KR20160141612A - Nucleotide Sequences of a New Species Freshwater Crab. Naju crab, Inhabiting the Naju city, Southwestern Region of Korea - Google Patents

Abstract

The present invention relates to a specific nucleotide sequence for identifying a species of aquarium fishes found in the southwestern region of South Korea and can identify a new fish species resident in the city of Naju in the southwestern region of the Republic of Korea by the specific nucleotide sequence of the present invention . In addition, the present invention can accurately identify the bacterium bacterium using the identification kit of bacterium bacterium containing the specifically binding primer or probe of the specific nucleotide sequence of the present invention.

Description

{Nucleotide Sequences of a New Species Freshwater Crab. Naju crab, Inhabiting the Naju city, Southwestern Region of Korea}

The present invention relates to a nucleotide sequence of a novel strain of the genus Lepidoptera in the southern part of the Republic of Korea.

There are about 1300 species of freshwater crab in the world. Shin et al., 2004; Shih et al., 2008b; Shih et al., 2011b) play an important role in ecology throughout the world. Pure shinbang is considered to have adopted the freshwater, semi-wild, or life-style lifestyle and is characterized by the ability to complete an independent life cycle away from the marine environment (Yeo et al. 2008). Article O (zoea) and some megalopa wave of larvae and immature stages without gwetel Fusa such as (megalopa) (Geothelphusa) Embryos of the species develop directly by hatching directly into the young. Mature crabs protect young crabs for a certain period of time.

The Geothelphusa genus is one of the eight genus benthos . Stimpson (1858) is a diverse and wealthy group of buffets. It is reported that more than 50 Chapelpus species live in Far East islands, including Taiwan, the Ryukyu Islands, Pinnacle Islands and Japan (Dai 1999; Ng et al. 2008; Shih et al. 2011a; www.marinespecies.org/aphia.php?p=taxdetails&id=391198).

Segawa and Aotsuka (2005) published a nearly complete sequence of the mitochondrial genome of the Japanese genus bark G. dehaani . The present specification has found that the new P. falciparum species live in the southern part of the peninsula in Naju. So I gave it a name (Naju crab, Geothelphusa najuensis ). Until now, the Jin-ming banquet including the Zapelpusa species has never been collected on the peninsula. Genomes were extracted from the chromosome 16S rDNA nucleotide sequence, cytochrome c oxidase I (CO1) nucleotide sequence, and internal transcribed spacer (ITS) nucleic acid sequence to identify a unique part of the nucleotide sequence Respectively. We have found evidence of the development of large egg yolks in this species directly hatching into newborn crabs.

A number of articles are referenced throughout this specification and their citations are indicated. The disclosures of the cited articles are incorporated herein by reference in their entirety to more clearly describe the state of the art to which the present invention pertains and the content of the present invention.

The present inventors peninsula as a new species in the Southwest Naju, gwetel Fusa Naju N-Sys (Geothelphusa najuensis) to discover the 'I give' termed was a novel gene that can be homologous to bite the new jinmin 16S rDNA, CO1 and ITS gene To identify the specific nucleotide sequence of the nucleotide sequence.

The present invention is to provide a specific 16S rDNA nucleotide sequence of a new species of aquaculture genus inhabiting the southwestern region of the Korean peninsula.

The present invention provides a nucleotide sequence of the CO1 gene specific to a new species of the sea bream that lives in the southwestern region of the Korean peninsula.

The present invention relates to a nucleotide sequence of a specific ITS gene of a new species of Bacillus subtilis inhabiting the southwestern region of the Korean peninsula.

The present invention is to provide a kit for identifying a new type of crab crab inhabiting the southwestern region of the Korean peninsula.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a 16S rDNA of G. najuensis having the nucleotide sequence set forth in SEQ ID NO: 1.

The present invention is the result of a specific nucleotide sequence for the identification of a new species of aquaculture found in the southern part of the Korean peninsula in Naju City. Through bioinformatics analysis, we found a minimum of 6 specific nucleotide sequences.

As used herein, the term " G. najuensis "means a new type of ginseng that the present inventors have found in the southern part of the Republic of Korea. In addition, there are about 1,300 species of shrimp inhabiting the world's freshwater environments, and these shrimp benthos play an important role in ecology around the world (Shih et al., 2004; Yeo et al., 2008; Shih et al., 2011b).

As used herein, the term "16S rDNA (16S ribosomal DNA) " refers to DNA encoding 16S rRNA. Although there is almost no diversity in alleles, diversity among different species occurs, Or to identify and classify organisms that have never been reported. The 16S rDNA of the present invention is also interpreted to include a nucleotide sequence that exhibits substantial identity to the above nucleotide sequence.

According to another aspect of the present invention, the present invention provides a nucleic acid molecule encoding mitochondrial cytochrome oxidase subunit 1 (CO1) of G. najuensis having the nucleotide sequence set forth in SEQ ID NO: Lt; / RTI >

As used herein, the term "nucleic acid molecule" has the meaning inclusive of DNA (gDNA and cDNA) and RNA molecules. In the nucleic acid molecule, the nucleotide which is a basic constituent unit is not only a natural nucleotide, Also included are analogues (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

As used herein, the term " mitochondrial cytochrome oxidase subunit 1 (CO1) "is a gene that exists in mitochondria and shows a different nucleic acid sequence for each species and is used as a DNA marker. More specifically, the nucleic acid molecule of the present invention comprises a nucleotide sequence represented by SEQ ID NO: 2. The nucleic acid molecule encoding CO1 of Quetal Fusanage nucleic acid is interpreted to include a sequence that exhibits substantial identity to the above nucleotide sequence.

According to another aspect of the present invention, there is provided a nucleic acid molecule encoding an internal transfer spacer (ITS) of G. najuensis having the nucleotide sequence set forth in SEQ ID NO: 3.

The term "internal transfer spacer (ITS) " as used herein refers to the space between the regions where the rRNA is coded. The sequence of rRNA is very well conserved because ribosomes are very important in organisms, whereas ITS is a region where species variation can be very severe. In one embodiment of the invention, the ITS is a region comprising the nucleotide sequence of the ITS1 region, the 5.8S rDNA and the ITS2 region. The nucleic acid molecule encoding the ITS of Quetal Fusanage nisus is interpreted to include a sequence that exhibits substantial identity to the nucleotide sequence described above. The above substantial identity is determined by aligning the nucleotide sequence of the present invention with any other sequence as much as possible and analyzing the aligned sequence using algorithms commonly used in the art. Homology, more preferably at least 90% homology, most preferably at least 95% homology.

According to another aspect of the present invention, there is provided an identification kit for a G. najuensis of the present invention comprising a primer or a probe that specifically binds to a nucleic acid sequence of G. najuensis .

The present inventors have sought to identify the species of the bell crickets found in the southern part of the country, Namju. As a result, the specific nucleotide sequence of the 16S rDNA, CO1 and ITS genes was identified, thereby completing the present invention.

The term " identification "in this specification means to determine the position of a new new species or a living organism among already identified taxa by comparing the traits by various illustrations, search tables and gene tests.

According to one embodiment of the present invention, the kit of the present invention is a microarray or a polymerase chain reaction (PCR).

When the kit of the present invention is a microarray, the probe is immobilized on the solid-phase surface of the microarray. When the kit of the present invention is a polymerase chain reaction, it includes a primer or a primer and a probe.

The probe or primer used in the identification kit of the present invention has a sequence complementary to a nucleotide sequence selected from the group consisting of 16S rDNA, CO1 and ITS genes. The term "complementary " as used herein means having complementarity enough to selectively hybridize to the nucleotide sequences described above under any particular hybridization or annealing conditions. Thus, the term "complementary" has a different meaning from the term complementary, and the primers or probes of the present invention may include one or more mismatches mismatch < / RTI > nucleotide sequence.

As used herein, the term "primer" refers to a primer that, under suitable conditions (i.e., four different nucleoside triphosphates and polymerization enzymes) in a suitable buffer at a suitable temperature, - means strand oligonucleotide. The suitable length of the primer is typically 15-30 nucleotides, although it varies with various factors such as temperature and use of the primer. Short primer molecules generally require lower temperatures to form a sufficiently stable hybrid complex with the template.

The sequence of the primer does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient if the primer has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer. Therefore, the primer in the present invention does not need to have a perfectly complementary sequence to the above-mentioned nucleotide sequence, which is a template, and it is sufficient that the primer has sufficient complementarity within a range capable of hybridizing to the gene sequence and acting as a primer. The design of such a primer can be easily carried out by a person skilled in the art with reference to the above-mentioned nucleotide sequence, for example, by using a program for primer design (for example, PRIMER 3 program).

As used herein, the term "probe" refers to a linear oligomer of natural or modified monomer or linkages and includes deoxyribonucleotides and ribonucleotides and can specifically hybridize to a target nucleotide sequence, Present or artificially synthesized. The probe of the present invention is preferably a single strand, and is an oligodioxyribonucleotide.

The nucleotide sequence specific to the present invention to be referred to in the preparation of the primer or probe can be found in Sequence Listing Nos. 1 and 2 to 3. Primers or probes can be designed with reference to the above sequences.

In the microarray of the present invention, the probe is used as a hybridizable array element and immobilized on a substrate. Preferred gases include, for example, membranes, filters, chips, slides, wafers, fibers, magnetic beads or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries, as suitable rigid or semi-rigid supports. The hybridization array elements are arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bound by UV on a polylysine coating surface. In addition, the hybridization array element may be coupled to the gas through a linker (e.g., ethylene glycol oligomer and diamine).

On the other hand, the sample DNA to be applied to the microarray of the present invention can be labeled and hybridized with the array elements on the microarray. Hybridization conditions can be varied. The detection and analysis of the hybridization degree can be variously carried out according to the labeling substance.

The identification kit of G. najuensis of the present invention can be carried out on the basis of hybridization. In this case, a probe having a sequence complementary to the nucleotide sequence of the above-mentioned specific genes of the present invention is used.

Hybridization-based analysis may be performed using a probe hybridized to the nucleotide sequence of the genes of the present invention to determine whether or not the gene belongs to G.

The label of the probe may provide a signal to detect hybridization, which may be linked to an oligonucleotide. Suitable labels include fluorescent moieties (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent moieties, magnetic particles, (P ³² and S ³⁵ ), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), joins, substrates for enzymes, heavy metals such as gold and antibodies, streptavidin , Haptens with specific binding partners such as biotin, digoxigenin and chelating groups. Markers can be generated using a variety of methods routinely practiced in the art such as the nick translation method, the Multiprime DNA labeling systems booklet (Amersham, 1989) and the kaination method (Maxam & Gilbert, Methods in Enzymology , 65: 499 (1986)). The label provides signals that can be detected by fluorescence, radioactivity, colorimetry, weighing, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, and nanocrystals.

The nucleic acid sample to be analyzed can be prepared using mRNA obtained from various biosamples. Said raw sample is preferably safflower juice. Instead of the probe, the cDNA to be analyzed may be labeled and subjected to a hybridization reaction-based analysis.

When a probe is used, the probe is hybridized with the cDNA molecule. In the present invention, suitable hybridization conditions can be determined by a series of procedures by an optimization procedure. This procedure is performed by a person skilled in the art in a series of procedures to establish a protocol for use in the laboratory. Conditions such as, for example, temperature, concentration of components, hybridization and washing time, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. The detailed conditions for hybridization are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization , Springer-Verlag New York Inc .; NY (1999). For example, high stringency conditions were hybridized at 65 ° C in 0.5 M NaHPO ₄ , 7% SDS (sodium dodecyl sulfate) and 1 mM EDTA, followed by addition of 0.1 x SSC / 0.1% SDS Lt; RTI ID = 0.0 > 68 C < / RTI > Alternatively, high stringency conditions means washing at < RTI ID = 0.0 > 48 C < / RTI > in 6 x SSC / 0.05% sodium pyrophosphate. Low stringency conditions mean, for example, washing in 0.2 ㅧ SSC / 0.1% SDS at 42 캜.

After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. The hybridization signal can be carried out in various ways depending on, for example, the type of label attached to the probe. For example, when a probe is labeled with an enzyme, the substrate of the enzyme can be reacted with the result of hybridization reaction to confirm hybridization. Combinations of enzymes / substrates that may be used include, but are not limited to, peroxidases (such as horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis- Acetyl-3,7-dihydroxyphenox), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2) , 2'-Azine-di [3-ethylbenzthiazoline sulfonate]), o -phenylenediamine (OPD) and naphthol / pyronin; (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1-phosphate, and ECF substrate; alkaline phosphatase and bromochloroindoleyl phosphate; Glucose oxidase and t-NBT (nitroblue tetrazolium) and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate.

According to a specific embodiment of the present invention, the identification kit of the present invention can be a gene amplification by a polymerase chain reaction.

The term "amplification" as used herein refers to a reaction that amplifies a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. (LCR) (see, for example, A Laboratory Manual , 3rd Ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822) 12,13), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA, WO 88/10315) (SEQ ID NO: 1), self-sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence primed polymerase chain reaction CP-PCR), U.S. Patent No. 4,437,975), random plasmids (AP-PCR), U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA), U.S. Patent No. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification (14,15), and loop-mediated isothermal amplification. LAMP) 16, but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR and thermal asymmetric interlaced PCR (TAIL-PCR) have been developed for specific applications. For more information on PCR, see McPherson, MJ, and Moller, SG PCR . BIOS Scientific Publishers, Springer-Verlag New York Berlin, Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.

When the identification kit of the present invention is carried out using a primer, a gene amplification reaction is carried out to investigate the degree of identity of the specific nucleotide sequence of the present invention.

Therefore, in principle, the present invention uses a mRNA in a sample as a template and performs a gene amplification reaction using a primer that binds to mRNA or cDNA.

To obtain mRNA, total RNA is isolated from the sample. The isolation of total RNA can be carried out according to conventional methods known in the art (see Sambrook, J. et al., Molecular Cloning , A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001); Tesniere , C. et al, Plant Mol Biol Rep, 9:..... 242 (1991); Ausubel, FM et al, Current Protocols in Molecular Biology, John Willey & Sons (1987); and Chomczynski, P. et al Anal. Biochem. 162: 156 (1987)). For example, TRIzol can be used to easily isolate total RNA in a cell. Next, cDNA is synthesized from the separated mRNA, and this cDNA is amplified. Since the total RNA of the present invention is isolated from a sample of Shin-myeon jujube, it has a poly-A tail at the end of mRNA, and cDNA can be easily synthesized using oligo dT primer and reverse transcriptase using this sequence property (see: PNAS USA, 85: 8998 ( 1988); Libert F, et al, Science, 244:.... 569 (1989); and Sambrook, J. et al, Molecular Cloning A Laboratory Manual, 3rd ed Cold Spring Harbor Press (2001)). Next, the synthesized cDNA is amplified through gene amplification reaction.

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-stranded structure. Conditions suitable nucleic acid hybridization to form such double-stranded structure is Joseph Sambrook, such as, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, etc., Nucleic Acid Hybridization , A Practical Approach , IRL Press, Washington, DC (1985).

A variety of DNA polymerases can be used in the amplification of the present invention, including the "Clenow" fragment of E. coli DNA polymerase I, the thermostable DNA polymerase and the bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus furiosus (Pfu) .

When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component. It is required to provide the reaction mixture such that the desired degree of amplification can be achieved, such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reaction without changing the conditions such as the addition of reactants.

In the present invention, annealing is carried out under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary with environmental variables.

The thus amplified cDNA of the specific nucleotide sequence of the present invention is analyzed by a suitable method to investigate the presence of the specific nucleotide sequence of the present invention. For example, the amplification reaction products described above are subjected to gel electrophoresis, and the resultant bands are observed and analyzed for the presence of the specific nucleotide sequence of the present invention.

The features and advantages of the present invention are summarized as follows.

(a) The present invention can provide a specific 16S rDNA nucleotide sequence of a new species of aquaculture genus inhabiting the southern western part of the Republic of Korea.

(b) The present invention can provide the nucleotide sequence of the CO1 gene specific to the newborn bacterium inhabiting the southern part of the Republic of Korea.

(c) The present invention can provide a nucleotide sequence of a specific ITS gene of a new species of a bacterium belonging to the genus Bombyx mori in the southwestern part of the Republic of Korea.

(d) The present invention can provide a kit for identifying a new kind of crab crab inhabiting the southern part of the South Korean region of the Republic of Korea.

Figures 1a and 1b show the entire dorsal and abdomen of a new shark 's head , G. najuensis . The shell is hexagonal. Figure 1a shows a female routine reference specimen. Figure 1B shows a male routine reference specimen. The photograph shows that the skin color of the male is changed after fixing the crab with anhydrous alcohol.
Figures 2a and 2b show the kangaroo mother care of G. najuensis . The arrow marks the newborn crab in the mother 's belly. Figure 2a shows that a newborn crab leaves the mother. Figure 2b shows that sends the whole life cycle in gwetel Fusa (Geothelphusa) paper fresh water environment. In other words, the embryo develops directly into the baby, and the female carries the newborn baby on the boat for a certain period of time.
FIGS. 3A and 3B show the result of multi-sequence alignment and UPGMA with tree root roots according to branch lengths. Figure 3A shows the result of multiple sequence alignment. FIG. 3B shows the results of UPGMA, which is based on Clustal W and visualized Boxshade's 16S rDNA homology nucleotide sequence (515 bp). White letters on black indicate very well-conserved nucleotide sequences, while black letters indicate low-conserved sequences. Numbers indicate nucleotide positions. The red background represents two unique nucleotide sequences of G. najuensis , among the nucleotide sequences of several species tested. G. dehaani (AB187570), G. sakamotoana (AB266174), G. ilan (AB625683), Apotamonautes hainanensis (AB428459), Sinopotamon baiyanense (AB428470), Stoliczia chaseni (AB290627), Nanhaipotamon wupingense (AB433548), Huananpotamon angulatum (AB428454) , And Indochinamon tannanti (AB428482) were used for multiple sequence alignment. Indochinamon tannanti (AB428482) was selected as the outgroup for analysis of the 16S rDNA nucleotide sequence.
Figures 4A and 4B show nucleotide sequence alignment and phantom numbers. Figure 4a shows nucleotide sequence alignment results. Figure 4b shows a phylogenetic tree based on the sequences of some gwetel Fusa (Geothelphusa) mitochondrial cytochrome oxidase subunit 1 gene, the genes (CO1) from Korea, Taiwan, and Japan. The background color expresses sequence similarity. White letters on black indicate very well-preserved nucleotide sequences. While the black letter indicates a low conserved nucleotide sequence. The red background represents four unique nucleotide sequences found only in the G. najuensis : KM507491 CO1 gene in the G. fusa species used in the experiment. G. dehaani (AB551393) and G. sakamotoana (AB266313) were found in Japan. G. minei (AB625727), G. tali (AB625716), G. eucriodonta (AB625703), G. miyazakii (AB625754), and G. fulva (AB625760) were found in Taiwan. Candidiopotamon rathbunae CO1 (AB433579) was used as an outgroup.
Figure 5 shows the comparison results of some COl amino acid sequences (219 amino acids) with respect to other genera by Clustal W and Boxshade. The background color represents a similar sequence. White letters on black indicate very well-preserved nucleotide sequences whereas black letters indicate low-conserved nucleotide sequences. Amino acids marked in gray shades are of similar polarity. The number indicates the amino acid position in the protein of mitochondrial cytochrome oxidase subunit 1 (CO1). The red background represents the unique amino acid sequence of G. najuensis among the tested crabs. Huananpotamon angulatum (AB433576), Candidiopotamon rathbunae (AB433579), Sinopotamon yangtsekiense (JF918815), Neotiwaripotamon whiteheadi (AB896766), Perbrinckia punctata (GQ289648), Mahatha ornatipes (GQ289663), Cylindrotelphusa steniops (GQ289639), Eriocheir hepuensis (FJ455506), and Telmessus acutidens (HM180916) was used for multiple sequence alignment. T. acutidens live in the oceans and rocks. E. hepuensis and T. acutidens were selected as outgroups.
Figure 6 shows the nucleotide sequence of ITS. The black letters on the yellow background indicate the nucleic acid sequence of the ITS1 region. The red letter indicates the 5.8S rDNA nucleotide sequence. The 5.8S rDNA nucleic acid sequence was determined based on the 5.8S rDNA nucleotide sequence of Epilobocera sinuatifrons , which is a genus buffalo in the Toro Negro State Forest of Puerto Rico, Central America. The black letters on the green background indicate the nucleotide sequence of the ITS2 region. The nucleotide sequence of the ITS1 and ITS2 regions is a very unique nucleotide sequence because no nucleotide sequences similar to each other have been found to date.

Materials and methods

Harvest area

The new specimens were collected from a small stream, one of the Yeongsan River tributaries belonging to Naju city in Jeollanamdo, southwest of the Korean Peninsula. The entire body was stored at 95% ethanol or -80 < 0 > C.

Molecular technology

Genomic DNA was isolated from liquid nitrogen by crushing whole crabs into fine powder. The DNA was purified from freshly collected specimens using the GeneAll Exgene cell SV kit (GeneAll, Seoul, Korea).

A partial region of the 16S rDNA gene, the cytochrome oxidase subunit 1 ( CO1 ) gene and the entire region of the ITS were selected for amplification by polymerase chain reaction (PCR) using the following primer sets: CrustCO1LP (GGTCAACAAATCATAAGATATTGG) and CrustCO1RP (Crutall and Fitzpatrick, 1996) were used for the mitochondrial CO1 gene (Former et al., 1994). Crustml16S1471LP (CCTGTTTANCAAAAACAT) and Crustml16S1472RP (AGATAGAAACCAACCTGG) were used for the mitochondrial 16S rDNA gene (TAAACTTCAGGGTGACCAAAAAATCA). The entire ITS region was selected and amplified by polymerase chain reaction (PCR) using the following primer set [CrustITSLP1 (GGAAGTAAAAGTCGTAACAAGG) and CrustITSRP1 (TTCAGTCGCCCTTACTAAGGGAATCC)] (Tang et al., 2003).

The PCR reaction mix included 5 [mu] L 10 [mu] buffer, 2.5 mM dNTP mix, and 5 units Taq polymerase (Genotech, Daejeon, Korea). The amplification program was performed for 20 minutes at 95 ° C, 30 seconds at 40-50 ° C, and 30 seconds at 72 ° C for 10 minutes at 72 ° C for extension after 25-30 cycles. The PCR products were purified and sequenced using an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA. USA).

Phylogenetic analysis

The nucleotide sequence was aligned and the phantom number was generated using the Multiple Sequence Alignment program (ClustalW, http://www.genome.jp/tools/clustalw/). Other nucleotide sequences were obtained from NCBI GenBank to compare phylogenetic relationships.

The nucleotide sequence generated by the study was submitted to register with GeneBank. The sequence of the mitochondrial small subunit ribosomal DNA gene (16S rDNA) and the cytochrome oxidase subunit 1 ( CO1 ) gene was constructed to confirm the genetic relationship of the separated G. najuensis . Some 16S rDNA genes, some CO1 genes, and two sets of data consisting of their amino acid sequences were compared and analyzed. Each set of data was compared using the default ClustalX (http://www.genome.jp/tools/clustalw/). Multiple sequence alignments of nucleotide and amino acid sequences were printed and shaded with the BOXSHADE 3.21 program (http://www.ch.embnet.org/software/BOX_form.html). Indochinamon tannanti (AB428482) was selected as the outgroup for analysis of the 16S rDNA nucleotide sequence. The entire ITS region of Fusanagus nessis does not have a similar nucleotide sequence to date.

result

Habitat and form

Similar to the habitat of G. dehaani (Okano et al., 2001), G. najuensis was also found in clear, clean and moderately-flowing freshwater habitats. The dorsal skin of the dorsal root is hexagonal, and the front-to-outer edge is medium-wide (Figs. 1A and 1B). The outline of the back skin is usually smooth, and the color of the umbrella Fusanage nessis is dark red. The female specimens were collected in September 2014 and showed particular characteristics of the Geothelphusa species, which has a juvenile crab (Fig. 2A). Figure 2B shows the moment when a young crab leaves the mother.

Tree

16S rDNA and CO1 genes were selected to establish genotypes of crabs (Former et al., 1994 Crandall and Fitzpatrick, 1996).

The 515-bp segment of 16S rDNA (GenBank accession No. KM507490) was amplified and aligned from a new sample of G. najuensis : the segment of the 16S rDNA sequence was high (71.9% AT) (T: 37.1 %, A: 34.8%, G: 18.5%, C: 9.7%) (FIG. 3A). The mutation of nucleotide sequence of 16S rDNA of the bacterium bacterium tested was widely distributed: the mutation density of 16S DNA of Fusanagus nissis of T. ganoderma was high (51 base of 515 = 9.9%). However, the mutation of the nucleotide sequence of 16S rDNA was the lowest between G. najuensis and G. dehaani (9 bases in 515 bases = 1.75%), one nucleotide in G. dehaani was added, and one nucleotide was removed. 16S rDNA gene sequence of G. najuensis metaphor is entirely different from the second 16S rDNA gene and the 20 nucleotides of the near G. sakamotoana to (515 bases of the 20 base = 3.9%). In G. sakamotoana , three nucleotides were added and two nucleotides were removed. This result supports that the new G. najuensis is included in Geothelphusa . Of the 10 16S rDNA sequences used in the experiments, 2 nucleotides of G. najuensis 16S rDNA (G at positions 249 and 298) were very distinct. This result suggests that T. nusanisis is an endemic species on the Korean peninsula.

A phylogenetic analysis of the 16S rDNA segment confirmed that the newly isolated one of seven genera ( Apotamonautes, Geothelphusa, Huananpotamon, Indochinamon, Nanhaipotamon, Sinopotamon , and Stoliczia ) belongs to Geothelphusa . Indochinamon tannanti (AB428482) was selected as the outgroup.

Two major branches of the system were found, of which the large branch contains G. najuensis as well as most species ( Geothelphusa, Apotamonautes, and Sinopotamon ). Apotamonautes hainanensis was collected from Hainan Island (Dai and Xing, 1993) and Sinopotamon baiyanense was collected from Hunan province cave in China. Although Sinopotamon baiyanense is twice as large, its overall appearance is similar to that of G. najuensis (Ng and Dai, 1997). Small line branches include Nanhaipotamon wupingense (AB433548) and Huananpotamon angulatum (AB428454). N. wupingense and H. angulatum are two species of shrimp benthos inhabiting elsewhere in China's Fusong Province (Shih et al., 2011a).

The 658-bp segment of the CO1 gene (GenBank accession No. KM507491) was also amplified from G. najuensis and high in AT (65.5%) (T: 37.2%, A: 28.3%, C: 18.5% , G: 16.0%). Four nucleotides in the CO1 gene sequence of Fusanage nissis from Ganoderma are highly characteristic in the eight species of Ganoderma species tested (C at position 100, 232, A at position 541, G at position 649). The CO1 gene sequence of Fusanage nissis differs from the CO1 gene of the nearest genetically-derived Fusanage nisus by 16 nucleotides (16 base of 658 base = 2.4%). The CO1 gene sequence of P. fujanaensis is 59 nucleotides different from the CO1 gene of the second closest genome of G. sakamotoana (59 base of 616 base = 9.6%).

It is important to study which species among the genus Geothelphusa is very similar to G. najuensis . There were two main branching branches in Gatortelpu (Fig. 4B). G. najuensis is more similar to that of Japan ( G. dehaani and G. sakamotoana ). Branches I include G. najuensis, G. dehaani and G. sakamotoana . The area in which G. sakamotoana exists is known as Okinawa-Jima in Japan (http://species-identification.org/species.php?species_group=crabs_of_japan&id=1621). The large system branch (Clade II) includes Geothelphusa species collected from Taiwan ( G. tali, G. eucriodonta, and G. miyazakii ) and the Yaeyama group in the southern Ryukyu archipelago of Japan (Shih et al., 2011b ). Although the nucleotide sequence of some CO1 genes in P. fusa najusis varies in the genus Thunberger Fusa, some amino acid sequences (219 amino acids) deduced from the CO1 gene in the genus Thunberger fusanage are completely conserved in 9 species of ganoderma fusatus Not). However, the amino acid sequence deduced as CO1 gene was not completely conserved in other genus. One of the amino acid residues (Ile, isoleucine, 127 amino acids) from Zugtelfus was not fully conserved in all nine different species used in the experiment, while the Val residue was strictly conserved. Ile belongs to Hemo-Cu oxidase I phase. Since this Ile residue belongs to the D-path domain in the major proton-transfer pathway in cytochrome oxidase subunit I, the Ile residue can exert an important function. It was also highly preserved in some arthropods, bees, bumblebees and citrus mites. Sequence analysis of the mitochondrial cytochrome oxidase subunit I (CO1) and mitochondrial 16S rDNA supports that the newly isolated crabs belong to the genera Ganoderma Fusia (FIGS. 3, 4 and 5).

discussion

In the present invention, we have reported a new specimen of Geothelphusa species collected from the southern western part of the peninsula (Fig. 1 and 2). We named it G. najuensis in the name of Naju city in South Korea. Its bark is hexagonal and the front-to-outer edges are moderately wide (Fig. 1). The shape of the sample is similar to G. dehaani . The specimens of Guapelle Pusanajus nessis were found in clear and clean, moderate flow freshwater habitats. The specimen is inhabited by small, short creeks in the southwestern part of Korea, one of the tributaries in the middle region of Jeollanam - do and Youngsan River.

A characteristic of raising newborn crabs was observed in the abdomen of female specimens collected in September 2014 (Fig. 2). This observation is a proof of direct development that hatches directly from egg to eggplant as a characteristic of freshwater crab characterized by the ability to complete an independent life cycle deviating from the marine environment.

The phylogenetic tree based on the 16S rDNA sequence was isolated from G. dehaani, G. sakamotoana, and G. Or to give a specific and showed a clearly separated by G. najuensis (Fig. 3B). G. dehaani and G. sakamotoana in the Japanese mainland and Okinawa-jima (http://species-identification.org/species.php?species_group=crabs_of_japan&id=1621), which are based on the nucleotide sequence of the CO1 gene, (Fig. 4).

This specification describes G. najuensis as a genuine jujube bush which was first discovered in Korea. Gatortelpusa Naju Nishis was collected from the Korean Peninsula, which is not included in the islands but on the Asian continent. This discovery is 168 years after White discovered G. dehaani in Japan for the first time. Therefore genus gwetel Fusa (Geothelphusa) not limited to the East island (tayion, Pinnacle Island, Ryuukyuu island and mainland Japan). However, they were not found in the Asian continent before. It is inferred that Geothelphusa species did not appear before the Asian continent and islands (Japan, Pinnacle and Ryukyu) were separated by sea or ocean. Therefore, it is believed that the gypsum fusanage nessis is separated from other gigas fusa species after the Ice Age. Moreover, the present invention is essential for the study of animal geography and ecological origins such as diagnosis, natural color, habitat and distribution.

conclusion

G. najuensis is the first freshwater crab collected from the Asian continent of the Geothelphusa species. It has a large number of shrimps and plays an important role in global freshwater ecology. Sea, ocean, and mountain are the main obstacles to the spread of gabardia fusia species that are resistant to saltwater. For this reason, it is considered that the spread of ganoderma pusanajus nessis in a small region of Korea can be limited and it can become an endemic species. In addition, the population of G. fusa najusisis is very small and limited to narrow streams. Therefore, G. fusanajus nessis is geographically restricted and adapts to ecologically defined habitats in cold winter. As a result, the protection of this species is urgently needed from the extreme crisis of extinction. Civil engineering, air pollution, traffic, habitat loss, national temperature rise, and population increase. It is probably endangered, such as Asian black bears, Korean leopards, Korean leopard cats, and endangered species such as Eurasian otters.

references

1. Crandall KA, Fitzpatrick JFJ, Crayfish molecular systematics: using a combination of procedures to estimate phylogeny. Systematic Biology 45: 1 ?? 26. (1996).

2. Daia , Xing D, A study on potamonautes from Hainan Island, China. Sinozoologia . 0 (10): 63-74, (1993).

3. Former O, Black M, Hoeh W, Lutz R, Vrijenhoek R, DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol. Biotech 3 (5): 294-299, (1994).

4. Ng NK, Dai AY, Sinopotamon baiyanense , a new species of cavernicolous potamid crab (Cristacea: Decapoda: Brachyura: Potamidae) from southern China. Raff Bull Zoo 45: 139-144, (1997).

5. Okano T, Suzuki H, Miura T, Comparative biology of two Japanese freshwater crabs G. exigua and G. dehaani (Decapota, Brachyura, potaymidae) J. Crustacean Biol . 20 (2): 299-314, (2001).

6. Segawa RD, Aotsuka T, The mitochondrial genome of the Japanese freshwater crab, Geothelphusa dehaani (Crustacea: Brachyura): evidence for its evolution via gene duplication. Gene 355: 28-39, (2005).

7. Shih H-T, Ng PKL, Naruse T, Shokita S, & Liu M-Y. Pleistocene speciation of freshwater crabs (Crustacea: Potamidae: Geothelphusa) from northern Taiwan and southern Ryukyus, as revealed by phylogenetic relationships. Zoologischer Anzeiger - A Journal of Comparative Zoology, 250, 457-471, (2011a).

8. Shih HT, Ng PKL, Chang HW, Systematics of the genus Geothelphusa from southern Taiwan: A molecular appraisal. Zoological Studies . 43: 561-570, (2004).

9. Shih HT, Zhou XM, Chen GX, Chien IC, Ng PKL, Recent vicarious and dispersal events affecting the phylogeny and biogeography of East Asian freshwater crab genus Nanhaipotamon (Decapoda: Potamidae). Mol Phylogenet Evol. 58 (3): 427-438, (2011b).

10. Yeo DCJ, Ng PKL, Cumberlidge N, Magalh ㅳ s C, Daniels SR & Campos MR, Balian EV, L ㅹ ㅺ C, Segers H & Martens K ed. "Global diversity of crabs (Crustacea: Decapoda: Brachyura) in freshwater". Hydrobiologia. Developments in Hydrobiology, ( Springer ) vol. 198, 595 (1): 275-286, (2008).

11. Tang B, Zhou K, Song D, Yang G, Dai A. Molecular systematics of the Asian mitten crabs, genus Eriocheir (Crustacea: Brachyura). Mol Phylogenet Evol . 29 (2): 309-16, (2003).

12. Wiedmann M, Wilson WJ, Czajka J, Luo J, Barany F, Batt CA. "Ligase chain reaction (LCR) - overview and applications." PCR Methods and Applications Feb; 3 (4): S51-64, (1994).

13. Barany F. "Genetic disease detection and DNA amplification using cloned thermostable ligase." Proc Natl Acad Sci US A. Jan 1: 88 (1): 189-93, (1991).

14. Tindall KR and Kunkel TA (1988). "Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase". Biochemistry 27 (16): 6008-13.

15.Coskun; Alsmadi, O "Whole genome amplification from a single cell: a new era for preimplantation genetic diagnosis ". Prenatal diagnosis 27 (4): 297? 302 (2007).

16. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T "Loop-mediated isothermal amplification of DNA". Nucleic Acids Res. 28 (12): E63, (2000).

<110> Industry foundation of chonnam national unversity <120> Nucleotide Sequences of a New Species Freshwater Crab. Naju crab,          Inhabiting the Naju city, Southwestern Region of Korea <130> pN150125 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 515 <212> DNA <213> 16S rDNA of Geothelphusa. najuensis <400> 1 cccctgattt taattaaagg gccgcagtat taataactgt gcaaaggtag cataatcatt 60 aggtttttaa ttggaatctt gtatgaatgg ttagacaaaa gagtaactct ctttatatta 120 attttgaatt taacttttaa gtgaaaaggc ttaaataagc taaggggacg ataagaccct 180 ataaaacttt acattgtagt tatattttat tgaatttata aataaaaaat ttaatttaat 240 tatttgttgt gttggggaga cataagtaaa atttatttta actgcttagt agtttatgac 300 aattattagt gataattttg tagaagatcc tttttgaaga ttagtaggtt aagttacttt 360 agggataaca gcgtaatttc ttttaagagt tcttatcgaa aaggaaggtt gcgacctcga 420 tgttgaatta aaaaatctat ataatgaaga ggttatataa gaaggtctgt tcgaccttta 480 aaattttaca tgatttgagt tcaaaccggt gtgag 515 <210> 2 <211> 658 <212> DNA <213> CO1 of Geothelphusa. najuensis <400> 2 tactttatat tttattctag gtgcttgagc tggtatagta ggaacttcat tgagcttaat 60 tattcgtgcc gaattaagtc aaccaggaag tcttattggc aacgaccaaa tttacaatgt 120 tgtagttact gctcatgctt ttgtaataat tttttttata gtaataccta ttataattgg 180 aggatttggc aactgacttt tacctcttat attaggagcc ccagatatag cctttccccg 240 aataaataat ataagatttt ggctccttcc tccttccttg actttacttt taataagagg 300 tatagtagaa agaggaattg gaacaggatg aaccgtatat cctcccttag ctgctgcaat 360 cgcccacgcc ggagcttcca ttgatatagg aatcttttct ttacatttag ctggagtttc 420 ctcaatttta ggcgcagtaa actttataac tacagtaatt aacatacgat catatggcat 480 aactatagat caaatacctt tatttgtttg agctattttt attacagtaa ttcttttact 540 actttcactt ccagtattag ccggcgcaat taccatatta ttaaccgatc gaaatttaaa 600 tacctctttt tttgatcctg ctggaggtgg agatcctatt ttataccagc atttattt 658 <210> 3 <211> 1515 <212> DNA <213> ITS of Geothelphusa. najuensis <400> 3 tttccgtagg tgaacctgcg gaaggatcat taccgtgctg ttgcacaaaa aaaacaggta 60 tcctaagaaa tcacgggcgg ccgggtgagg aagcttgact cactccctcc cggccggaga 120 gtggggaagg ggcggtcccc actgcccaca aattttcctc ccttctccta tgaggaggag 180 gcggggacgg acctctttca ccgtcgctgg cggggcagtg aacgggtatt ctgcatgcat 240 gctcatccct tggccgggcg cagtcctcgg caagtgggat caatgcattg gaatcagtac 300 tggagttgca gcagctgcag acacttgcac cgccagtcgg cgcacttggt taaacccttc 360 ccgggttgag agttttcaaa ccatgcacac tacgccttcc cacatcgtct cagggggcag 420 agacggcgga agtgtgtcgg gaaaacccga cgtaaaagta aaatacacaa ctcttaacgg 480 tggatcactc ggctcgtggg tcgatgaaga ccgcagcaag ctgcgtgtcg gtatgtgaat 540 cgcaagaata ccagatacat cgacaagtcg aacgcacatt gcggcggcgg cactctcatg 600 tgctgccgtc actcctacac gagggtcgga tacaaattta catgcatcgg ctttgccacc 660 gccggcgcgc ccctcgccac cgccacgcgg ggaggtgctg tacgcagctt gggtgaagct 720 ggtgctgcag tgatttctct tgcgtgagcg cgtcagttgc gaagggggtg cgtgagcgtt 780 atgtgtggca tcgaccgcat tggggagtct gccttgctta ctctggtaag cgaagagtgg 840 ttcccttaag gcgtgctgcc agccccgccc gccggttttt ccgcttctag tactagaagg 900 gattgctgcg tcggggtctc ccaagaagag tgcttgggag attggccgct aaggaccatg 960 agacacgttt gacagcttga gaacgagagt aacgggctgc tgctgctatt gccaccgggt 1020 cggtgtgtcg gctcttagag cggcacacgg caggcggtat ccctgtctct cgattcttgg 1080 atgagtttct accagctggc gttgtcgtcg ccgtccttca tatgctttga cggcattgtt 1140 ttcaatgcac gtctcctcgt caccggatcc caaagtggtt gctctgcata gcaagggggg 1200 acgagcggga ggcgaccggg tcggttctta ggcaaggtcc cggatcgcag cacccagagc 1260 tcggccgcag aagcgaccga tggtggagta ggttacacca tcaggaggag gctgctactc 1320 agtagtaagc cggagggacc gagagacgag ttgaggagct acagctcggc agcagagaaa 1380 gtactgtatg agaaaggctg aggagtcact cactcaagcc ttctgctgct gagcgctccg 1440 gtgtcgacct cgtgttaggg tagagtaccc gccaaattta agcatattaa taagcggagg 1500 aaaagaaacc aacag 1515

Claims (5)

16S rDNA of G. najuensis having the nucleotide sequence set forth in SEQ ID NO: 1.
A nucleic acid molecule encoding a mitochondrial cytochrome oxidase subunit 1 (CO1) of G. najuensis having the nucleotide sequence set forth in SEQ ID NO: 2.
A nucleic acid molecule encoding an internal transfer spacer (ITS) of G. najuensis having the nucleotide sequence set forth in SEQ ID NO: 3.
An identification kit of G. najuensis comprising a primer or a probe that specifically binds to the nucleic acid molecule of any one of claims 1 to 16S rDNA or any of claims 2 and 3.
5. The identifying kit according to claim 4, wherein the primer or the probe is used for a microarray or a polymerase chain reaction (PCR).

Images