를 넉다운시키면 상기 결합이 억제되는 것을 확인하였고, 프로테오좀(Proteasome) 억제제인 MG132를 처리하면 β-catenin 및 KRT19의 발현이 증가하고 RAC1는 큰 변화가 없음을 확인하였다. 즉, MG132을 처리하면 KRT19, β-catenin 및 RAC1의 발현이 다소 증가하는 반면, KRT19 발현이 억제되면, β-catenin과 RAC1는 극적으로 줄어드는 영향을 나타냄을 확인하였다. 따라서, KRT19는 β-catenin와 RAC1를 조절하는 역할을 하는 것을 확인하였다.As shown in FIG. 6, it was confirmed that KRT19 directly affects the β-catenin and RAC1 complexes. However, it was confirmed that the binding was inhibited when KRT19 was knocked down. When MG132, which is a proteasome inhibitor, was treated, the expression of β-catenin and KRT19 was increased and RAC1 was not significantly changed. That is, the expression of KRT19, β-catenin and RAC1 slightly increased when MG132 was treated, while that of β-catenin and RAC1 decreased dramatically when KRT19 expression was suppressed. Therefore, it was confirmed that KRT19 plays a role in regulating β-catenin and RAC1.

[[ 실시예Example 6] 유방암 줄기세포(KU- 6] Breast cancer stem cells (KU- CSLCsCSLCs )에서 )in KRT19의Of KRT19 역할 확인. Identify roles.

실시예 1 및 2와 동일한 방법으로, 환자 유래 CD133high/CXCRhigh/ALDH1high 유방암 줄기세포(KU-CSLCs; cancer stem-like cell)에서 KRT19, NOTCH1, HES1등의 발현을 확인하였고, 줄기세포 마커 유전자의 발현을 확인하였다. 이의 결과를 도 7에 나타내었다(도 7의 a: MDA-MB231 세포 및 KU-CSLCs 세포에서 KRT19 mRNA 발현양 확인; 도 7의 b: KRT19, NUMB, NOTCH1 및 HES1의 발현 수준 확인(RT-PCR 및 웨스턴 블롯); 도 7의 c 및 d: 구형성능 확인; 도 7의 e: 줄기세포 마커 유전자 발현 확인; 도 7의 f 성장배지 또는 구형성배지에서 MDA-MB231 및 KU-CSLCs 세포에 대한 양적 PCR 수행 결과; 도 7의 g: 면역결핍 마우스(SCID)에 MDA-MB231 또는 KU-CSLCs 세포를 이식한 4주 후, 종양 형성(좌), 상기 마우스에서 떼어낸 종양(우) 확인; 도 7의 h: 상기 세포를 이식한 마우스의 무게 측정; 도 7의 j: DAPT 처리 후, KRT18, NUMB, NOTCH1 및 HES 1 유전자의 발현 양상 확인; 도 7의 I DAPT 처리 후, 암의 전이 또는 침습능 확인)Expression of KRT19, NOTCH1, HES1, and the like was confirmed in patient-derived CD133 high / CXCR high / ALDH1high breast cancer stem cells (KU-CSLCs) in the same manner as in Examples 1 and 2, . The results are shown in FIG. 7 (a: MDA-MB231 cells and KU-CSLCs cells showed the expression level of KRT19 mRNA; Fig. 7b: expression levels of KRT19, NUMB, NOTCH1 and HES1 And Western blot); c and d of FIG. 7: confirmation of spherical performance; e of FIG. 7: confirmation of stem cell marker gene expression; quantification of MDA-MB231 and KU-CSLCs cells in f growth medium or spherical growth medium of FIG. 7; Fig. 7 g: Tumor formation (left), confirmation of tumor removed from the mouse (right) after 4 weeks of transplantation of MDA-MB231 or KU-CSLCs cells into immunodeficient mouse (SCID) 7: Determination of Expression Patterns of KRT18, NUMB, NOTCH1 and HES1 Gene after DAPT Treatment: After the DAPT treatment in Fig. 7, the transfer or invasiveness of cancer Confirm)

도 7에 나타난 바와 같이, 유방암 줄기세포(KU-CSLCs)에서 KRT19가 낮은 발현을 보여 주며, NOTCH1과 HES1 또한 낮은 수준으로 나타남을 확인하였다. 또한, KU-CSLCs는 구형성에서 구형성 배지뿐만 아니라 일반 배양액에서 쉽게 형성됨을 확인하였다. 또한, 상기 세포는 줄기세포 마커 유전자의 발현이 높음을 확인하였다.As shown in FIG. 7, KRT19 showed low expression in breast cancer stem cells (KU-CSLCs), and NOTCH1 and HES1 also showed low levels. In addition, it was confirmed that KU-CSLCs were easily formed in spherical form as well as spherical form medium in spherical form. In addition, the cells showed high expression of the stem cell marker gene.

또한, DAPT를 세포에 처리한 경우, shKRT19 MDA-MB231 및 KU-CSLCs에서 NUMB 발현이 대조군과 차이가 없었으며 DAPT는 세포의 증식 및 전이 등의 특징을 억제하고, 줄기세포 마커 유전자들의 발현을 감소시킴을 확인하였다. 특히, KU-CSLCs에서 상기의 변화가 더 심하게 나타남을 확인하였다. In addition, when DAPT was treated with cells, NUMB expression in shKRT19 MDA-MB231 and KU-CSLCs was not different from that of the control. DAPT inhibited cell proliferation and metastasis, decreased expression of stem cell marker genes Respectively. Especially, it was confirmed that the above-mentioned change appears more strongly in KU-CSLCs.

[[ 실시예Example 7]KRT19을7] KRT19 과발현 또는  Overexpression or NOTCH1NOTCH1 억제 시, 유방암 줄기세포(KU- When suppressed, breast cancer stem cells (KU- CSLCsCSLCs )의 세포증식, 전이, 약물 내성, 및 ), Cell proliferation, metastasis, drug resistance, and 구형성Sphere formation 억제확인. Confirming inhibition.

1. One. KRT19KRT19 과발현 또는  Overexpression or NOTHCH1NOTHCH1 넉다운Knockdown 세포 제조 Cell Manufacturing

NOTCH1 넉다운세포는 실시예 1의 방법에 따라, shNOTCH를 클로닝하여 제조하였다. KRT19의 과발현을 위하여, KRT19의 유전자를 pGEM-T Easy 백터 (Promega, Madison, WI, USA)에 클로닝 후, pCDH-EF1-MCS-T2A-copGFP lentiviral vector (System Biosciences)에 서브 클로닝하였다. 이를 인산칼슘형질주입 방법에 따라 HEK293T 세포를 특정 렌티 바이러스 벡터 및 바이러스 패키징 플라스미드(RRE, REV)로 형질도입시켰다. 5 % CO2, 37 ℃에서 72시간에 배양한 후 바이러스 초 원심 분리기(Optima L-90K, Beckman Coulter Inc., CA, USA)를 사용하여 수집하였다. 이 후, MDA-MB231, KU-CSLCs 및 MCF7 세포에 상기 렌티바이러스로 감염시킨 다음, 5% CO2, 37℃에서 12시간 배양하였고, 12 내지 18시간 후, 새로운 배지(High-Glucose DMEM/RPMI 1640 with 10% FBS)로 바꿔주었다. 렌티 바이러스 감염 효율은 <95 %로 계산되었고, 렌티 바이러스 발현 유무는 RT-PCR 및 웨스턴블럿 분석으로 확인하였다.NOTCH1 knockdown cells were prepared by cloning shNOTCH according to the method of Example 1. For over-expression of KRT19, sub-cloned in the gene KRT19 pGEM -T Easy vector (Promega, Madison, WI, USA ), pCDH-EF1-MCS-T2A-copGFP lentiviral vector (System Biosciences) and then cloned into the. HEK293T cells were transfected with a specific lentiviral vector and a virus packaging plasmid (RRE, REV) according to the calcium phosphate transfection method. 5% CO 2 at 37 ° C for 72 hours, and then harvested using a virus ultracentrifuge (Optima L-90K, Beckman Coulter Inc., CA, USA). MDA-MB231, KU-CSLCs and MCF7 cells were then infected with the lentivirus and then cultured at 37 ° C for 12 hours in 5% CO 2. After 12 to 18 hours, the cells were cultured in new medium (High-Glucose DMEM / RPMI 1640 with 10% FBS). The efficiency of lentivirus infection was calculated to be <95%, and the presence or absence of lentivirus expression was confirmed by RT-PCR and Western blot analysis.

2. KRT19을 과발현 또는 NOTCH1 억제 시, 유방암 줄기세포(KU- CSLCs )의 세포증식, 전이, 약물 내성, 및 구형성 억제확인. 2 . Confirming cell proliferation, metastasis, drug resistance, and sphere formation inhibition of breast cancer stem cells (KU- CSLCs ) upon overexpression of KRT19 or inhibition of NOTCH1 .

KRT19가 NOTCH1 신호를 조절하는 것을 확인하기 위하여, KRT19 과발현 또는 NOTCH1를 감소시키는 실험을 수행하였다. 이의 결과를 도 8(도 8의 a:KRT19를 과발현 또는 NOTCH1 넉다운시킨 경우, KRT19, NUMB, NOTCH1 및 HES1의 발현; 도 8의 b:KRT19를 과발현 또는 NOTCH1 넉다운 시킨 경우, 세포 증식 확인; 도 8의 c:KRT19를 과발현 또는 NOTCH1 넉다운 시킨 경우, 세포의 전이 및 침습능 확인; 도 8의 d:KRT19를 과발현 또는 NOTCH1 넉다운 시킨 경우, 약물 저항능 확인; 도 8의 e:KRT19를 과발현 또는 NOTCH1 넉다운 시킨 경우, 구형성능 확인; 도 8의 f: KRT19를 과발현 또는 NOTCH1 넉다운시킨 경우, 줄기세포 마커 발현 확인)에 나타내었다. In order to confirm that KRT19 regulates the NOTCH1 signal, experiments were performed to reduce KRT19 overexpression or NOTCH1. The results are shown in FIG. 8 (a in FIG. 8: expression of KRT19, NUMB, NOTCH1 and HES1 when KRT19 is overexpressed or NOTCH1 knockdown; b in FIG. 8: confirmation of cell proliferation when overexpression or NOTCH1 knockdown of KRT19; 8: confirmation of drug resistance when KRT19 is overexpressed or NOTCH1 knockdown; e: KRT19 is overexpressed or NOTCH1 knockdown , F: confirmation of expression of stem cell marker when KRT19 was overexpressed or NOTCH1 knockdown, as shown in Fig. 8).

도 8에 나타난 바와 같이, 상기 두 실험 결과가 같은 경향을 보임을 확인하였다. 또한, KRT19의 발현이 증가하거나 NOTCH1이 감소하면 KU-CSLCs 세포의 증식, 전이를 억제하며 약물 내성 마커와 줄기세포 마커들의 발현이 감소됨을 확인하였다. 상기의 결과는 KRT19가 NUMB를 통해서 NOTCH 신호를 조절하는 것을 나타낸다.As shown in FIG. 8, it is confirmed that the above two experimental results show the same tendency. In addition, when KRT19 expression was increased or NOTCH1 was decreased, proliferation and metastasis of KU-CSLCs cells were inhibited and the expression of drug resistance markers and stem cell markers was decreased. The above results indicate that KRT19 regulates the NOTCH signal through NUMB.

<110> Kunkuk-Industry cooperation foundation <120> Composition for preventing or treating cancer comprising inducer or activator of KRT19 <130> P-1 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 400 <212> PRT <213> Artificial Sequence <220> <223> it is KRT19 amino acid sequence <400> 1 Met Thr Ser Tyr Ser Tyr Arg Gln Ser Ser Ala Thr Ser Ser Phe Gly 1 5 10 15 Gly Leu Gly Gly Gly Ser Val Arg Phe Gly Pro Gly Val Ala Phe Arg 20 25 30 Ala Pro Ser Ile His Gly Gly Ser Gly Gly Arg Gly Val Ser Val Ser 35 40 45 Ser Ala Arg Phe Val Ser Ser Ser Ser Ser Gly Ala Tyr Gly Gly Gly 50 55 60 Tyr Gly Gly Val Leu Thr Ala Ser Asp Gly Leu Leu Ala Gly Asn Glu 65 70 75 80 Lys Leu Thr Met Gln Asn Leu Asn Asp Arg Leu Ala Ser Tyr Leu Asp 85 90 95 Lys Val Arg Ala Leu Glu Ala Ala Asn Gly Glu Leu Glu Val Lys Ile 100 105 110 Arg Asp Trp Tyr Gln Lys Gln Gly Pro Gly Pro Ser Arg Asp Tyr Ser 115 120 125 His Tyr Tyr Thr Thr Ile Gln Asp Leu Arg Asp Lys Ile Leu Gly Ala 130 135 140 Thr Ile Glu Asn Ser Arg Ile Val Leu Gln Ile Asp Asn Ala Arg Leu 145 150 155 160 Ala Ala Asp Asp Phe Arg Thr Lys Phe Glu Thr Glu Gln Ala Leu Arg 165 170 175 Met Ser Val Glu Ala Asp Ile Asn Gly Leu Arg Arg Val Leu Asp Glu 180 185 190 Leu Thr Leu Ala Arg Thr Asp Leu Glu Met Gln Ile Glu Gly Leu Lys 195 200 205 Glu Glu Leu Ala Tyr Leu Lys Lys Asn His Glu Glu Glu Ile Ser Thr 210 215 220 Leu Arg Gly Gln Val Gly Gly Gln Val Ser Val Glu Val Asp Ser Ala 225 230 235 240 Pro Gly Thr Asp Leu Ala Lys Ile Leu Ser Asp Met Arg Ser Gln Tyr 245 250 255 Glu Val Met Ala Glu Gln Asn Arg Lys Asp Ala Glu Ala Trp Phe Thr 260 265 270 Ser Arg Thr Glu Glu Leu Asn Arg Glu Val Ala Gly His Thr Glu Gln 275 280 285 Leu Gln Met Ser Arg Ser Glu Val Thr Asp Leu Arg Arg Thr Leu Gln 290 295 300 Gly Leu Glu Ile Glu Leu Gln Ser Gln Leu Ser Met Lys Ala Ala Leu 305 310 315 320 Glu Asp Thr Leu Ala Glu Thr Glu Ala Arg Phe Gly Ala Gln Leu Ala 325 330 335 His Ile Gln Ala Leu Ile Ser Gly Ile Glu Ala Gln Leu Gly Asp Val 340 345 350 Arg Ala Asp Ser Glu Arg Gln Asn Gln Glu Tyr Gln Arg Leu Met Asp 355 360 365 Ile Lys Ser Arg Leu Glu Gln Glu Ile Ala Thr Tyr Arg Ser Leu Leu 370 375 380 Glu Gly Gln Glu Asp His Tyr Asn Asn Leu Ser Ala Ser Lys Val Leu 385 390 395 400 <210> 2 <211> 1201 <212> DNA <213> Artificial Sequence <220> <223> it is KRT19 DNA sequence <400> 2 atgacttcct acagctatcg ccagtcgtcg gccacgtcgt ccttcggagg cctgggcggc 60 ggctccgtgc gttttgggcc gggggtcgcc tttcgcgcgc ccagcattca cgggggctcc 120 ggcggccggg cgtatccgtg tcctccgccc gctttgtgtc ctcgtcctcc tcgggggcct 180 acggcggcgg ctacggcgcg tcctgaccgc gtccgacggg ctgctggcgg gcaacgagaa 240 gctaaccatg cagaacctca acgaccgcct ggcctcctac ctggacaagg tgcgcgccct 300 ggaggcggcc aacggcgagc tagaggtgaa gatccgcgac tggtaccaga agcaggggcc 360 tgggccctcc cgcgactaca gccactacta cacgaccatc caggacctgc gggacaagat 420 tcttggtgcc accattgaga actccaggat tgtcctgcag atcgacaatg cccgtctggc 480 tgcagatgac ttccgaacca agtttgagac ggaacaggct ctgcgcatga gcgtggaggc 540 cgacatcaac ggcctgcgca gggtgctgga tgagctgacc ctggccagga ccgacctgga 600 gatgcagatc gaaggcctga aggaagagct ggcctacctg aagaagaacc atgaggagga 660 aatcagtacg ctgaggggcc aagtgggagg ccaggtcagt gtggaggtgg attccgctcc 720 gggcaccgat ctcgccaaga tcctgagtga catgcgaagc caatatgagg tcatggccga 780 gcagaaccgg aaggatgctg aagcctggtt caccagccgg actgaagaat tgaaccggga 840 ggtcgctggc cacacggagc agctccagat gagcaggtcc gaggttactg acctgcggcg 900 cacccttcag ggtcttgaga ttgagctgca gtcacagctg agcatgaaag ctgccttgga 960 agacacactg gcagaaacgg aggcgcgctt tggagcccag ctggcgcata tccaggcgct 1020 gatcagcggt attgaagccc agctgggcga tgtgcgagct gatagtgagc ggcagaatca 1080 ggagtaccag cggctcatgg acatcaagtc gcggctggag caggagattg ccacctaccg 1140 cagcctgctc gagggacagg aagatcacta caacaatttg tctgcctcca aggtcctctg 1200 a 1201 <110> Kunkuk-Industry effort foundation <120> Composition for preventing or treating cancer          or activator of KRT19 <130> P-1 <160> 2 <170> KoPatentin 3.0 <210> 1 <211> 400 <212> PRT <213> Artificial Sequence <220> <223> it is KRT19 amino acid sequence <400> 1 Met Thr Ser Tyr Ser Tyr Arg Gln Ser Ser Ala Thr Ser Ser Phe Gly   1 5 10 15 Gly Leu Gly Gly Gly Gly Ser Val Arg Phe Gly Pro Gly Val Ala Phe Arg              20 25 30 Ala Pro Ser Ile His Gly Gly Ser Gly Gly Arg Gly Val Ser Ser Ser          35 40 45 Ser Ala Arg Phe Val Ser Ser Ser Ser Gly Ala Tyr Gly Gly Gly      50 55 60 Tyr Gly Gly Val Leu Thr Ala Ser Asp Gly Leu Leu Ala Gly Asn Glu  65 70 75 80 Lys Leu Thr Met Gln Asn Leu Asn Asp Arg Leu Ala Ser Tyr Leu Asp                  85 90 95 Lys Val Arg Ala Leu Glu Ala Ala Asn Gly Glu Leu Glu Val Lys Ile             100 105 110 Arg Asp Trp Tyr Gln Lys Gln Gly Pro Gly Pro Ser Arg Asp Tyr Ser         115 120 125 His Tyr Tyr Thr Thr Ile Gln Asp Leu Arg Asp Lys Ile Leu Gly Ala     130 135 140 Thr Ile Glu Asn Ser Arg Ile Val Leu Gln Ile Asp Asn Ala Arg Leu 145 150 155 160 Ala Ala Asp Asp Phe Arg Thr Lys Phe Glu Thr Glu Gln Ala Leu Arg                 165 170 175 Met Ser Val Glu Ala Asp Ile Asn Gly Leu Arg Arg Val Leu Asp Glu             180 185 190 Leu Thr Leu Ala Arg Thr Asp Leu Glu Met Gln Ile Glu Gly Leu Lys         195 200 205 Glu Glu Leu Ala Tyr Leu Lys Lys Asn His Glu Glu Glu Ile Ser Thr     210 215 220 Leu Arg Gly Gln Val Gly Gly Gln Val Ser Val Glu Val Asp Ser Ala 225 230 235 240 Pro Gly Thr Asp Leu Ala Lys Ile Leu Ser Asp Met Arg Ser Gln Tyr                 245 250 255 Glu Val Met Ala Glu Gln Asn Arg Lys Asp Ala Glu Ala Trp Phe Thr             260 265 270 Ser Arg Thr Glu Glu Leu Asn Arg Glu Val Ala Gly His Thr Glu Gln         275 280 285 Leu Gln Met Ser Ser Ser Glu Val Thr Asp Leu Arg Arg Thr Leu Gln     290 295 300 Gly Leu Glu Ile Glu Leu Glu Ser Glu Leu Ser Met Lys Ala Ala Leu 305 310 315 320 Glu Asp Thr Leu Ala Glu Thr Glu Ala Arg Phe Gly Ala Gln Leu Ala                 325 330 335 His Ile Gln Ala Leu Ile Ser Gly Ile Glu Ala Gln Leu Gly Asp Val             340 345 350 Arg Ala Asp Ser Glu Arg Gln Asn Gln Glu Tyr Gln Arg Leu Met Asp         355 360 365 Ile Lys Ser Arg Leu Glu Gln Glu Ile Ala Thr Tyr Arg Ser Leu Leu     370 375 380 Glu Gly Glu Glu Asp His Tyr Asn Asn Leu Ser Ala Ser Lys Val Leu 385 390 395 400 <210> 2 <211> 1201 <212> DNA <213> Artificial Sequence <220> <223> it is KRT19 DNA sequence <400> 2 atgacttcct acagctatcg ccagtcgtcg gccacgtcgt ccttcggagg cctgggcggc 60 ggctccgtgc gttttgggcc gggggtcgcc tttcgcgcgc ccagcattca cgggggctcc 120 ggcggccggg cgtatccgtg tcctccgccc gctttgtgtc ctcgtcctcc tcgggggcct 180 acggcggcgg ctacggcgcg tcctgaccgc gtccgacggg ctgctggcgg gcaacgagaa 240 gctaaccatg cagaacctca acgaccgcct ggcctcctac ctggacaagg tgcgcgccct 300 ggaggcggcc aacggcgagc tagaggtgaa gatccgcgac tggtaccaga agcaggggcc 360 tgggccctcc cgcgactaca gccactacta cacgaccatc caggacctgc gggacaagat 420 tcttggtgcc accattgaga actccaggat tgtcctgcag atcgacaatg cccgtctggc 480 tgcagatgac ttccgaacca agtttgagac ggaacaggct ctgcgcatga gcgtggaggc 540 cgacatcaac ggcctgcgca gggtgctgga tgagctgacc ctggccagga ccgacctgga 600 gatgcagatc gaaggcctga aggaagagct ggcctacctg aagaagaacc atgaggagga 660 aatcagtacg ctgaggggcc aagtgggagg ccaggtcagt gtggaggtgg attccgctcc 720 gggcaccgat ctcgccaaga tcctgagtga catgcgaagc caatatgagg tcatggccga 780 gcagaaccgg aaggatgctg aagcctggtt caccagccgg actgaagaat tgaaccggga 840 ggtcgctggc cacacggagc agctccagat gagcaggtcc gaggttactg acctgcggcg 900 cacccttcag ggtcttgaga ttgagctgca gtcacagctg agcatgaaag ctgccttgga 960 agacacactg gcagaaacgg aggcgcgctt tggagcccag ctggcgcata tccaggcgct 1020 gatcagcggt attgaagccc agctgggcga tgtgcgagct gatagtgagc ggcagaatca 1080 ggagtaccag cggctcatgg acatcaagtc gcggctggag caggagattg ccacctaccg 1140 cagcctgctc gagggacagg aagatcacta caacaatttg tctgcctcca aggtcctctg 1200 a 1201

Claims (9)

KRT19(Keratin 19)의 발현 또는 활성 촉진제를 유효성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물.A pharmaceutical composition for preventing or treating cancer, comprising KRT19 (Keratin 19) expression or activity promoting agent as an active ingredient. 제 1 항에 있어서, 상기 KRT19의 활성 촉진제는 서열번호 1의 아미노산 서열로 이루어진 KRT19 단백질인 것인, 조성물.2. The composition of claim 1, wherein the activity promoter of KRT19 is the KRT19 protein consisting of the amino acid sequence of SEQ ID NO: 1. 제 1 항에 있어서, 상기 KRT19의 발현 촉진제는 서열번호 2의 염기서열로 이루어진 것인, 조성물.2. The composition according to claim 1, wherein the expression promoter of KRT19 comprises the nucleotide sequence of SEQ ID NO: 2. 제 1 항에 있어서, 상기 암은 구강암, 간암, 위암, 결장암, 유방암, 폐암, 골암, 췌장암, 피부암, 두부암, 경부암, 피부암, 자궁경부암, 난소암, 대장암, 소장암, 직장암, 나팔관암종, 항문부근암, 자궁내막암종, 질암종, 음문암종, 호지킨병(Hodgkin's disease), 식도암, 임파선암, 방광암, 담낭암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직육종, 요도암, 음경암, 전립선암, 만성 백혈병, 급성 백혈병, 림프구 림프종, 신장암, 수뇨관암, 신장세포암종, 신장골반암종, 중추신경계 종양, 1차 중추신경계 림프종, 척수 종양, 뇌간 신경교종 및 뇌하수체 선종으로 이루어진 군 중 선택된 1종 이상인 것인, 조성물. The method of claim 1, wherein the cancer is selected from the group consisting of oral cancer, liver cancer, stomach cancer, colon cancer, breast cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head cancer, cervical cancer, skin cancer, cervical cancer, ovarian cancer, Endometrioid cancer, thyroid cancer, pituitary cancer, soft tissue sarcoma, soft tissue sarcoma, urethral cancer, penile cancer, endometrioid cancer, endometrial cancer, endometrial carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, Hodgkin's disease, A cancer of the central nervous system, a primary central nervous system lymphoma, a spinal cord tumor, a brain giant glioma, and a pituitary adenoma. The term &quot; cancer &quot; &Lt; / RTI &gt; 1)피검개체로부터 분리된 시료로부터 KRT19의 발현 또는 활성을 측정하는 단계; 및
2)상기 1)단계의 KRT19의 발현 또는 활성이 정상 대조군에 비해 감소한 경우, 암에 대한 위험성이 있는 것으로 판정하는 단계를 포함하는, 암의 진단의 정보를 제공하는 방법.
1) measuring the expression or activity of KRT19 from a sample isolated from the subject; And
2) determining that there is a risk for cancer when the expression or activity of KRT19 in step 1) is decreased as compared to a normal control.
제 5 항에 있어서, 상기 1)단계의 시료는 세포, 조직, 혈액, 혈청, 타액 및 소변으로 구성된 군으로부터 선택된 어느 하나인 것인, 정보를 제공하는 방법.6. The method according to claim 5, wherein the sample in step (1) is any one selected from the group consisting of cells, tissues, blood, serum, saliva, and urine. 제 5 항에 있어서, 상기 단계 1)의 KRT19의 발현 또는 활성 정도는 조직면역염색, 방사능면역분석법(RIA), 효소면역분석법 (ELISA), 웨스턴블럿(Western Blotting), 면역침전분석법(Immunoprecipitation Assay), 면역확산분석법(Immunodiffusion Assay), 보체고정분석법(Complement Fixation Assay), FACS(Fluorescence-activated cell sorter) 및 단백질칩(protein chip) 분석법 및 RT-PCR 중 선택된 1 종 이상의 방법으로 측정하는 것인, 정보를 제공하는 방법. 6. The method according to claim 5, wherein the expression or activity level of KRT19 in step 1) is measured by tissue immunostaining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting, immunoprecipitation assay Wherein the protein is measured by at least one method selected from the group consisting of an immunodiffusion assay, a complement fixation assay, a fluorescence activated cell sorter (FACS) and a protein chip assay, and RT-PCR. How to provide information. 1)항암 후보 물질을 세포주에 처리하는 단계;
2)상기 세포주에서 a)KRT19의 발현양, b)NUMB의 발현양, c)β-catenin과 RAC1의 결합 및 핵 내 위치화 및 d)NOTCH 신호전달 경로의 활성으로 구성된 군으로부터 선택되는 하나 이상을 측정하는 단계; 및
3) 상기 2)단계의 결과를 대조군으로서 항암 후보 물질을 처리하지 않은 세포주와 비교하여, a)KRT19의 발현량이 증가, b)NUMB의 발현량의 증가, c)β-catenin와 RAC1의 결합 및 핵 내 위치화를 증가시키고, d)NOTCH 신호전달 경로를 불활성화 시키는 화합물을 선별하는 단계;를 포함하는, 항암 후보 물질의 스크리닝 방법.
1) treating the cell line with an anticancer candidate substance;
2) at least one selected from the group consisting of a) an expression amount of KRT19, b) an expression amount of NUMB, c) a combination of β-catenin and RAC1 and localization in nucleus, and d) ; And
3) Comparing the results of step 2) with those of cells treated with no anticancer candidate substance as a control, it was found that a) increased expression of KRT19, b) increased expression of NUMB, c) Increasing the localization in the nucleus, and d) selecting a compound that inactivates the NOTCH signaling pathway.
제 8 항에 있어서, 상기 제 2)단계의 측정은 조직면역염색, 방사능면역분석법(RIA), 효소면역분석법(ELISA), 웨스턴블럿(Western Blotting), 면역침전분석법(Immunoprecipitation Assay), 면역확산분석법(Immunodiffusion Assay), 보체고정분석법(Complement Fixation Assay), FACS(Fluorescence-activated cell sorter) 및 단백질칩(protein chip) 분석법 및 RT-PCR 중 선택된 1 종 이상의 방법을 이용한 것인, 항암 후보 물질의 스크리닝 방법.




The method according to claim 8, wherein the measurement of the second step is performed by a method selected from the group consisting of tissue immunostaining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting, immunoprecipitation assay, Screening of anticancer candidate substances using one or more methods selected from Immunodiffusion Assay, Complement Fixation Assay, Fluorescence-activated cell sorter (FACS), protein chip analysis and RT-PCR Way.




KR1020160041407A 2016-04-05 2016-04-05 Composition for preventing or treating cancer comprising inducer or activator of KRT19 Active KR101863433B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160041407A KR101863433B1 (en) 2016-04-05 2016-04-05 Composition for preventing or treating cancer comprising inducer or activator of KRT19

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160041407A KR101863433B1 (en) 2016-04-05 2016-04-05 Composition for preventing or treating cancer comprising inducer or activator of KRT19

Publications (2)

Publication Number Publication Date
KR20170114479A true KR20170114479A (en) 2017-10-16
KR101863433B1 KR101863433B1 (en) 2018-06-01

Family

ID=60295526

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160041407A Active KR101863433B1 (en) 2016-04-05 2016-04-05 Composition for preventing or treating cancer comprising inducer or activator of KRT19

Country Status (1)

Country Link
KR (1) KR101863433B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060031809A (en) * 2003-06-09 2006-04-13 더 리젠츠 오브 더 유니버시티 오브 미시간 Compositions and methods for treating and diagnosing cancer
KR20070031925A (en) * 2004-06-04 2007-03-20 베리덱스, 엘엘씨 Diagnosis or Prediction of Breast Cancer Progression
KR20120055449A (en) * 2010-11-23 2012-05-31 한양대학교 산학협력단 An anti-cancer composition containing an antibody of krt19

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060031809A (en) * 2003-06-09 2006-04-13 더 리젠츠 오브 더 유니버시티 오브 미시간 Compositions and methods for treating and diagnosing cancer
KR20070031925A (en) * 2004-06-04 2007-03-20 베리덱스, 엘엘씨 Diagnosis or Prediction of Breast Cancer Progression
KR20120055449A (en) * 2010-11-23 2012-05-31 한양대학교 산학협력단 An anti-cancer composition containing an antibody of krt19

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Clin. Cancer Res. Vol. 19(16), pages 4335-4346 (2013)* *

Also Published As

Publication number Publication date
KR101863433B1 (en) 2018-06-01

Similar Documents

Publication Publication Date Title
Friday et al. Calcineurin initiates skeletal muscle differentiation by activating MEF2 and MyoD
CN107709359A (en) The conditioning agent that ROR1 ROR2 are combined
CA2319715C (en) Breast cancer resistance protein (bcrp) and the dna which encodes it
Sacco et al. Novel RasGRF1-derived Tat-fused peptides inhibiting Ras-dependent proliferation and migration in mouse and human cancer cells
WO2011049346A2 (en) Compositions for improving migration potential of stem cells
US7223733B2 (en) Modulation of TRIP-Br function and method of treating proliferative disorders
KR101137019B1 (en) A novel g protein coupled receptor and a use thereof
KR102150239B1 (en) Anticarcinogenic composition comprising an inhibitor of DRG2 as an active ingredient
KR102111030B1 (en) Composition for biomarker detecting neuronal differentiation and promoting neural cell differentiation containing JAB1
KR101863433B1 (en) Composition for preventing or treating cancer comprising inducer or activator of KRT19
KR101433794B1 (en) Composition comprising inhibitors of Progranulin for the prevention or treatment of osteoporosis
Kim et al. Prenylated Rab acceptor 1 (PRA1) inhibits TCF/β-catenin signaling by binding to β-catenin
JP2008515459A (en) Autocline growth factor receptor and method
JP2022532667A (en) GPCR heteromer inhibitors and their use
KR101713428B1 (en) Pharmaceutical composition for preventing or treating inflammatory bone disease comprising miR 218-2
KR101245111B1 (en) Radiation sensitive marker comprising HMG17 gene or expression protein thereof, or protein regulated by expression-decreased HMG17 gene
KR20190112977A (en) Use of HSP90AA1 for Treating or Diagnosing NANOG-mediated Diseases
KR101385357B1 (en) Use of GKN1 brichos domain having anticancer activity
KR101419999B1 (en) Use of Hades as a negative regulator of Akt
US10322165B2 (en) TIFA antagonists and their use for treating diseases
KR101796091B1 (en) A biomarker composition for diagnosis of head and neck cancer comprising carboxyl-terminal modulator protein
KR100525704B1 (en) Pharmaceutical composition for the treatment of gastric cancer comprising inhibitory agent against 9-27 gene
WO2010009905A1 (en) Cancer treatment and test
KR101394828B1 (en) Use of GKN1 amino―terminal regulatory motif having anticancer activity
AU2002317527B2 (en) Breast Cancer Resistance Protein (BCRP) and the DNA which encodes it

Legal Events

Date Code Title Description
A201 Request for examination
PA0109 Patent application

St.27 status event code: A-0-1-A10-A12-nap-PA0109

PA0201 Request for examination

St.27 status event code: A-1-2-D10-D11-exm-PA0201

D13-X000 Search requested

St.27 status event code: A-1-2-D10-D13-srh-X000

D14-X000 Search report completed

St.27 status event code: A-1-2-D10-D14-srh-X000

E902 Notification of reason for refusal
PE0902 Notice of grounds for rejection

St.27 status event code: A-1-2-D10-D21-exm-PE0902

E13-X000 Pre-grant limitation requested

St.27 status event code: A-2-3-E10-E13-lim-X000

P11-X000 Amendment of application requested

St.27 status event code: A-2-2-P10-P11-nap-X000

P13-X000 Application amended

St.27 status event code: A-2-2-P10-P13-nap-X000

PG1501 Laying open of application

St.27 status event code: A-1-1-Q10-Q12-nap-PG1501

E902 Notification of reason for refusal
PE0902 Notice of grounds for rejection

St.27 status event code: A-1-2-D10-D21-exm-PE0902

T11-X000 Administrative time limit extension requested

St.27 status event code: U-3-3-T10-T11-oth-X000

P11-X000 Amendment of application requested

St.27 status event code: A-2-2-P10-P11-nap-X000

P13-X000 Application amended

St.27 status event code: A-2-2-P10-P13-nap-X000

E701 Decision to grant or registration of patent right
PE0701 Decision of registration

St.27 status event code: A-1-2-D10-D22-exm-PE0701

GRNT Written decision to grant
PR0701 Registration of establishment

St.27 status event code: A-2-4-F10-F11-exm-PR0701

PR1002 Payment of registration fee

St.27 status event code: A-2-2-U10-U11-oth-PR1002

Fee payment year number: 1

PG1601 Publication of registration

St.27 status event code: A-4-4-Q10-Q13-nap-PG1601

PR1001 Payment of annual fee

St.27 status event code: A-4-4-U10-U11-oth-PR1001

Fee payment year number: 4

PR1001 Payment of annual fee

St.27 status event code: A-4-4-U10-U11-oth-PR1001

Fee payment year number: 5

PR1001 Payment of annual fee

St.27 status event code: A-4-4-U10-U11-oth-PR1001

Fee payment year number: 6

R18-X000 Changes to party contact information recorded

St.27 status event code: A-5-5-R10-R18-oth-X000

PN2301 Change of applicant

St.27 status event code: A-5-5-R10-R13-asn-PN2301

St.27 status event code: A-5-5-R10-R11-asn-PN2301

PR1001 Payment of annual fee

St.27 status event code: A-4-4-U10-U11-oth-PR1001

Fee payment year number: 7

R18-X000 Changes to party contact information recorded

St.27 status event code: A-5-5-R10-R18-oth-X000

R18-X000 Changes to party contact information recorded

St.27 status event code: A-5-5-R10-R18-oth-X000

PR1001 Payment of annual fee

St.27 status event code: A-4-4-U10-U11-oth-PR1001

Fee payment year number: 8

R18-X000 Changes to party contact information recorded

St.27 status event code: A-5-5-R10-R18-oth-X000

R18-X000 Changes to party contact information recorded

St.27 status event code: A-5-5-R10-R18-oth-X000