KR20170059948A - Beverage with improved taste including fragment of fruit or plant and method of preparing the same - Google Patents

Abstract

The present invention relates to a beverage which contains pieces of fruits or plants and ensures improved flavor and texture, and a production method thereof. More specifically, the present invention relates to a beverage which offers favorable texture while maintaining textures of pieces of fruits or plants. To this end, the beverage contains psicose in addition to the pieces of fruits or plants such as flesh pieces of fruits or tissue fragments of fruit vegetable and edible plants. The present invention further relates to a production method thereof.

Description

Beverage with improved taste including fragment of fruit or plant and method of preparing the same}

The present invention relates to a beverage containing a piece of fruit or vegetable with improved texture and texture, and a method for producing the same, and more particularly, to a beverage containing a piece of fruit or vegetable, for example, a piece of fruit or vegetable. By including, it relates to a beverage that maintains the texture of the fruit or plant fragment and provides a good texture, and a method of manufacturing the same.

Beverages containing fruits, vegetables, medicinal plants, etc. may be provided by juice of fruits, vegetables, medicinal plants, etc., or beverages containing fragments such as fruits, vegetables and medicinal plants may be prepared in the beverage. For example, fruit beverages include fruit juices, pulp beverages (beverages containing fruit pulp), fruit juice beverages containing fruit granules (fruit juice beverages containing fruit granules), and fruit juices containing pulp. Beverages (fruit juice drinks that contain pulp). Fruit juice beverages are produced from fruit juices such as citrus fruits, fruit juices, tropical fruit juices, and vegetable juices.

Most of the technologies for producing beverages containing such fruits, vegetables and medicinal plants are focused on improving the quality of beverages and researching the appropriate ingredients of beverages. However, as a result of the recent diversification of consumer preferences, beverages containing various types of fruits, vegetables, and medicinal plants are being manufactured, and examples of fruits that make flesh-containing beverages include oranges, grapefruits, lemons, peaches, and pears. , Apples, tangerines, pineapples, kiwis, coconuts, etc., mainly fruits are used, but the demand for beverages made from various vegetables and medicinal plants is constantly increasing.

When a medicinal plant, for example, aloe is used as a health drink, a juice (aloe extract) produced by compressing the leaves of aloe varieties [Vera, Avoresense (Kitichi), Saponaria] is generally used. However, aloe juice is susceptible to oxidation by oxygen in the air, and when oxidized, it discolors to reddish brown, and is contaminated by microorganisms and is liable to decay. Aloe extract is sold in a sealed container by filtering and sterilizing the aloe juice obtained by juicing the leaves of aloe, so it can be stored for a certain period of time by being blocked from outside air in a sterile state. Since various studies have been conducted for long-term storage, in order to prevent discoloration of aloe extract due to the oxidation and decay by microorganisms, in general, antioxidants such as vitamin C and citric acid, and L-ascorbic acid are used in aloe juice. Long-term storage properties are provided by adding a storage agent or a preservative such as potassium sorbate.

As an aloe beverage, a number of products are commercialized in the form of a beverage that contains only aloe juice or includes aloe juice and aloe pulp. However, although the beverage contains aloe fragments, it is difficult to ensure long-term storage properties of aloe fragments like aloe.

Therefore, it is necessary to improve the texture of the beverage by increasing the storage stability and maintaining the texture of not only the beverage but also the flesh fragments contained in the beverage.

Accordingly, an object of the present invention is to provide a beverage containing flesh meat with improved texture by increasing the storage stability of not only beverage but also flesh fragments contained in the beverage and maintaining the texture, and a method of manufacturing the same.

In addition, the present invention provides a low-calorie beverage by replacing all of the fructose and sugar added to the conventional pulp-containing beverage, or reducing the content of fructose and sugar, as well as improving the texture of the pulp contained in the pulp-containing beverage. It is to provide a beverage with improved taste and texture of the beverage and a method of manufacturing the same.

The present invention relates to a beverage containing a fruit or plant fragment having an improved texture and texture, and a method for producing the same, and in more detail, a fruit or plant fragment, for example, a fruit or vegetable fragment or a tissue fragment of a fruit or vegetable and medicinal plant. By including a psychological course in a beverage containing, it relates to a beverage that maintains the texture of the fruit or plant fragment and provides a good texture, and a method of manufacturing the same.

Specifically, in one embodiment of the present invention, extracts or juices of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants, flesh fragments of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants, and psicose Including, the texture and taste is improved pulp-containing beverages are provided.

Conventionally, sweetness and product properties are given through the use of sugar or liquid fructose, but this is the cause of high calorie and rapid blood sugar rise. Accordingly, the whole amount of fructose and sugar added to the flesh-containing beverage is replaced, or the content of fructose and sugar is reduced to provide a low-calorie beverage, as well as improving the texture of the flesh contained in the flesh-containing beverage, and It is intended to provide a beverage that enhances texture.

In addition, it is intended to provide a beverage containing flesh meat with improved texture by increasing the storage stability of not only beverages but also flesh fragments contained in beverages and maintaining texture, and a method of manufacturing the same.

Hereinafter, the present invention will be described in more detail.

The present invention relates to an extract or juice of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants, and a flesh-containing beverage containing the flesh fragments of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants. It is to provide a flesh-containing beverage with improved texture and taste, including psicose.

The beverage preparation material usable in the present invention may be an extract or juice of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants.

Examples of the fruits include orange, grape, grapefruit, lemon, peach, apricot, pear, apple, tangerine, pineapple, strawberry, cranberry, blueberry, black currant, asahi berry, pomegranate, banana, mango, guava, watermelon, melon, It may be plum, kiwi, prunes, and mixed fruits, and examples of the vegetables include carrots, tomatoes, lettuce, cabbage, celery, pumpkin, broccoli, red beets, spinach, kale, bell pepper, cauliflower, parsley, watercress , Red bell peppers, bell peppers, radishes, and mixed vegetables, and the like, and the medicinal plants are aloe, cactus, drop, sinseoncho, hut, deodeok, bellflower, mushrooms, honeysuckle, wolfberry, goldfish, cornus milk, schisandra, dandelion, ginger, and At least one selected from the group consisting of hemp may be a medicinal plant. Aloe has been widely used for medicinal purposes worldwide, and it is widely known as a medicinal plant that has been used as a folk remedy for laxatives, mouth sores, itching, gastrointestinal drugs, anthelmintics, burns, bruises, and leprosy.

In the present invention, the flesh-containing beverage is a cut product obtained by cutting at least one plant selected from the group consisting of fruits, vegetables and medicinal plants that are components of the drink, a pulverized product obtained by crushing, or a crushed product obtained by crushing. It includes, and refers to a beverage containing a fragment of the plant, and is not particularly limited to a method of producing the fragment. For example, when the plant is a fruit, a beverage containing fruit flesh, a fruit juice beverage containing fruit granules, and a fruit juice beverage containing pulp (may include a fruit juice beverage containing pulp. In addition, the fragment of the plant may be a fragment of the fruit itself, the eating part of vegetables, for example, a leaf part for leafy vegetables, a root part for root vegetables, and the like, and the medicinal plant It can be a short story.

As a specific example, in the case of a beverage containing aloe pulp, the pulp portion of an aloe leaf may be cut and included as a fragment. After completely removing the skin of the aloe leaf, collecting and slicing only the inner pulp (jelly), sweeteners, acidulants, vitamins, etc. can be homogeneously mixed to prepare aloe pulp. Alternatively, commercially available aloe pulp may be purchased and added to beverages for use.

There are various varieties of aloe, and for example, it may be one or more selected from the group consisting of vera, avorescens (kitichi), and saponaria, and is sometimes classified as a medicinal plant or vegetable.

The extract or juice may be a solvent extract, juice, concentrate of the solvent extract or juice, or powder of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants. The juice can be prepared by applying pressure to one or more plants selected from the group consisting of fruits, vegetables, and medicinal plants to juice, and the method is not particularly limited. In addition, the solvent extract can be extracted by adding a solvent to one or more plants selected from the group consisting of fruits, vegetables and medicinal plants, cuts or crushed products thereof, and the usable solvents include water and alcohols having 1 to 6 carbon atoms. It may be one or more solvents selected from the group consisting of. The juice or extract may be used as it is added to a beverage, a concentrate obtained through an additional concentration process, a diluted product prepared by adding a diluting solvent such as water, or a powder obtained by drying.

The pulp-containing beverage according to the present invention may reduce off-flavor of fruits, vegetables, or medicinal plants by adding psicose, and improve the taste and texture by maintaining the texture of the pulp contained therein. As an example, in the case of a beverage containing aloe, the taste of the aloe may be improved by reducing the fishy taste of aloe and the irritation of the slices (astringent taste from canned food), etc. by the addition of psicose.

* Psychose contained in the ginseng composition according to the present invention may be a powder or a solution prepared in various concentrations by using the picose having a purity of 90% or more. In addition, the Psychose may be a Psychose alone or a mixed sugar containing additional other saccharides, and an example of the mixed saccharide may contain 1 to 99.9 parts by weight of Psychose based on 100 parts by weight of the solid content of the total mixed sugar, and additionally fructose , Glucose, and may further include one or more selected from the group consisting of oligosaccharides.

Specific examples of the mixed sugars containing picose include 2 to 55 parts by weight of psicose, 30 to 80 parts by weight of fructose and 2 to 60 parts by weight of glucose, and 0 to 15 parts by weight of oligosaccharide based on 100 parts by weight of the total solid content of the mixed sugar. It may be, and may not contain oligosaccharides. The psicose, fructose and glucose are preferably all D-isomers.

*The psicose may be performed by chemical synthesis or a biological method using a psicose epimerization enzyme, and preferably, may be performed by a biological method. Thus, the Psicose comprises at least one selected from the group consisting of a Psicose epimerase, a bacterial body of a strain producing the enzyme, a culture of the strain, a lysate of the strain, and an extract of the lysate or culture. The composition for producing Psicose may be prepared by reacting with a fructose-containing raw material.

In one embodiment of the present invention, as a method of producing a psicose according to a biological method, a strain producing a psicose epimerase or a recombinant strain into which a gene encoding a psicose epimerase is introduced is cultured, and It can be produced by reacting a cos epimerase with a fructose-containing raw material. The psicose epimerization enzyme may be performed in a liquid phase reaction or a solid phase reaction using an immobilized enzyme.

Or, obtaining a strain producing a psicos epimerase or a recombinant strain into which a gene encoding a psicose epimerase is introduced, and the cells of the strain, cultures of the strains, lysates of the strains, and lysates or cultures A composition for producing psicose comprising at least one selected from the group consisting of extracts may be prepared by reacting with a fructose-containing raw material. When Psicose is prepared using the cells of the strain producing the Psicose epimerization enzyme, it may be carried out in a liquid phase reaction or a solid phase reaction using immobilized cells.

In a specific example of the present invention, the strain for producing a psicose epimerase may be a strain capable of producing a psicose epimerization enzyme in high yield while having high stability. The recombinant strain may be a variety of host cells, such as Escherichia coli, Bacillus strain, Salmonella spp, and Corynebacterium strain, but may be preferably GRAS strain of Corynebacterium sp. strain, Corynebacterium It may be Leeum glutaricum.

In the case of using a recombinant strain, the Psychos epimerization enzyme can use a gene encoding an enzyme derived from a variety of strains, for example, the enzyme derived from Triponema primitia described in Korean Patent Publication 2014-0021974, Korea Patent Publication 2014-0080282 It may be an enzyme derived from Luminococos Torque described in and an enzyme derived from Closthyridium syndance described in Korean Patent No. 10-1318422, and may also be an enzyme derived from Encipher Ad Harens. In a specific example, the psychosis epimerization enzyme according to the present invention may be an enzyme derived from Closthyridium syntheses, for example, has an amino acid sequence of SEQ ID NO: 7, and includes a nucleic acid sequence of SEQ ID NO: 8 or SEQ ID NO: 9. . The nucleic acid sequence of SEQ ID NO: 8 is an E. coli optimized nucleic acid sequence, and SEQ ID NO: 9 is a nucleic acid sequence modified for Corynebacterium.

In the production of a recombinant strain according to an embodiment of the present invention, the expression of the enzyme can be controlled using a control sequence located above the nucleic acid sequence encoding the psicose epimerase, and the control sequence essentially requires a transcriptional promoter. And may further include a ribosome binding region and/or a spacer sequence. The elements constituting the control sequence may be directly linked or linked by including one or more linkers of a nucleic acid sequence containing 1 to 100 bases, for example, 5 to 80 bases.

In one embodiment, the transcriptional promoter may be a nucleic acid molecule expressing a nucleic acid sequence encoding a psicose epimerase in a strain of the genus Corynebacterium, but may be a tac1, tac2, trc, or sod promoter. The sod promoter is derived from Corynebacterium glutaricum, and preferably contains the nucleic acid sequence of SEQ ID NO: 1 as a core region. The trc promoter is an Escherichia coli-derived promoter and is manufactured by combining the trp promoter and the lac UV5 promoter. The Tac1 promoter is a promoter derived from E. coli, and is produced by a combination of a trp promoter and a lac UV5 promoter. The Tac2 promoter is an Escherichia coli-derived promoter, prepared by a combination of a trp promoter and a lac UV5 promoter, and is an optimized form by modifying the sequence of the Tac1 promoter.

The ribosome binding region and the spacer may be chemically connected directly or indirectly connected through a linker nucleic acid sequence in the middle thereof. In one embodiment of the present invention, the ribosome binding region and the spacer sequence may include one oligonucleotide sequentially linked in the order of 5'to 3'. The nucleic acid sequences of the promoter sequence, ribosome binding region, and spacer sequence according to an embodiment of the present invention are shown in Table 1 below. In Table 1, the underlined and bold portions indicate the ribosome binding region, spacer sequence, and linker sequence of the control sequence.

order
number Sequence (5'->3') denomination One aagcgcctcatcagcggtaaccatcacgggttcgggtgcgaaaaaccatgccataacaggaatgttcctttcgaaaattgaggaagccttatgcccttcaaccctacttagctgccaattattccgggcttgtgacccccgctacccgatcccctcccgaggaggtccccgttaggaggaggtcccatgccataacaggaatgt
gaaaggattttttacccatggctgtatacgaactcccagaactcgactacgcatacgacgaaaggattacaaa Sod promoter
2 tgacaattaatcatcggctcgtatattgt
gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggggaaaggattacaaa tac1 promoter
3 Tgacaattaatcatccggctcgtataatgt
taacaatttgtggaattgtgagcggacacacaggaaacagaccatggaattcgagctcggtacccggggaaaggattacaaa Tac2 promoter
4 Tgacaattaatcatcggcctcgtataatgt trc promoter
5 Gaaagga Ribosome binding region 6 Ttacaaa Spacer sequence

It is preferable that the psicose epimerization enzyme according to the present invention has excellent enzymatic activity and thermal stability. Accordingly, in an embodiment of the present invention, the transcriptional promoter or regulatory sequence is important in combination with a gene encoding a psicose epimerase, and , Tac1, tac2, trc, and sod promoters can all provide more than adequate protein expression with the psicose epimerase used in the present invention, and when the sod promoter is used, the folding of the protein is robust and thermal stability is achieved. Higher results can be obtained, which is more preferable.

The method for producing Psychos using the recombinant strain may be performed according to the methods described in Korean Patent Publication 2014-0021974, Korean Patent Publication 2014-0080282, and Korean Patent Publication No. 10-1318422, but is not particularly limited. In the method of producing psicose, for efficient psicose production, the concentration of fructose used as a substrate may be 40 to 75% (w/v), for example, 50 to 75% (w/v) based on the total reactant. have. When the concentration of fructose is lower than the above range, economic efficiency is lowered, and when the concentration of fructose is higher than the above range, fructose is not easily dissolved. Therefore, the concentration of fructose is preferably within the above range. The fructose may be used in the form of a buffer solution or a solution dissolved in water (eg distilled water).

The beverage composition according to the present invention includes extracts or juices of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants, flesh fragments of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants, and psicose It may include.

The beverage composition according to the present invention may contain 0.1 to 100 parts by weight of extracts or juices of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants based on 100 parts by weight of the total solid content of the beverage composition.

Beverage composition according to the present invention, based on 100 parts by weight of the total solids content of the beverage composition, 1 to 80 parts by weight, for example, 5 to 50 parts by weight of the flesh fragments of one or more plants selected from the group consisting of fruits, vegetables and medicinal plants. It may be included in parts by weight or 10 to 45 parts by weight. The juice or extract may be used as it is added to a beverage, a concentrate obtained through an additional concentration process, a diluted product prepared by adding a diluting solvent such as water, or a powder obtained by drying.

Beverage composition according to the present invention, based on 100 parts by weight of the total solids content of the beverage composition may contain 1 to 20 parts by weight, for example, 5 to 15 parts by weight of the psychological course, taking into account the sweetness, taste and texture of the beverage Therefore, it can be included in a variety of contents.

In one embodiment, all of the sweeteners included in the beverage may be substituted for psicose, for example, one or more saccharides selected from the group consisting of sugar and fructose may not be added to the beverage. In addition, the content of one or more saccharides selected from the group consisting of sugar and fructose contained in beverages may be reduced, and may be used by mixing with psicose. In addition, when a small amount of sugar is included in the beverage, it has the effect of increasing the solubility of the stabilizer (gellan gum). For example, the method of adding a stabilizer to the beverage is to mix sugar and stabilizer and add small amounts of the stabilizer to the dissolution rate of the stabilizer. Increase The stabilizer reacts with calcium to form a fluid gel, and this fluid gel has a strong suspending ability without increasing the viscosity, so that the aloe pulp fragments do not settle and can be evenly distributed throughout the beverage.

Specific examples may include 0.1 to 98 parts by weight of extracts or juices of one or more selected plants, 1 to 50 parts by weight of flesh slices, and 1 to 20 parts by weight of psicos, based on 100 parts by weight of the total solid content of the beverage composition. Additional water may be included if necessary.

The preparation of the beverage composition according to the present invention includes the steps of providing an extract or juice of at least one selected plant, providing a flesh fragment of at least one plant selected from the group consisting of fruits, vegetables and medicinal plants, and the plant It includes the step of preparing a beverage by mixing the extract or juice of the flesh and the flesh fragments, and psicose.

The step of providing the extract or juice of the selected one or more plants, and the step of providing the flesh fragment of the selected one or more plants, directly prepares an extract or juice or flesh fragment of a plant from fruits, vegetables and medicinal plants, or It is also possible to purchase and use commercially available plant extracts or juice and flesh fragments. In a specific example, in the case of direct manufacture, after washing the aloe leaf with water and completely removing the skin of the aloe leaf, only the inner pulp part (jelly) was collected and 0.1 mm ² to 50 mm ² , for example 0.1 to 10 mm ² , 0.5mm ² to 10 mm ² , or 0.5 to 5 mm ² It can be cut into a size of 2 to prepare a pulp fragment. The size of the flesh pieces may be appropriately selected in consideration of the ease of sealing of the packaging container and the chewy taste of the flesh. The prepared pulp may be used as it is for beverage production, or additionally, a process of adding an acid such as citric acid or malic acid) to a piece of pulp, a process of sterilizing by heating at an appropriate temperature condition, and a process of treating additional additives. It can be manufactured by additionally performing one or more processes selected from.

In addition, in the step of preparing a beverage by mixing the extract or juice of the plant, the flesh fragment, and the psicose, a beverage is prepared by mixing the prepared raw materials, and a sterilization process, a filling process in a container, a degassing process, etc. are additionally performed. May be.

The beverage composition according to the present invention may further contain water or a solvent, in addition to plant extracts or juices, pulp fragments, and psicose, to prepare a diluted beverage. In addition, the beverage composition according to the present invention may further include one or more additives selected from the group consisting of flavorings, spices, stabilizers, pH adjusters, souring agents, seasonings, colorants, vitamins and antioxidants.

The souring agent is not particularly limited, and it is used to impart a sour taste to the flesh beverage. Examples of acidulants include citric acid, trisodium citric acid, DL-malic acid, lactic acid, phosphoric acid, tartaric acid, phytic acid, and the like. The flavoring is not particularly limited, and may be used to add flavor to the flesh beverage.

The vitamin is not particularly limited, and may be vitamin A, vitamin B1, vitamin B2, vitamin C, nicotic acid, pantothenic acid, vitamin B6, biotin, vitamin B12, vitamin E, and/or others. . These vitamins may be used alone or in combination of two or more.

The flesh beverage according to the present invention may contain various substances well known in the beverage manufacturing field. For example, amino acids, proteins, fiber foods, dietary petroleum, minerals, and the like may be included in one or more flesh drinks.

The present invention relates to a beverage containing fruit or plant fragments with improved texture and taste, and a method of manufacturing the same, which improves the storage stability of beverages and pulp fragments and maintains the texture to improve texture, and conventional pulp-containing beverages It has the effect of lowering the calorie and improving the taste of the beverage by replacing all of the fructose and sugar added to it, or by reducing the content of fructose and sugar.

1 is a schematic diagram illustrating a manufacturing process of a beverage according to an embodiment of the present invention.
Figure 2 is a diagram showing an example of the expression recombinant vector (pCES_sodCDPE) for the production of psicose syrup used in the present invention.
3 is a graph showing the osmotic pressure of a beverage prepared by injecting liquid fructose, sugar and psychos syrup to aloe vera gel pulp in an embodiment and a comparative example of the present invention.

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

Preparation Example 1: Preparation of Psicose-producing Strains and Psicose Syrup

Preparation Example 1-1: Preparation of Psicose-producing strain

The coding gene (DPE gene; Gene bank: EDS06411.1) of the psicose epimerase derived from Crosstridiuimscindens ATCC 35704 was synthesized as a polynucleotide in a modified form optimized for E. coli and CDPE Name it. The sod promoter and T7 terminator obtained from the polynucleotide optimized for E. coli (SEQ ID NO: 2) and pET21a vector were obtained as respective templates through PCR, and these were connected to one template by the overlap PCR method. Then, by cloning into a pGEM T-easy vector through T-vector cloning, the sequence of the polynucleotide including the sod promoter (SEQ ID NO: 1), the optimized CDPE sequence of SEQ ID NO: 8, and the T7-terminator was confirmed.

Recombinant vector pCES208/ by inserting the identified entire polynucleotide into the same restriction enzyme site of the expression vector pCES208 (J. Microbiol. Biotechnol., 18:639-647, 2008) using restriction enzymes NotI and XbaI (NEB). Psychos epimerase (pCES_sodCDPE) was prepared. A cleavage map of the prepared recombinant vector (pCES_sodCDPE) is disclosed in FIG. 1.

The prepared recombinant vector (pCES_sodCDPE) plasmid was transformed into Corynebacterium glutaricum using electroporation. Colonies were picked and inoculated in 4ml of LB medium (trypton 10g/L, NaCl 10g/L, yeast extract 5g/L) added with kanamycin at a final concentration of 15ug/ml, and culture conditions 30? And incubated at 250 rpm for about 16 hours. Then, 1 ml of the culture solution was obtained and inoculated into 100 ml LB medium containing 15 ug/ml kanamycin, and the main culture was performed for 16 hours or more. After lysing the cultured cells using a bead beater, only the supernatant is obtained, mixed with the sample buffer in 1:1, and heated at 100? for 5 minutes. Prepared sample was 12% SDS-PAGE gel (composition: running gel-3.3 ml H2O, 4.0 ml 30% acrylamide, 2.5 ml 1.5M Tris buffer (pH 8.8), 100 µl 10% SDS, 100 µl, 10% APS, 4 Μl TEMED / stacking gel-1.4 ml H2O, 0.33 ml 30% acrylamide, 0.25 ml 1.0M Tris buffer (pH 6.8), 20 µl 10% SDS, 20 µl 10% APS, 2 µl TEMED) at 180V for about 50 minutes Protein expression was confirmed by electrophoresis. After checking the expression of CDPE on the SDS-PAGE gel, proceed with His-tag purification using Ni-NTA resin to measure the exact expression level, and the calculation formula (expression rate (%) = (Purified protein (mg) / Total soluble protein (mg))) )) * 100) was used to calculate the expression rate. The prepared transformed Corynebacterium glutaricum produced 16.62 mg of total water-soluble protein and 1.74 mg of purified enzyme protein.

Preparation Example 1-2: Preparation of Psychos

In order to prepare Psicose from fructose by using the recombinant strain producing Psicose epimerase obtained in Preparation Example 1-1, cells were recovered by centrifugation in the strain culture.

Then, the cell suspension was treated with 0.05% (w/v) of an emulsifier (M-1695) in the final volume, followed by treatment at 35° C. (±5° C.) for 60 minutes. After the reaction was completed, the supernatant containing the emulsifier was removed using a centrifuge again, and the cells were recovered.

For the preparation of immobilized beads, the recovered cells were mixed with DW to adjust the final cell concentration to 5% (w/v), 4% (w/v) alginic acid dissolved in water and 5% recovered cells (w/v) ) Was mixed at 1:1, and stored refrigerated at 4° C. to remove air bubbles generated during mixing. The refrigerated mixed solution is formed into droplets by injection of the mixed solution through a neddle (internal diameter 0.20 ~ 0.30mm) and falls by weight, and the dropped mixed solution is dropped into a pre-prepared 100mM calcium chloride (CaCl ₂ ) solution and cured. To form a spherical or elliptical bead (diameter 2.0-2.2mm). The formed beads were immersed in a 100mM calcium chloride solution and mixed evenly by a stirrer to further harden.

After all the mixture was injected, the beads were further cured while refrigerated for 4 to 6 hours, and then replaced with a new 100 mM calcium chloride solution to cure for about 6 hours in a refrigerated state. After the curing was completed, the beads were removed completely and water was completely removed, and then three times the volume of water was added to the volume of the beads, followed by stirring for 10 minutes, and this process was treated three times to remove the calcium chloride solution. The washed beads were completely drained for manganese soaking, and then a 40 brix (%) reaction substrate containing 10 mM manganese was added in a volume of 3 times the volume of the beads, followed by stirring for 10 minutes. It was replaced with a reaction substrate containing 10 mM manganese. The reaction substrate is controlled by 3N NaOH at pH 6.8 ~ 7.2, and liquid fructose or crystalline fructose can be used as the reaction substrate depending on the type of product. The beads replaced with the reaction substrate containing 10 mM manganese were transferred to the reaction tank and reacted for about 30 to 60 minutes at a reaction temperature of 50? to complete the soaking of the beads with manganese and fructose. The diameter of the soaked bead is reduced to about 1.6~1.8mm, and the strength is also increased. After removing the substrate of the soaked beads, they were filled in an immobilization reaction column, and then used to produce psicose syrup.

<Immobilization column reaction conditions>

Reaction temperature: 50℃ inside the column jacket

Substrate flow rate: 0.5 SV (space velocity L. h-1)

Reaction substrate: crystalline fructose 40 brix, pH 6.8~7.2, no ^{Mn 2+ added}

Bead preparation: 2.5% (w/w) cells, 2% (w/w) alginic acid mixed and 10 mM Mn ²⁺ soaking

In the immobilization reaction column, when the raw material solution contains 75% solids and the total solids content is 100 parts by weight, a raw material containing 55 parts by weight of fructose and a raw material containing 92 parts by weight are provided. Psychos syrup, which is a mixed sugar of, was prepared. That is, 15 (w/w)% Psychos syrup with glucose: fructose: picose: oligosaccharide = 41:39:15:5 was obtained from the reaction solution and used in the following examples.

Examples 1 and 2: Preparation of aloe beverage

Trisodium citrate was completely dissolved in purified water at 80 to 85°C, and white sugar and gellan gum were added in small portions and heated to 80°C or higher to completely dissolve. Then, calcium lactate was dissolved in water and added to the heated mixture. Psychosyrup, dextrin, vitamin C, and citric acid were added and then stirred for 10 minutes. Finally, after the aloe flavor was added, purified water was further added, and then sterilized at 104° C. for 20 seconds.

The aloe vera gel juice-containing fragment was added to the sterilized solution, and cooled to 40? or less. An aloe beverage was prepared by applying a shearing force so that the aloe vera gel fragments contained in the cooled solution were evenly dispersed. In Example 1, 15% syrup was used, and in Example 2, 15% syrup and sugar were mixed and used.

Comparative Example 1: Preparation of fructose-added beverage

In the method for preparing an aloe beverage to which the psicose was added of Examples 1 and 2, it was prepared in the same manner except that liquid fructose was used in place of psicose syrup.

In Table 2 below, the blending ratios of the raw materials for preparing the aloe beverages of Examples 1 to 2 and Comparative Example 1 are shown in wt%.

Comparative Example 2: Preparation of sugar-added beverage

In the method for preparing an aloe beverage to which psicose was added of Examples 1 and 2, it was prepared in the same manner except that sugar was used in place of psicose syrup.

In Table 2 below, the blending ratios of the raw materials for preparing the aloe beverages of Examples 1 to 2 and Comparative Example 2 are shown in wt%.

Raw material name Comparative Example 1 Comparative Example 2 Example 1 Example 2 Fragment containing aloe vera gel juice (wt%) 10.00 10.00 10.00 10.00 Liquid fructose (wt%) 12.00 - - - Psychosyrup (wt%) - - 12.00 10.00 White sugar (wt%) - 9.00 - 2.00 Dextrin (wt%) 0.50 0.50 0.50 0.50 Citric acid (wt%) 0.13 0.13 0.13 0.13 Calcium lactate (wt%) 0.15 0.15 0.15 0.15 Vitamin C (wt%) 0.03 0.03 0.03 0.03 Trisodium citrate (wt%) 0.02 0.02 0.02 0.02 Gellan gum (wt%) 0.03 0.03 0.03 0.03 Aloe fragrance (wt%) 0.10 0.10 0.10 0.10 Purified water (wt%) Balance Balance Balance Balance Total (wt%) 100.00 100.00 100.00 100.00

In the table above, the liquid fructose was used by Samyang Genex Co., Ltd., and the white sugar was used by Samyang Corporation.

Test Example 1: Sensory test

For the sensory evaluation of the beverage, 15 ml of the beverage of Examples 1 to 2 and the beverage according to Comparative Examples 1 to 2 were put in the mouth, and the oral epidermis was evenly stimulated for 20 seconds and then spit out. After 10 minutes elapsed after the mouth was washed, the next sample was evaluated, and the sensory elements were displayed on a 5-point box scale. In order to investigate the effect on the sensory properties of beverages, the temperature of all samples used for sensory evaluation was prepared to be room temperature. The sensory evaluation personnel consisted of 10 panelists who were trained in the evaluation of basic taste and flavor, and were displayed on a 5-point scale. The evaluation criteria of the above items are as follows, and the results are shown in Table 3 below.

The overall taste preference, intensity of sweetness, sore throat, astringency, and astringent aftertaste were evaluated on a 5-point scale. The aftertaste is a taste that has a long remaining in the mouth, and when the aftertaste is low, it is 1, and the strongest is 5. It was determined by points and evaluated on a 5-point scale.

[Evaluation standard]

Overall taste preference (very bad (1 point)-very good (5 points))

Degree of sweetness (not sweet at all (1 point)-very sweet (5 points)

Astringent taste (no astringent taste at all (1 point)-very astringent taste (5 points))

Neck passing (Neck passing is too bad (1 point)-Neck passing is very good (5 points))

Fumi Arin taste (No taste at all (1 point)-Very much Arin taste (5 points))

Evaluation item Comparative Example 1 Comparative Example 2 Example 1 Example 2 Overall taste preference 3.55 3.68 4.09 3.85 Degree of sweetness 3.10 3.06 3.15 3.24 Astringent taste 2.28 2.15 1.84 1.98 Over the neck 3.30 3.23 4.07 3.90 Afternoon taste 2.88 2.96 1.99 2.15

The liquid fructose application product (Comparative Example 1) and the white sugar application product (Comparative Example 2) had a tingling taste at the tail, but the psychedelic syrup application product (Examples 1 and 2) had improved arid taste. In addition, compared to the liquid fructose application product (Comparative Example 1) and the white sugar application product (Comparative Example 2), the applied products of Psychos syrup (Examples 1 and 2) improved throat.

Test Example 2: Evaluation of physical properties of beverages

In order to measure the Brix, specific gravity, pH and acidity of the beverage, the beverages of Examples 1 to 2 and the beverages according to Comparative Examples 1 to 2 were measured using a pH meter, a digital refractometer, and an acidity measurement method. , The results are shown in Table 4 below. The specific measurement criteria for physical properties are as follows.

pH measurement: measuring temperature 25℃, using a pH meter (Methrom 780 pH meter, Switzerland)

Brix: Measuring temperature 20℃, measured using Digital Refractometer (ATAGO Digital Refractometer RX-5000)

Acidity: Take 50 g of each sample, add _{distilled water from which CO 2} has been removed, and titrate with 0.1N NaOH until the pH reaches 8.2, and calculate the acidity according to the following equation.

Evaluation item Comparative Example 1 Comparative Example 2 Example 1 Example 2 pH 3.754 3.751 3.738 3.749 Brix 10.82 10.76 10.78 10.75 Acidity (v/w%) 0.125 0.125 0.125 0.125

As shown in Table 4, it was confirmed that the beverage of the example was equivalent to the beverage of the comparative example in the case of pH, Brix, and acidity.

Test Example 3: Evaluation of physical properties of pulp

The weight of the first aloe vera gel pulp of a slice containing aloe vera gel juice (45% aloe vera gel, 54.9% aloe vera gel juice, 0.1% citric acid) was measured. After filtration, the weight of the aloe vera gel was measured to compare the osmotic pressure, that is, the difference in the degree of addition of liquid fructose, sugar, and psychosyrup to the aloe vera gel pulp. The experimental results are shown in Tables 5, 6, and 3 below.

Osmotic pressure (w/w%) = {Aloe vera gel pulp weight after 10 days (g)-Initial aloe vera gel pulp weight (g)}/ Initial aloe vera gel pulp weight (g) X 100

Evaluation item Comparative Example 1 Comparative Example 2 Example 1 Example 2 Initial pulp weight (g) 22.5 22.5 22.5 22.5 Weight of pulp after 10 days (g) 23.64 23.45 24.18 23.90 Sugar input degree (w/w%) 5.06 4.22 7.47 6.22

In addition, for the filtered aloe vera gel pulp, the sensory evaluation personnel of the degree of moisture, the degree of sweetness, the degree of bitterness, the degree of firmness, and the freshness of the pulp were 10 panelists trained in taste and flavor evaluation. It was configured and displayed on a 5-point scale.

Evaluation item Comparative Example 1 Comparative Example 2 Example 1 Example 2 Degree of moisture 3.0 2.9 3.3 3.1 Degree of sweetness 2.5 2.5 2.6 2.6 Degree of firmness 2.2 2.2 2.4 2.3 Freshness of the flesh 2.9 2.8 3.1 3.0

Compared to the liquid fructose application product (Comparative Example 1) and the white sugar application product (Comparative Example 2), the degree of moisture, the degree of elasticity, and the freshness of the flesh were improved in the products applied with Psychos syrup (Examples 1 and 2).

Example 3 and Comparative Example 3-4: Pear puree-containing beverage

According to the composition of the ingredients in Table 7 below, trisodium citrate is completely dissolved in purified water at 80 to 85° C., and white sugar and gellan gum are added in small portions to dissolve 80? It was warmed to the above. Then, calcium lactate was dissolved in water and added to the heated mixture. Psychos 15% syrup, vitamin C, and citric acid were added and then stirred for 10 minutes. Finally, after orientation was added, purified water was further added and sterilized at 104° C. for 20 seconds. Pear puree was prepared by purchasing pears and grinding them so that ^{the grains are 1 to 5 mm 2.}

As the sweetener, Psychos 15% syrup was used in Example 3, liquid fructose was used in Comparative Example 3, and white sugar was used in Comparative Example 4. The liquid fructose was used by Samyang Genex Co., Ltd., and the white sugar was used by Samyang Corporation.

Vapure was added to the sterilized solution, and cooled to 40? or less. Aloe beverage was prepared by applying a shearing force so that the pear puree contained in the cooled solution was evenly dispersed.

Raw material name Comparative Example 3 Comparative Example 4 Example 3 Pear puree (wt%) 15.00 15.00 15.00 Liquid fructose (wt%) 10.00 - - White sugar (wt%) - 7.50 - Psychosyrup (wt%) - - 10.00 Citric acid (wt%) 0.10 0.10 0.10 Calcium lactate (wt%) 0.15 0.15 0.15 Vitamin C (wt%) 0.03 0.03 0.03 Trisodium citrate (wt%) 0.02 0.02 0.02 Gellan gum (wt%) 0.03 0.03 0.03 Orientation 0.10 0.10 0.10 Purified water (wt%) Balance Balance Balance Sum 100.00 100.00 100.00

For the three beverages prepared above, 15 ml of the beverage was placed in the mouth, the oral epidermis was evenly stimulated for 20 seconds, and then spit out, and each time the evaluation of one sample was completed, the mouth was washed with water, and after 10 minutes elapsed, the next sample was evaluated. Thus, the sensory elements were expressed on a 5-point box scale. In order to investigate the effect on the sensory properties of beverages, the temperature of all samples used for sensory evaluation was prepared to be room temperature. The sensory evaluation personnel consisted of 10 panelists trained in taste and flavor evaluation, and were expressed on a 5-point scale.

Accordingly, the pear puree of the beverage was filtered to evaluate the moisture, sweetness, firmness of the pulp, and the freshness of the pulp according to the following evaluation criteria, and the results are shown in Table 8.

[Evaluation standard]

Moisture level: (Not at all moist (1 point)-Very moist (5 points))

Sweetness: (Not at all sweet (1 point)-Very sweet (5 points))

The firmness of the flesh: (Not at all firm (1 point)-Very firm (5 points))

Freshness of the flesh: (Not at all fresh (1 point)-Very fresh (5 points))

Evaluation item Comparative Example 3 Comparative Example 4 Example 3 Degree of moisture 3.0 3.1 3.5 Degree of sweetness 3.7 3.6 3.6 The degree of firmness of the flesh 2.3 2.2 2.5 Freshness of the flesh 3.2 3.0 3.4

Compared to the liquid fructose application product (Comparative Example 3) and the white sugar application product (Comparative Example 4), the degree of moisture, elasticity, and freshness of the flesh were improved in the Psychos syrup application product (Example 3).

Example 4 and Comparative Example 5-6: Orange Sack-Containing Beverage

According to the component composition of Table 9 below, concentrated orange fruit juice, citric acid, vitamin C, and sweetener were added to purified water and stirred to prepare a mixed solution. As the sweetener, Psychos 15% syrup was used in Example 4, liquid fructose was used in Comparative Example 5, and white sugar was used in Comparative Example 6. The liquid fructose was used by Samyang Genex Co., Ltd., and the white sugar was used by Samyang Corporation.

Orange sak and orange flavor were added to the mixture and stirred for 10 minutes, followed by sterilization at 104° C. for 20 seconds. The sterilized solution was cooled to 40? or less to prepare a beverage. Orange juice was concentrated to 65 brix, and American juice was used, and orange juice was processed so that only small grains were produced by acid and salt treatment of oranges.

Raw material name Comparative Example 5 Comparative Example 6 Example 4 Orange Concentrated Fruit Juice (wt%) 7.00 7.00 7.00 Orange sac (SAC) (wt%) 15.0 15.0 15.0 Liquid fructose (wt%) 10.00 - - White sugar (wt%) - 7.50 - Psychosyrup (wt%) - - 10.00 Citric acid (wt%) 0.18 0.18 0.18 Vitamin C (wt%) 0.015 0.015 0.015 Orange scent 0.10 0.10 0.10 Purified water (wt%) Balance Balance Balance Sum 100.00 100.00 100.00

For the three beverages prepared above, orange sap was filtered to evaluate the moisture, sweetness, firmness of the pulp, and the freshness of the pulp using substantially the same evaluation criteria and evaluation methods as in Example 3, and the results are shown in Table 10. Shown in.

Evaluation item Comparative Example 5 Comparative Example 6 Example 4 Degree of moisture 2.9 2.8 2.9 Degree of sweetness 3.2 3.0 3.2 Degree of firmness 3.5 3.5 3.8 Freshness of the flesh 3.4 3.3 3.5

Compared to the liquid fructose application product (Comparative Example 5) and the white sugar application product (Comparative Example 6), the degree of moisture, elasticity, and freshness of the flesh were improved in the Psychos syrup application product (Example 4).

Example 5 and Comparative Example 7-8: Preparation of grape beverage containing natad coco

According to the composition of the ingredients in Table 11 below, trisodium citrate is completely dissolved in purified water at 80 to 85° C., and white sugar and gellan gum are added in small portions to be completely dissolved by 80? It was warmed to the above. Then, calcium lactate was dissolved in water and added to the heated mixture. Psychos 15% syrup, vitamin C, and citric acid were added and then stirred for 10 minutes. Finally, after adding grape flavor, purified water was further added, and then sterilized at 104° C. for 20 seconds.

As the sweetener, 15% syrup was used in Example 5, and liquid fructose was used in Comparative Example 7 and white sugar was used in Comparative Example 8. The liquid fructose was used by Samyang Genex Co., Ltd., and the white sugar was used by Samyang Corporation.

Natad Coco was added to the sterilized solution, and cooled to 40° C. or less. A grape beverage containing Natad Coco was prepared by applying a shearing force so that the Natad Coco contained in the cooled solution was evenly dispersed.

The grape concentrate in the drink was made from American juice concentrated to 68 brix, and Natad Coco is a jelly-type processed product made by hardening coconut fruit juice (coconut milk) with acetic acid fermentation. Natad Coco 45%, coconut syrup 54.9 %, citric acid is mixed with 0.1% and distributed by aseptic or vacuum packaging, and the natadcono in the beverage was made of Vietnamese raw materials having a ^{natadcoco particle size of 1 to 10 mm 2.}

Raw material name Comparative Example 7 Comparative Example 8 Example 5 Grape Concentrate Juice (wt%) 0.50 0.50 0.50 Natad Coco (wt%) 10.00 10.00 10.00 Liquid fructose (wt%) 10.00 - - White sugar (wt%) - 7.50 - Psychosyrup (wt%) - - 10.00 Citric acid (wt%) 0.18 0.18 0.18 Calcium lactate (wt%) 0.15 0.15 0.15 Vitamin C (wt%) 0.03 0.03 0.03 Trisodium citrate (wt%) 0.02 0.02 0.02 Gellan gum (wt%) 0.03 0.03 0.03 Grape flavor (wt%) 0.10 0.10 0.10 Purified water (wt%) Balance Balance Balance Sum 100.00 100.00 100.00

For the three beverages prepared above, the moisture, sweetness, firmness of the pulp, and the freshness of the pulp were evaluated by substantially the same evaluation criteria and evaluation methods as in Example 3, and the results are shown in Table 12.

Evaluation item Comparative Example 7 Comparative Example 8 Example 5 Degree of moisture 2.8 2.8 2.9 Degree of sweetness 1.7 1.6 1.7 Degree of firmness 3.8 3.8 3.8 Freshness of the flesh 3.0 2.9 3.2

Compared to the liquid fructose application product (Comparative Example 7) and the white sugar application product (Comparative Example 7), the freshness of the flesh was improved in the Psychos syrup application product (Example 5).

<110> SAMYANG GENEX CORPORATION <120> Beverage with improved taste including fragment of fruit or plant and method of preparing the same <130> DPP20172160KR <160> 9 <170> KopatentIn 1.71 <210> 1 <211> 356 <212> DNA <213> Artificial Sequence <220> <223> sod promoter (6) <400> 1 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg acgaaaggat tacaaa 356 <210> 2 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> Tac1 promoter (4) <400> 2 tgacaattaa tcatcggctc gtatattgtg tggaattgtg agcggataac aatttcacac 60 aggaaacaga attcccgggg aaaggattac aaa 93 <210> 3 <211> 112 <212> DNA <213> Artificial Sequence <220> <223> Tac2 promoter (4) <400> 3 tgacaattaa tcatccggct cgtataatgt taacaatttg tggaattgtg agcggacaca 60 caggaaacag accatggaat tcgagctcgg tacccgggga aaggattaca aa 112 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Trc promoter (1) <400> 4 tgacaattaa tcatcggcct cgtataatgt 30 <210> 5 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Ribosome binding region <400> 5 gaaagga 7 <210> 6 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Spacer sequence <400> 6 ttacaaa 7 <210> 7 <211> 289 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of an enzyme protein originated from Clostridium scindens <400> 7 Met Lys His Gly Ile Tyr Tyr Ala Tyr Trp Glu Gln Glu Trp Ala Ala 1 5 10 15 Asp Tyr Lys Arg Tyr Val Glu Lys Ala Ala Lys Leu Gly Phe Asp Ile 20 25 30 Leu Glu Val Gly Ala Ala Pro Leu Pro Asp Tyr Ser Ala Gln Glu Val 35 40 45 Lys Glu Leu Lys Lys Cys Ala Asp Asp Asn Gly Ile Gln Leu Thr Ala 50 55 60 Gly Tyr Gly Pro Ala Phe Asn His Asn Met Gly Ser Ser Asp Pro Lys 65 70 75 80 Ile Arg Glu Glu Ala Leu Gln Trp Tyr Lys Arg Leu Phe Glu Val Met 85 90 95 Ala Gly Leu Asp Ile His Leu Ile Gly Gly Ala Leu Tyr Ser Tyr Trp 100 105 110 Pro Val Asp Phe Ala Thr Ala Asn Lys Glu Glu Asp Trp Lys His Ser 115 120 125 Val Glu Gly Met Gln Ile Leu Ala Pro Ile Ala Ser Gln Tyr Gly Ile 130 135 140 Asn Leu Gly Met Glu Val Leu Asn Arg Phe Glu Ser His Ile Leu Asn 145 150 155 160 Thr Ser Glu Glu Gly Val Lys Phe Val Thr Glu Val Gly Met Asp Asn 165 170 175 Val Lys Val Met Leu Asp Thr Phe His Met Asn Ile Glu Glu Ser Ser 180 185 190 Ile Gly Asp Ala Ile Arg His Ala Gly Lys Leu Leu Gly His Phe His 195 200 205 Thr Gly Glu Cys Asn Arg Met Val Pro Gly Lys Gly Arg Thr Pro Trp 210 215 220 Arg Glu Ile Gly Asp Ala Leu Arg Glu Ile Glu Tyr Asp Gly Thr Val 225 230 235 240 Val Met Glu Pro Phe Val Arg Met Gly Gly Gln Val Gly Ser Asp Ile 245 250 255 Lys Val Trp Arg Asp Ile Ser Lys Gly Ala Gly Glu Asp Arg Leu Asp 260 265 270 Glu Asp Ala Arg Arg Ala Val Glu Phe Gln Arg Tyr Met Leu Glu Trp 275 280 285 Lys <210> 8 <211> 870 <212> DNA <213> Artificial Sequence <220> <223> modified nucleic acid sequence (1) of the enzyme protein of SEQ ID NO: 7 <400> 8 atgaaacacg gtatctacta cgcgtactgg gaacaggaat gggcggcgga ctacaaacgt 60 tacgttgaaa aagcggcgaa actgggtttc gacatcctgg aagttggtgc ggcgccgctg 120 ccggactact ctgcgcagga agttaaagaa ctgaaaaaat gcgcggacga caacggtatc 180 cagctgaccg cgggttacgg tccggcgttc aaccacaaca tgggttcttc tgacccgaaa 240 atccgtgaag aagcgctgca gtggtacaaa cgtctgttcg aagttatggc gggtctggac 300 atccacctga tcggtggtgc gctgtactct tactggccgg ttgacttcgc gaccgcgaac 360 aaagaagaag actggaaaca ctctgttgaa ggtatgcaga tcctggcgcc gatcgcgtct 420 cagtacggta tcaacctggg tatggaagtt ctgaaccgtt tcgaatctca catcctgaac 480 acctctgaag aaggtgttaa attcgttacc gaagttggta tggacaacgt taaagttatg 540 ctggacacct tccacatgaa catcgaagaa tcttctatcg gtgacgcgat ccgtcacgcg 600 ggtaaactgc tgggtcactt ccacaccggt gaatgcaacc gtatggttcc gggtaaaggt 660 cgtaccccgt ggcgtgaaat cggtgacgcg ctgcgtgaaa tcgaatacga cggtaccgtt 720 gttatggaac cgttcgttcg tatgggtggt caggttggtt ctgacatcaa agtttggcgt 780 gacatctcta aaggtgcggg tgaagaccgt ctggacgaag acgcgcgtcg tgcggttgaa 840 ttccagcgtt acatgctgga atggaaataa 870 <210> 9 <211> 870 <212> DNA <213> Artificial Sequence <220> <223> modified nucleic acid sequence (2) of the enzyme protein of SEQ ID NO:7 <400> 9 atgaagcacg gcatctacta cgcatactgg gagcaggagt gggcagcaga ctacaagcgc 60 tacgttgaga aggcagcaaa gctgggcttc gacatcctgg aggttggcgc agcaccactg 120 ccagactact ccgcacagga ggttaaggag ctgaagaagt gcgcagacga caacggcatc 180 cagctgaccg caggctacgg cccagcattc aaccacaaca tgggctcctc cgacccaaag 240 atccgcgagg aggcactgca gtggtacaag cgcctgttcg aggttatggc aggcctggac 300 atccacctga tcggcggcgc actgtactcc tactggccag ttgacttcgc aaccgcaaac 360 aaggaggagg actggaagca ctccgttgag ggcatgcaga tcctggcacc aatcgcatcc 420 cagtacggca tcaacctggg catggaggtt ctgaaccgct tcgagtccca catcctgaac 480 acctccgagg agggcgttaa gttcgttacc gaggttggca tggacaacgt taaggttatg 540 ctggacacct tccacatgaa catcgaggag tcctccatcg gcgacgcaat ccgccacgca 600 ggcaagctgc tgggccactt ccacaccggc gagtgcaacc gcatggttcc aggcaagggc 660 cgcaccccat ggcgcgagat cggcgacgca ctgcgcgaga tcgagtacga cggcaccgtt 720 gttatggagc cattcgttcg catgggcggc caggttggct ccgacatcaa ggtttggcgc 780 gacatctcca agggcgcagg cgaggaccgc ctggacgagg acgcacgccg cgcagttgag 840 ttccagcgct acatgctgga gtggaagtaa 870

Claims (15)

At least one extract or juice selected from the group consisting of fruits, vegetables and medicinal plants; At least one pulp fraction selected from the group consisting of fruits, vegetables and medicinal plants; And ficus-containing beverages comprising sauces and improved texture and flavor.
The beverage according to any one of claims 1 to 4, wherein the Saikosu maintains the texture of the flesh.
The method of claim 1, wherein the fruit is selected from the group consisting of orange, grape, grapefruit, lemon, peach, apricot, pear, apple, tangerine, pineapple, strawberry, cranberry, blueberry, blackcurrant, asahiberry, pomegranate, Watermelon, melon, plum, kiwi and furun,
The vegetable may be at least one selected from the group consisting of carrot, tomato, lettuce, cabbage, celery, pumpkin, broccoli, red beet, spinach, kale, cabbage, cauliflower, parsley, watercress, red bell pepper, ego,
Wherein the medicinal plant is at least one selected from the group consisting of aloe, cactus, drop, chinese herb, hump, dodeca, bellflower, mushroom, bean curd, bean curd, bean curd, corn oil, omija, dandelion, ginger and horse.
[Claim 4] The composition according to claim 3, which is at least one extract or juice selected from the group consisting of aloe, pear, orange, and grape; And at least one pulp fraction selected from the group consisting of aloe, pear, orange, and grape, and psicose.
5. The beverage according to claim 4, wherein the beverage comprises aloe juice, aloe fruit fractions, and psicose.
The beverage according to claim 1, wherein the extract or juice is a solvent extract, a juice, a concentrate or a powder of the solvent extract or juice of at least one plant selected from the group consisting of fruits, vegetables and medicinal plants.
The beverage according to claim 1, wherein the pulp is a pulverized material or a cutter of at least one plant selected from the group consisting of fruits, vegetables and medicinal plants.
The beverage according to claim 1, wherein the fruit piece is 0.1 to 50 mm ² in size.
The beverage according to any one of claims 1 to 5, wherein the Saicos is added in powder or liquid form.
[Claim 2] The method according to claim 1, wherein the cyclosporin is contained in an amount of 1 to 99.9 parts by weight, based on 100 parts by weight of the total solid content of the mixed sugar, and further contains at least one saccharide selected from the group consisting of fructose, glucose and oligosaccharide Drinks.
[Claim 10] The beverage according to claim 10, wherein the Saicos is comprised of 2 to 55 parts by weight, 10 to 30 parts by weight of fructose, and 2 to 60 parts by weight of glucose, based on 100 parts by weight of the total solid content of the mixed sugar.
The beverage according to claim 1, comprising 1 to 80 parts by weight of a flesh piece of at least one plant selected from the group consisting of fruits, vegetables and medicinal plants based on 100 parts by weight of the total solid content of the beverage.
The beverage according to claim 1, wherein the beverage comprises 1 to 20 parts by weight of acyclovir, based on 100 parts by weight of the total solids content of the beverage.
[3] The composition of claim 1, which comprises 0.1 to 98 parts by weight of an extract or juice of at least one plant selected from the group consisting of fruits, vegetables and medicinal plants based on 100 parts by weight of the total solid content of the beverage; 1 to 50 parts by weight of a flesh piece of at least one plant selected from the group consisting of fruits, vegetables and medicinal plants; And about 1 to about 20 parts by weight of Saicos.
The beverage according to claim 1, further comprising at least one additive selected from the group consisting of flavorings, spices, stabilizers, pH adjusting agents, acidifiers, seasonings, colorants, vitamins and antioxidants.

Images