KR20170092461A - Method for the mass production of 3-fucosyllactose - Google Patents

Abstract

The present invention relates to a method of mass-producing alpha-1,3-fucosyllactose using recombinant E. coli. When using the recombinant E. coli of the present invention, restriction of a conventional technique where industrial mass production is impossible due to low production yield is overcome, thereby being able to mass-produce 3-fucosyllactose with a very high production yield.

Description

[Method for the mass production of 3-fucosyllactose}

The present invention relates to a method for mass-producing α-1,3-fucosyl lactose, and more particularly, to a method for mass-producing α-1,3-fucosyl lactose using recombinant E. coli.

Human milk oligosaccharides (HMO), which have more than 200 different structures, are present in human milk at significantly higher concentrations (5 to 15 g/L) than other mammals.

HMO has been in the spotlight recently because it is known to exhibit essential functions for infants and toddlers, such as prebiotic effect, inhibitory effect on intestinal obstruction of pathogens, and immune regulation system regulation effect.

2-Fucosyllactose, which is present in the largest amount among HMOs, is reported to be the main HMO involved in various biological activities mentioned above, and its isomer, 3-Fucosyllactose, is also expected to have the above functionality. have.

It is known that about 33% of 2-fucosylactose exists in HMO, while 3-fucosylactose is present in a small amount of 3-4%.The production method of 3-fucosyllactose is directly extracted from breast milk. There are two methods: a method of extracting by chemical or enzymatic method.

The direct extraction method is problematic due to the limitation of breast milk supply and low productivity. Chemical synthesis has problems such as expensive substrates, low isomer selectivity and production yield, and the use of toxic reagents. In addition, the enzymatic synthesis method has a problem that the GDP-L-fucose as a precursor is very expensive and the purification cost of the fucose transfer enzyme is high.

Due to the above problems, mass production of 3-fucosyl lactose is difficult and there is little technology for mass production. However, since a lot of functional improvement can be expected by being added to baby food for infants, more research for industrial production is needed.

Republic of Korea Patent Registration No. 10-1544184 (registration date 2015. 08. 06) relates to a mutant microorganism for producing 2-fucosyl lactose and a method for producing 2-fucosyl lactose using the same, lacZ At least one gene selected from the group consisting of a gene encoding a modified or removed operon and a gene encoding FucT2 or a variant thereof, G6PDH (glucose-6-phosphate dehydrogenase) and GSK (guanosine-inosine kinase) is introduced or amplified. A mutant microorganism and a method for producing 2-fucosyl lactose using the same are described.

In the present invention, by using recombinant E. coli, it is intended to develop and provide a method for mass-producing α-1,3-fucosylactose.

The present invention, in the recombinant E. coli for the production of α-1,3-fucosylactose, the recombinant E. coli is derived from Helicobacter pylori ATCC 26695, α-1 having the amino acid sequence of SEQ ID NO: 5 ,3-fucose transferase-encoding nucleic acid sequence was introduced, or Helicobacter pylori Derived from ATCC 43504, for the production of α-1,3-fucosylactose, characterized in that the nucleic acid sequence encoding α-1,3-fucose transferase having the amino acid sequence of SEQ ID NO:6 is introduced Recombinant E. coli is provided.

In order to produce α-1,3-fucosyl lactose, α-1,3-fucosyl lactose production reaction using GDP-L-fucose and lactose as substrates To perform α-1,3-fucosyltransferase (α-1,3-fucosyltransferase) is required (see Fig. 1). These enzymes exist in various microorganisms, and in the present invention, two types of α-1,3-fucose transferases (FucB and PylT) with excellent production yield of α-1,3-fucosylactose were discovered.

According to the experiment of the present invention below, when introducing the gene fucB of SEQ ID NO: 1 encoding α-1,3-fucose transferase derived from Helicobacter pylori ATCC 26695 into the present invention, in fed-batch culture 0.42 g 3-FL / g lactose of α-1,3- Foucault chamber could determine the lactose yield, Helicobacter pylori (Helicobacter pylori) When the gene pylT of SEQ ID NO: 2 encoding α-1,3-fucosetransferase derived from ATCC 43504 is introduced into the present invention, 0.57 3-FL/g lactose α-1,3- fucosyl in fed-batch culture The lactose production yield could be confirmed. On the contrary, Bacteroides fragilis ) The α-1,3-fucosetransferases derived from ATCC 25285 showed only 0.007 3-FL/g lactose and 0.009 3-FL/g lactose, respectively.

On the other hand, in the recombinant E. coli for the production of α-1,3-fucosylactose of the present invention, the nucleic acid sequence encoding α-1,3-fucose transferase having the amino acid sequence of SEQ ID NO: 5 is preferably sequence Nucleic acid sequence described in number 1 ( fucB Gene). In addition, the nucleic acid sequence encoding α-1,3-fucose transferase having the amino acid sequence of SEQ ID NO: 6 may preferably be the nucleic acid sequence ( pylT gene) of SEQ ID NO: 2.

On the other hand, in the recombinant E. coli for the production of α-1,3-fucosylactose of the present invention, the E. coli is preferably E. coli BL 21 star (DE3) strain. Existing E. coli (E. coli) K12 has an F'plasmid, so when it grows at a high cell density, it creates an excessive amount of biofilm, and when it grows at a high cell density, there is a problem that cell growth is inhibited to increase the rate of product formation. . In addition, there is a problem of accumulating a high level of acetate, and as a whole, fed-batch culture itself is difficult.

However, E. coli (E. coli) BL21 star (DE3) of the present invention does not have an F'plasmid, and cell growth is also fast due to active sugar metabolism. In addition, there are characteristics that the amount of acetate accumulation is relatively small, and the glucose utilization rate is excellent. For this reason, E. coli BL21 star (DE3) is a strain suitable for the production of α-1,3-fucosyl lactose of the present invention, and a large amount of α-1,3-fucosyl through fed-batch culture It can produce lactose.

On the other hand, in the recombinant Escherichia coli for the production of α-1,3-fucosylactose of the present invention, the recombinant Escherichia coli, preferably, instead of the'wild type lac operon','betagal whose activity is lowered than that of the wild type beta galactosidase. LacZ encoding lactosidase Gene, wild-type lacY gene and wild-type lacA gene lac operon, or wild-type lacZ gene is completely removed, wild-type lacY gene and wild-type lacA It is good to have a'lac operon' consisting of only genes.

The E. coli (E. coli) BL21 star (DE3) strain of the present invention can be said to be an optimal strain for the production of α-1,3-fucosyl lactose, because of the various advantages discussed above, but the metabolism of lactose is Because it is strong, lacZ is indispensable for the production of α-1,3-fucosylactose in high yield.

This were the present invention, the build ΔL YA strains have a modified lacZ and ΔL M15 strain and lacZ deletion have a wild-type lacYA and wild type lacYA, these strains inhibited the metabolism of lactose, and that flows smoothly into the E. coli lactose It is a developed strain.

On the other hand, in the recombinant E. coli for the production of α-1,3-fucosylactose of the present invention, the recombinant E. coli is preferably GDP-D-mannose-4,6-dehydratase (Gmd), GDP- L-fucose synthase (WcaG), phosphomannomutase (ManB), and genes for cancerizing mannose-1-phosphate guanyltransferase (ManC) are preferably introduced.

By introducing these genes into the strain, the biosynthetic pathway for producing GDP-L-fucose from glycerol is strengthened, and ultimately, the production amount of α-1,3-fucosylactose can be increased.

On the other hand, in the recombinant E. coli for the production of α-1,3-fucosylactose of the present invention, the recombinant E. coli is wcaJ It is good that the gene has been removed. By removing this gene, it prevents the conversion of GDP-L-fucose, which is used as a precursor of α-1,3-fucosylactose, to colanic acid, thereby enhancing the final production yield. do.

On the other hand, the present invention α-1,3-fucosyl lactose, characterized in that culturing the recombinant E. coli for the production of the α-1,3-fucosyl lactose of the present invention in a medium containing glycerol and lactose Provides the production method of At this time, the production method of α-1,3-fucosyllactose is preferably fed-batch culture in which glycerol is additionally supplied.

In addition, the fed-batch culture of the present invention is derived from Helicobacter pylori ATCC 26695, preferably starting at a culture temperature of 37° C., and a sequence encoding α-1,3-fucose transferase Expressing the gene fucB of number 1 , or Helicobacter pylori After expressing the gene pylT of SEQ ID NO: 2, which is derived from ATCC 43504, encoding α-1,3-fucose transferase, it is recommended to lower the culture temperature by 25°C.

In addition, preferably, after lowering the culture temperature to 25°C, lactose is preferably injected into the culture medium.

In the case of using the recombinant E. coli of the present invention, it is possible to mass-produce α-1,3-fucosyl lactose with a very high production yield by overcoming the limitations of the prior art, which was not possible to mass-produce industrially due to a low production yield.

1 is a schematic diagram showing a pathway for biosynthesizing α-1,3-fucosyl lactose from glycerol and lactose.
Figure 2 shows'BL21 (DE3) star Δ L M15 pmBCGW + pFucB strain','BL21 (DE3) star Δ L M15 pmBCGW + pPylT strain','BL21 (DE3) star Δ L M15 pmBCGW + pFra1 strain'and'BL21. (DE3) Star Δ L M15 pmBCGW + pFra2 strain '3-Fucosyllactose using a batch culture results.
Figure 3 'BL21 (DE3) star Δ L YA pmBCGW + pFucB strain','BL21 (DE3) star Δ L YA pmBCGW + pPylT strain','BL21 (DE3) star Δ L YA pmBCGW + pFra1 strain'and'BL21 (DE3) Star Δ L YA pmBCGW + pFra2 strain'fed-batch culture results.
4 is a result of disruption of the wcaJ gene of'BL21 (DE3) star strain'.
5 is a fed- batch culture result of'BL21 (DE3) star Δ L YA ΔwcaJ pmBCGW + pPylT strain'.

Hereinafter, the content of the present invention will be described in more detail through the following examples and experimental examples. However, the scope of the present invention is not limited to the following examples, and includes modifications of the technical idea equivalent thereto.

[Production Example 1: Preparation of recombinant strain and plasmid]

Production of new 3-fucosilactose by introducing α-1,3-fucose transferase to the GDP-fucose-producing strain ( E. coli BL21 (DE3) star Δ L M15 pmBCGW) already constructed by the present inventors It was attempted to build a strain.

Meanwhile, the pmBCGW vector is inserted into the E. coli to convert glycerol or glucose into GDP-L-fucose used as a precursor of fucosylactose (Lee, WH, et al., 2009, Bioresour Technol, 100 (24):6143). This vector has four types of pETDuet-1: Gmd (GDP-D-mannose-4, 6-dehydratase), WcaG (GDP-L-fucose synthase), ManB (phosphomannomutase), and ManC (mannose-1-phosphate guanyltransferase). Protein can be expressed, and all genes are derived from E. coli.

Meanwhile, the host strain E. coli BL21 (DE3) star Δ L M15 used in Example 2 was prepared by the following method. First, to prepare pGlacZ△M15, two pairs of primers'P1_M15 lac/ P2_M15 lac'and'P3_M15 lac/P4_M15 lac' were used to prepare two DNA fragments from genomic DNA of E. coli K-12 (ATCC10798), respectively. Amplified. The amplified DNA fragment was inserted into pGRG36 treated with Sma I, respectively, using'In-Fusion HD Cloning Kit (TAKARA, Japan)', and as a result, pGlacZ△M15 (having modified lacZ and wild-type lacYA ) could be constructed. (Chin, YW, et al. (2015) Journal of Biotechnology 210: 107-115). Is a pGlacZ △ M15 was inserted into E. coli BL21 star (DE3) were finally produce the E. coli BL21 (DE3) star Δ L M15.

On the other hand, E. coli BL21 (DE3) star ΔL YA host, which is the host strain used in Example 3 below The strain was produced by the following method. To prepare pGlacYA, two pairs of primers'P1_M15 lac/P2_lacYA'and'P3_lacYA/P4_M15lac' were used to amplify two DNA fragments. The amplified DNA fragments were inserted into pGRG36 treated with Sma I, respectively, using'In-Fusion HD Cloning Kit (TAKARA, Japan)', and as a result, pGlacYA (with lacZ deletion and wild-type lacYA ) was constructed (Chin, YW, et al. (2015) Journal of Biotechnology 210: 107-115). This pGlacYA was inserted into E. coli BL21 (DE3) star, and finally E. coli BL21 (DE3) star Δ L YA could be produced.

Meanwhile, Helicobacter pylori (Helicobacter pylori) ATCC α-1,3- Foucault Oz transferase gene from 26695 fucB (SEQ ID NO: 1) was cloned and introduced into pCOLADuet-1 to construct a recombinant vector pFucB. Further, the Helicobacter pylori (Helicobacter pylori) Α-1,3- fucosetransferase gene pylT in ATCC 43504 (SEQ ID NO: 2) was cloned and introduced into pCOLADuet-1 to construct a recombinant vector pPylT. Also, Bacteroides fragilis ) α-1,3-fucose transferase gene fra1 derived from ATCC 25285 (SEQ ID NO: 3), fra2 Recombinant vectors pFra1 and pFra2 were constructed by introducing (SEQ ID NO: 4) into pCOLADuet-1, respectively.

On the other hand, by introducing the vector constructed above for the production of 3-Fucosilactose of Example 2 into the GDP-fucose producing strain (BL21 (DE3) star Δ L M15 pmBCGW), finally'BL21 (DE3) star Δ L M15 pmBCGW + pFucB strain','BL21 (DE3) star Δ L M15 pmBCGW + pPylT strain','BL21 (DE3) star Δ L M15 pmBCGW + pFra1 strain','BL21 (DE3) star Δ L M15 pmBCGW + Each of'pFra2 strain' was constructed.

In addition, by introducing the vector constructed above for the production of 3-fucosyllactose of Example 3 into a GDP-fucose-producing strain ( E. coli BL21 (DE3) star ΔL YA pmBCGW), finally'BL21 ( DE3) star △L YA pmBCGW + pFucB strain','BL21 (DE3) star △L YA pmBCGW + pPylT strain','BL21 (DE3) star △L YA pmBCGW + pFra1 strain','BL21 (DE3) star △L YA pmBCGW + pFra2 strain' was constructed, respectively.

On the other hand, all strains, plasmids, and oligonucleotides for producing 3-fucosyllactose are described in Tables 1 to 2.

Strains and Plasmids Strain Related features E. coli TOP10 ^{F -, mcr A (mrr -} hsd RMS - mcr BC) f80lacZΔM15 ΔlacX74 recA1 araD139 Δ ( ara-leu ) 7 697 galU galK rpsL (Str ^R ) endA1 nupG E. coli BL21star(DE3) ^{F -, ompT, hsdSB (r} B - m B -), gal, dcm rne131 (DE3) Δ L BL21star(DE3) ΔlacZYA Δ L M15 BL21star(DE3) ΔlacZYA Tn7::lacZΔM15YA Δ L YA BL21star(DE3) ΔlacZYA Tn7::lacYA Plasmid Related features pmBCGW pETDuet-1 + gmd-wcaG ( Nde I /Xho I) + manB-manC ( Nco I +EcoR I) pCOLADuet-1 Two T7 promoters, ColA replicon, Kan ^R pFucB pCOLADuet-1 + fucB (Nde I / Kpn I) pPylT pCOLADuet-1 + pylT (Nde I / Kpn I) pFra1 pCOLADuet-1 + fra 1 ( Nde I/ Kpn I) pFra2 pCOLADuet-1 + fra 2 ( Nde I/ Bgl II)

Primer used Primer name Sequence (5'->3') Remark F_ Nde I_fucB GGAATTC CATATG TTCCAACCCCTATTAGACGC R_ Kpn I-fucB GG GGTACC TTACAAACCCAATTTTTTAACCAAC F_ Nde I_pylT GGAATTC CATATG TTCCAACCCCTATTAGACGCC R_ Kpn I-pylT GG GGTACC TTATTTTTTAACCCACCTCCTTATTACACG F_ Nde I_fra1 GGAATTC CATATG GATATATTGATTCTTTTTTATAATACGATGTGG R_ Kpn I-fra1 CGG GGTACC TCATATCCCTCCCAATTTTAGTTCGTGTAT F_ Nde I_fra2 GA AGATCT ATGAAAAAAGTATTCATTCCTATAAATACCAAAATTCCTG R_ Bgl II-fra2 CGG GGTACC CTAATAAAACAACCTGTATATTCTATTTCT * Sequences in italics indicate the recognition site of a specific restriction enzyme

[Example 1: Production of α-1,3-fucosylactose through batch culture]

Using the newly constructed strains in Preparation Example 1, α-1,3-fucosyl lactose was produced. Using a flask, the minimum medium (13.5 g/L KH ₂ PO ₄ , 4.0 g/L (NH ₄ ) ₂ HPO ₄ , 1.7 g/L citric acid, 1.4 g/L MgSO ₄ 7H ₂ O, 10 ml/L Trace element solution (10 g/L Fe(III) citrate, 2.25 g/L ZnSO ₄ 7H ₂ O, 1.0 g/L CuSO ₄ 5H ₂ O, 0.35 g/L MnSO ₄ H ₂ O, 0.23 g/ L Na ₂ B ₄ O ₇ 10H ₂ O, 0.11 g/L (NH ₄ ) ₆ Mo ₇ O ₂₄ , 2.0 g/L CaCl ₂ 2H ₂ O), pH 6.8), 20 g/L of glycerol Was added as an initial carbon source to produce 3-fucosyllactose. And, when the OD ₆₀₀ was 0.6 to 0.8, induction was performed at a concentration of 0.1 mM IPTG (Isopropyl β-D-1-thiogalactopyranoside), and at this time, lactose was added to the medium to be 20 g/L.

The experimental results were shown in FIG. 2. In the case of'BL21 (DE3) star Δ L M15 pmBCGW + pFucB strain', 0.13 g/L, and in the case of'BL21 (DE3) star Δ L M15 pmBCGW + pPylT strain', 0.24 g/L of 3-fucosyl lactose was respectively used. Produced. In addition,'BL21 (DE3) star Δ L M15 pmBCGW + pFra1 strain'and'BL21 (DE3) star Δ L M15 pmBCGW + pFra2 strain' are α-1,3-Fuco at 0.16 g/L and 0.06 g/L, respectively. Silactose was produced.

Figure 2 shows'BL21 (DE3) star Δ L M15 pmBCGW + pFucB strain','BL21 (DE3) star Δ L M15 pmBCGW + pPylT strain','BL21 (DE3) star Δ L M15 pmBCGW + pFra1 strain'and'BL21. (DE3) star Δ L M15 pmBCGW + pFra2 strain 'α-1,3-fucosyl lactose production results using.

[Example 2: Mass production of α-1,3-fucosylactose through fed-batch culture]

Produced in Preparation Example 1,'BL21 (DE3) star Δ L YA pmBCGW + pFucB strain','BL21 (DE3) star Δ L YA pmBCGW + pPylT strain','BL21 (DE3) star Δ L YA pmBCGW + pFra1 Strains'and'BL21 (DE3) star Δ L YA pmBCGW + pFra2 strain' were fed-batch culture for mass production of α-1,3-fucosylactose.

Using a 2.5 L bioreactor, fed-batch culture was performed for high concentration cell culture and mass production of 3-fucosylactose in 1 L minimal medium having the same composition as in the flask culture of Example 1.

Protein was expressed at a concentration of 0.1 mM IPTG after growing until the _{amount of dried cells reached about OD 600} =6.5 using an initial 20 g/L glycerol. At this time, the temperature of the fermentor was adjusted from 37°C to 25°C, and additional lactose was added to a concentration of 20 g/L. In addition, glycerol was continuously supplied while maintaining the pH to be 6.78 to 6.72 using a pH-stat. The stirring speed was 1200 rpm, and the aeration speed was adjusted to be 2 vvm.

As a result of the experiment, in the case of'BL21 (DE3) star Δ L YA pmBCGW + pFucB strain', 6.7 g/L of α-1,3-fucosyl lactose was produced using 16 g/L of lactose for 72 hours. . In the case of'BL21 (DE3) star Δ L YA pmBCGW + pPylT strain', 10.6 g/L of α-1,3-fucosylactose was produced using 20.2 g/L of lactose for 58 hours. . In addition, in the case of'BL21 (DE3) star Δ L YA pmBCGW + pFra1 strain', 0.1 g/L of α-1,3-fucosylactose was produced for 48.5 hours. In addition, in the case of'BL21 (DE3) star Δ L YA pmBCGW + pFra2 strain', 0.14 g/L of α-1,3-fucosylactose was produced for 50.8 hours.

1 L culture result of the Helicobacter pylori (Helicobacter pylori) ATCC 43504 showed the highest pylT production of 3-fucosylactose, and Bacteroides fragilis ) It has been shown that α-1,3-fucose transferases derived from ATCC 25285 hardly produce α-1,3-fucosylactose.

Table 3 below summarizes the results of the experiment, and FIG. 3 is 'BL21 (DE3) star Δ L YA pmBCGW + pFucB strain','BL21 (DE3) star Δ L YA pmBCGW + pPylT strain','BL21 (DE3) star Δ L YA pmBCGW + pFra1 strain'and'BL21 (DE3) Star Δ L YA pmBCGW + pFra2 strain'fed-batch culture results.

Maximum dry cell mass (g/L) Consumed lactose conc. (g/L) Maximum 3-FL conc. (g/L) Yield (g 3-FL / g lactse) Productiviy (g/L·h) FucB 47.2 16.1 6.7 0.42 0.106 PylT 52.1 20.2 10.6 0.57 0.203 Fra1 48.5 14.5 0.1 0.007 Fra2 50.8 14.8 0.14 0.009

[Example 3: wcaJ Further disruption of the gene]

For further disruption of the wcaJ gene, lambda red recombinase (One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, KA Datsenko, PNAS , 2000) was used. 4 is a result of disruption of the wcaJ gene of the'BL21 (DE3) star strain' (1. Confirmation of wild type wcaJ , 2. Insertion of Kanamycin cassette, 3. Confirmation of ΔwcaJ strain). As can be seen from the band of Figure 4, it was confirmed that the wcaJ gene was well crushed.

[Example 4: wcaJ Confirmation of the crushed strain]

The'BL21 (DE3) star Δ L YA ΔwcaJ pmBCGW + PylT strain' in which wcaJ was additionally crushed from the existing strain constructed in Preparation Example 1 was constructed. In addition, fed-batch culture was performed under the same fermentation conditions as specified above.

The total fermentation time was 59 hours, and 11.5 g/L of 3-fucosyl lactose could be produced using 18.2 g/L of lactose. The wcaJ disruption strain showed an increase in production of about 8.5% even though a small amount of lactose was used compared to the'BL21 (DE3) star Δ L YA pmBCGW + PylT strain', which was not. 5 is a fed- batch culture result of'BL21 (DE3) star Δ L YA ΔwcaJ pmBCGW + PylT strain'.

<110> SNU R&DB FOUNDATION <120> Method for the mass production of 3-fucosyllactose <130> AP-2015-0226 <160> 6 <170> KopatentIn 2.0 <210> 1 <211> 1278 <212> DNA <213> Helicobacter pylori ATCC 26695 <400> 1 atgttccaac ccctattaga cgcctttata gaaagcgctt ccattgaaaa aatggcctct 60 aaatctcccc ccccccccct aaaaatcgct gtggcgaatt ggtggggaga tgaagaaatt 120 aaagaattta aaaagagcgt tctttatttt atcctaagcc aacgctacgc aatcaccctc 180 caccaaaacc ccaatgaatt ttcagatcta gtttttagca atcctcttgg agcggctaga 240 aagattttat cttatcaaaa cactaaacga gtgttttaca ccggtgaaaa cgaatcacct 300 aatttcaacc tctttgatta cgccataggc tttgatgaat tggattttaa tgatcgttat 360 ttgagaatgc ctttgtatta tgcccatttg cactataaag ccgagcttgt taatgacacc 420 actgcgccct acaaactcaa agacaacagc ctttatgctt taaaaaaacc ctctcatcat 480 tttaaagaaa accaccctaa tttgtgcgca gtagtgaatg atgagagcga tcttttaaaa 540 agagggtttg ccagttttgt agcgagcaac gctaacgctc ctatgaggaa cgctttttat 600 gacgctctaa attccataga gccagttact gggggaggaa gtgtgagaaa cactttaggc 660 tataaggttg gaaacaaaag cgagttttta agccaataca agttcaatct ctgttttgaa 720 aactcgcaag gttatggcta tgtaaccgaa aaaatccttg atgcgtattt tagccatacc 780 attcctattt attgggggag tcccagcgtg gcgaaagatt ttaaccctaa aagttttgtg 840 aatgtgcatg atttcaacaa ctttgatgaa gcgattgatt atatcaaata cctgcacacg 900 cacccaaacg cttatttaga catgctctat gaaaaccctt taaacaccct tgatgggaaa 960 gcttactttt accaagattt gagttttaaa aaaatcctag atttttttaa aacgatttta 1020 gaaaacgata cgatttatca caaattctca acatctttca tgtgggagta cgatctgcat 1080 aagccgttag tatccattga tgatttgagg gttaattatg atgatttgag ggttaattat 1140 gaccggcttt tacaaaacgc ttcgccttta ttagaactct ctcaaaacac cacttttaaa 1200 atctatcgca aagcttatca aaaatccttg cctttgttgc gcgcggtgag aaagttggtt 1260 aaaaaattgg gtttgtaa 1278 <210> 2 <211> 1365 <212> DNA <213> Helicobacter pylori ATCC 43504 <400> 2 atgttccaac ccctattaga cgcctttata gaaagcgctt ccattgaaaa aatggcctct 60 aaatctcccc cccccctaaa aatcgctgtg gcgaattggt ggggagatga agaaattaaa 120 gaatttaaaa agagcactct gtatttcatt ttaagtcagc attacacaat cactttacac 180 cgaaaccctg ataaacctgc ggacatcgtt tttggtaacc cccttggatc agccagaaaa 240 atcttatcct atcaaaacac taaacgaata ttttacaccg gtgaaaacga atcgcctaat 300 ttcaacctct ttgattacgc cataggcttt gatgaattag actttagaga tcgttatttg 360 agaatgcctt tatattatga taggctacac cataaagccg agagcgtgaa tgacaccacc 420 gcaccctaca agattaaagg caacagcctt tatactttaa aaaaaccctc ccattgtttt 480 aaagaaaacc accctaattt gtgcgcgctc atcaataatg agagcgatcc tttgaaaaga 540 gggtttgcca gttttgtagc gagcaacgct aacgctccta tgaggaacgc tttctatgac 600 gctttaaatt ctattgagcc agttactggg ggaggagccg tgaaaaacac tttaggctat 660 aaggttggaa acaaaagcga gtttttaagc caatacaaat tcaacctgtg ttttgaaaac 720 tcacaaggct atggctatgt aaccgaaaaa atcattgacg cttactttag ccatactatt 780 cccatttatt gggggagtcc cagcgtggcg aaagatttta accctaagag ttttgtgaat 840 gtccatgatt tcaacaactt tgatgaagcg attgattacg tgagatactt gcacacgcac 900 ccaaacgctt atttagacat gctctatgaa aaccctttaa acacccttga tgggaaagct 960 tacttttacc aaaatttgag ttttaaaaaa atcctagatt tttttaaaac gattttagaa 1020 aacgacacga tttatcataa taaccctttc attttctatc gtgatttgaa tgagccgtta 1080 gtatccattg ataatttgag aatcaattat gataatttga gggttaatta tgatgatttg 1140 agggttaatt atgatgattt gagggttaat tatgatgatt tgagaatcaa ttatgatgat 1200 ttgagaatca attatgatga tttgagaatt aattatgagc gccttttgca aaacgcttca 1260 cctttattgg aattgtccca aaacacctct tttaaaatct atcgcaaaat ttatcaaaaa 1320 tccttaccct tattgcgtgt aataaggagg tgggttaaaa aataa 1365 <210> 3 <211> 891 <212> DNA <213> Bacteroides fragilis ATCC 25285 <400> 3 atggatatat tgattctttt ttataatacg atgtggggat ttccactcga gttccgaaag 60 gaagatttac ctgggggctg tgtgataacg actgatcgaa acctcattgc aaaggcggat 120 gccgtggttt tccatttgcc cgatttgcct tcggtgatgg aggatgaaat cgataagcgg 180 gaaggacagc tttgggtggg atggagtctg gaatgtgaag agaattatag ttggacgaag 240 gatcccgagt tcagagagag ttttgactta tggatggggt atcatcagga ggatgatatt 300 gtgtatcctt attatggacc ggattatggg aagatgctgg ttacggcacg gagggaaaag 360 ccttataaga agaaggcatg tatgtttatt tcgagtgata tgaaccggag tcaccgacaa 420 gagtatctta aggaattgat gcagtatacc gacatcgatt cgtatgggaa actataccgt 480 aattgtgaat tacctgttga ggatcgggga cgggatacac ttcttagtgt gatcggggat 540 tatcagtttg tgataagttt tgagaatgcg atagggaagg attatgtgac agaaaagttt 600 ttcaatcctt tgttggccgg tactgttccg gtctatctgg gagctcccaa tattcgggaa 660 tttgctccgg gagaaaattg ttttctggat atttgtactt tcgattctcc cgagggagta 720 gccgctttta tgaatcaatg ctatgatgac gaggcattgt atgaacgttt ttatgcatgg 780 aggaaacggc ctttattatt gtcgtttaca aataagttag agcaagtccg gagcaatccg 840 ttaatcaggc tttgccaaaa aatacacgaa ctaaaattgg gagggatatg a 891 <210> 4 <211> 981 <212> DNA <213> Bacteroides fragilis ATCC 25285 <400> 4 atgaaaaaag tattcattcc tataaatacc aaaattcctg ttgaaaggca gttccctaat 60 agagttccta tttggggaaa ttacgagttt attatatcta ctaaagaacc agagcaagaa 120 tacgattatg ttgtggtatt agatgacatt gaatattctc ttcgtttgat gtgctgtaag 180 caaaatatat gtttatttac aggagaacct ccatatgtta agctttatcc tcgtaaatat 240 ttaaaccaat ttgggcatgt ttatacgtgc caatccagtg tattaaaaag agataatgcc 300 tgcttatctt atcctgcatt accttggatg ctatattaca atttctataa tgacaaacaa 360 aaagaagagt tattaataga ttatgatttt ttgaaaaata gaccaacatt acagaggaaa 420 aataaaatct gcttatttac ttctaataaa aaaatatcta aggggcatat tgaacgcatt 480 aagtttgcgt tgaaattgca agaggaaatg cctgatttga ttgatatata tggttctggc 540 tttactaatg ttgattataa atatgaagtg atggtacaat ataagtatgc cattgtaata 600 gaaaactgtt catatccgta ttattggact gagaaattgg ctgatacttt cttgtcagga 660 tgctatccga tatattttgg tgatccacat attggagatt ttttttcaaa ggaagaaatg 720 gctgtgattg atattaggaa ttttgatgaa agtaagcaga ctataaaaaa aataatagat 780 aataatgttt atgagaagca atatgagaat atttgtcatg cacgagacaa aattttagat 840 aaatataata tgttttcttt aatttcgagt acactggatt caatacctgc taagttagat 900 aaggaaaaat tacttctttc tcctatgcgg cttagtgttt ttgatagaat tagaaataga 960 atatacaggt tgttttatta g 981 <210> 5 <211> 425 <212> PRT <213> Helicobacter pylori ATCC 26695 <400> 5 Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu 1 5 10 15 Lys Met Ala Ser Lys Ser Pro Pro Pro Pro Leu Lys Ile Ala Val Ala 20 25 30 Asn Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Val Leu 35 40 45 Tyr Phe Ile Leu Ser Gln Arg Tyr Ala Ile Thr Leu His Gln Asn Pro 50 55 60 Asn Glu Phe Ser Asp Leu Val Phe Ser Asn Pro Leu Gly Ala Ala Arg 65 70 75 80 Lys Ile Leu Ser Tyr Gln Asn Thr Lys Arg Val Phe Tyr Thr Gly Glu 85 90 95 Asn Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp 100 105 110 Glu Leu Asp Phe Asn Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Ala 115 120 125 His Leu His Tyr Lys Ala Glu Leu Val Asn Asp Thr Thr Ala Pro Tyr 130 135 140 Lys Leu Lys Asp Asn Ser Leu Tyr Ala Leu Lys Lys Pro Ser His His 145 150 155 160 Phe Lys Glu Asn His Pro Asn Leu Cys Ala Val Val Asn Asp Glu Ser 165 170 175 Asp Leu Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn 180 185 190 Ala Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro 195 200 205 Val Thr Gly Gly Gly Ser Val Arg Asn Thr Leu Gly Tyr Lys Val Gly 210 215 220 Asn Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu 225 230 235 240 Asn Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Leu Asp Ala Tyr 245 250 255 Phe Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys 260 265 270 Asp Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe 275 280 285 Asp Glu Ala Ile Asp Tyr Ile Lys Tyr Leu His Thr His Pro Asn Ala 290 295 300 Tyr Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys 305 310 315 320 Ala Tyr Phe Tyr Gln Asp Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe 325 330 335 Lys Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Lys Phe Ser Thr Ser 340 345 350 Phe Met Trp Glu Tyr Asp Leu His Lys Pro Leu Val Ser Ile Asp Asp 355 360 365 Leu Arg Val Asn Tyr Asp Asp Leu Arg Val Asn Tyr Asp Arg Leu Leu 370 375 380 Gln Asn Ala Ser Pro Leu Leu Glu Leu Ser Gln Asn Thr Thr Phe Lys 385 390 395 400 Ile Tyr Arg Lys Ala Tyr Gln Lys Ser Leu Pro Leu Leu Arg Ala Val 405 410 415 Arg Lys Leu Val Lys Lys Leu Gly Leu 420 425 <210> 6 <211> 454 <212> PRT <213> Helicobacter pylori ATCC 43504 <400> 6 Met Phe Gln Pro Leu Leu Asp Ala Phe Ile Glu Ser Ala Ser Ile Glu 1 5 10 15 Lys Met Ala Ser Lys Ser Pro Pro Pro Leu Lys Ile Ala Val Ala Asn 20 25 30 Trp Trp Gly Asp Glu Glu Ile Lys Glu Phe Lys Lys Ser Thr Leu Tyr 35 40 45 Phe Ile Leu Ser Gln His Tyr Thr Ile Thr Leu His Arg Asn Pro Asp 50 55 60 Lys Pro Ala Asp Ile Val Phe Gly Asn Pro Leu Gly Ser Ala Arg Lys 65 70 75 80 Ile Leu Ser Tyr Gln Asn Thr Lys Arg Ile Phe Tyr Thr Gly Glu Asn 85 90 95 Glu Ser Pro Asn Phe Asn Leu Phe Asp Tyr Ala Ile Gly Phe Asp Glu 100 105 110 Leu Asp Phe Arg Asp Arg Tyr Leu Arg Met Pro Leu Tyr Tyr Asp Arg 115 120 125 Leu His His Lys Ala Glu Ser Val Asn Asp Thr Thr Ala Pro Tyr Lys 130 135 140 Ile Lys Gly Asn Ser Leu Tyr Thr Leu Lys Lys Pro Ser His Cys Phe 145 150 155 160 Lys Glu Asn His Pro Asn Leu Cys Ala Leu Ile Asn Asn Glu Ser Asp 165 170 175 Pro Leu Lys Arg Gly Phe Ala Ser Phe Val Ala Ser Asn Ala Asn Ala 180 185 190 Pro Met Arg Asn Ala Phe Tyr Asp Ala Leu Asn Ser Ile Glu Pro Val 195 200 205 Thr Gly Gly Gly Ala Val Lys Asn Thr Leu Gly Tyr Lys Val Gly Asn 210 215 220 Lys Ser Glu Phe Leu Ser Gln Tyr Lys Phe Asn Leu Cys Phe Glu Asn 225 230 235 240 Ser Gln Gly Tyr Gly Tyr Val Thr Glu Lys Ile Ile Asp Ala Tyr Phe 245 250 255 Ser His Thr Ile Pro Ile Tyr Trp Gly Ser Pro Ser Val Ala Lys Asp 260 265 270 Phe Asn Pro Lys Ser Phe Val Asn Val His Asp Phe Asn Asn Phe Asp 275 280 285 Glu Ala Ile Asp Tyr Val Arg Tyr Leu His Thr His Pro Asn Ala Tyr 290 295 300 Leu Asp Met Leu Tyr Glu Asn Pro Leu Asn Thr Leu Asp Gly Lys Ala 305 310 315 320 Tyr Phe Tyr Gln Asn Leu Ser Phe Lys Lys Ile Leu Asp Phe Phe Lys 325 330 335 Thr Ile Leu Glu Asn Asp Thr Ile Tyr His Asn Asn Pro Phe Ile Phe 340 345 350 Tyr Arg Asp Leu Asn Glu Pro Leu Val Ser Ile Asp Asn Leu Arg Ile 355 360 365 Asn Tyr Asp Asn Leu Arg Val Asn Tyr Asp Asp Leu Arg Val Asn Tyr 370 375 380 Asp Asp Leu Arg Val Asn Tyr Asp Asp Leu Arg Ile Asn Tyr Asp Asp 385 390 395 400 Leu Arg Ile Asn Tyr Asp Asp Leu Arg Ile Asn Tyr Glu Arg Leu Leu 405 410 415 Gln Asn Ala Ser Pro Leu Leu Glu Leu Ser Gln Asn Thr Ser Phe Lys 420 425 430 Ile Tyr Arg Lys Ile Tyr Gln Lys Ser Leu Pro Leu Leu Arg Val Ile 435 440 445 Arg Arg Trp Val Lys Lys 450

Claims (10)

In the recombinant Escherichia coli for producing? -1,3-fucosyllactose,
The recombinant Escherichia coli,
A promoter derived from Helicobacter pylori ATCC 43504 is characterized in that a nucleic acid sequence encoding an alpha -1,3-fucose transferase comprising the amino acid sequence of SEQ ID NO: 6 is introduced. Recombinant E. coli for the production of fucosyllactose.
The method according to claim 1,
The nucleic acid sequence encoding the alpha -1,3-fucose transferase consisting of the amino acid sequence of SEQ ID NO: 6 is the nucleic acid sequence of SEQ ID NO: 2, which is used for the production of alpha-1,3-fucosyllactose Recombinant E. coli.
The method according to claim 1,
The above-
Escherichia coli (E. coli) α-1,3- Foucault room lactose Recombinant Escherichia coli for the production, characterized in that the BL 21 star (DE3) strain.
The method of claim 3,
The recombinant Escherichia coli,
Instead of the 'wild-type lac operon'
"Wild-type beta-galactosidase than consisting of the lacZ gene, wild-type lacY gene and the wild-type lacA gene encoding the beta-galactosidase Gene activity was lower lac operon, or" wild type lacZ gene is completely removed, wild lacY gene and A lac operon consisting of only the wild-type lacA gene. The recombinant Escherichia coli for producing [alpha] -l, 3-fucosyllactose .
The method according to claim 1,
The recombinant Escherichia coli,
GDP-D-mannose-4,6-dehydratase (Gmd), GDP-L-fucose synthase (WcaG), phosphofanomuthase (ManB), and mannose-1-phosphate guanyltransferase A recombinant Escherichia coli for producing [alpha] -1,3-fucosyllactose characterized by introducing a gene encoding an enzyme (ManC).
The method according to claim 1,
The recombinant Escherichia coli,
The recombinant Escherichia coli for producing? -1,3-fucosyllactose is characterized in that the wcaJ gene is removed.
A method for producing? -1,3-fucosyllactose, which comprises culturing the recombinant E. coli of claim 1 in a culture medium containing glycerol and lactose.
8. The method of claim 7,
The production method of? -1,3-fucosyllactose is not particularly limited,
A method for producing? -1,3-fucosyllactose, which is a fed-batch culture in which glycerol is further fed.
9. The method of claim 8,
The above-
The culture was started at a culture temperature of 37 ° C,
1, which expresses the gene pylT of SEQ ID NO: 2 encoding Helicobacter pylori ATCC 43504 encoding the alpha-1,3-fucose transferase and then lowering the culture temperature by 25 DEG C, Production method of 3-fucosyllactose.
10. The method of claim 9,
The production method of? -1,3-fucosyllactose is not particularly limited,
A method for producing? -1,3-fucosyllactose, wherein the culture temperature is lowered to 25 占 폚, and lactose is then injected into the culture medium.

Images