KR102462125B1 - Biological production method of human milk oligosaccharide by cofactor engineering - Google Patents

Abstract

The present invention relates to a recombinant Corynebacterium, a production method thereof, and a production method of 2-fucosyllactose (2-FL) using the same, wherein a Corynebacterium is transformed with a recombinant vector overexpressing a nucleotide diphosphate kinase (NDK) gene that contributes to synthesis of 2-FL by coenzyme engineering to significantly increase production of 2-FL without inhibiting growth of the Corynebacterium. When using the recombinant Corynebacterium of the present invention, production ability of 2-FL can be significantly improved through overexpression of the NDK gene, and therefore, the recombinant Corynebacterium can be practically used in an industrial process for mass production of 2'-FL.

Description

Biological production method of human milk oligosaccharide by cofactor engineering

The present invention relates to a recombinant Corynebacterium strain overexpressing Nucleotide Diphosphate Kinase (NDK), a method for preparing the same, and 2'-fucosyllactose, 2'-FL, a human milk oligosaccharide using the same. It relates to biological production methods.

Human milk oligosaccharide (HMO) is the third most abundant in human milk after lactose and lipids. HMO is a carbohydrate polymer composed of five monomers with more than 200 different structures: D-glucose, D-galactose, N -acetylglucosamine, L-fucose and N-acetylneuraminic acid (sialic acid). All HMOs contain lactose that can be reduced and fucosylated at the ends, and its simplest form includes 2'-fucosyllactose, 3-fucosyllactose, and the like. Human milk oligosaccharides are important metabolites regulating the innate immune response.

2'-Fucosyllactose, which is naturally present in human milk oligosaccharides, has the properties of probiotics and is known to regulate the immune system of the mucous membrane. In addition, 2'-Fucault room lactose is Campylobacter jejuni ( Campylobacter jejuni ), Salmonella enterica serotype typhimurium ( Salmonella enterica serotype Typhimurium ), Helicobacter pylori ( Helicobacter pylori ) Epithelial adhesion of pathogens and toxins (toxin) It can prevent epithelial adhesion, protects the human body from infectious diseases, and stimulates the growth of beneficial intestinal bacteria, Bifidobacteria , to help protect against pathogens and toxins. 2'-fucosyllactose having these properties has been approved to be added to infant formula for additional probiotic function by the US FDA and European Food Safety Authority.

Methods for producing 2'-fucosyllactose include direct extraction from breast milk, chemical or enzymatic synthesis. In order to directly extract 2'-fucosyllactose from breast milk, about 20% of women have mutations in fucosyltransferase that synthesizes fucosyl oligosaccharides, and it is known that they cannot synthesize it properly in the body, as well as productivity. There is a limit to this low.

Chemical or enzymatic methods are available as methods that can overcome the limitations of these direct extraction methods. However, GDP-L-fucose used in the chemical synthesis method of 2'-fucosyllactose is very expensive, and the cost of purifying fucose transferase is high. Recombinant Escherichia coli has been used in the enzymatic production method of 2'-fucosyllactose, but the cell membrane component of E. coli may act as an endotoxin, so it is expensive to separate and purify it.

Currently, although it has succeeded in industrially producing 2'-fucosyllactose in Corynebacterium, which is safer than E. coli in the enzymatic production method, industrial mass production of 2'-fucosyllactose in Corynebacterium is still difficult. .

10-1731263 B1

The present inventors made intensive research efforts to develop a method for biological mass production of human milk oligosaccharides through coenzyme engineering. As a result, a recombinant Corynebacterium strain overexpressing the Nucleotide Diphosphate Kinase (NDK) gene that reproduces the coenzyme GTP (guanosine triphosphate) was prepared, and using this, mass production of 2'-fucosyllactose, a milk oligosaccharide, is possible. By elucidating, the present invention was completed.

Accordingly, it is an object of the present invention to provide a recombinant Corynebacterium overexpressing the NDK gene.

Another object of the present invention is to provide a method for producing the recombinant Corynebacterium.

Another object of the present invention is to provide a method for producing 2'-fucosyllactose using the recombinant Corynebacterium.

The present inventors made intensive research efforts to develop a method for biological mass production of human milk oligosaccharides through coenzyme engineering. As a result, a recombinant Corynebacterium strain overexpressing the Nucleotide Diphosphate Kinase (NDK) gene that reproduces the coenzyme GTP was prepared, and using this, it was confirmed that mass production of 2'-fucosyllactose, a milk oligosaccharide, is possible.

According to one aspect of the present invention, the present invention is a nucleotide diphosphate kinase (Nucleotide Diphosphate Kinase, NDK) gene, α-1,2-fucosyltransferase (α-1,2-fucosyltransferase, FucT2) gene, GDP-D -Mannose-4,6-dehydratase (GDP-D-mannose-4,6-dehydratase, Gmd) gene, GDP-L-fucose synthase (GDP-L-fucose synthase, WcaG) gene, lactose Lactose permease (LacY) gene, thiogalactoside transacetylase (LacA) gene, Phosphomannomutase (ManB) gene and GTP-mannose-1-phosphate guanyltransfer It provides a recombinant Corynebacterium transformed by one or more recombinant vectors containing a Rase (GTP-mannose-1-phosphate guanylyltransferase, ManC) gene.

As used herein, the term 'human milk oligosaccharides (HMO)' refers to a multifunctional glycan naturally present in human breast milk.

As used herein, the term '2'-fucosyllactose (2'-FL)' refers to a neutral trisaccharide composed of L-fucose, D-galactose and D-glucose. 2'-fucosyllactose is one of the major HMOs.

Although it has succeeded in industrially producing 2'-fucosyllactose in Corynebacterium, which is safer than E. coli, industrial mass production of 2'-fucosyllactose in Corynebacterium is still difficult. The present invention provides a recombinant Corynebacterium transformed to enable the biological mass production of 2'-fucosyllactose through coenzyme engineering, which can overcome these limitations.

On the other hand, for the biological production of 2'-fucosyllactose using microorganisms, two steps are needed: i) GDP-L-fucose (GDP-L-fucose) production and ii) lactose fucosylation (fucosylation).

i) In the step of producing GDP-L-fucose, GDP-L-fucose can be synthesized through a de novo pathway and a salvage pathway.

In the recovery pathway, L-fucose is catalyzed by L-fucokinase and GDP-L-fucose phosphorylase enzymes to produce GDP-L-fucose. (not shown in Figure 1).

In the neosynthetic pathway, mannose-6-phosphate is four enzymes, phosphomannomtase (ManB), GTP-mannose-1-phosphate guanyltransferase (ManC), GDP-D- It is catalyzed by mannose-4,6-dehydratase (Gmd) and GDP-L-fucose synthase (WcaG) to produce GDP-L-fucose (see mechanism on the left in FIG. 1 ).

ii) In the lactose fucosylation step, GDP-L-fucose produced as above acts as a fucose donor of fucosyl-oligosaccharides. Lactose introduced into the cell through lactose permease (LacY) receives fucose from GDP-L-fucose by α-1,2-fucose transferase (FucT2) and is fucosylated, so that 2'-fucose Silactose is produced (see mechanism on the right in FIG. 1 ).

In the present invention, GDP-L-fucose donates fucose to lactose by FucT2 and overexpresses nucleotide diphosphate kinase (NDK) that converts the generated GDP (guanosine diphosphate) into the coenzyme GTP. GTP, whose reproduction is promoted by the overexpressed NDK, is catalyzed by ManC together with mannose-1-phosphate to be converted to GDP-D-mannose and Pi, and then through a series of processes to promote the production of GDP-L-fucose and, as a result, it was possible to mass-produce 2'-fucosyllactose (see FIG. 1).

Accordingly, the present invention provides a recombinant bacterial strain, that is, a recombinant Corynebacterium, that selectively enhances only the production of 2'-fucosyllactose and does not inhibit bacterial growth by overexpressing NDK in the present invention. The recombinant Corynebacterium strain in which the NDK is overexpressed can promote the reproduction of GTP, and by culturing with the addition of glucose or culturing with the addition of lactose, an industrial process for mass production of 2'-fucosyllactose, which is HMO can be used practically for

As used herein, the term ' Corynebacterium ' refers to a genus of Gram-positive and aerobic bacteria. Corynebacterium is a rod-shaped bacterium, bacilli, and is club-shaped at some stages of its life cycle, so the "coryne form" meaning club-shaped influences the genus name caused Corynebacterium are naturally widely distributed in the animal microbiota (including the human microbiota), are mostly harmless, and most commonly exist in a symbiotic relationship with the host. Some bacteria belonging to Corynebacterium, such as C. glutamicum , are useful in industrial settings, but other Corynebacterium, such as C. diphtheriae , which cause diphtheria in humans. Bacteria in the genus Leumium can cause disease in humans.

In order to produce 2'-fucosyllactose using this Corynebacterium strain, some enzymes participating in the neosynthesis pathway of GDP-L-fucose and lactose fucosylation that the Corynebacterium strain does not have are encoded gene must be introduced from a foreign

More specifically, the Corynebacterium strain is among these enzymes α-1,2-fucose transferase (FucT2), GDP-D-mannose-4,6-dehydratase (Gmd), GDP-L -Fucose synthase (WcaG), lactose permease (LacY) and thiogalactoside transacetylase (LacA) are not possessed by themselves, so exogenous introduction and expression of the gene is required, especially 2 '-For mass production of fucosyllactose, overexpression of these genes is required.

In addition, the Corynebacterium strain possesses phosphomannomutase (ManB), GTP-mannose-1-phosphate guanyltransferase (ManC) and nucleotide diphosphate kinase (NDK) by itself among these enzymes, For mass production of 2'-fucosyllactose, overexpression of ManB, ManC, and especially NDK genes is required in the present invention.

As used herein, the term 'Nucleotide Diphosphate Kinase (NDK)' is an enzyme also called NDPK, NDP kinase, (poly) nucleotide kinase and nucleoside diphosphokinase, and different nucleoside diphosphate (NDP) ) and an enzyme that catalyzes the exchange of terminal phosphates between triphosphates (NTPs) to produce nucleotide triphosphates (NTPs) in a reversible manner.

The Corynebacterium strain, which is the host of the present invention, has the NDK gene itself, but by overexpressing the NDK gene, mass production of 2'-fucosyllactose is possible, so Corynebacterium consisting of SEQ ID NO: 1 Using a recombinant vector containing the NDK gene (NDK CG) derived from the glutamicum (CG) strain or the NDK gene (NDK CA) derived from the Corynebacterium ammoniagenesis (CA) strain consisting of SEQ ID NO: 2 introduced.

In one embodiment of the present invention, the nucleotide diphosphate kinase (NDK) gene is a gene (NDK CG) derived from a Corynebacterium glutamicum (CG) strain, or a gene consisting of the nucleotide sequence of SEQ ID NO: 1 to be.

In one embodiment of the present invention, the nucleotide diphosphate kinase (NDK) gene is a gene (NDK CA) derived from a Corynebacterium ammoniagenesis (CA) strain, or a gene consisting of the nucleotide sequence of SEQ ID NO: 2 to be.

In the present specification, the term 'α-1,2-fucosyltransferase (α-1,2-fucosyltransferase, FucT2)' refers to 2'-fucosylation by using GDP-L-fucose as a fucose donor and fucosylation of lactose. It refers to an enzyme that produces silactose.

Since the Corynebacterium strain does not have the FucT2 gene, in the present invention, it was introduced using a recombinant vector containing the FucT2 gene derived from Helicobacter pylori consisting of SEQ ID NO: 3 (Korea Patent Registration No. 10-1731263) see no.).

In addition, a recombinant vector containing a COFucT2 gene consisting of SEQ ID NO: 8 encoding a codon-optimized FucT2 (hereinafter, COFucT2) was introduced into Corynebacterium in consideration of the codon use of Corynebacterium (Korea). See Patent Registration No. 10-1731263).

In one embodiment of the present invention, the α-1,2-fucose transferase gene is a gene consisting of the nucleotide sequence of SEQ ID NO: 3, or a codon-optimized gene consisting of the nucleotide sequence of SEQ ID NO: 8.

As used herein, the term 'GDP-D-mannose-4,6-dehydratase (GDP-D-mannose-4,6-dehydratase, Gmd)' refers to GDP-D-mannose to GDP-4-keto-6 -Means an enzyme that catalyzes a reversible chemical reaction that converts deoxymannose and water. Gmd belongs to a family of hydrolases that cleave carbon-hydrogen bonds, and is involved in the metabolism of fructose and mannose using the coenzyme NAD ⁺ .

As used herein, the term 'GDP-L-fucose synthase (WcaG)' is GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4- It refers to an enzyme that catalyzes a reversible chemical reaction that converts GDP-4-keto-6-deoxymannose, NADPH and H ⁺ to GDP-L-fucose and NADP ⁺ , also called reductase. WcaG belongs to the family of oxidoreductases acting on the CH-OH group of the donor using NAD ⁺ or NADP ⁺ as the acceptor, and is involved in the metabolism of fructose and mannose.

Since the Corynebacterium strain does not have a Gmd gene and a WcaG gene, in the present invention, it was introduced using a recombinant vector containing E. coli-derived Gmd and WacG genes consisting of SEQ ID NO: 4.

As used herein, the term 'lactose permease (LacY)' is a membrane protein that is a member of the major facilitator superfamily, and β-galactosides such as lactose (β- It means a symporter that transports galactoside into cells. It is encoded by the lacY gene of the Lac operon in E. coli.

As used herein, the term 'thiogalactoside transacetylase (LacA)' is also called galactoside acetyltransferase and galactoside O-acetyltransferase, Seeds and enzymes that transfer to lactosides. It is encoded by the lacA gene of the Lac operon in E. coli.

Since the Corynebacterium strain does not have LacY and LacA genes, in the present invention, it was introduced using a recombinant vector containing the E. coli-derived LacYA gene consisting of SEQ ID NO: 5. Alternatively, it can be introduced using a recombinant vector containing only the LacY gene.

As used herein, the term 'LacYA' refers to a gene in which the LacZ gene is removed from the Lac operon of Escherichia coli. The product of the LacZ gene is β-galactosidase, which cleaves lactose, a disaccharide, and converts it into glucose and galactose. In the present invention, since GDP-L-fucose and lactose must be catalyzed by FucT2 for mass production of 2'-fucosyllactose, the LacZ gene that cuts lactose is removed, LacYA, a Lac operon, was introduced.

As used herein, the term 'phosphomannomutase (Phosphomannomutase, ManB)' refers to an enzyme that catalyzes a reversible chemical reaction converting mannose-6-phosphate into alpha-mannose-1-phosphate. ManB belongs to isomerase, has D-glucose 1,6-bisphosphate and D-mannose 1,6-phosphate as two coenzymes, and is involved in fructose and mannose metabolism.

As used herein, the term 'GTP-mannose-1-phosphate guanyltransferase (GTP-mannose-1-phosphate guanylyltransferase, ManC)' is used to convert GTP and alpha-D-mannose 1-phosphate to diphosphate and GDP-mannose. An enzyme that catalyzes a reversible chemical reaction. ManC belongs to transferases and is involved in fructose and mannose metabolism.

Corynebacterium strain has ManB and ManC genes by itself, but in the present invention, for mass production of 2'-fucosyllactose, Corynebacterium glutamicum-derived ManB gene and SEQ ID NO: A recombinant vector containing a ManC gene derived from Corynebacterium glutamicum consisting of 7 was introduced into the strain.

In one embodiment of the present invention, the transformed recombinant Corynebacterium strain of the present invention includes, but is not limited to, one or more bacteria selected from the group consisting of: Corynebacterium acetoacid. Cydophilum ( Corynebacterium acetoacidophilum ), Corynebacterium acetoglutamicum ( Corynebacterium acetoglutamicum ), Corynebacterium alkanolyticum ( Corynebacterium alkanolyticum ) , Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium My ( Corynebacterium callunae ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium herculis ( Corynebacterium herculis ), Corynebacterium lilium ( Corynebacterium lillium ) lilium ), Corynebacterium melassecola and Corynebacterium thermoaminogenes.

In one embodiment of the present invention, the transformed recombinant Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum ) strain.

In one embodiment of the present invention, the transformed recombinant Corynebacterium is a Corynebacterium ammoniagenes strain.

As used herein, the term ' Corynebacterium glutamicum (CG)' refers to a gram-positive, rod-shaped bacterium, previously known as Micrococcus glutamicus . Corynebacterium glutamicum is industrially used for mass production of amino acids, and its name derives from its ability to produce glutamic acid under aerobic conditions. Corynebacterium glutamicum is a strain recognized as GRAS (generally recognized as safe) unlike E. coli conventionally used for production of 2'-fucosyllactose, and is known not to produce endotoxin.

As used herein, the term ' Corynebacterium ammoniagenes ( CA)' refers to a Gram-positive, non-pathogenic soil bacterium (soil bacterium), formerly known as Brevibacterium ammoniagenes . means Corynebacterium ammoniagenesis is an industrially important organism known for its high guanine-cytosine (GC) DNA content and, due to its diverse evolution, various strains are used to produce different metabolites (Hou, Y., Chen). , S., Wang, J. et al . Isolating promoters from Corynebacterium ammoniagenes ATCC 6871 and application in CoA synthesis. BMC Biotechnol 19, 76 (2019).).

As used herein, the term 'overexpression' basically means that by introducing an endogenous gene encoding an enzyme that the Corynebacterium strain of the present invention can make on its own into the strain, its transcription and translation increase. It is also meant to encompass the introduction of an exogenous gene into a strain, where transcription and translation occur and increase.

In one embodiment of the present invention, the NDK gene is overexpressed in the recombinant Corynebacterium strain of the present invention.

In another embodiment of the present invention, one or more genes selected from the group consisting of FucT2, Gmd, WcaG, LacY, LacA, ManB and ManC genes are overexpressed in the recombinant Corynebacterium strain of the present invention.

In another embodiment of the present invention, one or more genes selected from the group consisting of COFucT2, Gmd, WcaG, LacY, LacA, ManB and ManC genes are overexpressed in the recombinant Corynebacterium strain of the present invention.

In a preferred embodiment of the present invention, NDK, FucT2, Gmd, WcaG, LacY, LacA, ManB and ManC genes are overexpressed in the recombinant Corynebacterium strain of the present invention.

In the most preferred embodiment of the present invention, NDK, COFucT2, Gmd, WcaG, LacY, LacA, ManB and ManC genes are overexpressed in the recombinant Corynebacterium strain of the present invention.

According to another aspect of the present invention, the present invention provides a method for producing a recombinant Corynebacterium comprising the steps of:

(a) Nucleotide Diphosphate Kinase (NDK) gene, α-1,2-fucosyltransferase (α-1,2-fucosyltransferase, FucT2) gene, GDP-D-mannose-4,6-de Hydratase (GDP-D-mannose-4,6-dehydratase, Gmd) gene, GDP-L-fucose synthase (GDP-L-fucose synthase, WcaG) gene, lactose permease (lactose permease, LacY) gene, thiogalactoside transacetylase (LacA) gene, Phosphomannomutase (ManB) gene and GTP-mannose-1-phosphate guanyltransferase (GTP-mannose-1) -phosphate guanylyltransferase, ManC) preparing one or more recombinant vectors containing the gene; and

(b) transforming the one or more recombinant vectors of step (a) into a Corynebacterium strain.

Hereinafter, each step according to an embodiment of the method for producing a recombinant Corynebacterium of the present invention will be described in detail step by step.

(a) preparing a recombinant vector

In step (a) of the method for producing recombinant Corynebacterium of the present invention, one or more recombinant vectors including NDK, FucT2, Gmd, WcaG, LacY, LacA, ManB and ManC genes are prepared.

When producing the recombinant vector in the present invention, expression control sequences such as promoters, terminators, enhancers, etc., sequences for membrane targeting or secretion, etc. according to the type of Corynebacterium strain as the host cell It can be appropriately selected and combined in various ways depending on the purpose.

The vector of the present invention includes, but is not limited to, a plasmid vector, a cosmid vector, a bacteriophage vector and a viral vector. Suitable expression vectors include a signal sequence or leader sequence for membrane targeting or secretion in addition to expression control elements such as promoter, operator, start codon, stop codon, polyadenylation signal and enhancer, and may be prepared in various ways depending on the purpose. The promoter of the vector may be a constitutive promoter that always remains active, such as the CMV, EF1A and SV40 promoters, or an inducible promoter such as the tac promoter (Ptac), which is activated only under specific circumstances. . As used herein, Ptac is an inducible promoter activated by IPTG (Isopropyl β-D-1-thiogalactopyranoside). In a preferred embodiment of the present invention, the recombinant vector of the present invention contains Ptac and overexpresses a gene under Ptac.

In the present invention, a recombinant vector can be prepared using the Gibson assembly method. The Gibson assembly method is a molecular cloning method that can combine multiple DNA fragments in a single isothermal reaction. Therefore, eight recombinant vectors each containing NDK, COFucT2, Gmd, WcaG, LacY, LacA, ManB and ManC genes can be prepared and the eight recombinant vectors can be transformed into recombinant Corynebacterium, but the Gibson assembly method is used. If used, one, two, three, four, five, six or seven recombinant vectors can be prepared by combining the above eight gene fragments.

In one embodiment of the present invention, the number of recombinant vectors may be 1 to 8. In another embodiment of the present invention, the number of recombinant vectors may be 1 to 4. In a preferred embodiment of the present invention, the number of recombinant vectors is three. In a more preferred embodiment of the present invention, there are two recombinant vectors.

In one embodiment of the present invention, in order to prepare the recombinant vector, the NDK gene is processed by the Gibson assembly method so as to be located downstream of the ManC gene (see FIGS. 2B and 2C ). The NDK gene is NDK CG (NDK gene derived from Corynebacterium glutamicum) or NDK CA (NDK gene derived from Corynebacterium ammoniagenesis).

The NDK CG gene consisting of SEQ ID NO: 1 may be introduced into an expression cassette and overexpressed together with the ManB and ManC genes (see FIG. 2C ). The NDK CA gene consisting of SEQ ID NO: 2 may be introduced into an expression cassette and overexpressed together with the ManB and ManC genes (see FIG. 2b ). The NDK CG gene may be represented by SEQ ID NO: 1. The NDK CA gene may be represented by SEQ ID NO: 2.

The recombinant vector of the present invention may include, but is not limited to, one or more antibiotic resistance genes selected from the group consisting of: Kanamycin resistance gene, Streptomycin resistance Gene, Spectinomycin resistance gene, Ampicillin resistance gene, Carbenicillin resistance gene, Bleomycin resistance gene, Erythromycin resistance gene, Polymyxin B resistance gene, tetracycline resistance gene and chloramphenicol resistance gene.

In one embodiment of the present invention, the recombinant vector may include a kanamycin resistance gene and/or a tetracycline resistance gene.

In one embodiment of the present invention, the following first recombinant vector, second recombinant vector, third recombinant vector and fourth recombinant vector are prepared to provide a control strain and recombinant Corynebacterium.

The first recombinant vector, tac promoter (tac promoter, Ptac) - Gmd and WcaG genes consisting of SEQ ID NO: 4 - Ptac - FucT2 consisting of SEQ ID NO: 3 or COFucT2 consisting of SEQ ID NO: 8 - terminator, in this order gene, and may include one or more of the antibiotic resistance genes described above. For example, the antibiotic resistance gene may be a kanamycin resistance gene (Kan ^R ). An example of the first recombinant vector is shown in FIG. 2A , which is hereinafter referred to as pEGWTT(CO).

The second recombinant vector contains genes in the following order: Ptac - manB consisting of SEQ ID NO: 6 and manC consisting of SEQ ID NO: 7 - terminator, LacZ is removed from the Lac operon upstream of this series of gene sequences and the LacYA operon gene consisting of SEQ ID NO: 5, and may include one or more antibiotic resistance genes described above. For example, the antibiotic resistance gene may be a tetramycin resistance gene (Tet ^R ). The second recombinant vector does not contain the NDK gene and is used for the preparation of a control strain, which is hereinafter referred to as pVBCL.

The third recombinant vector comprises genes in the following order: Ptac - manB consisting of SEQ ID NO: 6 and manC consisting of SEQ ID NO: 7 - NDK CA consisting of SEQ ID NO: 2 - terminator, upstream of this series of gene sequences ) in which LacZ has been removed from the Lac operon, includes the LacYA operon gene consisting of SEQ ID NO: 5, and may include one or more of the antibiotic resistance genes described above. For example, the antibiotic resistance gene may be a tetramycin resistance gene (Tet ^R ). An embodiment of the third recombinant vector is shown in FIG. 2B and used for the production of the recombinant Corynebacterium of the present invention, which is hereinafter referred to as pVBCLN (CA).

The fourth recombinant vector comprises genes in the following order: Ptac - manB consisting of SEQ ID NO: 6 and manC consisting of SEQ ID NO: 7 - NDK CG consisting of SEQ ID NO: 1 - terminator, Lac upstream of this series of gene sequences LacYA operon gene consisting of SEQ ID NO: 5 in which LacZ has been removed from the operon may be included, and may include one or more antibiotic resistance genes. For example, the antibiotic resistance gene may be a tetramycin resistance gene (Tet ^R ). An example of the fourth recombinant vector is shown in FIG. 2C and used for the production of the recombinant Corynebacterium of the present invention, which is hereinafter referred to as pVBCLN (CG).

(b) transforming the one or more recombinant vectors of step (a) into a Corynebacterium strain

In step (b) of the method for producing a recombinant Corynebacterium of the present invention, one or more recombinant vectors prepared in step (a) are transformed into a Corynebacterium strain to prepare a recombinant bacterium.

In the present invention, a Corynebacterium strain is used as a host cell for the recombinant bacteria.

In one embodiment of the present invention, the Corynebacterium strain of the present invention includes, but is not limited to, one or more bacteria selected from the group consisting of: Corynebacterium acetoacidophyllum ( Corynebacterium ) acetoacidophilum ), Corynebacterium acetoglutamicum ( Corynebacterium acetoglutamicum ), Corynebacterium alkanolyticum ( Corynebacterium alkanolyticum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium callunae ( Corynebacterium callunae) ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium herculis ), Corynebacterium lilium ( Corynebacterium lilium ), Coryne Nebacterium melassecola ( Corynebacterium melassecola ) and Corynebacterium thermoaminogenes ( Corynebacterium thermoaminogenes ).

The host cell of the recombinant bacteria may be a Corynebacterium glutamicum strain. The host cell of the recombinant bacteria may be a Corynebacterium ammoniagenes strain. The Corynebacterium strain may be a Corynebacterium glutamicum ATCC 13032 strain. The Corynebacterium strain may be a Corynebacterium ammoniagenes ATCC 6871 strain.

A conventional method known in the art may be used as a transformation method for inserting one or more recombinant vectors prepared in step (a) into a Corynebacterium strain. For example, the transformation method includes electroporation, an immediate heat shock after electroporation (van der Rest ME et al. , A heat shock following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA. Appl Microbiol Biotechnol. 1999 Oct;52(4):541-5.), electric pulse method, calcium chloride precipitation method, calcium phosphate precipitation method, Hanahan method (Hanahan D. Studies on transformation of Escherichia coli with plasmids. J Mol Biol. 1983 Jun 5;166(4):557-80), protoplast fusion method, agitation method using silicon carbide fiber, transformation method using PEG, dextran sulfate, lipofectamine and drying/inhibition mediated transformation method, etc. However, it is not necessarily limited thereto.

For example, one or more recombinant vectors prepared in step (a) may be introduced into a Corynebacterium strain using electroporation. More specifically, the two recombinant vectors prepared in step (a) may be introduced into a Corynebacterium glutamicum or Corynebacterium ammoniagenes strain using heat shock after electroporation.

Since the successfully transformed Corynebacterium strain contains an antibiotic resistance gene, it is selected by culturing in a medium containing the antibiotic. Prepare a medium containing an antibiotic corresponding to the antibiotic resistance gene possessed by one or more recombinant vectors prepared in step (a). By culturing a Corynebacterium strain, which is a host cell of the recombinant bacteria, in a medium containing the corresponding antibiotic, seed culture is performed.

In one embodiment according to the present invention, the Corynebacterium strain transformed by the first recombinant vector and the second recombinant vector is cultured in a medium containing kanamycin and tetracycline antibiotics. With this culture, a recombinant Corynebacterium strain, which is a control strain that does not overexpress NDK, is obtained, which is referred to as pEGWTT(CO)+pVBCL.

In another embodiment according to the present invention, the Corynebacterium strain transformed by the first recombinant vector and the third recombinant vector is cultured in a medium containing kanamycin and tetracycline antibiotics. By the above culture, a recombinant Corynebacterium strain of the present invention overexpressing a Corynebacterium ammoniagenes-derived NDK gene is obtained, which is referred to as pEGWTT(CO)+pVBCLN(CA).

In another embodiment according to the present invention, the Corynebacterium strain transformed by the first recombinant vector and the fourth recombinant vector is cultured in a medium containing kanamycin and tetracycline antibiotics. By the above culture, a recombinant Corynebacterium strain of the present invention overexpressing the Corynebacterium glutamicum-derived NDK gene is obtained, which is referred to as pEGWTT(CO)+pVBCLN(CG).

In a preferred embodiment of the present invention, the recombinant Corynebacterium strain transformed with the recombinant vectors pEGWTT(CO) and pVBCL is Corynebacterium ammoniagenes. That is, Corynebacterium ammoniagenes is an expression strain of the recombinant vectors pEGWTT(CO) and pVBCL, which is a control strain. In another preferred embodiment of the present invention, the recombinant Corynebacterium strain transformed by the recombinant vectors pEGWTT(CO) and pVBCLN(CA) is Corynebacterium ammoniagenes. That is, Corynebacterium ammoniagenes is an expression strain of the recombinant vectors pEGWTT(CO) and pVBCLN(CA), which is the recombinant Corynebacterium of the present invention. In another preferred embodiment of the present invention, the recombinant Corynebacterium strain transformed with the recombinant vectors pEGWTT(CO) and pVBCLN(CG) is Corynebacterium ammoniagenes. That is, Corynebacterium ammoniagenes is an expression strain of the recombinant vectors pEGWTT(CO) and pVBCLN(CG), which is the recombinant Corynebacterium of the present invention.

In a more preferred embodiment of the present invention, the recombinant Corynebacterium strain transformed by the recombinant vectors pEGWTT(CO) and pVBCL is Corynebacterium glutamicum. That is, Corynebacterium glutamicum is an expression strain of the recombinant vectors pEGWTT(CO) and pVBCL, which is a control strain. In another more preferred embodiment of the present invention, the recombinant Corynebacterium strain transformed by the recombinant vectors pEGWTT(CO) and pVBCLN(CA) is Corynebacterium glutamicum. That is, Corynebacterium glutamicum is an expression strain of the recombinant vectors pEGWTT(CO) and pVBCLN(CA), which is the recombinant Corynebacterium of the present invention. In another more preferred embodiment of the present invention, the recombinant Corynebacterium strain transformed by the recombinant vectors pEGWTT(CO) and pVBCLN(CG) is Corynebacterium glutamicum. That is, Corynebacterium glutamicum is an expression strain of the recombinant vectors pEGWTT(CO) and pVBCLN(CG), which is the recombinant Corynebacterium of the present invention.

Since the method for producing a recombinant Corynebacterium of the present invention is a method for producing a recombinant Corynebacterium, which is another aspect of the present invention described above, overlapping contents are referred to in order to avoid excessive complexity of the description of the present specification, and the description thereof omit

According to another aspect of the present invention, 2'-fucosyllactose comprising the step of culturing the recombinant Corynebacterium of the present invention in a lactose-added medium according to an embodiment of the present invention ) of the production method.

When using the recombinant Corynebacterium strain of the present invention, it is possible to mass-produce 2'-fucosyllactose with high concentration, high yield, and high productivity.

In one embodiment of the present invention, the medium further comprises glucose.

By culturing the recombinant Corynebacterium strain of the present invention in a medium to which lactose and glucose are added, the growth of the strain becomes active and 2'-fucosyllactose can be produced with higher productivity.

In one embodiment of the present invention, the culture is a fed-batch culture in which glucose and/or lactose are additionally supplied.

If glucose and/or lactose are continuously supplied through fed-batch culture, cell growth can be further increased, and 2'-fucosyllactose can be produced in large quantities with high purity, high yield, and high productivity. Since the details of fed-batch culture are conventional techniques in the art, detailed description thereof will be omitted.

Since the method for producing 2'-fucosyllactose according to the present invention uses the recombinant Corynebacterium, which is another aspect of the present invention described above, overlapping content is cited in order to avoid excessive complexity of the description of the present specification, and the description thereof omit

A brief description of the sequence

SEQ ID NO: 1 is a nucleotide sequence for the NDK gene of C. glutamicum (ATCC 13032).

SEQ ID NO: 2 is the nucleotide sequence for the NDK gene of C. ammoniagenes (KCCM 11740).

SEQ ID NO: 3 is the nucleotide sequence for the FucT2 gene of H. pylori (ATCC 700392).

SEQ ID NO: 4 is the nucleotide sequence for the gmd-wcaG gene of E. coli (K-12 MG1655).

SEQ ID NO: 5 is a nucleotide sequence for the LacYA gene of E. coli (BL21star, DE3). LacYA is a Lac operon from which lacZ has been removed, and refers to LacY (lactose permease) and LacA (thiogalactoside transacetylase) genes.

SEQ ID NO: 6 is a nucleotide sequence for the ManB gene of C. glutamicum (ATCC 13032).

SEQ ID NO: 7 is a nucleotide sequence for the ManC gene of C. glutamicum (ATCC 13032).

SEQ ID NO: 8 is a nucleotide sequence for the codon-optimized COFuT2 gene according to the codon use of Corynebacterium glutamicum to improve the translation efficiency of the FucT2 gene derived from Helicobacter pylori ( H. pylori ) of SEQ ID NO: 3 to be.

SEQ ID NO: 9 is a forward primer sequence for amplifying the NDK gene of C. ammoniagenes .

SEQ ID NO: 10 is a reverse primer sequence for amplifying the NDK gene of C. ammoniagenes .

SEQ ID NO: 11 is a forward primer sequence for amplifying the NDK gene of C. glutamicum .

SEQ ID NO: 12 is a reverse primer sequence for amplifying the NDK gene of C. glutamicum .

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a recombinant Corynebacterium transformed with one or more recombinant vectors comprising an NDK gene, a FucT2 gene, a Gmd gene, a WcaG gene, a LacY gene, a LacA gene, a ManB gene and a ManC gene. .

(b) The present invention provides a method for producing the recombinant Corynebacterium.

(c) The present invention provides a method for producing 2'-fucosyl lactose comprising the step of culturing the recombinant Corynebacterium in a lactose-added medium.

(d) when using the recombinant bacterial strain of the present invention, it is possible to improve the production capacity of 2'-FL through NDK gene overexpression, practical use in the industrial process for mass production of 2'-FL in Corynebacterium This is possible.

1 shows the production metabolic pathway of 2'-fucosyllactose of a recombinant Corynebacterium strain according to an embodiment of the present invention. The gene marked in red in FIG. 1 indicates the name of the gene overexpressed in the recombinant Corynebacterium strain according to an embodiment of the present invention.
2A to 2C show cleavage maps of a recombinant vector according to an embodiment of the present invention.
2A is a cleavage map of the pEGWTT(CO) vector, wherein pEGWTT(CO) overexpresses exogenous genes Gmd, WcaG and COFucT2, and shows a recombinant vector containing a kanamycin resistance gene.
Figure 2b is a cleavage map of the pVBCLN (CA) vector, overexpressing an exogenous gene LacYA operon, endogenous genes manB and manC, and Corynebacterium ammoniagenes (CA)-derived NDK gene, ndk (CA). and a recombinant vector containing a tetramycin resistance gene.
Figure 2c is a cleavage map of the pVBCLN (CG) vector, overexpressing an exogenous gene LacYA operon, endogenous genes manB and manC, and Corynebacterium glutamicum (CG)-derived NDK gene, ndk (CG). and represents a vector containing a tetramycin resistance gene.
Figures 3a to 3c are using Corynebacterium glutamicum (ATCC 13032) as an expression strain, the amount of glucose and lactose consumption (g / L) and acetate, lactate production over time in the control strain and the recombinant strain (g/L) and a graph measuring the production (mg/L) of 2'-fucosyllactose.
Figure 3a is a control strain pEGWTT (CO) + pVBCL, Figure 3b is a recombinant strain of the present invention pEGWTT (CO) + pVBCLN (CA), Figure 3c is a recombinant strain of the present invention pEGWTT (CO) + pVBCLN (CG) As a result of , the symbols in the graph are as follows: ● = Optical density (OD); □ = glucose; △ (grey triangle) = lactose; ▼ (black inverted triangle) = lactate; and ◇ (red diamonds) = 2'-fucosyllactose.
Figures 4a to 4c are using Corynebacterium ammoniagenes (ATCC 6871) as an expression strain, the amount of glucose and lactose consumption (g / L) and acetate and lactate production over time in the control strain and the recombinant strain (g/L) and a graph measuring the production (mg/L) of 2'-fucosyllactose. Figure 4a is a control strain pEGWTT (CO) + pVBCL, Figure 4b is a recombinant strain of the present invention pEGWTT (CO) + pVBCLN (CA), Figure 4c is a recombinant strain of the present invention pEGWTT (CO) + pVBCLN (CG) As a result of , the symbols in the graph are as follows: ● = Optical density (OD); □ = glucose; △ (grey triangle) = lactose; ▼ (black inverted triangle) = lactate; and ◇ (red diamonds) = 2'-fucosyllactose.
Figure 5a is a control strain pEGWTT (CO) + pVBCL and the recombinant strain of the present invention pEGWTT (CO) + pVBCLN (CA) and pEGWTT (CO) + pVBCLN (CG) in a batch culture, intracellular ( 2'-Fucault room lactose production (g/L) of intracellular) is shown in a measured graph.
Figure 5b is a control strain pEGWTT (CO) + pVBCL and the recombinant strain of the present invention pEGWTT (CO) + pVBCLN (CA) and pEGWTT (CO) + pVBCLN (CG) in batch culture, the extracellular ( 2'-Fucault room lactose production (g/L) secreted to extracellular) is measured in a graph.
6a and 6b show the consumption of glucose and lactose (g/L), lactate and 2'-FL production (g/L) by culturing the Corynebacterium glutamicum ATCC 13032 strain in a fed-batch manner. ) is shown in the measured graph. Figure 6a is a control strain pEGWTT (CO) + pVBCL, Figure 6b is the result of the recombinant strain pEGWTT (CO) + pVBCLN (CG) of the present invention, the symbols in the graph are as follows: ● = optical density (Optical) density, OD); □ = glucose; △ = lactose; ▼ = lactate; and ◇ = 2'-fucosyllactose.
Figure 7a shows the principle for the NDK enzyme assay (NDK enzymatic assay).
Figure 7b is a graph of the measurement results of the NDK enzyme activity, the NDK enzyme activity of the control strain pEGWTT (CO) + pVBCL and the recombinant strain of the present invention, pEGWTT (CO) + pVBCLN (CG) at 6 hours, 24 hours and 48 hours ( units/ml).

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Preparation Example 1: Construction of Recombinant Vector

As shown in Table 1 below, for the production of plasmids and 2'-fucosyllactose Escherichia coli, E. Coil TOP10, Corynebacterium glutamicum ( C. glutamicum ) ATCC 13032 and Corynebacter Leum ammonia genes ( C. ammoniagenes ) ATCC 6871 was used.

strains used in the experiment strain related features E. coli Top 10 used for genetic manipulation C. glutamicum (CG) Type strain KACC 20786, ATCC 13032 C. ammoniagenes (CA) Type strain KCCM 11740, ATCC 6871

As shown in Table 2 below, the NDK (Nucleotide Diphosphate Kinase) gene was amplified by PCR from the chromosomes of Corynebacterium ammoniagenes (CA) and Corynebacterium glutamicum (CG). SEQ ID NO: 1 shows the NDK gene sequence of Corynebacterium glutamicum (CG), SEQ ID NO: 2 shows the NDK gene sequence of Corynebacterium ammoniagenes (CA).

Gene-specific strains and SEQ ID NOs gene name strain SEQ ID NO: NDK CG C. glutamicum ATCC 13032 One NDK CA C. ammoniagenes KCCM 11740 2 FucT2 H. pylori ATCC 700392 3 Gmd-WcaG E. coli K-12 MG1655 4 LacYA E. coli BL21star (DE3) 5 ManB C. glutamicum ATCC 13032 6 ManC C. glutamicum ATCC 13032 7 COFucT2 artificial sequence 8

In order to amplify the NDK gene of Corynebacterium ammoniagenes, F_mabC_RBS_ndk (ca) of SEQ ID NO: 9 and R_ndk (ca)_SpeI_CC_BamHI_Bb (term) of SEQ ID NO: 10 shown in Table 3 below were used.

In order to amplify the NDK gene of Corynebacterium glutamicum, F_mabC_RBS_ndk (cg) of SEQ ID NO: 11 and R_ndk (cg)_SpeI_CC_Bam HI_Bb (term) of SEQ ID NO: 12 shown in Table 3 below were used.

In Table 3 below, a ribosome binding site (RBS) was added to the forward primers of SEQ ID NO: 9 and SEQ ID NO: 11, and the reverse primers of SEQ ID NO: 10 and SEQ ID NO: 12 had a restriction enzyme site Spe I for the next experiment and BamH I were added. The Spe I and BamHI restriction enzyme sites were located after the manB gene of the pVBCL plasmid. The pVBCL plasmid was treated with Spe I and BamHI restriction enzymes and used as a backbone.

primer sequence Primer name sequence (5 ' → 3 ' ) SEQ ID NO: F_mabC_RBS_ndk(ca) GCGGAATTCGTTTTTCGTCTGATCAGTAGA GAAAGGAGA GGATTGATGACTGAACGTACACTCAT 9 R_ndk(ca)_SpeI_CC_BamHI_Bb(term) CGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCGGACTAGTTACTTGTTTGGGAACCAGA 10 F_mabC_RBS_ndk(cg) GCGGAATTCGTTTTTCGTCTGATCAGTAGA GAAAGGAGA GGATTGATGACTGAACGTACTCTCAT 11 R_ndk(cg)_SpeI_CC_BamHI_Bb(term) CGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCGGACTAGTTACAGGTTAGGGAACCAGA 12

* In Table 3, italics and underlined sequences mean RBS (ribosome binding site) and spacer.

The amplified NDK gene and pVBCL backbone were combined through Gibson assembly. The pVBCL plasmid containing the NDK gene of Corynebacterium ammoniagenes was referred to as pVBCLN (CA), and the pVBCL plasmid containing the NDK gene of Corynebacterium glutamicum was referred to as pVBCLN (CG). The characteristics of the plasmids used are shown in Table 4 below.

plasmid plasmid related features pEGWTT(CO) pEGWT(CO) + tac promoter (after COFucT2) pVBCLN(CA) pVBCL + NDK gene (from Corynebacterium ammoniagenes ) pVBCLN (CG) pVBCL + NDK gene (from Corynebacterium glutamicum )

In Table 4 above, the pEGWT(CO) plasmid refers to the plasmid constructed in the prior literature (Korean Patent No. 10-1731263). Briefly, the pEGWT(CO) plasmid was isolated from the kanamycin resistance gene (Kan ^R ), Ptac, lacIq , pBL1, oriVC.g. , oriVE.c. By including a shuttle vector of Corynebacterium glutamicum and E. coli to control gene expression and Gmd-WcaG derived from E. coli K-12 MG1650 consisting of SEQ ID NO: 4 and Helicobacter pylori ATCC 700392 derived FucT2 consisting of SEQ ID NO: 8 Codon optimization It is a plasmid containing one CoFucT2.

The pEGWTT(CO) plasmid of Table 4 is a recombinant vector containing Ptac in the above-described pEGWT(CO) plasmid, and a cleavage map thereof is shown in FIG. 2A.

The pVBCLN(CA) plasmid of Table 4 above is a recombinant vector including an NDK derived from Corynebacterium ammoniagenes in a pVBCL plasmid to be described later, and a cleavage map thereof is shown in FIG. 2B .

The pVBCLN(CG) plasmid of Table 4 above is a recombinant vector including the Corynebacterium glutamicum-derived NDK in the pVBCL plasmid to be described later, and a cleavage map thereof is shown in FIG. 2C .

In addition, the pVBCL plasmid in Table 4 above refers to the plasmid constructed in the prior literature (Korean Patent No. 10-1731263). Briefly, the pVBCL plasmid was obtained from the tetracycline resistance gene (Tet ^R ), Ptac, lacIq , pHM1519, oriVC.g. , oriVE.c. Corynebacterium glutamicum and Escherichia coli shuttle vector to control gene expression by including, Corynebacterium glutamicum ATCC 13032 derived manB consisting of SEQ ID NO: 6, Corynebacterium glutamicum consisting of SEQ ID NO: 7 It is a plasmid containing manC derived from ATCC 13032, and LacYA derived from Escherichia coli BL21star (DE3) consisting of SEQ ID NO: 5.

Preparation Example 2: Preparation of recombinant Corynebacterium of the present invention

The plasmid of Preparation Example 1, that is, the recombinant vector, was transformed into Corynebacterium to prepare a recombinant Corynebacterium of the present invention.

Briefly, 1) the recombinant vectors pEGWTT(CO) and pVBCL of Preparation Example 1 described above were transformed into Corynebacterium, which was denoted as [pEGWTT(CO)+pVBCL], and was used as a control strain. 2) The recombinant vectors pEGWTT(CO) and pVBCLN(CA) of Preparation Example 1 were transformed into Corynebacterium, and this was denoted as [pEGWTT(CO)+pVBCLN(CA)], and the recombinant Coryne of the present invention Nebacterium strain was used. 3) The recombinant vectors pEGWTT(CO) and pVBCLN(CG) of Preparation Example 1 described above were transformed into Corynebacterium, and this was denoted as [pEGWTT(CO)+pVBCLN(CG)], and the recombinant Coryne of the present invention Nebacterium strain was used.

As a transformation method, a competent cell was prepared with Corynebacterium glutamicum, and then, the recombinant vector (combination of two plasmids) of Preparation Example 1 was applied to the strain using electroporation. introduced. When introducing the plasmid, two plasmids were not introduced at once, but one each. The detailed experimental method will be described later.

2-1: Preparation of soluble cells

A soluble cell was prepared using the Corynebacterium glutamicum ATCC 130132 strain.

First, the streaked (streaking) colonies of Corynebacterium glutamicum ATCC130132 strain were picked and inoculated in BHI medium (Brain Heart Infusion broth) and then cultured at 30° C., 250 rpm for 6 hours. The culture medium was inoculated in NCMS medium by adjusting the optical density (OD) value to 0.4, and then cultured at 30°C and 250 rpm. When the OD value reached 1.0, 10 mL of the culture solution was dispensed into a 50 mL Falcon ^® tube, and then centrifuged at 13,000 rpm for 10 minutes. After centrifugation, the supernatant was discarded and the remaining cell pellet was chilled on ice for 15 minutes. After that, the experiment was continued by placing the strain on ice.

At this time, the NCMS medium is potassium hydrogen phosphate (Potassium phosphate dibasic) 13.92 g / L, sodium chloride (sodium chloride) 9.28 g / L, glucose (glucose) 4 g / L, tryptone (tryptone) 4 g / L, yeast It is a medium prepared under the conditions of 0.8 g/L of yeast extract, 0.04 g/L of magnesium sulfate heptahydrate, and 72.88 g/L of D-sorbitol.

After chilling, 5 mL of an ice-cold 10% (v/v) glycerol solution prepared in a 0.1 M lithium acetate solution was added, and the cells were released by gently shaking. 15 mL of the 10% (v/v) glycerol solution was further added, followed by centrifugation at 13,000 rpm for 10 minutes. After centrifugation, the supernatant was discarded. The process of adding glycerol, centrifugation, and discarding the supernatant was repeated 5 times.

After the last centrifugation, cells were resuspended using 400 μL of 10% (v/v) glycerol to prepare soluble cells. Soluble cells were aliquoted at 160 μL and stored at -80°C until use.

2-2: Transformation- Heat shock after electroporation

The cuvette was placed on ice, and the LBBHIS medium was previously placed in a water bath at 46°C. At this time, the LBBHIS medium was prepared under the conditions of 10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl, 10 g/L BHI and 91.1 g/L sorbitol, and pH 7.2.

In 160 μL of the soluble cells of Preparation Example 2-1, 2 μL of the recombinant vector of Preparation Example 1 was placed in each cuvette at a concentration of 200 μg/μL to 300 μg/μL, and mixed so as not to generate bubbles.

Each of the mixtures was placed in a 2 mm electroporation cuvette manufactured by Bio-Rad and pulsed with the following EC program. Specifically, by using the MicroPulser system, bacteria were selected in the pre-set, the voltage was set to 2.5 kb, and then the electroporation method was performed by selecting the second pulse.

Then, the LBBHIS medium previously set at 46° C. was put into the cells and resuspended. A total of 1 mL of the resuspended cells was transferred to a 1.7 mL eppen tube (Eppendorf), and heat shock was applied at 46° C. for 6 minutes in a constant temperature water bath.

Shaking incubation was performed at 30° C. and 250 rpm for 2 hours after thermal shock. After shaking culture, centrifugation was performed at 300 rpm for 3 minutes. After centrifugation, 600 μL of the supernatant was discarded, and the strain was resuspended in the remaining 300 μL, and then plated on a medium containing antibiotics. In this case, kanamycin antibiotics were used when the pEGWTT (CO) plasmid was transformed, and when transformed with the pVBCL, pVBCLN (CA) or pVBCLN (CG) plasmids, tetramycin antibiotics were used.

The plasmid, that is, the recombinant vector of Preparation Example 1 was transformed one by one by the above-described method, and finally a control strain expressing the recombinant vector of [pEGWTT(CO)+pVBCL] and [pEGWTT(CO)+pVBCLN] (CA)] or [pEGWTT(CO)+pVBCLN(CG)], the recombinant Corynebacterium of the present invention expressing the recombinant vector was completed.

The recombinant Corynebacterium strain of the present invention basically expresses manB, manC, gmd, wcaG, COFucT2 and lacYA (lacZ removed lac operon) to produce 2'-fucosyllactose recombinant Corynebacterium capable of producing lactose. and a recombinant strain in which the gene encoding the NDK is overexpressed. That is, the recombinant Corynebacterium strain of the present invention additionally overexpresses only the NDK gene compared to the control strain.

2-3: seed culture

The successfully transformed recombinant Corynebacterium glutamicum of the present invention was inoculated into 5 mL of BHI medium containing appropriate antibiotics (kanamycin 25 μg/mL and tetracycline 5 μg/mL). Incubated for 13 hours at 30 ℃, 250 rpm. The culture result was used as a seed culture. Corynebacterium glutamicum transformed with the control strain [pEGWTT(CO)+pVBCL] was also subjected to the seed culture described above.

The [pEGWTT(CO)+pVBCL], [pEGWTT(CO)+pVBCLN(CA)] and [pEGWTT(CO)+pVBCLN(CG)] recombinant vectors are Corynebacterium glutamicum and/or Corynebacterium. It can be expressed in ammonia gas. It will be appreciated by those skilled in the art that other bacteria belonging to Corynebacterium, other than bacteria capable of causing disease in humans, such as Corynebacterium diphtheria, may also be used as expression strains.

Example 1: Determination of the concentration of cells and metabolites

After diluting the sample appropriately to adjust the optical density (O.D.) to a range between 0.1 and 0.5, absorbance was measured at 600 nm using a spectrophotometer (Ultrospec 2000, Amersham Pharmacia Biotech, USA).

Concentrations of 2'-fucosyllactose, lactose, lactate, glucose and acetic acid are 'Carbohydrate Analysis column (Rezex ROA-organic acid, Phenomenex, USA)' and 'RI (refractive index)' HPLC (Agilent 1100LC) equipped with a detector. , USA) was used. 20 μL of 10-fold diluted culture medium was analyzed by applying a column heated at 60°C. A 5 mM H ₂ SO ₄ solution at a flow rate of 0.6 mL/min was used as the mobile phase.

Example 2: 2'-FL batch production using recombinant Corynebacterium of the present invention

In order to determine whether the production of 2'-fucosyllactose was enhanced through the introduction of the NDK gene, the recombinant Corynebacterium and control strains of the present invention were primarily subjected to batch culture.

2-1: Batch culture method

Batch culture is 100 mL of minimal medium ((NH ₄ ) ₂ SO ₄ 20 g/L, urea 5 g/L, KH ₂ PO ₄ 1 g/L, K ₂ HPO ₄ 1 g/L, MgSO ₄ 0.25 g/L L, MOPS((3-(N-morpholino)propanesulfonic acid) 42 g/L, CaCl ₂ 10 mg/L, biotin 0.2 mg/L, Protocatechuic acid 30 mg/L, FeSO ₄ 7H ₂ 0 10 mg/L, MnSO ₄ H ₂ O 10 mg/L, ZnSO ₄ 7H ₂ O 1 mg/L, CuSO ₄ 0.2 mg/L, NiCl ₂ 6H ₂ O 0.02 mg/L, pH 7.0) Incubation was carried out in a 250 mL flask contained therein at 30° C. The stirring speed was maintained at 250 rpm.

During batch culture, when the optical density (OD ₆₀₀ ) reached 0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) and lactose were added so that the final concentrations were 1.0 mM and 10 g/L, respectively.

2-2: 2'-FL batch production results

Concentrations of 2'-fucosyllactose, lactose, lactate, glucose and acetic acid were determined by the method of Example 1.

The batch culture results when using Corynebacterium glutamicum as the expression strain for the recombinant vector of the present invention are shown in Table 5 and FIGS. 3a to 3c below, and Corynebacterium ammoniagenes as the expression strain. The batch culture results when used are shown in Table 6 and FIGS. 4a to 4c below.

2-2-1: When Corynebacterium glutamicum is used as an expression strain

As shown in Table 5 below, when compared with the maximum 2'-FL production of 579 mg/L of the control strain ([pEGWTT(CO)+pBVCL]) in which NDK is not overexpressed (see FIG. 3a ), Corynebacterium ammonia The maximum 2'-FL production of the recombinant strain of the present invention ([pEGWTT(CO)+pVBCLN(CA)]) overexpressing the NDK gene of Genes was improved by 41.5% to 819 mg/L (see FIG. 3b ), and The maximum 2'-FL production of the recombinant strain of the present invention ([pEGWTT(CO)+pVBCLN(CG)]) overexpressing the NDK gene of Nebacterium glutamicum was improved by 45.6% to 843 mg/L (Fig. 3c). Reference).

Results of flask batch culture using NDK in recombinant Corynebacterium glutamicum as an expression strain vector used Final OD (600 nm) Maximum 2'-FL concentration (mg/L) Productivity (mg/L/h) pEGWTT(CO)+pVBCL 39.9 579 8.5 pEGWTT(CO)+pVBCLN(CA) 39.7 819 12.1 pEGWTT(CO)+pVBCLN(CG) 41.9 843 12.4

2-2-2: When Corynebacterium ammoniagenes was used as an expression strain

As shown in Table 6 below, when compared with the maximum 2'-FL production 425 mg/L of the control strain ([pEGWTT(CO)+pBVCL]) in which NDK is not overexpressed (see FIG. 4a ), Corynebacterium ammonia The maximum 2'-FL production of the recombinant strain of the present invention ([pEGWTT(CO)+pVBCLN(CA)]) overexpressing the NDK gene of Genes was improved by 0.5% to 427 mg/L (see FIG. 4b), and The maximum 2'-FL production of the recombinant strain of the present invention ([pEGWTT(CO)+pVBCLN(CG)]) overexpressing the NDK gene of Nebacterium glutamicum was improved by 5.9% to 450 mg/L (Fig. 4c). Reference).

Results of flask batch culture using NDK in recombinant Corynebacterium ammoniagenes as an expression strain vector used Final OD (600 nm) Maximum 2'-FL concentration (mg/L) Productivity (mg/L/h) pEGWTT(CO)+pVBCL 33.2 425 6.16 pEGWTT(CO)+pVBCLN(CA) 36.6 427 6.19 pEGWTT(CO)+pVBCLN(CG) 35.3 450 6.52

2-2-3: sintering

When both recombinant strains of the present invention (Corynebacterium ammoniagenes and Corynebacterium glutamicum) overexpressed NDK, the production was measured to be higher than that of the strain not overexpressed. In particular, when Corynebacterium glutamicum was used as an expression strain, higher production was shown. In addition, both recombinant strains showed the highest 2'-FL production concentration when overexpressing NDK derived from Corynebacterium glutamicum.

Example 3: Intracellular and extracellular 2'-FL production

The present inventors from Example 2, when using Corynebacterium glutamicum as an expression strain, 2'-FL production concentration is high, recombinant Corynebacterium glutamicum is a strain particularly suitable for mass production of 2'-FL It was confirmed that

Therefore, in Example 3, intracellular and extracellular 2'-FL production was investigated using Corynebacterium glutamicum as an expression strain, and the recombinant Corynebacterium glue of the present invention compared to a control strain that does not overexpress NDK. It was investigated whether Tamicum exhibits increased 2'-FL production inside and outside the cell.

3-1: 2'-FL production in cells

When Corynebacterium glutamicum was used as the expression strain, the control strain ([pEGWTT(CO)+pVBCL]) and the recombinant strain of the present invention ([pEGWTT(CO)+pVBCLN(CA)] or [pEGWTT(CO) +pVBCLN(CG)]) was batch cultured in the same manner as in Example 2, and intracellular 2'-fucosyllactose production (g/L) was measured at 68 hours. The concentration of 2'-fucosyllactose was determined by the method of Example 1. The results are shown in Figure 5a.

As shown in Figure 5a, the control strain ([pEGWTT(CO)+pVBCL]) versus the recombinant strain of the present invention ([pEGWTT(CO)+pVBCLN(CA)] or [pEGWTT(CO)+pVBCLN(CG)]) In all, it was confirmed that the intracellular production of 2'-foucault room lactose was increased.

3-2: extracellular 2'-FL production

When Corynebacterium glutamicum was used as the expression strain, the control strain ([pEGWTT(CO)+pVBCL]) and the recombinant strain of the present invention ([pEGWTT(CO)+pVBCLN(CA)] or [pEGWTT(CO) +pVBCLN(CG)]) was batch cultured in the same manner as in Example 2, and 2'-fucosyllactose production (g/L) secreted to the extracellular was measured at 68 hours. The concentration of 2'-fucosyllactose was determined by the method of Example 1. The results are shown in Figure 5b.

As shown in Figure 5b, the control strain ([pEGWTT(CO)+pVBCL]) versus the recombinant strain of the present invention ([pEGWTT(CO)+pVBCLN(CA)] or [pEGWTT(CO)+pVBCLN(CG)]) In all, it was confirmed that the extracellular production of 2'-foucault room lactose was increased.

From the above results, the present inventors further overexpressed the NDK gene, so that the recombinant Coneribacterium glutamicum of the present invention compared to the control strain that did not overexpress the NDK gene 2'-Fucosyllactose increased both intracellularly and extracellularly. Since it represents the production, it was confirmed that it can be usefully used for industrial mass production of 2'-fucosyllactose.

Example 4: 2'-FL fed-batch production using recombinant Corynebacterium of the present invention

The present inventors confirmed that, from Example 2, higher 2'-FL production and productivity could be obtained when Corynebacterium glutamicum was used as the expression strain. In addition, it was confirmed that higher 2'-FL production can be obtained when the NDK derived from Corynebacterium glutamicum is overexpressed in the same expression strain. Therefore, in fed-batch culture, an expression strain was selected as Corynebacterium glutamicum, and a recombinant vector containing a Corynebacterium glutamicum-derived NDK gene was introduced into the expression strain.

4-1: Fed-batch culture method

The composition of the medium for the fed-batch culture was the same as the minimum medium for the batch culture of Example 2 described above, but in the fed-batch culture, IPTG and lactose were used at the time when 40 g/L of glucose was all consumed using HPLC. Additional additions were made so that final concentrations were 1.0 mM and 10 g/L, respectively.

Specifically, fed-batch culture for high-concentration cell culture is a 2.5 L-scale bioreactor containing 40 g/L of glucose and 1.0 L of minimal medium containing 25 μg/mL of kanamycin and 5 μg/mL of tetracycline. , Kobiotech, Incheon, Korea). After the initially added glucose was completely depleted, a feeding solution containing 800 g/L of glucose was supplied by a continuous feeding method at a rate of 5.7 g/L/h. At the same time, IPTG and lactose were added to a final concentration of 1.0 mM and 10 g/L, respectively, to induce tac promoter-mediated gene expression to produce 2'-fucosyllactose.

During fermentation, when the pH of the medium is lower than the set-point, 28% NH ₄ OH is automatically supplied, and when it becomes high, 2N HCl is added so that the pH is maintained within a certain range (pH 6.98 to pH 7.02). did. The pH of the medium was measured in real time using a pH electrode (Mettler Toledo, USA). The stirring speed and the aeration speed were maintained at 1,000 rpm and 2 vvm, respectively, to prevent oxygen starvation. The fed-batch culture results are shown in Table 7 below, FIGS. 6a and 6b.

4-2: fed-batch culture results

As shown in Table 7 below, when Corynebacterium glutamicum is used as the expression strain, the 2'-FL production concentration of the control strain ([pEGWTT(CO)+pVCBCL]) that does not overexpress NDK is 3.66 g/L The recombinant strain of the present invention ([pEGWTT(CO)+pVCBCLN(CG)]) in which the NDK derived from Corynebacterium glutamicum is overexpressed compared to (see FIG. 6a ) has a 2'-FL production concentration of 6.56 g/L By increasing (see FIG. 6b ), a 2'-FL production concentration of up to 10.22 g/L was obtained, and it was confirmed that the productivity of 2'-FL was improved by 2.8 times.

Results of fed-batch culture using NDK in Corynebacterium glutamicum as an expression strain vector used Final OD (600nm) Maximum 2'-FL concentration (g/L) Productivity (g/L/h) pEGWTT(CO)+pVBCL 140 3.66 0.043 pEGWTT(CO)+pVBCLN(CG) 154 10.22 0.082

Example 5: Measurement of intracellular NDK activity

The recombinant Corynebacterium of Preparation Example 2 according to the present invention overexpressed NDK, thereby enabling mass production of 2'-FL. It was confirmed whether the overexpressed NDK actually exhibits enzymatic activity in recombinant Corynebacterium to reproduce GDP as coenzyme GTP, and whether the difference in 2'-FL production value is actually due to the difference in NDK activity value In order to do this, the NDK activity measurement experiment was performed as follows.

5-1: Sample Preparation

Corynebacterium glutamicum strain (using [pEGWTT(CO)+pVBCLN(CG)] vector) overexpressing NDK derived from Corynebacterium glutamicum and Corynebacterium glutamicum as a control strain not overexpressing NDK Coomb strain ([pEGWTT(CO)+pVBCL] vector used, corresponding to control) was used.

Vector [pEGWTT(CO) + pVBCL] or [pEGWTT(CO) + pVBCL(CG)] before/after induction of tac promoter-mediated gene expression by IPTG (Isopropyl β-D-1-thiogalactopyranoside) and lactose A recombinant Corynebacterium glutamicum sample transformed with was prepared.

After diluting the sample to a final volume of 1 mL, cell down (cell down), discard the supernatant, and put 500 μL of 50 mM potassium phosphate buffer (photoassium phosphate buffer, pH 7.6) was added to release the clumped cells by tapping.

Then, the cells were sonicated for a total of 2 minutes in a '7 second sonication followed by a 10 second stop' cycle, and performed with an amplitude (amplitude, Amp) of 45%. The cell lysate prepared by sonication was centrifuged at 4° C. and 13,000 rpm for 15 minutes, and the supernatant was taken and stored at 4° C., which was used as a coenzyme solution to measure NDK activity as follows.

5-2: NDK activity measurement

An enzymatic assay was performed according to the method for measuring NDK activity provided by Sigma-Aldrich. As the method, continuous spectrophotometric rate determination was used. Eight hours after the start of culture, IPTG and lactose were added so that final concentrations of 1.0 mM and 10 g/L, respectively, were added to induce overexpression of the Ptac subgene, that is, the NDK gene. Analysis time points according to time were 6 hours after the start of culture (2 hours before induction), and 24 hours and 48 hours after the start of culture (16 hours and 40 hours after induction, respectively). The activity of NDK was measured using a spectrophotometer (Spectrophotometer, Ultrospec 8000, GE healthcare CO. US) at an absorbance of 340 nm at 25° C. and pH 7.6.

The final value was calculated by putting the result value into the calculation formula for the enzyme titer (units/ml enzyme) shown in the center of FIG. 7a. Relevant abbreviations are also shown at the bottom of FIG. 7A .

Specifically, the enzyme titer (units/ml enzyme) was calculated as follows. Change in absorbance at 340 nm according to time (minutes) using the recombinant Corynebacterium glutamicum coenzyme solution (experimental group) of the present invention transformed with the recombinant vector [pEGWTT(CO)+pVBCLN(CG)] (ΔA _340nm / min Test), the difference in absorbance change at 340 nm (ΔA _{340 nm} /min Blank) according to the time (min) of the sample (control group) added with 50 mM potassium phosphate buffer (pH 7.6) instead of the coenzyme solution was subtracted from the difference value of the assay solution. Multiply the total volume (mL) by the dilution factor (df), divide by 6.22, the millimolar extinction coefficient of β-NADH at 340 nm, and divide by 0.05 mL, the volume of the coenzyme solution, The NDK enzyme activity was calculated in units/mL, and it is shown in Figure 7b and Table 8 below. 7B, the X-axis represents incubation time (6 hours, 24 hours and 48 hours), the Y-axis represents the NDK enzyme titer, and statistical significance is shown as ^*** p <0.001.

Corynebacterium glutamicum transformed with the control vector [pEGWTT(CO)+pVBCL] was also 6 hours, 24 hours and 48 hours after incubation in the same way as above (ie, 2 hours before induction, 16 hours after induction) and 40 hours), the NDK enzyme titers (units/mL) were calculated, and are shown in Figure 7b and Table 8 below.

5-3: Statistical Analysis

The results of the enzyme activity analysis of the NDK were statistically processed as follows. The calculated values were compared with multiple datasets using single-factor ANOVA coupled with Scheffe's analysis as a post hoc test ( ^* p <0.05, ^** p < 0.01 and ^*** p < 0.001). Statistical difference between the strain without NDK overexpression (using the [pEGWTT(CO)+pVBCL] vector, control) and the strain overexpressing NDK (using the [pEGWTT(CO)+pVBCL(CG)] vector) using one-way ANOVA were compared. The results are shown in Figure 7b.

5-4: Result

As shown in Table 8 and Figure 7b below, when the two strains were compared at 6 hours after incubation (ie, 2 hours before induction) before NDK gene overexpression, the p value was 0.1 or more, there was no significant statistical difference, that is, The NDK activity of the two strains was almost similar.

However, when the two strains were compared at 24 hours and 48 hours after initiation of culture, that is, 16 hours and 40 hours after induction, a statistically significant difference was confirmed with a p value of 0.001 or less. At both time points, the NDK activity was significantly higher in the recombinant Corynebacterium strain overexpressing NDK derived from Corynebacterium glutamicum compared to the control strain in which the NDK was not overexpressed.

In addition, when comparing the NDK activity at 6 hours, 24 hours and 48 hours after the start of culture, that is, the p value at 24 hours and 48 hours compared to 6 hours after the start of culture is 0.05 or less in each strain. There was one statistical difference.

From the above results, compared to the case in which NDK was not overexpressed, the NDK enzyme titer by NDK overexpression after induction was significantly increased by about 6.86 times at 24 hours after induction (16 hours after induction), and 48 hours after induction ( 40 hours after induction), it was confirmed that there was a significant increase of 82.31 times (see Table 8 below).

These results suggest that the recombinant Corynebacterium of the present invention not only overexpressed the NDK gene, but also substantially increased the intracellular activity of the overexpressed NDK enzyme, enabling mass production of 2'-FL.

NDK enzyme titer expressed in Corynebacterium strain for 2'-FL production incubation time NDK enzyme titer (units/ml) pEGWTT(CO)+pVBCL(control) pEGWTT(CO)+pVBCLN(CG) medium Standard Deviation medium Standard Deviation 6 hours 0.035 0.005 0.013 24 hours 0.37 0.17 2.54 0.034 48 hours 0.13 0.067 10.7 0.70

conclusion

In the present invention, a Corynebacterium strain was selected as a host cell for producing 2'-fucosyllactose. In particular, the Corynebacterium glutamicum strain is not only a strain recognized as GRAS, unlike the conventionally used E. coli. , it does not produce endotoxin, and is a strain widely used in the industrial production of amino acids and nucleic acids, which are food additives. Therefore, Corynebacterium glutamicum can be said to be a suitable strain for the production of food and pharmaceutical materials, and has the advantage of dispelling concerns about the safety aspect of consumers.

In the present invention, the recombinant vector according to Preparation Example 1 of the present invention was transformed into Corynebacterium to prepare a recombinant Corynebacterium overexpressing NDK (Preparation Example 2). Recombinant Corynebacterium overexpressing NDK of the present invention produced a large amount of 2'-fucosyllactose compared to a control strain that does not overexpress NDK. In particular, when Corynebacterium glutamicum-derived NDK was overexpressed using Corynebacterium glutamicum as an expression strain, the production of 2'-fucosyllactose was significantly increased (Example 2). In addition, compared to the control strain that does not overexpress NDK, the recombinant Corynebacterium of the present invention exhibited increased 2'-fucosyllactose production inside and outside the cell (Example 3), and also 2'-fucosyl in fed-batch culture Lactose production concentration and productivity were greatly improved (Example 4), and showed a significantly increased intracellular NDK activity (Example 5).

From the above results, the present inventors confirmed that, using the recombinant Corynebacterium of the present invention, biological mass production of 2'-fucosyllactose through coenzyme engineering is substantially possible, and it can be usefully used for industrial mass production. .

<110> Kookmin University Industry Academy Cooperation Foundation <120> Biological production method of human milk oligosaccharide by cofactor engineering <130> PN210219 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 411 <212> DNA <213> Corynebacterium glutamicum <400> 1 atgactgaac gtactctcat ccttatcaag ccagacggtg ttaccaacgg acacgtcggc 60 gaaatcatcg cacgtattga gcgcaagggc ctgaagctcg ctgctctgga tctgcgtgtt 120 gcagaccgcg agaccgctga aaagcactac gaagagcacg ctgacaagcc attcttcggt 180 gagctcgttg aattcatcac ctctgcacct ctgatcgcag gcatcgtcga aggcgagcgt 240 gcaatcgatg catggcgtca gcttgctggt ggcaccgacc cagttgctaa ggcaacccca 300 ggcaccatcc gcggcgattt cgcactgact gttggagaga acgttgttca cggttctgat 360 tccccagagt ccgctgagcg cgagatctcc atctggttcc ctaacctgta a 411 <210> 2 <211> 411 <212> DNA <213> Corynebacterium ammoniagenes <400> 2 atgactgaac gtacactcat ccttattaag ccagacggcg ttgcaaacgg ccatgtcggt 60 gacatcatcg cacgcatcga gcgcaagggc ctcaagctcg tcgagttgga cctgcgcacc 120 gcagaccgcg agaccgctga gaagcactac gaagagcact ccgataagcc attcttcggt 180 gaactcgtag aattcatcac ttctgcacca ctgattgctg gcatcgtcga aggcgagcgc 240 gcaattgacg catggcgtca gttggctggc ggcaccgacc cagtctccaa ggcaacccca 300 ggcaccatcc gtggtgactt tgcgttgact gttggcgaaa acgtcgtcca cggctccgac 360 tcacctgaat ccgctgagcg cgaaatcggc atctggttcc caaacaagta a 411 <210> 3 <211> 916 <212> DNA <213> Helicobacter pylori <400> 3 aaggagatat acaatggctt ttaaggtggt gcaaatttgc ggagggcttg ggaatcaaat 60 gtttcaatac gctttcgcta aaagtttgca aaaacactct aatacgcctg tgctgttaga 120 tatcacttct tttgattgga gcgataggaa aatgcaatta gaacttttcc ctattgattt 180 gccctatgcg agcgcgaaag aaatcgctat agctaaaatg caacacctcc ccaagctagt 240 aagagacgcg ctcaaatgca tgggatttga tagggtgagt caagaaatcg tttttgaata 300 cgagcctaaa ttgctaaagc caagccgctt gacttatttt tttggctatt tccaagatcc 360 acgatacttt gatgctatat cccctttaat caagcaaacc ttcactctac cccccccccc 420 cgaaaataat aagaataata ataaaaaaga ggaagaatat cagtgcaagc tttctttgat 480 tttagccgct aaaaacagcg tgtttgtgca tataagaaga ggggattatg tggggattgg 540 ctgtcagctt ggtattgact atcaaaaaaa ggcgcttgag tatatggcaa agcgcgtgcc 600 aaacatggag ctttttgtgt tttgcgaaga cttagaattc acgcaaaatc ttgatcttgg 660 ctaccctttt atggacatga ccactaggga taaagaagaa gaggcgtatt gggacatgct 720 gctcatgcaa tcttgtcagc atgccattat cgctaatagc acttatagct ggtgggcggc 780 ctatttgata gaaaatccag aaaaaatcat tattggcccc aaacactggc tttttgggca 840 tgagaatatc ctttgtaagg agtgggtgaa aatagaatcc cattttgagg taaaatccca 900 aaagtataac gcttaa 916 <210> 4 <211> 2090 <212> DNA <213> Escherichia coli <400> 4 atgtcaaaag tcgctctcat caccggtgta accggacaag acggttctta cctggcagag 60 tttctgctgg aaaaaggtta cgaggtgcat ggtattaagc gtcgcgcatc gtcattcaac 120 accgagcgcg tggatcacat ttatcaggat ccgcacacct gcaacccgaa attccatctg 180 cattatggcg acctgagtga tacctctaac ctgacgcgca ttttgcgtga agtacagccg 240 gatgaagtgt acaacctggg cgcaatgagc cacgttgcgg tctcttttga gtcaccagaa 300 tataccgctg acgtcgacgc gatgggtacg ctgcgcctgc tggaggcgat ccgcttcctc 360 ggtctggaaa agaaaactcg tttctatcag gcttccacct ctgaactgta tggtctggtg 420 caggaaattc cgcagaaaga gaccacgccg ttctacccgc gatctccgta tgcggtcgcc 480 aaactgtacg cctactggat caccgttaac taccgtgaat cctacggcat gtacgcctgt 540 aacggaattc tcttcaacca tgaatccccg cgccgcggcg aaaccttcgt tacccgcaaa 600 atcacccgcg caatcgccaa catcgcccag gggctggagt cgtgcctgta cctcggcaat 660 atggattccc tgcgtgactg gggccacgcc aaagactacg taaaaatgca gtggatgatg 720 ctgcagcagg aacagccgga agatttcgtt atcgcgaccg gcgttcagta ctccgtgcgt 780 cagttcgtgg aaatggcggc agcacagctg ggcatcaaac tgcgctttga aggcacgggc 840 gttgaagaga agggcattgt ggtttccgtc accgggcatg acgcgccggg cgttaaaccg 900 ggtgatgtga ttatcgctgt tgacccgcgt tacttccgtc cggctgaagt tgaaacgctg 960 ctcggcgacc cgaccaaagc gcacgaaaaa ctgggctgga aaccggaaat caccctcaga 1020 gagatggtgt ctgaaatggt ggctaatgac ctcgaagcgg cgaaaaaaca ctctctgctg 1080 aaatctcacg gctacgacgt ggcgatcgcg ctggagtcat aagcatgagt aaacaacgag 1140 tttttattgc tggtcatcgc gggatggtcg gttccgccat caggcggcag ctcgaacagc 1200 gcggtgatgt ggaactggta ttacgcaccc gcgacgagct gaacctgctg gacagccgcg 1260 ccgtgcatga tttctttgcc agcgaacgta ttgaccaggt ctatctggcg gcggcgaaag 1320 tgggcggcat tgttgccaac aacacctatc cggcggattt catctaccag aacatgatga 1380 ttgagagcaa catcattcac gccgcgcatc agaacgacgt gaacaaactg ctgtttctcg 1440 gatcgtcctg catctacccg aaactggcaa aacagccgat ggcagaaagc gagttgttgc 1500 agggcacgct ggagccgact aacgagcctt atgctattgc caaaatcgcc gggatcaaac 1560 tgtgcgaatc atacaaccgc cagtacggac gcgattaccg ctcagtcatg ccgaccaacc 1620 tgtacgggcc acacgacaac ttccacccga gtaattcgca tgtgatccca gcattgctgc 1680 gtcgcttcca cgaggcgacg gcacagaatg cgccggacgt ggtggtatgg ggcagcggta 1740 caccgatgcg cgaatttctg cacgtcgatg atatggcggc ggcgagcatt catgtcatgg 1800 agctggcgca tgaagtctgg ctggagaaca cccagccgat gttgtcgcac attaacgtcg 1860 gcacgggcgt tgactgcact atccgcgagc tggcgcaaac catcgccaaa gtggtgggtt 1920 acaaaggccg ggtggttttt gatgccagca aaccggatgg cacgccgcgc aaactgctgg 1980 atgtgacgcg cctgcatcag cttggctggt atcacgaaat ctcactggaa gcggggcttg 2040 ccagcactta ccagtggttc cttgagaatc aagaccgctt tcgggggtaa 2090 <210> 5 <211> 3335 <212> DNA <213> Escherichia coli <400> 5 accatcgaat ggcgcaaaac ctttcgcggt atggcatgat agcgcccgga agagagtcaa 60 ttcagggtgg tgaatgtgaa accagtaacg ttatacgatg tcgcagagta tgccggtgtc 120 tcttatcaga ccgtttcccg cgtggtgaac caggccagcc acgtttctgc gaaaacgcgg 180 gaaaaagtgg aagcggcgat ggcggagctg aattacattc ccaaccgcgt ggcacaacaa 240 ctggcgggca aacagtcgtt gctgattggc gttgccacct ccagtctggc cctgcacgcg 300 ccgtcgcaaa ttgtcgcggc gattaaatct cgcgccgatc aactgggtgc cagcgtggtg 360 gtgtcgatgg tagaacgaag cggcgtcgaa gcctgtaaag cggcggtgca caatcttctc 420 gcgcaacgcg tcagtgggct gatcattaac tatccgctgg atgaccagga tgccattgct 480 gtggaagctg cctgcactaa tgttccggcg ttatttcttg atgtctctga ccagacaccc 540 atcaacagta ttattttctc ccatgaagac ggtacgcgac tgggcgtgga gcatctggtc 600 gcattgggtc accagcaaat cgcgctgtta gcgggcccat taagttctgt ctcggcgcgt 660 ctgcgtctgg ctggctggca taaatatctc actcgcaatc aaattcagcc gatagcggaa 720 cgggaaggcg actggagtgc catgtccggt tttcaacaaa ccatgcaaat gctgaatgag 780 ggcatcgttc ccactgcgat gctggttgcc aacgatcaga tggcgctggg cgcaatgcgc 840 gccattaccg agtccgggct gcgcgttggt gcggatatct cggtagtggg atacgacgat 900 accgaagaca gctcatgtta tatcccgccg ttaaccacca tcaaacagga ttttcgcctg 960 ctggggcaaa ccagcgtgga ccgcttgctg caactctctc agggccaggc ggtgaagggc 1020 aatcagctgt tgcccgtctc actggtgaaa agaaaaacca ccctggcgcc caatacgcaa 1080 accgcctctc cccgcgcgtt ggccgattca ttaatgcagc tggcacgaca ggtttcccga 1140 ctggaaagcg ggcagtgagc gcaacgcaat taatgtgagt tagctcactc attaggcacc 1200 ccaggcttta cactttatgc ttccggctcg tatgttgtgt ggaattgtga gcggataaca 1260 atttcacaca ggaaacagct atgtactatt taaaaaacac aaacttttgg atgttcggtt 1320 tattcttttt cttttacttt tttatcatgg gagcctactt cccgtttttc ccgatttggc 1380 tacatgacat caaccatatc agcaaaagtg atacgggtat tatttttgcc gctatttctc 1440 tgttctcgct attattccaa ccgctgtttg gtctgctttc tgacaaactc gggctgcgca 1500 aatacctgct gtggattatt accggcatgt tagtgatgtt tgcgccgttc tttattttta 1560 tcttcgggcc actgttacaa tacaacattt tagtaggatc gattgttggt ggtatttatc 1620 taggcttttg ttttaacgcc ggtgcgccag cagtagaggc atttattgag aaagtcagcc 1680 gtcgcagtaa tttcgaattt ggtcgcgcgc ggatgtttgg ctgtgttggc tgggcgctgt 1740 gtgcctcgat tgtcggcatc atgttcacca tcaataatca gtttgttttc tggctgggct 1800 ctggctgtgc actcatcctc gccgttttac tctttttcgc caaaacggat gcgccctctt 1860 ctgccacggt tgccaatgcg gtaggtgcca accattcggc atttagcctt aagctggcac 1920 tggaactgtt cagacagcca aaactgtggt ttttgtcact gtatgttatt ggcgtttcct 1980 gcacctacga tgtttttgac caacagtttg ctaatttctt tacttcgttc tttgctaccg 2040 gtgaacaggg tacgcgggta tttggctacg taacgacaat gggcgaatta cttaacgcct 2100 cgattatgtt ctttgcgcca ctgatcatta atcgcatcgg tgggaaaaac gccctgctgc 2160 tggctggcac tattatgtct gtacgtatta ttggctcatc gttcgccacc tcagcgctgg 2220 aagtggttat tctgaaaacg ctgcatatgt ttgaagtacc gttcctgctg gtgggctgct 2280 ttaaatatat taccagccag tttgaagtgc gtttttcagc gacgatttat ctggtctgtt 2340 tctgcttctt taagcaactg gcgatgattt ttatgtctgt actggcgggc aatatgtatg 2400 aaagcatcgg tttccagggc gcttatctgg tgctgggtct ggtggcgctg ggcttcacct 2460 taatttccgt gttcacgctt agcggccccg gcccgctttc cctgctgcgt cgtcaggtga 2520 atgaagtcgc ttaagcaatc aatgtcggat gcggcgcgag cgccttatcc gaccaacata 2580 tcataacgga gtgatcgcat tgaacatgcc aatgaccgaa agaataagag caggcaagct 2640 atttaccgat atgtgcgaag gcttaccgga aaaaagactt cgtgggaaaa cgttaatgta 2700 tgagtttaat cactcgcatc catcagaagt tgaaaaaaga gaaagcctga ttaaagaaat 2760 gtttgccacg gtaggggaaa acgcctgggt agaaccgcct gtctatttct cttacggttc 2820 caacatccat ataggccgca atttttatgc aaatttcaat ttaaccattg tcgatgacta 2880 cacggtaaca atcggtgata acgtactgat tgcacccaac gttactcttt ccgttacggg 2940 acaccctgta caccatgaat tgagaaaaaa cggcgagatg tactcttttc cgataacgat 3000 tggcaataac gtctggatcg gaagtcatgt ggttattaat ccaggcgtca ccatcgggga 3060 taattctgtt attggcgcgg gtagtatcgt cacaaaagac attccaccaa acgtcgtggc 3120 ggctggcgtt ccttgtcggg ttattcgcga aataaacgac cgggataagc actattattt 3180 caaagattat aaagttgaat cgtcagttta aattataaaa attgcctgat acgctgcgct 3240 tatcaggcct acaagttcag cgatctacat tagccgcatc cggcatgaac aaagcgcagg 3300 aacaagcgtc gcatcatgcc tctttgaccc acagc 3335 <210> 6 <211> 1377 <212> DNA <213> Corynebacterium glutamicum <400> 6 atgcgtaccc gtgaatctgt cacggctgta attaaggcgt atgacgtccg tggtgttgtt 60 ggtgtcgata ttgatgctga tttcatttct gagactggcg ctgcctttgg tcggctcatg 120 cgtagtgagg gtgaaaccac cgttgctatt ggccatgaca tgcgtgattc ctcccctgaa 180 ttggccaagg cgtttgccga tggcgtgact gcacagggtt tggatgttgt tcatttggga 240 ctgacttcta ctgatgagct gtactttgcg tccggaacct tgaagtgtgc tggtgcgatg 300 tttactgcgt cgcataaccc cgctgagtac aacggcatca agttgtgtcg tgcgggtgct 360 cgtccggtcg gtcaggattc tggtttggcc aacatcattg atgatctggt tgagggtgtt 420 ccagcgtttg atggtgagtc aggttcggtt tctgagcagg atttgctgag cgcatatgcc 480 gagtacctca atgagcttgt tgatctgaag aacatccgcc cgttgaaggt tgctgtggat 540 gcggcaaacg gcatgggtgg gttcactgtc cctgaggtat tcaagggtct gccacttgat 600 gttgcgccac tgtattttga gcttgacggc aatttcccca accatgaggc caatcctctg 660 gagcctgcca acctggttga tttgcagaag tttaccgtag agaccggatc tgatatcggt 720 ttggcgttcg acggcgatgc ggatcgttgc ttcgtggtcg atgagaaggg ccagccagtc 780 agcccttcgg cgatctgtgc gatcgtagcg gagcgttact tggagaagct tccgggttcc 840 accatcatcc acaacctgat tacctctaag gctgtgcctg aggtgattgc tgaaaacggt 900 ggcactgcgg tgcgtactcg cgtgggtcac tccttcatca aggcgaagat ggcagagacc 960 ggtgcggcct ttggtggcga gcactctgcg cactactact tcactgagtt cttcaatgcg 1020 gactccggca ttttggctgc gatgcacgtg ctggctgcgc tgggaagcca ggaccagcca 1080 ctcagtgaga tgatggctag gtataaccgg tacgttgctt caggcgagtt gaactcccgt 1140 ttggctaatg cagaggcgca gcaagagcgc acccaggctg tgctcgatgc gttcgctgat 1200 cgcaccgagt ccgtggacac ccttgacggc gtgactgtgg aactcaagga cacctccgcg 1260 tggttcaacg tgcgtgcgtc caacaccgag ccgctgcttc gcctcaatgt tgaagctgca 1320 tcgaaggaag aagtcgatgc gttggtagcg gagattctag ggattatccg cgcataa 1377 <210> 7 <211> 1089 <212> DNA <213> Corynebacterium glutamicum <400> 7 atgactttaa ctgacaacag caaaaacgtt gatgctgtca tcttggtcgg tggcaaaggt 60 acccgactgc gccccctgac cgtcaatact ccaaagccaa tgctgccaac tgctggccac 120 ccattcttga cccacctttt ggcccgcatc aaggccgcag gcatcacca cgtcgtgctg 180 ggaacgtcat tcaaagctga agtcttcgag gaatacttcg gagatggctc cgaaatgggc 240 ttggaaattg aatatgtcgt cgaggatcag cctttgggca ctggtggtgg catccgaaac 300 gtctacgaca agctgcgtca cgatactgcg attgtgttca acggcgatgt gctctccggt 360 gcggatctca acagcattct ggacacccac cgcgaaaagg acgcagatct gaccatgcat 420 ctcgtgcgcg tagctaaccc tcgtgcgttt ggttgcgtcc ccaccgatga ggatggtcgc 480 gtcagcgaat tccttgaaaa gaccgaagat ccaccaaccg atcagatcaa cgccggctgc 540 tacgtgttca agaaggaact catcgagcag atcccggcag gccgagcagt ttccgtcgag 600 cgcgaaacct tccctcagct gttggaagaa ggcaagcgag tcttcggcca cgtcgacgct 660 tcctactggc gcgacatggg caccccaagc gacttcgtcc gcggctcggc tgacctggtc 720 cgcggcattg cgtactcccc attgctcgaa ggcaaaacag gagagtcgct tgtcgacgcc 780 tccgccggcg ttcgcgacgg cgtcctgctg ctcggcggaa ccgtagtcgg ccgcggcact 840 gagatcggtg ccggctgccg cgttgacaac actgttattt tcgacggcgt caccattgaa 900 ccaggtgcgg tcattgaaaa ttccatcatt tcctcgggag cacgcatcgg tgctaatgcg 960 cacatctccg gttgcatcat tggcgagggc gcacaggttg gtgctcggtg tgaactcaac 1020 gcagggatgc gcgtcttccc aggcgttgtg atcccagaca gcggaattcg tttttcgtct 1080 gatcagtag 1089 <210> 8 <211> 903 <212> DNA <213> Artificial Sequence <220> <223> COfuT2 <400> 8 atggcgttta aagtggtgca aatttgcgga ggcttgggta accaaatgtt tcagtacgcc 60 ttcgctaaaa gtttgcaaaa gcattccaac acgccggtgc tgctcgatat cactagcttt 120 gattggtctg atcgcaaaat gcaactggaa ctttttccga ttgacttgcc atacgcctcg 180 gcgaaagaga tcgcgatcgc taaaatgcag cacctcccga agctagtccg cgatgcactg 240 aagtgcatgg gcttcgaccg cgtgtctcaa gaaatcgttt tcgaatacga gccgaagctt 300 ctcaagccaa gccgcctcac ttatttcttc ggctacttcc aggacccacg atactttgat 360 gctatctccc ctttaatcaa gcaaaccttc accctgccac ccccccccga aaacaacaag 420 aataataata agaaagagga agagtatcag tgcaagcttt cactcatcct cgccgctaag 480 aatagcgtgt ttgttcacat ccgtcgcggt gactatgtcg gcattggctg tcagctgggt 540 attgattacc agaagaaggc tcttgagtac atggcaaagc gcgtgccaaa catggaactt 600 ttcgtgtttt gcgaagatct ggaattcaca cagaaccttg accttggata ccctttcatg 660 gatatgacca cccgtgacaa ggaggaagaa gcgtactggg acatgctgct catgcagtct 720 tgccagcacg ccattatcgc aaactccacc tattcgtggt gggcagcgta cttgatcgag 780 aacccagaaa agattattat tggccctaaa cactggttgt tcgggcacga aaacatcctg 840 tgtaaagagt gggtgaaaat cgaatcccat ttcgaggtca aatcccagaa gtataacgca 900 taa 903 <210> 9 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> F_mabC_RBS_ndk(ca) <400> 9 gcggaattcg tttttcgtct gatcagtaga gaaaggagag gattgatgac tgaacgtaca 60 ctcat 65 <210> 10 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> R_ndk(ca)_SpeI_CC_BamHI_Bb(term) <400> 10 cggccagtga attcgagctc ggtacccggg gatccggact agttacttgt ttgggaacca 60 ga 62 <210> 11 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> F_mabC_RBS_ndk(cg) <400> 11 gcggaattcg tttttcgtct gatcagtaga gaaaggagag gattgatgac tgaacgtact 60 ctcat 65 <210> 12 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> R_ndk(cg)_SpeI_CC_BamHI_Bb(term) <400> 12 cggccagtga attcgagctc ggtacccggg gatccggact agttacaggt tagggaacca 60 ga 62

Claims (14)

Nucleotide Diphosphate Kinase (NDK) gene, α-1,2-fucosyltransferase (FucT2) gene comprising the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 , GDP-D-mannose-4,6-dehydratase (GDP-D-mannose-4,6-dehydratase, Gmd) gene, GDP-L-fucose synthase (GDP-L-fucose synthase, WcaG) ) gene, lactose permease (LacY) gene, thiogalactoside transacetylase (LacA) gene, phosphomannomutase (ManB) gene and GTP-mannose-1- In the recombinant Corynebacterium transformed by one or more recombinant vectors comprising a phosphate guanyltransferase (GTP-mannose-1-phosphate guanylyltransferase, ManC) gene,
The Corynebacterium is Corynebacterium glutamicum or Corynebacterium ammoniagenes, recombinant Corynebacterium.
delete delete The recombinant Corynebacterium according to claim 1, wherein the nucleotide diphosphate kinase gene is a gene derived from a Corynebacterium glutamicum strain.
The recombinant Corynebacterium according to claim 1, wherein the nucleotide diphosphate kinase gene is a gene derived from a Corynebacterium ammoniagenes strain.
According to claim 1, wherein the α-1,2- fucose transferase gene is a gene consisting of the nucleotide sequence of SEQ ID NO: 3, or a codon-optimized gene consisting of the nucleotide sequence of SEQ ID NO: 8, recombinant coryne Bacteria.
A method for producing a recombinant Corynebacterium comprising the steps of:
(a) nucleotide diphosphate kinase (NDK) gene comprising the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, α-1,2-fucosyltransferase (α-1,2-fucosyltransferase, FucT2) gene, GDP-D-mannose-4,6-dehydratase (GDP-D-mannose-4,6-dehydratase, Gmd) gene, GDP-L-fucose synthase (GDP-L-fucose) synthase, WcaG) gene, lactose permease (LacY) gene, thiogalactoside transacetylase (LacA) gene, Phosphomannomutase (ManB) gene and GTP-mannose -1-phosphate guanyltransferase (GTP-mannose-1-phosphate guanylyltransferase, ManC) preparing one or more recombinant vectors containing the gene; and
(b) transforming the one or more recombinant vectors of step (a) into a Corynebacterium strain,
Here, the Corynebacterium is Corynebacterium glutamicum or Corynebacterium ammoniagenes.
delete delete The method of claim 7, wherein the nucleotide diphosphate kinase gene is a gene derived from a Corynebacterium glutamicum strain.
The method of claim 7, wherein the nucleotide diphosphate kinase gene is a gene derived from a Corynebacterium ammoniagenes strain.
A method for producing 2'-fucosyllactose, comprising the step of culturing the recombinant Corynebacterium according to any one of claims 1 and 4 to 6 in a lactose-added medium. .
The method of claim 12, wherein the medium further comprises glucose, 2'-fucosyllactose.
The method of claim 12, wherein the culture is a fed-batch culture in which i) glucose, ii) lactose, or iii) glucose and lactose are additionally supplied.

Images