KR20170003260A - fermented alcoholic beverage of grains with improved storage stability and sweetness quality and method of preparing the same - Google Patents
fermented alcoholic beverage of grains with improved storage stability and sweetness quality and method of preparing the same Download PDFInfo
- Publication number
- KR20170003260A KR20170003260A KR1020150093688A KR20150093688A KR20170003260A KR 20170003260 A KR20170003260 A KR 20170003260A KR 1020150093688 A KR1020150093688 A KR 1020150093688A KR 20150093688 A KR20150093688 A KR 20150093688A KR 20170003260 A KR20170003260 A KR 20170003260A
- Authority
- KR
- South Korea
- Prior art keywords
- weight
- cereal
- parts
- fermentation
- fermentation broth
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
- C12G3/00—Preparation of other alcoholic beverages
- C12G3/02—Preparation of other alcoholic beverages by fermentation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
- C12G3/00—Preparation of other alcoholic beverages
- C12G3/04—Preparation of other alcoholic beverages by mixing, e.g. for preparation of liqueurs
Abstract
The present invention is produced by adding a sweetener composition to an alcoholic fermentation broth prepared from cereals. By controlling the saccharides and sugar composition contained in the fermented cereal grains, it is possible to improve the sensory properties such as prolongation of the circulation period of the cereal fermentation tank, inhibition of post fermentation, .
Description
The present invention relates to a cereal fermentation liquor and a process for producing the same, more specifically, by adding a sweetener composition to an alcohol fermentation broth of cereal, and by controlling the saccharide and sugar composition contained in the cereal fermentation liquor, And improving the sensory properties such as sweetness.
Fermented beans produced from cereal starch raw materials are typically made of rice wine, and fermented with fermented starch raw materials and soup as main ingredients. Makgeolli is known to contain a rich variety of nutrients unlike other liquors. It contains essential amino acids involved in metabolism in the body, less lysine in normal grains, valine, which is a degradation product of protease in yeast, It helps to relieve the thirst by souring with amino acids such as Shin, serine, proline and glycine, vitamins B1 and B2, flavor substances such as ethyl acetate, amylacetate and ethyl caproate. Organic acids, and acetylcholine to aid liver function. Recently, as the functionality of the makgeolli has been emphasized, various kinds of makgeolli are commercialized and released.
The raw rice wine is characterized by a good yeast living in the body and a carbonic acid content due to fermentation, which is characterized by a fresh taste and a tangy taste of carbonic acid. However, the fermentation continues in the distribution process, thus limiting the storage and distribution process. As the starch fermentation progresses during the distribution process, carbonic acid gas is generated and the fermentation of residual sugar remaining by the yeast and bacteria continues, and the taste gradually changes, so that the shelf life is shortened to 10 days or less in cold storage have.
There is a method of sterilizing makgeolli in order to solve the problem of the raw makgeolli. However, the quality of the makgeolli is greatly changed according to the degree of heat treatment. In the conventional sensory quality characteristics, the fermentation is stopped due to the death of the microbes, Taste and fragrance are lost. Therefore, there has been an attempt to maintain the quality of the rice wine by maintaining the preservability and the enzyme activity by killing microorganisms by pasteurizing the rice wine.
An object of the present invention is to provide a cereal fermented juice having improved sensory properties such as prolongation of the circulation period, inhibition of post fermentation, and sweetness of a cereal fermentation tank by controlling the saccharides and sugar composition contained in the cereal fermented beverage, and a method for producing the same.
An example of the present invention is a fermented milk produced by adding a sweetener composition to an alcoholic fermentation broth prepared from cereals and comprising 40 weight parts or less of fructose and 3 weight parts or more of cicosane based on 100 weight parts of saccharides total. The present invention relates to an increased cereal fermentation product. And the pH of the cereal fermentation broth may be in the range of 4 to 4.5 under conditions of storage at 4 DEG C for 15 days.
The cereal-fermented beverage may be prepared by adding 1 to 50% by weight of a sweetener composition to 50 to 99% by weight of an alcoholic fermentation broth prepared from cereal grains.
The sweetener composition may contain 1 to 100% by weight of a cosmetic composition based on 100% by weight of the cosmetic composition. The cosmetic composition may further comprise one or more selected from the group consisting of alos, tagatose, alos, altrose, oligosaccharide and high- Or more. Saikosu may be powdery or liquid and may be provided alone or as a mixed sugar further comprising at least one saccharide selected from the group consisting of fructose, glucose and oligosaccharide.
Wherein the oligosaccharide is at least one selected from the group consisting of fructooligosaccharide, maltooligosaccharide, galactooligosaccharide, gentio oligosaccharide, xylooligosaccharide and isomaltooligosaccharide, wherein the high-intensity sweetener is selected from the group consisting of aspartame, acesulfame K, At least one selected from the group consisting of sodium, sodium saccharin, sucralose, stevia sweetener, dodecane, tau martin, tomaine, neotham, rebaudioside A and monelin.
A further aspect of the present invention is a method of producing &
Preparing a cereal raw material, saccharifying the prepared cereal raw material, fermenting the saccharified cereal with alcohol using yeast to obtain an alcohol fermentation liquid;
A sweetener composition is prepared,
A sweetener composition is added to the alcoholic fermentation broth to produce a cereal fermentation product containing not more than 40 parts by weight of fructose and not less than 3 parts by weight of Cicosone based on 100 parts by weight of the total amount of saccharides.
According to the present invention, by controlling the saccharides and the sugar composition contained in the cereal fermentation liquor, it is possible to increase the circulation period of the cereal fermentation vessel, inhibit post fermentation, It has an advantage of improving the sensory properties such as taste.
Hereinafter, the present invention will be described in more detail.
An example of the present invention is a cereal fermentation product comprising an alcoholic fermentation broth of cereal and a sweetener composition, wherein the cereal fermentation product has a storage stability of not more than 40 parts by weight, based on 100 parts by weight of total sugar, ≪ / RTI >
Conventional rice wine preservation period is usually about 4 days to 5 days from the date of manufacture, and when organic matter such as alcohol or fatty acid overflows during the above period, oxygen, light, heat, bacteria and enzymes Hydrolysis or oxidation by the action of the oxidizing agent to cause freezing and thawing which generates free fatty acids and various oxides. In addition, fermentation of raw rice wine continued in the process of distribution, and there were limitations on storage and distribution process. As the starch fermentation progresses during the distribution process, carbonic acid gas is generated, and the remaining fermentation by the yeast and germs continues, and the taste is gradually consumed, so that the shelf life is shortened. In addition, there is a method of sterilization of makgeolli to inhibit the fermentation of the distribution process, but there is a problem that the quality of the makgeolli deteriorates according to the degree of heat treatment and deteriorates the existing sensory quality characteristics.
Accordingly, the fermented cereal grains according to the present invention can improve the sensory properties such as prolongation of the circulation period, inhibition of post fermentation, and sweetness of the cereal fermentation tank by controlling the contained saccharides and sugar composition. For example, since the fermented cereal according to the present invention has a pH in the range of 4 to 4.5 at a storage condition at 4 ° C for 15 days, not only the deterioration of the quality characteristics can be prolonged, the circulation period can be extended, It is possible to obtain an effect of suppressing post-fermentation and improving the sweetness.
The cereal-fermented beverage according to the present invention may be a mixture of not more than 40 parts by weight of fructose and not less than 3 parts by weight of cicosaccharide, for example, not more than 36 parts by weight of fructose and not less than 5 parts by weight of cicosaccharide, based on 100 parts by weight of total sugar. Saikosu contained in the cereal fermentation stock may include 3 to 80 parts by weight based on 100 parts by weight of the total amount of the saccharides in the fermentation stock.
Specifically, the grain fermentation broth according to the present invention includes an alcohol fermentation liquid and a sweetener composition prepared from cereal grains. The mixing ratio of the alcohol fermentation broth to the sweetener composition may be 99 to 50% by weight of the alcohol fermentation broth and 1 to 50% by weight of the sweetener composition. As a specific example, the polymerization ratio of the alcohol fermentation broth: At a mixing ratio of 95: 1, 93.5: 6.5, 90:10, 80:20, 75:25, 70:30, 60:40 or 50:50 by weight.
The saccharification and alcohol fermentation can be appropriately selected and carried out by those skilled in the art according to the process of producing an alcoholic fermentation liquid of ordinary grains. have. A specific example of the preparation will be described later in the process for producing the following fermented cereal grain. As the cereal raw materials applicable to the present invention, the cereal may be at least one kind selected from the group consisting of white rice, brown rice, glutinous rice, red rice, barley rice, wheat, sweet potato, potato and combination.
In one embodiment of the present invention, the sweetener composition may be added to the alcoholic fermentation broth so that the fermentation broth contains not more than 40 parts by weight of fructose and not less than 3 parts by weight of cicosane based on 100 parts by weight of total saccharides contained in the fermentation broth .
The sweetener composition may be comprised of 1 to 100% by weight of Cicor, based on 100% by weight of the composition, i.e., a sweetener composition that additionally comprises 100% by weight of a sweetener composition or other saccharide. The sweetener composition may further include at least one selected from the group consisting of a rare saccharide (e.g., alos, tagatose, alos, altrose), an oligosaccharide, and a high-intensity sweetener.
The rare saccharide may be selected from the group consisting of alos, tagatose, alos, altrose, and the like.
The oligosaccharide may be at least one member selected from the group consisting of fructooligosaccharide, maltooligosaccharide, galactooligosaccharide, gentio oligosaccharide, xylooligosaccharide and isomaltooligosaccharide, and may be, for example, an isomaltooligosaccharide. The oligosaccharide may be used in an amount of 0.1 to 20, 0.1 to 15, 0.1 to 10, 0.1 to 5, 0.1 to 4, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 3 to 20, 3 to 15, 3 to 10, 3 to 10, 3 to 5, or 3 to 4 parts by weight. When oligosaccharides such as isomaltooligosaccharides are used in cereal fermentation, since isomaltooligosaccharide is non-fermentable, post-fermentation of the traditional stock can be adjusted, and glucose contained in the fermentation product is involved in post-fermentation to generate carbon dioxide gas to provide a refreshing sensation .
Wherein the high-intensity sweetener is selected from the group consisting of aspartame, acesulfame K, sodium cyclamate, saccharin sodium, sucralose, stevia sweetener, dicin, tau martin, tomain, neotam, rebaudioside A and monelin It may be more than one kind.
In general, psicose is almost similar in intensity and type of sweetness when compared to fructose, an epimer of d-fructose. However, unlike fructose, it has little calories to metabolize when absorbed into the body. It has low calorie and functions to inhibit glucose absorption by inhibiting glucose absorption, so it can be used in dietary food for diabetic patients, Because it has the function of inhibiting the enzyme activity involved, it can inhibit accumulation of abdominal fat, so it can be used for various functional food such as health food.
The psicose used in the present invention may be in powder or liquid form, for example syrup, and may be provided alone or in the form of a mixed sugar with other saccharides. An example of the above-mentioned psicose syrup may be provided to have a concentration of 60 to 85 brix.
In the cereal fermented juice of the present invention, it may be added in the form of a mixed sugar with sicosaccharide or other saccharide, and purified water may be added to the sicose powder instead of the cicosal syrup. However, unlike powders, since syrup contains a large amount of water, the addition amount is determined in consideration of the water content and the cicose content. Further, it may further include at least one selected from the group consisting of fructose, glucose and oligosaccharides added to the mixed sugar.
The mixed sugar may contain 1 to 99.9 parts by weight of a viscose based on 100 parts by weight of the total solid content, and may further include one or more selected from the group consisting of fructose, glucose, and oligosaccharides.
Specific examples of the saccharide-containing mixed sugar include 2 to 55 parts by weight of psicose, 30 to 80 parts by weight of fructose, 2 to 60 parts by weight of glucose and 0 to 15 parts by weight of oligosaccharide based on 100 parts by weight of the total solid content of the mixed sugar And may not include oligosaccharides. Saikos, fructose and glucose are preferably both D-isomer.
Saikosu can be carried out by chemical synthesis, or by biological methods using a cyclic epimerase, preferably by a biological method. Thus, the above-mentioned psicose includes at least one selected from the group consisting of psicose epimerase, cells of the strain producing the enzyme, culture of the strain, lysate of the strain, and extracts of the lysate or the culture The composition for producing psicose may be one prepared by reacting with a fructose-containing raw material.
In one embodiment of the present invention, a method for producing a scikos according to a biological method includes a method of culturing a strain producing a < RTI ID = 0.0 > cytokine < / RTI > epimerizing enzyme or a recombinant strain into which a gene encoding a scikos epimerase has been introduced, The course epimerase can be produced by reacting with a fructose-containing raw material. The above-mentioned cyclic epimerase can be carried out as a solid phase reaction using a liquid phase reaction or an immobilized enzyme.
Alternatively, a strain producing a cytomegalovirus or a recombinant strain into which a gene encoding a cytomegalovirus is introduced is obtained, and the culture of the strain, the culture of the strain, the lysate of the strain, and the lysate of the lysate or the culture Extract of the present invention can be produced by reacting a composition for producing a scorch, which comprises at least one member selected from the group consisting of a fructose-containing raw material, and a fructose-containing raw material. In the case of producing the cytosine using bacterial strains producing the Escherichia epimerase, the reaction can be carried out in the solid phase reaction using a liquid reaction or immobilized cells.
In a specific example of the present invention, as a strain producing a psicose epimerase, it may be a strain capable of producing a psicose epimerase at a high yield while having high stability. The recombinant strain may be a variety of host cells such as Escherichia coli, Bacillus sp., Salmonella sp., And Corynebacterium sp., Preferably, a strain of the genus Corynebacterium, which is a GRAS strain, Lt; / RTI > glutaricum.
In the case of using a recombinant strain, the gene encoding an enzyme derived from various strains can be used as a cytomegalic epimerase. For example, an enzyme derived from trifoneme primitia described in Korean Patent Publication No. 2014-0021974, Korean Patent Publication No. 2014-0080282 Or an enzyme derived from clostridials dans according to Korean Patent No. 10-1318422, and may also be an enzyme derived from enciphered hemolysin. In a specific example, the cytosine epimerase according to the present invention may be an enzyme derived from a clostridial synthase, for example, having the amino acid sequence of SEQ ID NO: 7, and the nucleic acid sequence of SEQ ID NO: 8 or SEQ ID NO: 9 . The nucleic acid sequence of SEQ ID NO: 8 is an E. coli optimized nucleic acid sequence and the SEQ ID NO: 9 is a nucleic acid sequence modified appropriately to Corynebacterium.
In the production of the recombinant strain according to an embodiment of the present invention, the expression of the enzyme may be regulated using a regulatory sequence located on the upper side of the nucleic acid sequence encoding the above-mentioned cyclic epimerase, and the regulatory sequence is essentially a transcription promoter And may further include ribosome binding regions and / or spacer sequences, and the like. The elements constituting the regulatory sequence may be directly linked or linked by including one or more linkers of the nucleic acid sequence having 1 to 100 bases, for example, 5 to 80 bases.
In one embodiment, the transcriptional promoter may be a nucleic acid molecule that expresses a nucleic acid sequence encoding a cyclic epimerase in a Corynebacterium sp. Strain, but may be a tac1, tac2, trc, or sod promoter. The sod promoter is derived from Corynebacterium glutaricum, and preferably comprises the nucleotide sequence of SEQ ID NO: 1 as a core region. The trc promoter is an Escherichia coli -derived promoter produced by a combination of the trp promoter and the lac UV5 promoter. The Tac1 promoter is an Escherichia coli-derived promoter, which is produced by a combination of the trp promoter and the lac UV5 promoter. The Tac2 promoter is an E. coli -based promoter, which is prepared by a combination of the trp promoter and the lac UV5 promoter, and is optimized by modifying the sequence of the Tac1 promoter.
The ribosome binding region and the spacer may be chemically linked directly or indirectly via a linker nucleic acid sequence in between. In an embodiment of the present invention, the ribosome binding region and the spacer sequence may include one oligonucleotide sequentially connected in 5 'to 3' order. The nucleotide sequences of the promoter sequence, the ribosome binding region and the spacer sequence according to an embodiment of the present invention are shown in Table 1 below. In Table 1, the underlined portions indicate the ribosome binding region, the spacer sequence, the linker sequence, and the like in the regulatory sequence.
number
gaaaggattttttacccatggctgtatacgaactcccagaactcgactac gcatacgac
gaaaggattacaaa
It is preferable that the cyclic epimerase according to the present invention is excellent in enzyme activity and thermal stability. Accordingly, in the embodiment of the present invention, the combination of the transcriptional promoter or the regulatory sequence with the gene encoding the cyclic epimerase is important , The tac1, tac2, trc, and sod promoters used in the present invention can provide more than adequate titers of protein expression, and when the sod promoter is used, folding of the protein is robust, It is more preferable to obtain a result which is high.
The method of producing a psicos using a recombinant strain can be carried out according to the method described in Korean Patent Publication Nos. 2014-0021974, 2014-0080282 and Korean Patent No. 10-1318422, but is not particularly limited.
Another embodiment of the present invention provides a method for producing a fermented milk, comprising: preparing a cereal raw material, saccharifying the prepared cereal raw material, fermenting the fermented cereal with alcohol using yeast to obtain an alcohol fermentation liquid; And a sweetener composition is added to the alcoholic fermentation broth to prepare a cereal fermented beverage containing not more than 40 parts by weight of fructose and not less than 3 parts by weight of cicosane based on 100 parts by weight of the sum of saccharides ≪ / RTI > The method for producing the fermented cereal grain according to the present invention can be explained step by step as follows.
Alcohol fermentation liquid preparation process of cereals
The alcohol fermentation liquid prepared from the cereal, which is one of the components during the fermentation of the present invention, includes a step of preparing a cereal raw material, saccharifying the prepared cereal raw material, and fermenting the saccharified cereal with alcohol using yeast to obtain an alcohol fermentation broth do.
The alcoholic fermentation broth of cereal may be, for example, makgeolli. Generally, the makgeolli is prepared by cultivating fungi, adding an appropriate amount of water and yeast to the broth, and adding yeast to the yeast. Adding water thereto, immersing it in two stages, aging and formulating it. In addition, the fermentation broth may be further added to the aging vessel and aged at a temperature of 5 to 25 DEG C for at least one month.
The step of preparing the cereal raw material in the conventional cereal fermentation liquor may include preparation of the cereal raw material, saccharification process, alcohol fermentation process, and preparation process, and specifically includes:
(1) a raw material preparing process for performing processes such as immersion, growth, and cooling of cereal, that is, starch raw material,
(2) A saccharification process in which the starch raw material is changed to sugar, for example, by adding water and cultured yeast to the entry and adding 0.1 to 1% (w / w) to the raw material saccharification enzyme, (Glycation step), which is a first step in which a mature agar is produced by stirring and dipping,
(3) Process for fermenting fermentation for 7-10 days at 23-28 ° C in order to produce a second batter which ferments sugar to alcohol by using a syrup after passing through the first fermentation step (alcohol fermentation process ); And
(4) A step of sieving the fermented fermented sake with a sieve to prepare a sake.
The raw material starch may be at least one selected from the group consisting of white rice, brown rice, glutinous rice, red rice, barley rice, wheat, sweet potato, potato, and combination. After that, the selected cereal raw materials are washed and immersed to remove foreign substances such as dust and absorb water. At this time, the absorption ratio of the starch raw material and water is generally 25 to 28% by volume to 72 to 75% by volume, but may be changed depending on the manufacturing environment. The dipped raw material is vaporized and then cooled. The raw material preparation process is known in the art in a variety of processing methods such as sieving, immersion, water removal, and potting time according to raw materials, and optionally mixed with other raw materials in consideration of the nutrient content required for flavor or fermentation composition The raw material can be processed and used for the next process. In addition, the cereal raw material may be used without a capital increase method, or may be used by pulverizing the grains.
Unlike the saccharide raw materials such as grapes, apples, etc., when the fermentation product is produced using the raw material for the saccharification, the saccharification process must undergo a saccharification process for decomposing starch into sugar. As the fermentation product used in the saccharification process, (A kind of fermenting agent in which a proper amount of water is added and then the fungus such as wild fungi is propagated) is used, or it is used as a feedstock (a type of modified fermentation agent in which fungal species are artificially propagated after the increase of the raw material for the cereal) .
Depending on the kind of the fermentation agent and the saccharification enzyme, the activity of the enzyme, the kind of the microorganism, and the propagation state may vary, and a person skilled in the art can appropriately select and use it. For example, as the distribution of microorganisms varies depending on the raw materials used, the manufacturing method, the production region, and the season, the effect of the nutrients on the quality of the nutrients may be different. In addition, in the case of immigration, white bacillus is used as a raw material, and the thus-obtained entry can be used as raw material for ground and granulated state, and as a raw material for one-stage soaking.
The fermentation of the raw material can be improved by further adding a cellulose decomposing enzyme which decomposes the cellulose when the saccharifying enzyme is added, depending on the cereals to be selected and the kinds of the starch raw materials subjected to the processing. However, depending on the cereals, documents, and kinds of the starch raw materials that have been processed, 0.1 to 1% (w / w) of a cellulose decomposing enzyme capable of decomposing fibrin is added to the weight of the raw material when the saccharifying enzyme is added The fermentation of the raw material can be improved.
The alcohol fermentation process is a process of saccharification, followed by fermentation of the sugar alcohol, and the temperature is about 23-28 ° C, preferably 25 ° C. The fermentation period is about 7-10 days.
In the above-mentioned forming process, the aged syrup is subjected to a sifting process, and is generally almost the same as the manufacturing principle of Yakju and Takju. First, Takju is obtained in a turbid state by sifting a fermented fermented syrup in a sifting process, but it is relatively transparent in comparison with Takju. The sake residue is squeezed using a squeezer, sedimented or filtered with a filter, .
The sweetener composition is added to the alcoholic fermentation broth of the above-mentioned cereal to prepare a cereal fermentation liquor. For example, 1 to 50% by weight of a sweetener composition is added to 50 to 99% by weight of an alcoholic fermentation broth to make the total 100%. The sweetener composition of the present invention is as described above.
The fermented cereal according to the present invention can be produced as it is by adding a sweetener composition to an alcoholic fermentation broth of a cereal, but it can be sterilized as a post-process to maintain a uniform taste during circulation, And a cooling sensation is provided by injecting carbonic acid. In the case of injecting carbonic acid gas, the cooling sensation is determined according to the amount of carbonic gas to be injected.
The present invention achieves the effect of improving the sensory properties such as prolongation of the circulation period of the cereal fermentation tank, inhibition of post fermentation, and sweetness by controlling the saccharide and sugar composition contained in the cereal fermentation stock.
1 is a diagram showing an example of an expression recombinant vector (pCES_sodCDPE) for producing a psicose syrup used in the present invention.
The present invention will be described in more detail with reference to the following examples, but the following examples are given by way of illustration and are not intended to limit the scope of the present invention.
Manufacturing example One: Saikos Produce
1-1: Saikos Production of production strains
The DPE gene (Gene bank: EDS06411.1) derived from Clostridium scindens ATCC 35704 was synthesized as modified polynucleotides by optimizing E. coli for the Escherichia coli To name it CDPE. The polynucleotide optimized for Escherichia coli (SEQ ID NO: 2) and the sod promoter and T7 terminator obtained from the pET21a vector were obtained through PCR using each template, which was then ligated into a template by overlap PCR (PCR) And cloned into pGEM T-easy vector through T-vector cloning to confirm the sequence of the polynucleotide including the sod promoter (SEQ ID NO: 1), the optimized CDPE sequence of SEQ ID NO: 8 and the T7-terminator.
The entire confirmed polynucleotide was inserted into the same restriction enzyme site of the expression vector pCES208 (J. Microbiol. Biotechnol., 18: 639-647, 2008) using restriction enzymes NotI and XbaI (NEB) to obtain a recombinant vector pCES208 / (PCES_sodCDPE) was prepared. A cleavage map of the prepared recombinant vector (pCES_sodCDPE) is shown in Fig.
The prepared recombinant vector (pCES_sodCDPE) plasmid was transformed into Corynebacterium glutaricum using electroporation. Colonies were picked and inoculated into 4 ml of LB medium (10 g / L of tryptone, 10 g / L of NaCl, 5 g / L of yeast extract) supplemented with kanamycin at a final concentration of 15 ug / And 250 rpm for about 16 hours. Then, 1 ml of the above culture was obtained and inoculated into 100 ml of LB medium containing 15 ug / ml kanamycin, and the culturing was continued for 16 hours or more. After lysis of cells cultured with Beadbeater, only the supernatant is obtained, mixed with sample buffer 1: 1, and heated at 100? For 5 minutes. The prepared sample was subjected to electrophoresis on a 12% SDS-PAGE gel (composition: running gel - 3.3 ml H2O, 4.0 ml 30% acrylamide, 2.5 ml 1.5 M Tris buffer (pH 8.8) 20 μl 10% SDS, 20 μl 10% APS, 2 μl TEMED) at 180 V for about 50 minutes at room temperature The protein expression was confirmed by electrophoresis. After the expression of CDPE was confirmed on SDS-PAGE gel, the His-tag purification was performed using Ni-NTA resin to determine the precise expression level. The expression (%) = (Purified protein (mg) / Total soluble protein )) * 100). The transformed Corynebacterium glutaricum prepared above produced 16.62 mg of total soluble protein and 1.74 mg of purified enzyme protein.
1-2: Saikos Manufacture of syrups
Cells were recovered by centrifugation in a strain culture in order to produce a scissors from fructose using the recombinant strain producing the scuche epimerase obtained in Production Example 1-1.
The cell suspension was then treated with 0.05% (w / v) of an emulsifier (M-1695) in a final volume at 35 ° C (± 5 ° C) for 60 minutes. After the completion of the reaction, the supernatant containing the emulsifier was removed using a centrifuge, and the cells were recovered.
For the preparation of the immobilized beads, the recovered cells were mixed with DW to a final cell concentration of 5% (w / v), mixed with 4% (w / v) alginic acid dissolved in water and 5% ) Were mixed at a ratio of 1: 1, and stored in a refrigerator at 4 ° C to remove bubbles generated during mixing. The mixture solution was injected through Needdle (inner diameter: 0.20 to 0.30 mm) and formed into a droplet shape, and dropped by weight. The dropped mixed solution was dropped into a pre-prepared 100 mM calcium chloride (CaCl 2 ) To form spherical or elliptical beads (diameter 2.0 to 2.2 mm). The formed beads were soaked in a 100 mM calcium chloride solution and mixed evenly by a stirrer so as to be further cured.
After all of the mixed solution was injected, the beads were further cured while refrigerated for 4 to 6 hours, and then replaced with a fresh 100 mM calcium chloride solution, and cured in a refrigerated state for about 6 hours. The hardened beads were completely removed from the beads, and then water having a volume three times the bead volume was added thereto. The beads were then stirred for 10 minutes. This process was repeated three times to remove the calcium chloride solution. The washed beads were completely removed for manganese soaking, and then a 40-brix (%) reaction substrate containing 10 mM of manganese was added thereto in a volume three times as large as the bead volume, followed by stirring for 10 minutes. And replaced with a reaction substrate containing 10 mM manganese. The reaction substrate is adjusted to pH 6.8 ~ 7.2 with 3N NaOH. Depending on the type of product, liquid fructose or crystalline fructose can be the reaction substrate. The beads were replaced with a reaction substrate containing 10 mM manganese. The beads were transferred to the reaction tank and reacted at a reaction temperature of 50 ° C for about 30 to 60 minutes to complete the sorbing of beads with manganese and fructose. The diameter of the finished bead decreases to 1.6 ~ 1.8mm and the strength also increases. The substrate of the beads which had been soaked was removed and the immobilized reaction column was filled and used for the production of the viscose syrup.
≪ Immobilization column reaction conditions >
Reaction temperature: Internal temperature of column jacket 50 ℃
Substrate flow rate: 0.5 SV (space velocity L. h -1 )
Reaction Substrate: Crystalline fructose 40brix, pH 6.8 to 7.2,
Bead preparation: 2.5% (w / w) cells, 2% (w / w) alginic acid mixture and 10 mM Mn 2 + soaking
The immobilization reaction column was provided with a raw material containing 92% by weight of fructose when the raw material solution contained 75% of solid content and 100% by weight of total solid content, Respectively. That is, 25 (w / w)% of psicose syrup of glucose: fructose: sucrose: oligosaccharide = 6: 67: 25: 2 was obtained from the reaction solution in the weight ratio of glucose: fructose: Lt; / RTI >
1-3: Saikos Preparation of powder
To remove impurities such as color and ion components, the psicose syrup obtained in Production Example 1-2 was added to a column at room temperature filled with a cation exchange resin, an anion exchange resin and a resin mixed with a cation and anion exchange resin, The solution was passed through at a speed of 2 times volume and desalted. Separately, the solution was separated into a high-purity scorch solution by chromatography packed with a calcium (Ca 2 + ) type ion exchange resin. The high-purity cicos syrup was concentrated to a concentration of 82 Bx and cooled gradually to a temperature of 10 < 1 > at a supersaturation temperature of 35 deg. C to form crystals. The mother liquor obtained in the crystallization step was centrifugally dehydrated to remove the mother liquor, and the crystal was washed with cooling water, followed by drying and recovering.
Example 1: makgeolli manufacturing
1-1: Preparation of Makgeolli stock solution
2 kg of white rice was washed with starch as a raw material to remove foreign substances such as dust and dipped in water for 12 hours, and water was removed to maintain the moisture at 30 to 35%. The mixture was heated at 121 DEG C for 40 minutes and then cooled to room temperature to prepare a rice cake.
The fermentation was divided into two stages. The first fermentation was carried out at 21 ℃ for 3 days by adding 1kg of crude broth (master), 0.2kg of immigration and purified water to the first fermentation process. As a secondary fermentation process, 1 kg of the fermentation broth of the primary fermentation process, 0.2 kg of yeast, and water were added and fermented at 25 DEG C for 20 days to obtain a secondary fermentation broth. The resulting secondary fermentation broth was sieved with a 60-mesh sieve to prepare a rice wine solution. A predetermined amount of water was added to the resulting fermentation stock solution to adjust the alcohol frequency to 5 degrees was used in the subsequent experiments.
1-2: Mixing of sweeteners and makgeolli
The alcoholic beverages prepared in 1-2 above were mixed with rice wine having a degree of alcohol of 5 in a composition as shown in Table 2 and blended so as to have a total weight of 100% by weight. As the above sweetener, Example 1 used a Saikoshi powder (Synchose content 99%) of Production Example 1-3.
(weight%)
Oligosaccharide (% by weight)
(weight%)
(weight%)
Example 2-5: Makgeolli Manufacturing
The makkalle and the sweetener composition of Example 1-1 were mixed in the composition shown in Table 2 and blended so that the total amount was 100% by weight. As the above-mentioned sweetener, a syrup containing 25% of the sucrose obtained in Production Example 1-2 was used in Example 2-5 in place of the sarcosine powder of Example 1. Examples 2 and 3, in which 25% Psycorus syrup was added at 5%, containing 1.25% by weight of Psycos and 3.75% by weight of Psycops based on the solids content and adding 25% Psycorus syrup at 10% 4, containing 10% by weight of 25% by weight of psicose syrup, 2.5% by weight of psicose and 3.75% by weight of fructose.
Examples 2 to 5 use psicose syrup, so that the amount of purified water added to the rice wine was adjusted so that 5% by weight or 10% by weight of psicose was added to the solid content.
Comparative Example 1 to 4
The makgeolli prepared in Example 1-1 was used as Comparative Example 1.
Comparative Examples 2 and 4 were prepared in the same manner as in Example 1 except that isomaltooligosaccharide was used in place of the cyclosporin of Example 1, aspartame was used in Comparative Example 3, Was prepared using both isomaltooligosaccharide and aspartame. The specific ingredients and mixing ratios of Comparative Examples 1 to 4 are shown in Table 3 below.
Oligosaccharide (% by weight)
Test Example One: During storage Evaluation of pH change
The pH of the makkalle obtained in Example 1-5 and Comparative Example 1-4 was stored at 4 ° C for 20 days, and the change in pH was measured with a pH meter.
As shown in Table 4, in the case of Example 1-5, in which a mixture of a viscose powder and a viscose syrup was added, there was almost no pH change during storage for 20 days, and the effect of extending the circulation period by adjusting post- Respectively.
In addition, the taste and sensory qualities of traditional rice wine were improved, and the shelf life of rice wine was generally 7 days to 10 days in refrigerated storage, .
Compared with Comparative Examples 2 and 4 in which isomaltooligosaccharide as a non-fermented saccharide was added, Comparative Examples 1 and 3 had no glucose contained in the isomaltooligosaccharide and thus could not be used as a substrate for microorganisms, And 4, and Example 1-5 showed the effect of inhibiting the pH change by acting on the metabolism of microorganisms.
Test Example 2: Sugar composition Change evaluation
The Makkoli of Examples 1-5 and Comparative Examples 1-4 were stored for 7 days at 4 ° C and then analyzed by High Performance Liquid Chromatography (HPLC) to determine the compositional change of the soluble sugar content of the makkolli. Aminex HPX-87C manufactured by BIO-RAD Co., Ltd. was used. The column temperature was 85 ° C, the solvent was water, the flow rate was 0.6 ml / min, and the result was measured using a Refractive Index Detector. Are shown in Table 5, and the results of the comparative examples are shown in Table 6, and the content of each saccharide is expressed in weight%.
The results of the experiments of Comparative Examples 1 to 4 show that the syncosic acid, glucose and fructose are naturally occurring in the fermentation process as a control without artificially adding sucrose, glucose and fructose. In Comparative Examples 1 and 3, the amount of fructose produced was substantially similar to that of Comparative Examples 2 and 4, but the amount of fructose expressed on the basis of the total saccharide content was comparable to that of Comparative Examples 2 and 4 because the experimental group was not artificially added with isomaltooligosaccharide Compared with the control group. On the other hand, Comparative Examples 2 and 4 show that the addition of isomaltooligosaccharide resulted in the inclusion of more than three saccharides (DP3) and four saccharides (DP4). Respectively.
In Table 5, the content of the sicos contained in the rice wine of Examples 1-5 was relatively higher than that of Comparative Examples 1 to 4, but it was not only artificially added to the sauces, but also was non-fermented, A relatively large amount was not detected.
Test Example 3: Sensory evaluation
The sensory evaluations of the rice wine of Examples 1-5 and Comparative Examples 1-4 were carried out by the following methods.
(1) Panel member selection: 16 men and women in their late 20s to late 40s were selected.
(2) Test method: First, the taste and taste of the tastes are observed. The smell coming from the nose is evaluated, and 5 ~ 10 ml of makgeolli is put on the tongue. , And the flavor and taste were evaluated. After spitting out the sake, I dropped my leftover alcohol on my throat and evaluated it.
(3) Display of test result: The degree of the sweetness, the amount of throat, and the preference were evaluated by the five point scaling method.
Sweetness: very strong 5 points, average 3 points, very weak 1 point
Thumbnails: very soft 5 points, average 3 points, not very soft 1 point
Body feel: Very good 5 points, Average 3 points, Very poor 1 point
Finish: Very good 5 points, Average 3 points, Very poor 1 point
Preferences: Very good 5 points, Average 3 points, Very poor 1 point
The scores of each panel were statistically significant at 95% confidence level. The results of the sensory evaluation are shown in Table 7 below.
In Comparative Example 4, the degree of sweetness was higher than that of Comparative Examples 1 to 3. This was due to the addition of aspartame, which is a high-intensity sweetener, and the sweetness of Comparative Example 4 was higher than that of Comparative Examples 1 to 3 , The body sensation and the finish were superior to Comparative Example 4 in which isomaltooligosaccharide and aspartame were used together.
Example 1 was prepared by adding 5% by weight of Sikosu powder without adding aspartame, which is a high-intensity sweetener, and the relative sweetness of Psychosis was 70% of that of sugar. Thus, it can be said that the effect of increasing the sweetness of rice wine The results are similar to those of Comparative Example 4 using isomaltooligosaccharide and aspartame as a high-intensity sweetener. This result means that, except for aspartame, which is a commonly used high-intensity sweetener, it is possible to improve the sweetness, flavor, body sensation, It may be possible to manufacture a makkolli composition which is more beneficial to health.
In Example 2, isomaltooligosaccharide and 5% of syrup containing 25% of sicos were applied. In Example 4, 10% of liquid syrup containing 25% of sicos was applied. Aspartame, which is also a high- The sensory test showed that it was superior to Comparative Example 4 in terms of taste, necking, body, and finish even though it was not used. In addition, Examples 3 and 5 were found to be superior to Comparative Example 4 in terms of taste, necking, body, and finish, and exhibited similar sensory properties as Examples 2 and 4, respectively.
<110> SAMYANG GENEX CORPORATION <120> Fermented alcoholic beverage of grains with improved storage stability and sweetness quality and method of preparing the same <130> DPP20150661KR <160> 9 <170> Kopatentin 1.71 <210> 1 <211> 356 <212> DNA <213> Artificial Sequence <220> The sod promoter (6) <400> 1 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg acgaaaggat tacaaa 356 <210> 2 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> The Tac1 promoter (4) <400> 2 tgacaattaa tcatcggctc gtatattgtg tggaattgtg agcggataac aatttcacac 60 aggaaacaga attcccgggg aaaggattac aaa 93 <210> 3 <211> 112 <212> DNA <213> Artificial Sequence <220> <223> The Tac2 promoter (4) <400> 3 tgacaattaa tcatccggct cgtataatgt taacaatttg tggaattgtg agcggacaca 60 caggaaacag accatggaat tcgagctcgg tacccgggga aaggattaca aa 112 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> The Trc promoter (1) <400> 4 tgacaattaa tcatcggcct cgtataatgt 30 <210> 5 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Ribosome binding region <400> 5 gaaagga 7 <210> 6 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Spacer sequence <400> 6 ttacaaa 7 <210> 7 <211> 289 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of an enzyme protein originated from Clostridium scindens <400> 7 Met Lys His Gly Ile Tyr Tyr Ala Tyr Trp Glu Gln Glu Trp Ala Ala 1 5 10 15 Asp Tyr Lys Arg Tyr Val Glu Lys Ala Ala Lys Leu Gly Phe Asp Ile 20 25 30 Leu Glu Val Gly Ala Ala Pro Leu Pro Asp Tyr Ser Ala Gln Glu Val 35 40 45 Lys Glu Leu Lys Lys Cys Ala Asp Asp Asn Gly Ile Gln Leu Thr Ala 50 55 60 Gly Tyr Gly Pro Ala Phe Asn His Asn Met Gly Ser Ser Asp Pro Lys 65 70 75 80 Ile Arg Glu Glu Ala Leu Gln Trp Tyr Lys Arg Leu Phe Glu Val Met 85 90 95 Ala Gly Leu Asp Ile His Leu Ile Gly Gly Ala Leu Tyr Ser Tyr Trp 100 105 110 Pro Val Asp Phe Ala Thr Ala Asn Lys Glu Glu Asp Trp Lys His Ser 115 120 125 Val Glu Gly Met Gln Ile Leu Ala Pro Ile Ala Ser Gln Tyr Gly Ile 130 135 140 Asn Leu Gly Met Glu Val Leu Asn Arg Phe Glu Ser His Ile Leu Asn 145 150 155 160 Thr Ser Glu Glu Gly Val Lys Phe Val Thr Glu Val Gly Met Asp Asn 165 170 175 Val Lys Val Met Leu Asp Thr Phe His Met Asn Ile Glu Glu Ser Ser 180 185 190 Ile Gly Asp Ala Ile Arg His Ala Gly Lys Leu Leu Gly His Phe His 195 200 205 Thr Gly Glu Cys Asn Arg Met Val Pro Gly Lys Gly Arg Thr Pro Trp 210 215 220 Arg Glu Ile Gly Asp Ala Leu Arg Glu Ile Glu Tyr Asp Gly Thr Val 225 230 235 240 Val Met Glu Pro Phe Val Arg Met Gly Gly Gln Val Gly Ser Asp Ile 245 250 255 Lys Val Trp Arg Asp Ile Ser Lys Gly Ala Gly Glu Asp Arg Leu Asp 260 265 270 Glu Asp Ala Arg Arg Ala Val Glu Phe Gln Arg Tyr Met Leu Glu Trp 275 280 285 Lys <210> 8 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (1) of the enzyme protein of SEQ ID NO: 7 <400> 8 atgaaacacg gtatctacta cgcgtactgg gaacaggaat gggcggcgga ctacaaacgt 60 tacgttgaaa aagcggcgaa actgggtttc gacatcctgg aagttggtgc ggcgccgctg 120 ccggactact ctgcgcagga agttaaagaa ctgaaaaaat gcgcggacga caacggtatc 180 cagctgaccg cgggttacgg tccggcgttc aaccacaaca tgggttcttc tgacccgaaa 240 atccgtgaag aagcgctgca gtggtacaaa cgtctgttcg aagttatggc gggtctggac 300 atccacctga tcggtggtgc gctgtactct tactggccgg ttgacttcgc gaccgcgaac 360 aaagaagaag actggaaaca ctctgttgaa ggtatgcaga tcctggcgcc gatcgcgtct 420 cagtacggta tcaacctggg tatggaagtt ctgaaccgtt tcgaatctca catcctgaac 480 acctctgaag aaggtgttaa attcgttacc gaagttggta tggacaacgt taaagttatg 540 ctggacacct tccacatgaa catcgaagaa tcttctatcg gtgacgcgat ccgtcacgcg 600 ggtaaactgc tgggtcactt ccacaccggt gaatgcaacc gtatggttcc gggtaaaggt 660 cgtaccccgt ggcgtgaaat cggtgacgcg ctgcgtgaaa tcgaatacga cggtaccgtt 720 gttatggaac cgttcgttcg tatgggtggt caggttggtt ctgacatcaa agtttggcgt 780 gacatctcta aaggtgcggg tgaagaccgt ctggacgaag acgcgcgtcg tgcggttgaa 840 ttccagcgtt acatgctgga atggaaataa 870 <210> 9 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (2) of the enzyme protein of SEQ ID NO: 7 <400> 9 atgaagcacg gcatctacta cgcatactgg gagcaggagt gggcagcaga ctacaagcgc 60 tacgttgaga aggcagcaaa gctgggcttc gacatcctgg aggttggcgc agcaccactg 120 ccagactact ccgcacagga ggttaaggag ctgaagaagt gcgcagacga caacggcatc 180 cagctgaccg caggctacgg cccagcattc aaccacaaca tgggctcctc cgacccaaag 240 atccgcgagg aggcactgca gtggtacaag cgcctgttcg aggttatggc aggcctggac 300 atccacctga tcggcggcgc actgtactcc tactggccag ttgacttcgc aaccgcaaac 360 aaggaggagg actggaagca ctccgttgag ggcatgcaga tcctggcacc aatcgcatcc 420 cagtacggca tcaacctggg catggaggtt ctgaaccgct tcgagtccca catcctgaac 480 acctccgagg agggcgttaa gttcgttacc gaggttggca tggacaacgt taaggttatg 540 ctggacacct tccacatgaa catcgaggag tcctccatcg gcgacgcaat ccgccacgca 600 ggcaagctgc tgggccactt ccacaccggc gagtgcaacc gcatggttcc aggcaagggc 660 cgcaccccat ggcgcgagat cggcgacgca ctgcgcgaga tcgagtacga cggcaccgtt 720 gttatggagc cattcgttcg catgggcggc caggttggct ccgacatcaa ggtttggcgc 780 gacatctcca agggcgcagg cgaggaccgc ctggacgagg acgcacgccg cgcagttgag 840 ttccagcgct acatgctgga gtggaagtaa 870
Claims (14)
Wherein the fermentation broth comprises an amount of fructose of 40 parts by weight or less based on 100 parts by weight of the total amount of saccharides and 3 parts by weight or more of cicosane.
A sweetener composition is prepared,
The fermented milk according to any one of claims 1 to 12, wherein the sweetener composition is added to the alcoholic fermentation broth and contains 40 parts by weight or less of fructose and 3 parts by weight or more of cicosane based on 100 parts by weight of total sugar A method for producing a fermented cereal grain having increased storage stability.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150093688A KR101709258B1 (en) | 2015-06-30 | 2015-06-30 | fermented alcoholic beverage of grains with improved storage stability and sweetness quality and method of preparing the same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150093688A KR101709258B1 (en) | 2015-06-30 | 2015-06-30 | fermented alcoholic beverage of grains with improved storage stability and sweetness quality and method of preparing the same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20170003260A true KR20170003260A (en) | 2017-01-09 |
| KR101709258B1 KR101709258B1 (en) | 2017-02-22 |
Family
ID=57810986
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020150093688A KR101709258B1 (en) | 2015-06-30 | 2015-06-30 | fermented alcoholic beverage of grains with improved storage stability and sweetness quality and method of preparing the same |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101709258B1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107502504A (en) * | 2017-08-24 | 2017-12-22 | 贵州禾玉来红谷有限公司 | A kind of red rice fermented glutinous rice and preparation method thereof |
| WO2020005023A1 (en) * | 2018-06-29 | 2020-01-02 | 주식회사 삼양사 | Alcoholic beverage having improved taste and savoriness |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120029365A (en) * | 2010-09-16 | 2012-03-26 | 마쓰다니가가꾸고오교가부시끼가이샤 | Alcoholic beverage and beer-flavored beverage each having improved quality of taste and method of producing the same |
| KR101252810B1 (en) * | 2010-01-21 | 2013-04-09 | 서주원 | Rice wine and manufacturing method of the same |
| KR20150015030A (en) * | 2007-05-18 | 2015-02-09 | 마쓰다니가가꾸고오교가부시끼가이샤 | Novel sweetener having sucrose-like taste, method for producing the same, and use of the same |
| KR20150067102A (en) * | 2015-05-27 | 2015-06-17 | 전남대학교산학협력단 | Makgeolli with stable flavor of fermentation |
-
2015
- 2015-06-30 KR KR1020150093688A patent/KR101709258B1/en active IP Right Grant
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150015030A (en) * | 2007-05-18 | 2015-02-09 | 마쓰다니가가꾸고오교가부시끼가이샤 | Novel sweetener having sucrose-like taste, method for producing the same, and use of the same |
| KR101252810B1 (en) * | 2010-01-21 | 2013-04-09 | 서주원 | Rice wine and manufacturing method of the same |
| KR20120029365A (en) * | 2010-09-16 | 2012-03-26 | 마쓰다니가가꾸고오교가부시끼가이샤 | Alcoholic beverage and beer-flavored beverage each having improved quality of taste and method of producing the same |
| KR20150067102A (en) * | 2015-05-27 | 2015-06-17 | 전남대학교산학협력단 | Makgeolli with stable flavor of fermentation |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107502504A (en) * | 2017-08-24 | 2017-12-22 | 贵州禾玉来红谷有限公司 | A kind of red rice fermented glutinous rice and preparation method thereof |
| WO2020005023A1 (en) * | 2018-06-29 | 2020-01-02 | 주식회사 삼양사 | Alcoholic beverage having improved taste and savoriness |
| KR20200002679A (en) * | 2018-06-29 | 2020-01-08 | 주식회사 삼양사 | Liquor with improved taste and savory taste |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101709258B1 (en) | 2017-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101695831B1 (en) | Saccharide mixture containing psicose with improved sweetness quality and crystallization | |
| KR101709255B1 (en) | microbial growth inhibitor comprising psicose | |
| KR101617379B1 (en) | Mixed sugar granule and method of preparing the same | |
| KR101731063B1 (en) | Composition for soaking syrup and use of the same | |
| JPH0866187A (en) | Heat-resistant trehalose release enzyme and its production and use | |
| KR101703264B1 (en) | The low calorie lactic-acid fermented milk with an enhanced storage stability and method for preparing the same | |
| KR20160143075A (en) | Frozen bread dough and method of preparing the same | |
| KR101648170B1 (en) | composition for increasing the storage stability of culture product of lactic acid bacteria | |
| CN104853611A (en) | Compositions and methods for reduced carbohydrates and increased erythritol in beverages | |
| KR101709258B1 (en) | fermented alcoholic beverage of grains with improved storage stability and sweetness quality and method of preparing the same | |
| JP2007166975A (en) | Method for producing black vinegar and black vinegar produced by the same method | |
| KR101709256B1 (en) | Hard candy having low calory, good sweetness and formability | |
| KR20170087322A (en) | Method for preparing traditional vinegar comprising fermentation of natural whole grains giving rich flavor to Korean food | |
| KR101696833B1 (en) | Composition for preparing frozen food using the culture product of lactic acid bacteria, and frozen food using the culture product | |
| KR101703263B1 (en) | The semisolid yoghurt with an enhanced storage stability and method for preparing the same | |
| KR20160055652A (en) | Beverage with improved taste including fragment of fruit or plant and method of preparing the same | |
| WO2002055708A1 (en) | POLYPEPTIDE HAVING α-ISOMALTOSYLGLUCOSACCHARIDE SYNTHASE ACTIVITY | |
| CN107523578B (en) | Gene encoding mannitol-1-phosphatase in kelp, protein and use thereof | |
| JPS6140783A (en) | Preparation of edible vinegar | |
| JPS6119479A (en) | Preparation of agar liquor | |
| KR20170009140A (en) | Saccharomyces cerevisiae having enhanced salt tolerance, sugar tolerance and alcohol tolerance, and method for manufacturing cereal-fermented material using the same | |
| KR101895913B1 (en) | Carbonated beverage comprising rare sugar | |
| CN112760430B (en) | Method for coproducing fructose and glucose syrup with different purities by using high-purity crystalline fructose | |
| KR101703262B1 (en) | Freeze-dried food using the culture product of lactic acid bacteria and method of preparing the same | |
| JPH10150971A (en) | Sweet potato vinegar and its production |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| N231 | Notification of change of applicant | ||
| A201 | Request for examination | ||
| A302 | Request for accelerated examination | ||
| E902 | Notification of reason for refusal | ||
| E90F | Notification of reason for final refusal | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant | ||
| FPAY | Annual fee payment |
Payment date: 20191216 Year of fee payment: 4 |