KR20170019883A - Method for enhancing metabolizing activity of hepatocytes - Google Patents

Abstract

The present invention relates to a production method of high-function hepatocyte, which differentiates into hepatocyte from human pluripotent stem cells, and increases the expression and activity of drug metabolizing enzyme and the physiological function of the hepatocyte by repetitively treating xenobiotics on the differentiated hepatocyte.

Description

Methods for enhancing metabolizing activity of hepatocytes [

The present invention relates to a method for producing high-function hepatocytes and high-performance hepatocytes prepared therefrom.

Adverse effects on liver function and hepatic tissue damage are one of the main toxic inducing factors of drugs, and it is very important to evaluate whether hepatotoxicity of drugs or the generation of unexpected metabolites in the early stage of new drug development. However, there is no in vitro evaluation tool that can replace the liver. In the case of hepatocellular carcinoma cell line used as a substitute, hepatic cell specific metabolite enzyme (CYP enzymes, Phase I & II such as GST) The expression and activity of major plasma membrane transporters (ABC, SLC transporters) are very low.

In addition, the hepatocytes harvested directly from the normal liver and harvested from the liver are very limited in their proliferative power, unstable in quality, different from the cells of other tissues, and the expression levels of the hepatocyte-specific drug metabolizing enzyme and major protein are remarkably different from those of normal hepatocytes It shows a difference. In particular, even in the case of primary cultured hepatocytes, even if cultured, the hepatocyte characteristics are easily lost and the drug metabolizing activity is lost, which is a great limitation in evaluating long-term hepatotoxicity.

Because of the polymorphism of the CYP family, which is expressed in human liver, there is always a potential difference in drug efficacy and risk of side effects due to the genetic variation of each race, even if the same drug is used.

Therefore, when approximately 90 kinds of fully differentiable human embryonic stem cells (WiCell data) established domestically and externally are used for drug screening and in vitro stability system construction through hepatocyte differentiation, a drug due to mutual genetic variation Activity and metabolism of the candidate drug may contribute to securing the stability of the candidate drug.

It is also used for in vitro drug screening and toxicity studies using human embryonic stem cells (hESCs) and human-derived pluripotent stem cells derived from hepatocyte-like cells (HLCs) do. However, the HLCs reported so far have very low drug metabolism capabilities, and researchers worldwide are struggling to find breakthroughs to overcome them. Recently, 3D culture technology, scaffold, nanopattern chip, and co-culture method with various cells have been applied to improve the low drug metabolism ability, but the function to improve is still low, so that the human hepatocyte screening and toxicity It is considered that there is a limit to use for research.

Woo, D. H., Kim, S. K., Lim, H. J., Heo, J., Park, H. S., Kang, G. Y., Kim, S. E., You, H. J., Hoeppner, D. J., Kim, Y., et al. (2012). Direct and indirect contribution of human embryonic stem cell-derived hepatocyte-like cells to liver repair in mice. Gastroenterology. 142, 602-611. Desta, Z., Zhao, X., Shin, J. G., Flockhart, D. A. (2002). Clinical significance of the cytochrome P450 2C19 genetic polymorphism. Clin Pharmacokinet. 41, 913-958. Gieseck, R. L., 3rd., Hannan, N. R., Bort, R., Hanley, N. A., Drake, R. A., Ameron, G. W., Wynn, T. A., Vallier, L. (2014). Maturation of induced pluripotent stem cell derived hepatocytes by 3D-culture. PloS one. 9, e86372. M., Nordell, P., Asplund, A., Rehnstrom, M., Jacobsson, S., Holmgren, G., Davidson, L., Brolen, G., Edsbagge, J., Bjorquist, P., et al. (2013). Drug metabolizing enzyme and transporter protein profiles of hepatocytes derived from human embryonic and induced pluripotent stem cells. Biochem Pharmacol. 86, 691-702. Schwartz, R. E., Fleming, H. E., Khetani, S. R., Bhatia, S. N. (2014). Pluripotent stem cell-derived hepatocyte-like cells. Biotechnology Adv. 32,504-513.

Accordingly, the present inventors have made efforts to solve the above problems, and as a result, the present inventors have completed the present invention by developing a method for producing hepatocytes in which the expression of drug metabolizing enzymes is enhanced by repeatedly treating the biochip with hepatocytes differentiated from stem cells.

It is an object of the present invention to provide a method for producing a high-function hepatocyte which enhances the expression of a drug metabolizing enzyme.

Another object of the present invention is to provide a highly functional hepatocyte produced by the above differentiation method.

As means for solving the above problems,

Repeated treatment of xenobiotics on hepatocytes differentiated from human pluripotent stem cells

The present invention also provides a method for producing a high-function hepatocyte which improves the expression and activity of the drug metabolizing enzyme including the hepatocyte and the physiological function of the hepatocyte.

As another means for solving the above problems, the present invention provides a highly functional hepatocyte produced by the above method.

As another means for solving the above problems, the present invention provides a therapeutic composition for the recovery of liver function necessary for the treatment of acute, chronic or genetic liver damage including high-function hepatocytes prepared by the above method do.

Further, as another means for solving the above problems,

A method for testing metabolism of a drug candidate substance,

There is provided a test method of drug metabolism for quantifying metabolism of a drug candidate using high function hepatocytes prepared by the above method.

Further, as another means for solving the above problems,

A method for testing the toxicity of a drug candidate substance,

There is provided a test method for toxicity of a drug candidate substance which quantifies a drug metabolizing enzyme mutation and apoptosis caused by a drug candidate substance using the high function hepatocyte prepared by the above method.

Since the present invention can be utilized as an analysis and evaluation tool very similar to human tissue in the development stage of new drugs, the present technology development can be utilized not only for identifying the cause of disease and for discovering new drug targets, It is expected that the technology will be available in most stages of preclinical field from the early stage of new drug development such as research, safety research, and metabolism research.

To assess the toxicity of differentiated hepatocytes from human omnipotent stem cell lines (human embryonic stem cells and derived pluripotent stem cells) with various genetic backgrounds, it is possible to predict and evaluate the individual differences in drug efficacy and toxicity through drug metabolism It is expected to be possible.

The CYP enzymatic activity of hepatocyte-derived stem cells, reported worldwide, is very low compared to normal hepatocytes. Therefore, when a method for producing a high-function hepatocyte for increasing the activity of essential enzymes related to these drug metabolism and delivery is developed, it is easy to develop a cell line functionally equivalent to human hepatocyte, which includes the evaluation of drug efficacy and toxicity Which will greatly contribute to the credibility of new drug development.

FIG. 1 is a schematic diagram showing the differentiation of undifferentiated human embryonic stem cells into pluripotent human embryonic stem cells in the absence of nutritious cells through various steps into functional hepatocytes. Step-specific differentiation markers (undifferentiated: OCT4, complete endoderm: Sox17, Cells: AFP, immature hepatocytes: ALB, mature hepatocytes (ALB, ASGPR1) and inducers for induction of differentiation (undifferentiated: mTeSR1 medium, complete endoderm: Activin A, CHIR99021, Sodium butyrate, abundant bacterium: BMP2, FGF4, Oncostatin M, Dexamethesone) were induced by 22 days in total for the differentiation of retinoic acid, B27, hepatocyte proliferation: Nicotinamide, Ascorbic acid, bFGF, B27, immature hepatocytes: HGF and mature hepatocytes.
FIG. 2 shows gene expression by differentiation stages.
FIG. 3 is a photograph showing the step of proliferating hepatocytes after hepatocytes were obtained through RA after differentiation into endoderm cells.
4 shows the expression of hepatocyte markers (albumin and AFP) and CYP3A4 enzyme expression in hepatocytes derived from human embryonic stem cells through repeated administration of a hepatotoxic substance.
FIG. 5 shows improvement of drug metabolism ability of human embryonic stem cell-derived hepatocytes by repeated administration of hepatotoxic substance.
Fig. 6 shows the activity of CYP3A4 in 3D hepatocyte hepatocyte increased drug metabolism by repeated treatment of drug.

Hereinafter, the configuration of the present invention will be described in more detail.

The present invention relates to a method for producing a high-function hepatocyte which enhances the expression of a drug metabolizing enzyme, comprising the step of culturing hepatocytes from stem cells by repeatedly treating xenobiotics.

The stem cell of the present invention may be a mammalian-derived cell having the ability to differentiate into hepatocytes in in vitro culture, preferably pluripotent stem cells or the originating cells of the cells. The mammal in the present invention is not particularly limited and may be selected from the group consisting of rodentia, lagomorpha, primates, carnivora, perissodactyla and artiodactyla Lt; RTI ID = 0.0 > mammal. ≪ / RTI > In one embodiment, the mammal may be a mouse, a rabbit, a cow, a pig, a monkey, a person, and may be a human, but specifically a mammalian cell having the ability to differentiate into hepatocytes in vitro, .

The term "pluripotent stem cells" refers to cells capable of almost enduring or prolonged cell proliferation maintained in an undifferentiated state by in vitro culture, and capable of proliferating cells of all lineages of trichomes (ectoderm, mesoderm, ≪ / RTI > cells with the ability to differentiate into < RTI ID = 0.0 > At present, pluripotent stem cells are embryonic stem cells (hereinafter abbreviated as "ES cells"), embryonic stem cells (hereinafter referred to as "embryonic stem cells") isolated from early embryos derived from mammals such as mouse, monkey, stage embryonic germ cells (abbreviated as "EG cells") and multipotent adult progenitor cells (hereinafter referred to as "MAPC") isolated from the adult bone marrow ).

In one embodiment, in the method of inducing differentiation of stem cells of the present invention, the pluripotent stem cells (iPSC), which is a pluripotent stem cell produced through the reprogramming of ES cells and various somatic cells, , EG cells, or MAPC, preferably ES cells, more preferably human ES cells.

Specific examples of mouse ES cells include EB3 cells, E4 cells, D3 cells, CCE cells, R1 cells, 129 SV cells, J1 cells, and the like. In addition, standard protocols for the production, transfer, and preservation of ES cells, EG cells, and MAPC have already been established, and known protocols (Matsui et al, Cell 70: 841, 1992; Shamblott et al., Proc. Natl. These pluripotent stem cells can be easily used with reference to US Pat. No. 6,060,622; International Patent Publication No. 01/11011), which is incorporated herein by reference in its entirety, to Jiang et al., Nature 418: 41 have.

In addition, the cells usable in the present invention are not limited to the above three kinds, and all the pluripotent stem cells derived from an embryo of a mammal, an adult tissue such as fetus, umbilical cord blood, adult organs or bone marrow, . As a specific example, stem cells (Sharda & Zahner, International Patent Publication No. 02/051980) obtained by treating medicinal agents such as 5-azacytidine (hereinafter abbreviated as "AZC" (Abuljadayel, Curr. Med. Res. Opin. 19: 355, 2003) or adult stem cells derived from adult cells (Li et al, Nature Med ., Advance online publication). In this case, the ES cell-like trait refers to a cell having a surface (antigen) marker specific to an ES cell, an ES cell specific gene, a teratoma forming function, or a chimeric mouse capable , And the like.

In addition, even if a cell that does not have a trait similar to an ES cell, or a cell that is not an pluripotent stem cell, is a cell capable of differentiating into a cell having a hepatocyte-like trait in at least an in vitro culture, Can be used.

The term "feeder" or "feeder cell" is a term used to describe a type of cell that co-cultures with other types of cells to provide an environment in which a second type of cell can grow.

The term " xenobiotics "is a generic term for harmful substances to the living body, such as artificial chemicals, drugs, food additives, environmental pollutants, and the like, In particular, lipophilic substances pass through the cell membrane and exhibit toxicity. In the liver, the polarity increases due to the action of cytochrome P450, etc., and becomes water-soluble, and most of the urine and bile are detoxified and excreted. In this process, the first phase and the second phase are present. In the former, oxidation (hydroxylation), reduction and hydrolysis by cytochrome P450 or an epoxide hydrazide to the redox enzyme, etc., and glutathione, glucuronic acid, Of the reaction occurs. For certain living organisms, cytochrome P450 gene expression is known to be exhibited.

In the examples of the present invention, a hepatotoxic drug was used as a living body, and the hepatotoxic drug was one or more selected from the group consisting of phenobarbital (PB), acetaminophen (AP) and rifampicin (RIF) But is not limited thereto.

In the present invention, hepatocytes differentiated from stem cells

(a) treating stem cells with AA (activin A) to obtain differentiated endoderm cells from the stem cells;

(b) treating the obtained endoderm cells with RA (retinoic acid) to obtain hepatocytes differentiated from the endoderm cells and treating the obtained hepatocytes with NA (nicotinamide) to grow hepatocytes; And

(c) treating hepatocyte growth factor (HGF) with the proliferated hepaticoblasts to obtain hepatocytes differentiated from the hepaticoblasts

And the like.

The step (b) may further include the step of culturing the endoderm cells obtained in step (a) by adding AA (activin A), sodium butyrate and fetal bovine serum (FBS) before the step (b).

The step (b) may further include pre-culturing the endoderm cells obtained in step (a) by adding bone morphogenetic protein 2 (BMP2) and fibroblast growth factor 4 (FGF4).

When the hepatic stem cells of step (b) are proliferated, basic fibroblast growth factor (bFGF) and ascorbic acid may be further treated.

The step (c) may further include the step of monoclonalizing the hepatocytes by treating trypsin with the hepaticoblasts obtained in step (b).

It is more preferable that the step (c) is performed through 3D floating culture.

And further comprising the step of treating the hepatocytes obtained through the step (c) with OSM (oncostatin M) and DEX (dexamethasone) to mature the hepatocytes.

After the differentiation into hepatocytes, the bio-water was repeatedly treated with hepatocytes to obtain a high-performance (high-performance) hepatocyte culture system with improved gene expression and activity of the Phase I metabolizing enzyme (cytochrome P450) and the phase II metabolizing enzyme (glutathione S-transferase, UDP-glucuronosyltransferases) Hepatocytes can be produced.

In the repeated treatment of the living body, it is preferable that the hepatocytes are subjected to a primary treatment of a living body, followed by a recovery step, and a secondary treatment of the living body. Thereafter, the living body can be further treated at least once.

The hyperfunctional hepatocytes prepared through these steps were found to exhibit CYP450 enzyme activity by drug metabolism activity similar to hepatocytes in vivo.

The CYP450 enzyme may include CYP1A2, CYP2A1, CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, CYP2E1, CYP3A4, CYP3A5, CYP3A6 and CYP3A7.

Repeated treatment of the related drug belonging to one of the CYP450 enzymes shows that the expression and activity of the CYP450 enzyme to which the drug belongs is increased. In one embodiment, AP, which is one of the drugs belonging to CYP3A4, was found to have increased drug metabolizing enzyme activity (FIG. 5).

The present invention also relates to a therapeutic composition comprising hepatocytes prepared by the method of the present invention, preferably a therapeutic composition for the recovery of liver function necessary for the treatment of acute, chronic or genetic liver damage, Thereby providing a composition for treating an impaired liver function.

The therapeutic composition of the present invention may be prepared into a suitable preparation including an acceptable carrier depending on the administration mode. Formulations suitable for the mode of administration are known and may include formulations that facilitate passage, typically through the membrane.

In addition, the therapeutic composition of the present invention can be used in the form of a general pharmaceutical preparation. The parenteral preparation may be in the form of a sterilized aqueous solution, a non-aqueous solvent, a suspension, an emulsion or a lyophilized preparation, or a tablet, troch, capsule, elixir, suspension, syrup or wafer in the case of oral administration. May be formulated in unit dosage ampoules or multiple doses.

In addition, the therapeutic composition of the present invention may be administered together with a pharmaceutically acceptable carrier. For oral administration, for example, binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring matters or fragrances may be used. In the case of injections, buffering agents, preservatives, An isotonic agent, an isotonic agent, a stabilizer, etc. may be used in combination. In the case of topical administration, a base, an excipient, a lubricant, a preservative and the like may be used.

In addition, the method of treating acute, chronic or genetic liver damage using the therapeutic composition of the present invention may include administration through a common route in which a predetermined substance is introduced into the patient in an appropriate manner. Such administration methods include, but are not limited to, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration and rectal administration. However, upon oral administration, the cells may be digested, so that the oral composition is preferably formulated to coat the active agent or protect it from being decomposed from above.

In addition, the pharmaceutical composition may be administered by any device capable of transferring the active substance to the target cell. Preferred modes of administration and formulations are intravenous, subcutaneous, intradermal, intramuscular or drip injectable. The injectable solution may be a non-aqueous solvent such as an aqueous solvent such as a physiological saline solution or a ring gel solution, a vegetable oil, a higher fatty acid ester (for example, oleic acid), an alcohol (for example, ethanol, benzyl alcohol, propylene glycol or glycerin) (For example, ascorbic acid, sodium hydrogen sulfite, sodium pyrophosphate, BHA, tocopherol, EDTA and the like), an emulsifier, a buffer for pH control, a microbial growth inhibitor Preservatives (for example, mercury nitrate, thimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, etc.). Preferably, a method of treating acute, chronic or genetic liver damage with the therapeutic composition of the present invention comprises administering a therapeutically effective amount of the therapeutic composition of the present invention. The pharmaceutically effective amount may be appropriately selected depending on the kind of the disease, the age, body weight, health, sex, sensitivity of the patient to the drug, administration route, administration method, administration frequency, And can be readily determined by those skilled in the art depending on the factors.

In addition, the stem cell-derived high-function hepatocyte prepared in the present invention can be used for the metabolism or toxicity test of drug candidates.

For example, when it is used for the metabolism test, the target drug candidate substance is treated with pluripotent stem cell-derived high-performance hepatocytes and cultured for example in a 5% CO ₂ incubator at 37 ° C for about 16 hours, I (cytochrome P450) and / or Phase II (glutathione S-transferase, UDP-glucuronosyltransferases) enzyme activity detection kit. For example, when a kit of Promega's p450-GloTM CYP assay kit is used, an assay can be performed using 50 μl of the culture supernatant. Therefore, following the induction of pluripotent stem cell differentiation, (Cytochrome P450) and / or Phase II (glutathione S-transferases, UDP-glucuronosyltransferases) enzyme activity.

When used for toxicity testing, the target drug candidate substance is added to pluripotent stem cell-derived high-performance hepatocytes and cultured for example in a 5% CO ₂ incubator at 37 ° C, followed by a general purpose cell death measurement technique To assess cytotoxicity. Detection of chromosomal DNA fragmentation by electrophoresis, detection of chromosomal DNA depletion cells using flow cytometry, cell cycle, detection of apoptotic cells using Annexin V, detection of apoptotic cells using propidium iodide And detection of apoptotic cells using a cytoplasmic staining agent such as propidium iodide (PI).

To distinguish between toxicity to hepatocytes and toxicity to biliary duct epithelium, the desired drug candidate substance is treated with pluripotent stem cell-derived high-performance hepatocytes and cultured in, for example, a 37 ° C, 5% CO ₂ incubator , The culture supernatant was recovered following the passage of time, and the enzyme group (glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT ), And enzymes characteristic of bile duct epithelial cells (? -Glutamyl transpeptidase (? -GTP), leucine aminopeptidase (LAP), type 1 alkaline phosphatase alkaline phosphatase type 1: ALP1)) by a general-purpose method.

A more detailed method for the toxicity test of drug candidates using pluripotent stem cell-derived hepatocytes is exemplified in the following manner.

First, the drug candidate substance is added to the culture supernatant of pluripotent stem cell-derived hepatocytes at various concentrations (e.g., 5 to 10 mM of acetaminophen). Subsequently, for example, the cells were cultured in a 5% CO ₂ incubator at 37 ° C to measure the cell viability, the activity variation of the drug metabolizing enzyme, and the change of the physiological function of the hepatocytes, .

Examples of the assays for cell viability include a general-purpose mitochondrial respiratory activity measurement method using a tetrazolium salt as a substrate (MTT assay, WST assay, etc.).

The cell death assays include 1) apoptosis detection technology (detection method of apoptotic cells by a flow cytometry analyzer using annexin V as a probe, measurement of cellular DNA content by PI (= measurement of sub G1 fraction), agarose electrophoresis (TUNEL assay), 2) general-purpose cell detection technology (measurement of PI-positive cells by flow cytometry, measurement of chromosomal DNA degradation by Comet assay), 3) quantification of chromosomal DNA- ) Grafting by the general method Gastrointestinal enzymes (glutamic oxaloacetic transaminase; GOT, glutamic pyruvic transaminase; GPT, gamma -glutamyltranspeptidase; gamma-GTP, leucine amino Peptidase; LAP, alkaline phosphatase (ALP), etc.).

Among them, the measurement of the deviation enzyme in the culture supernatant is particularly excellent in that measurement can be performed by dividing hepatocellular toxicity and bile duct cytotoxicity. That is, by examining whether the enzyme group (GOT, GPT) characteristic of hepatocytes and the enzyme group (γ-GTP, LAP, type 1 ALP) characteristic of bile duct epithelial cells are elevated, hepatocellular toxicity and bile duct cell It can be distinguished by toxicity.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the scope of the present invention is not limited by the following examples.

<Example 1> Undifferentiated human embryonic stem cell line and culture method for primary cultured hepatocytes

Undifferentiated human embryonic stem cell (hESC) cell lines were grown in DMEM / F12 medium (Invitrogen Life Technologies, USA) containing 4 ng / ml bFGF, 1% nonessential amino acids and 100 mM beta mercaptoethanol (10 μg / ml mitomycin-C) mouse embryonic fibroblasts (MEFs) using mitotically-inactivated cells. The cells were cultured under standard conditions (37 ° C, 5% CO ₂ and saturated humidity) and the medium was changed daily. When hESCs and hiPSC (human induced pluripotent stem cells) colonies are proliferated, all cells of the hESC and hiPSC cell lines are treated with type IV collagenase and then shredded and inoculated into new feeder cells every 5-6 days . BGOl hESCs were used to establish the protocol, and other hESCs and hiPSCs were used to validate the hepatocyte differentiation protocol.

Human primary hepatocytes (hPH), used as a control for the expression and activity of increased drug metabolizing enzymes in high function hepatocytes, were initially distributed in BD Biosciences Discovery Labware for white, black, and yellow men. Human hepatocytes cultured in 24 well plates coated with type 1 collagen were cultured and maintained for at least 24 hours before the hepatocyte culture medium was treated.

Two human liver cell lines (HepG2 and Huh7) were obtained from the Korean Cell Line Bank. The cells were inoculated into DMEM medium containing 10% FBS and 1% penicillin / streptomycin and cultured at 37 ° C and 5% CO ₂ . When the cell density reached a degree of saturation of 70-80%, subculture was performed. The medium was replaced every 3 days.

<Example 2> Differentiation of undifferentiated human embryonic stem cells into hepatocytes

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram of a method for differentiating human embryonic stem cells into hepatocytes.

To initiate hepatocyte differentiation, hESCs and hiPSCs were dispersed into single cells for 3 min using TrypLE select (Invitrogen) and harvested by centrifugation at 1000 rpm for 5 min. Matrigel-coated culture dishes were cultured for one day after inoculation with mTeSR1 medium containing a protein kinase inhibitor Y-27632 (ROCK inhibitor). Y-27632 (ROCK inhibitor) -free mTeSR1 medium for 2 days, and hepatocyte differentiation was performed. Human embryonic stem cells were identified by the expression of OCT4, an undifferentiated marker, through qPCR (Fig. 2).

Stage 1 ) To endoderm cells  Differentiation / 2D adherent culture

Endoderm cells can form epithelial cells of the internal organs, including the digestive tract, liver and lungs. The step of differentiating pluripotent stem cells into endoderm cells is necessary for the differentiation of hepatocytes in vitro. In the present invention, hESCs and hiPSCs were first differentiated into endoderm cells for 3 days. Differentiation of hESCs and hiPSCs for the first 1.5 days was initiated in RPMI medium containing 2 μM CHIR99021 (GSK-3 inhibitor) and 100 ng / ㎖ AA (activin A). For the next 1.5 days, the cells were further differentiated in RPMI medium containing 100 ng / ml AA, 0.5-1 mM sodium butyrate and 0.2% FBS in the same culture medium. Induction of endoderm cells was confirmed by measuring the expression level of SOX17, a marker of endoderm cells through qPCR (Fig. 2).

Step 2 ) Hepatic  Differentiation / 2D Adhesion culture

The endoderm cells obtained in step 1 were further cultured for 8 days and differentiated into hepaticoblasts. First, the cells were inoculated into RPMI medium containing B27 adjuvant (Gibco) and cultured for 2 days with 20 ng / ml BMP2 (bone morphogenetic protein 2) and 30 ng / ml FGF4 (fibroblast growth factor 4) . Differentiation into hepatocytes was induced by inoculating the cells into DMEM medium containing B27 adjuvant and treating with 2 μM RA (retinoic acid) for 2 days. The hepatocytes were inoculated into DMEM medium containing B27 adjuvant and cultured for 4 days with 10 mM NA (nicotinamide), 1 ng / ml bFGF, and 100 μM ascorbic acid to grow hepatocytes. The expression of HNF4? And AFP was analyzed by RT-PCR (Fig. 2). RT-PCR analysis was performed using SYBR Green PCR Master Mix (Applied Biosystems, USA). The PCR reaction consisted of 12.5 μl of SYBR Green PCR Master Mix, 25 μl each containing 0.8 μl of 10 mM primer, 10.4 μl of distilled water and 0.5 μl of template cDNA, and amplified using the CYP3A4 primer, a Phase I drug metabolizing enzyme. For the proliferation of hepatocytes, 10 μM EdU (5-ethynyl-2'-deoxyuridine) was added to the medium for 4 hours in order to evaluate the proliferative power during hepatocyte differentiation using the EdU incorporation assay kit (Invitrogen). After EdU was added to the intracellular DNA during DNA replication, the cells were washed three times with PBS and fixed in PBS containing 4% PFA (paraformaldehyde). EdU-stained cells were immunostained by the method described above. Fluorescence of EdU was photographed and evaluated with a fluorescence microscope (Carl Zeiss Jena, Germany) (Fig. 3).

Step 3 ) Differentiation into hepatocytes / 2D adherent culture

In order to induce the final maturation of hepatocytes, trypsin (TrypLE select) treatment was performed on the hepatic stem cells obtained in step 2 and single cellization was carried out. In order to carry out 2D adherent culture, inoculation on ITS medium in a culture dish coated with type 1 collagen , Treated with 20 ng / ml HGF, and cultured for 4 days to differentiate. The cells were inoculated into ITS medium containing 10 ng / ml OSM (oncostatin M) and 10? M DEX (dexamethasone) and cultured for 4 days for further maturation. Expression was confirmed using AAT and ALB as markers of the final differentiated cells (Fig. 2).

Immunofluorescent staining was performed by treating PBS containing 4% PFA (paraformaldehyde) in the case of differentiated hepatocytes. Fixed hepatocytes were blocked and perforated with 0.1% BSA / PBS containing 0.3% Triton X-100 / PBS and 10% serum (using PBS without 0.1% BSA in the case of ALB antibody) The secondary antibody was treated and reacted overnight at 4 ° C. Homologous mouse IgG or normal donkey serum was used as a negative control, but no fluorescence was detected in the negative control. The primary antibody against ALB was diluted. After washing three times with PBS, a secondary antibody diluted 1: 400 with TRITC (rhodamine) conjugated thereto was added and reacted at room temperature for 1 hour and 30 minutes. Next, the nuclei of the cells were stained using 1 ㎍ / ml DAPI (4 ', 6-diamidino-2-phenylindole). Between each step, cells were washed with PBS. Fluorescence photographs of EdU were taken with a fluorescence microscope (Carl Zeiss Jena, Germany).

FIG. 2 shows whether hepatocyte markers of the final differentiated hepatocyte are expressed well. OCT4, which is an undifferentiated marker of hepatocytes, decreases before repeated administration of the drug of the present invention, and SOX17 and HNF4a, which are endodermal markers, , And that AFP, a marker of immature hepatocyte, and ALB, a marker of final hepatocyte, are increased in the late stage of differentiation stage.

<Example 3> Measurement of hepatocyte property change for preparation of highly functional hepatocytes by induction of differentiation and repeated drug treatment

In order to induce the final maturation of the final differentiated hepatocytes by repeated treatment of the drug, the experiment was first conducted to demonstrate the hypothesis that repeated administration of the drug increases the expression and activity of the drug metabolizing enzymes in a state in which the hepatocyte- .

In the first group, the final differentiated hepatocytes were separated into single cells by adding TrypLE select, and fixed with 4% PFA for 20 minutes at 4 ° C. The cells were washed with FACS washing buffer sold by BD, and the primary antibody was added thereto, followed by reaction at 4 ° C for 30 minutes. After 3 washing steps, the secondary antibody was reacted at 4 ° C for 30 minutes. The washed cells were then analyzed using a BD-FACS Calibur Flow Cytometer (FACS Calibur, USA). Three independent experiments were performed each. Experimental results were analyzed using Flowjo software (Fig. 4A).

As the second group, 200 μM of AP was added to the medium used for final hepatocyte differentiation, and the cells were subjected to primary treatment with hepatocytes finalized for 48 hours to quantify albumin-expressing cells using the following FACS method. TrypLE select was added to separate into single cells and fixed with 4% PFA for 20 min at 4 ° C. The cells were washed with FACS washing buffer sold by BD, and the primary antibody was added thereto, followed by reaction at 4 ° C for 30 minutes. After 3 washing steps, the secondary antibody was reacted at 4 ° C for 30 minutes. The washed cells were then analyzed using a BD-FACS Calibur Flow Cytometer (FACS Calibur, USA). Three independent experiments were performed for each marker. The experimental results were analyzed using Flowjo software (Fig. 4B).

As the third group, the hepatocytes that were first exposed to AP 200 μM, such as the second group, were recovered again for 48 hours in the medium used for the hepatocyte final differentiation step in which the drug was not added, Albumin quantification using FACS was performed. As a result, it was confirmed that albumin synthesis, which is a typical physiological specificity of hepatocytes in the three groups of cells, was not changed by repeated treatment of the drug (FIGS. 4A, 4B and 4C). As a result, we confirmed the hypothesis that the repetitive treatment of drug can increase the expression and activity of drug metabolizing enzymes while maintaining the representative characteristics of hepatocyte. Three drugs PB, 200 μM, and 10 μM of RIF, It was decided to repeat treatment on the differentiated hepatocytes. FACS measurements were performed by dividing the final differentiated hepatocytes into single cells by adding TrypLE select, and then fixed with 4% PFA at 4 ° C for 20 minutes. The cells were washed with FACS washing buffer sold by BD, and the primary antibody was added thereto, followed by reaction at 4 ° C for 30 minutes. After 3 washing steps, the secondary antibody was reacted at 4 ° C for 30 minutes. The washed cells were then analyzed using a BD-FACS Calibur Flow Cytometer (FACS Calibur, USA). Three independent experiments were performed for each marker. Experimental results were analyzed using Flowjo software.

In an experiment to confirm the expression of CYP3A4 enzyme in the continuous administration of the drug, each of 25 μM PB and 200 μM AP was added to the differentiated hepatocytes for 4 days only once in the final hepatocyte differentiation medium of Example 2 PB and AP drug addition) were continuously cultured to confirm that the increased expression of CYP3A4 was maintained before the repeated treatment of the drug. On the 4th day, the cells were treated with TrypLE select for 6 minutes, collected from cells exposed repeatedly to the living body using TRIzol reagent, and subjected to a reverse transcription process using a reverse transcription system (Promega Corp., USA) Respectively. PCR amplification conditions were 94 ° C for 5 minutes, 35 cycles (94 ° C for 30 seconds, 50-57 ° C for 30 seconds and 72 ° C for 30 seconds) and 72 ° C for 10 minutes.

RT-PCR analysis was performed using SYBR Green PCR Master Mix (Applied Biosystems, USA). The PCR reactions consisted of 12.5 μl of SYBR Green PCR Master Mix, 25 μl each containing 0.8 μl of 10 mM primer, 10.4 μl of distilled water and 0.5 μl of template cDNA, and amplified using the CYP3A4 primer, a Phase I drug metabolizing enzyme 4D). In addition, the expression of AFP, a marker of immature hepatocyte, was assessed by (1) differentiation stages of each hepatocyte, (2) after the first drug treatment, (3) after the second drug repeated treatment, and (4) C), black (labeled AA), and oriental (marked A) human hepatocyte early cells by the same RT-PCR method (FIG. 4, E, CON: control Cells), 1ND: cells treated with 200 μM of primary AP, 2ND: cells treated with 200 μM of primary AP, and subjected to a second round of repetition for 2 days). Relative expression levels of each gene were normalized using GAPDH.

The sequences of the primers used are as follows (Table 1).

gene The forward direction (5 '- &gt; 3' The reverse direction (5 '- &gt; 3') Product size
(bp) POU5F1 TGGGCTCGAGAAGGATGTG GCATAGTCGCTGCTTGATCG 78 SOX17 CGCACGGAATTTGAACAGTA GGATCAGGGACCTGTCACAC 181 ALB GCCTGCTGACTTGCCTTCATTAG TCAGCAGCAGCACGACAGAGTA 149 HNF4? AAGAGGAACCAGTGCCGCTA CGCATTGATGGAGGGCAG 141 AAT TTTAAAGGCAAATGGGAGAG CCTAAACGCTTCATCATAGG 106 CYP1A2 CCAGTCTGTTCCCTTCTCGG GCTGGCTCATCCTTGACAGT 200 CYP2B6 AGCTTCATGACCGAGCCAAA CAGGATTGAAGGCGTCTGGT 216 CYP2C9 ATTTGTGTGGGAGAAGCCCT AAAGAGAGCTGCAGGGACTG 224 CYP2D6 GTGTCCAACAGGAGATCGACG CACCTCATGAATCACGGCAGT 100 CYP2D6 -v1 GTTCCCAAGGGGTGTTCCTG GGCTTTGTCCAAGAGACCGT 200 CYP2D6 -v2 CCCAAGGACGCCCCTTTC GCTGGGATATGCAGGAGGAC 205 CYP2C19 GAAGAGGAGCATTGAGGACCG GCCCAGGATGAAAGTGGGAT 103 CYP3A4 AGCCTGGTGCTCCTCTATCT CCCTTATGGTAGGACAAAAT 116 CYP3A7 GATCTCATCCCAAACTTGGCCG CATAGGCTGTTGACAGTCATAAATA 240 CAR GAC CTG CCT GTC TTC CGT TC GAT TTC CAC AGC TGC TCC CT 72 PXR CCA CTG GGA GTGCA GGG GC TGG CAG CCG GAA ATT CTT GA 101 PPARα TCG GCG AGG ATA GTT CTG GA TGG TGA AAG CGT GTC CGT GA 108 GSTA2 CCTTCTTTCAGTGGGAGGGA GCCATGGTAGCAGTCTCCTG 140 GSTA4 CCGAGTGGACTCCAGAAAGC GGCACTTGTTGGAACAGCAG 200 GSTM1 AGCTGGGCATGATCTGCTAC CAAGCCCTTGTTTCCTGCAA 134 GSTM4 TGTACACAAGGGTGGCTGTC GAAAGGAACGAGGAGGCAGG 144 PROX1 ACAGGGCTCTGAACATGCAC GGCATTGAAAAACTCCCGTA 100 ATF5 CTATGAGGTCCTTGGGGGAG CTCGCTCAGTCATCCAGTCA 76 C / EBPα ACAAGAACAGCAACGAGTACC CATTGTCACTGGTCAGCTCCA 110 GAPDH TTCAGTGGTGGACCTGACCT CACCACCCTGTTGCTGTAGC 256

4 shows the result of flow cytometry in order to prove that the differentiated hepatocytes repeatedly exposed to the drug do not lose their cytologic characteristics for the present invention. First, human embryonic stem cells were induced and differentiated into hepatocytes for 22 days, (1) cells treated with 200 μM AP for 2 days, (2) treated with drug for 2 days, and then incubated with drug-free culture medium for 2 days to regenerate hepatocyte-specific marker ALB (albumin) Analysis by flow cytometry showed that the expression of albumin remained almost unchanged.

D was continuously treated with 25 μM PB and 200 μM AP in hepatocyte-induced differentiation, and CYP3A4 expression was continuously increased. In contrast to this, real-time PCR confirmed that E is a marker of immature hepatocyte, AFP (alpha-fetoprotein), which is decreased by repeated exposure of drug. As a result, it is verified that the drug metabolizing ability of the differentiated hepatocytes can be optimized by increasing the expression of the drug metabolizing enzyme by repeated treatment of the drug without affecting the properties of the hepatocyte-specific cell. That is, it proves that hepatocyte differentiated can be produced which can be tested for new drugs and toxicity.

< Example  4> Increased gene expression and cell-physiological variation of drug metabolizing enzymes by repeated drug treatment of hepatocytes

In order to increase the drug metabolizing ability of the final differentiated hepatocytes, 25 μM PB, 200 μM AP and 10 μM RIF were added to the same composition as the medium used for the final hepatocyte culture in Example 2, Treated first. Subsequently, the cells were again restored for 48 hours in the medium without the addition of the drug, and then the secondary treatment drugs PB 25 μM, AP 200 μM and RIF 10 μM were repeatedly subjected to the second round, and the drug metabolizing enzymes CYP1A2, CYP2D6, CYP2C9 , CYP 3A4 and CYP3A7 were measured by the RT-PCR method of Example 3 above with ALB, PROX1, C / EBPa and ATF5, which are markers specifically expressed in mature hepatocytes

FIG. 5 is a graph showing an improvement in drug metabolism ability of hepatocytes derived from human embryonic stem cells through repeated administration of a hepatotoxic substance. Figure 5 shows that human embryonic stem cells were induced and differentiated into hepatocytes for 22 days and then treated with 25 μM phenobarbital (PB-phenobarbital), 200 μM acetaminophen (AP-acetaminophen) and 10 μM rifampicin (RIF- Were exposed to the primary exposure, followed by removal of the hepatotoxic drug from the culture solution for 2 days. The cells were allowed to recover for 2 days, and then treated again with the hepatotoxic drug for 2 days. The expression of hepatocyte markers and hepatocyte-specific drug metabolizing enzymes after the first exposure and second drug exposure in these hepatocytes was confirmed by real time PCR. As a result, hepatocyte-specific ALB, PROX1, C / EBPa, ATF5 marker expression and CYP1A2, CYP2D6, CYP2C9, and CYP3A4 drug metabolizing enzymes were significantly increased.

Example 5: Cell-based analysis of cytochrome P450 (CYP) enzyme drug metabolizing activity, a drug metabolizing enzyme

Cell-based CYP enzyme activity assay was used to confirm the intracellular activity of CYP3A4. (2) hepatocytes cultured with 3D spheres; (3) secondary hepatocytes with hepatocytes cultured with 3D spheres; (4) cells treated with 2D as a control; 3D human invasive cultured hepatocytes were prepared in a 24-well culture vessel and AP (10, 25, 50, 100 and 200 μM) were treated for 48 hours to measure the activity of the drug metabolizing enzymes (FIG. 6). Since human hepatocyte cultures are known to rapidly decrease drug metabolism after 48 hours in vitro, that is, in vitro, these experiments were carried out within 24 hours after culturing cryopreserved cells.

Luciferin substrate (luciferin-IPA for CYP3A4, luciferin-H EGE for CYP2C19, luciferin-ME for CYP1A2 and P450-Glo for CYP2D6) was added to the prepared hepatocyte groups and reacted at 37 DEG C for 1 hour. At the end of the reaction, 50 [mu] l of each reagent was dispensed into a 96 well opaque white luminometer plate at room temperature. Next, 50 占 퐇 of luciferin detection reagent was added to each well, and the reaction was carried out in a dark place for 40 to 60 minutes to induce a fluorescence reaction. The resulting fluorescence level was measured with an optical meter (Perkin Elmer, Victor 3). The fluorescence level was determined by dividing the protein concentration per each well and calculating the average fluorescence value to confirm the CYP3A4 activity.

FIG. 6 confirms that the activity of CYP3A4 in 3D somatic hepatocytes with an increased drug metabolizing enzyme by repeated treatment of the drug is similar to the activity (green line) of human hepatocyte cultured in nearly 2D cultured (purple line).

Claims (11)

Repeated treatment of xenobiotics on hepatocytes differentiated from human pluripotent stem cells
The present invention relates to a method for producing a high-function hepatocyte, which enhances the expression and activity of a drug metabolizing enzyme and the physiological function of hepatocytes.
The method according to claim 1,
The hepatocyte
(a) treating stem cells with AA (activin A) to obtain differentiated endoderm cells from the stem cells;
(b) Treating the obtained endoderm cells with RA (retinoic acid) to obtain hepatocytes differentiated from the endoderm cells, and treating the obtained hepatocytes with NA (nicotinamide) to proliferate hepatocytes.
(c) treating hepatocyte growth factor (HGF) with the proliferated hepaticoblasts to obtain hepatocytes differentiated from the hepaticoblasts
&Lt; RTI ID = 0.0 &gt; and / or &lt; / RTI &gt;
3. The method of claim 2,
Wherein the bFGF (basic fibroblast growth factor) and ascorbic acid are further treated when the hepatic stem cells of step (b) are proliferated.
3. The method of claim 2,
Further comprising the step of treating the hepatocytes obtained through the step (c) with OSM (oncostatin M) and DEX (dexamethasone) to mature hepatocytes.
The method according to claim 1,
Wherein said hepatocyte is hepatocyte in which gene expression and activity of Phase I metabolic enzyme (cytochrome P450) and Phase II metabolic enzyme (glutathione S-transferase, UDP-glucuronosyltransferases) are increased.
The method according to claim 1,
Wherein the drug is subjected to a primary treatment after hepatocytes, a recovery step, and a secondary treatment.
A high-function hepatocyte prepared by the method of claim 1.
8. The method of claim 7,
Functional hepatocytes that induced the expression and activity of Phase I metabolic enzymes (cytochrome P450) and phase II metabolic enzymes (glutathione S-transferases, UDP-glucuronosyltransferases).
A therapeutic composition for the recovery of liver function necessary for the treatment of acute, chronic or genetic liver damage including hyperfunctional hepatocytes prepared by the method of claim 1.
A method for testing metabolism of a drug candidate substance,
A method for assaying drug metabolism for quantitatively determining the metabolism of a drug candidate substance using the hyperfunctional hepatocyte of claim 7.
A method for testing the toxicity of a drug candidate substance,
A method for testing drug candidate substance toxicity, which quantifies drug metabolizing enzyme mutation and apoptosis of a cell caused by a drug candidate substance using the highly functional hepatocyte of claim 7.

Images