KR20160089892A - Composition for the prevention and treatment of antiviral comprising extracts of crude drug complex - Google Patents

Abstract

The present invention relates to a composition comprising a mixed extract of Cnidium officinale MAKINO, Ledebouriella seseloides WOLFF., Angelica gigas Nakai, Paeonia lactiflora, Forsythia suspensa Vahl, peppermint leaves, Ephedra sinica, Erigeron canadensis L., Rheum palmatum, gypsum, Platycodonis Radix, Scutellaria baicalensis, Atractylodes macrocephala Koidzumi, Gardenia jasminoides, Schizonepeta tenuifolia var. japonica, ginger, talc, licorice, Epimedium koreanum Nakai, Lonicera japonica, Polygala tenuifolia and Aucklandia lappa Decne, as active ingredients. It is shown that the composition increases cell survival, reduces the number of intracellular virus and inhibits proliferation of intracellular virus, in the cell infected with virus, such as Vesicular Stomatitis Virus (VSV), Newcastle disease virus (NDV), Enterovirus 71 and foot-and-mouth disease virus. The mixed extract according to the present invention is more significantly effective for inhibiting viral infection as compared to an extract of Paeonia lactiflora or an extract of a partial combination of the above medicinal herbs. Therefore, the composition according to the present invention is useful for an antiviral composition against Vesicular Stomatitis Virus, Newcastle disease virus, Enterovirus 71 and foot-and-mouth disease virus.

Description

Composition for the prevention and treatment of antiviral comprising extracts of crude drug complex}

The present invention is a mixed extract of Cheongung, Bangpung, Angelica, Peony, Yeongyo, Peppermint, Ephedra, Mangcho, Rhubarb, Gypsum, Gilgyeong, Golden, Baekchul, Sanchija, Hyeonggae, Ginger, Talc, Licorice, Yinyanggwak, Geumeunhwa, Wonji and Mokhyang Antiviral against Vesicular Stomatitis Virus (VSV), Newcastle disease virus (NDV), Enterovirus 71 and Foot-and-mouth disease virus contained as active ingredients It relates to a pharmaceutical composition for, and a health functional food.

Vesicular Stomatitis Virus (VSV) is a viral pathogen that causes vesicular stomatitis, and is broadly classified into two serotypes (Indiana type and New Jersey type). It is known to be stronger than the Indiana type. Since it occurs mainly in the Americas, it is also called a New World disease. It occurs intermittently in the United States, but occurs every year since 2004. Southern Mexico, Central American countries, northern South America, and Brazil are representative regions where vesicular stomatitis frequently occurs.

Because vesicular stomatitis cannot be differentiated from diseases such as Foot-and-Mouth Disease, Vesicular Exanthema, and Swine Vesicular Disease, it is not possible to differentiate it from the clinical symptoms in which blisters are formed. Detailed diagnosis is essential. If there are obvious clinical symptoms, it is determined by diagnostic methods such as virus isolation or reverse transcriptase chain reaction method for the causative agent, but if there are no clinical symptoms, it is difficult to separate the causative agent, so it is diagnosed by a serological test method. When infected with vesicular stomatitis virus, specific antibodies are produced in the blood after 5-8 days in host animals. Methods for detecting them include complement binding, neutralization, and enzyme-linked immunoassay. Bullous stomatitis, which occurs in many types of livestock, is a malignant infectious disease that is classified as List A along with foot-and-mouth disease by the International Waters Office (O.I.E.), and is a disease that causes enormous economic damage to the country of origin. Livestock susceptible to bullous stomatitis include almost all mammals such as horses, cattle, sheep, goats, and pigs, and cold-blooded animals have also been confirmed to be infectious. The mortality rate due to bullous stomatitis is very low, but when it occurs in ruminants or pigs, blisters are formed on the epithelium of the tongue, lips, oral mucosa, nipples and hoof canals, which greatly reduces the value of livestock. In addition, the bullous stomatitis virus can infect humans and has been reported to cause mild cold-like diseases.

Newcastle disease virus (NDV) is a virus that causes Newcastle Disease (ND). Newcastle disease is one of the 15 most important livestock diseases internationally. It is an acute febrile respiratory disease and is infected by non-immune poultry. % It is a statutory type 1 epidemic that dies. Newcastle disease has a malignant Asian type caused by a highly pathogenic virus and an American type caused by a weak pathogenic virus. Korea is a commercial area for Newcastle disease virus, and there are potential risk factors for Southeast Asia, China, and Taiwan, which have active trade with Korea, since various Newcastle disease viruses are prevalent.

The infection route of Newcastle disease in poultry is through air, oral, etc., such as secretions, feces, respiratory excretion, and direct contact with infected bird bodies. The main symptoms include cough, shortness of breath, loss of appetite, and green diarrhea after yellowish-white diarrhea. There are paralysis, convulsions, turning movements, twisting of the head, wings, and legs, and turbidity of air sacs. Newcastle disease in poultry occurs at all ages, regardless of age, is highly contagious, and is a terrifying type 1 legal infectious disease in poultry that causes 100% mortality when infected with unvaccinated chickens. However, the occurrence is not only increasing continuously, but also is causing great damage to poultry farms because it is in a national trend. To this day, there is no known cure or cure for Newcastle disease.

Enterovirus (Enterovirus) belongs to the genus Enterovirus of the family Picornaviridae family (Picornaviridae family) is a very small icosahedral icosahedral filmless virus having a size of 24-30 nm. It is classified as an RNA virus because it has a single-stranded RNA as its genome. In the case of enterovirus, the capsid, which is the protein shell surrounding the genome of the virus, is composed of 12 pentamers, and each pentamer is composed of four polypeptides of VP1, VP2, VP3, and VP4. It consists of 5 protomers. Enteroviruses that cause diseases in humans and animals are largely divided into poliovirus and non-polio enteroviruses, and non-polio enteroviruses are again coxsackie virus A, coxsackie virus B, ecovirus, And other enteroviruses.

Poliovirus is the causative agent of polio, and its incubation period is 3 to 35 days, and it occurs frequently in children under 15 years of age, especially 1 to 3 years old. Ecovirus mainly infects children 1-4 years old and causes various diseases such as aseptic meningitis, upper respiratory tract infection, rash, other febrile diseases, and diarrhea in infants. Coxsackie virus is further divided into groups A and B (23 species in group A and 6 species in group B). The incubation period of the coxsackie virus, which causes various diseases, is 2 to 9 days. It causes herpes stomatitis and hand, foot and mouth disease, and Coxsack B virus causes various diseases such as heart, pleura, pancreas, and liver, causing lateral chest pain, myocarditis, and pericarditis. Both groups A and B can cause aseptic meningitis and paralysis by affecting the meninges and motor nerve units. Among the classifications of enteroviruses, other enteroviruses are simply numbers given to strains newly isolated since 1969 for the convenience of classification regarding a number of types of enteroviruses. Among other enteroviruses, enterovirus 70 is the causative virus of acute hemorrhagic conjunctivitis, and it was greatly prevalent in Ghana, Africa in 1969. Since the Apollo 11 landing on the moon in the United States around this time, the infection caused by this virus is called Apollo eye disease. I also did. In addition to meningitis, enterovirus 71 commonly causes hand-foot and mouth disease or herpes stomatitis, and rarely causes serious complications in the brain or lungs, leading to death. The enterovirus 71 was greatly epidemic in Taiwan from 1997 to 1998, and also in Korea in 2000.

Foot-and-mouth disease (FMD) is a viral bullous disease that infects two-hoofed animals and is characterized by rapid replication and transmission. Due to its economic importance, this disease is classified as a List disease by the International Waters Office (OIE), and it is acting as a very important factor in the cross-border trade of livestock products. The pathogen is a single-stranded bipolar RNA virus, belonging to the genus Piconaviride (Piconaviridae) and Apthovirus, and is classified into 7 different serotypes (A, O, C, Asia1, SAT 1, SAT2 and SAT3). have.

Currently, enormous efforts are being made to develop antiviral drugs worldwide. Lamivudine for the treatment of human immunodeficiency virus-1 and hepatitis B, gancyclovir for the treatment of herpes virus infection, and respiratory syncytial virus ( respiratory syncytial virus) and infectious diseases, but in emergencies, ribavirin, which is used for various viral infections, is licensed and marketed, and rimantadine, a substance similar to amantadine, which is licensed for the treatment of influenza A virus. ), as well as artificially synthesized zanamivir (Relenza) and oseltamivir (TAMIFLU™) as inhibitors of neuraminidase of influenza virus are licensed and commercially available. However, zanamivir has a drawback that requires inhalation and intravenous administration, and oseltamivir can be administered orally, but it is pointed out as a drawback due to recent reports of the emergence of resistant viruses and side effects such as vomiting and dizziness when oral administration (Ward P. et al., J. Antimicrob. Chemother., 55 (supp1), p.i5-i21, 2005). Therefore, there is a need to develop an antiviral agent containing a natural substance that is safe without side effects along with vaccines and therapeutic agents.

Accordingly, the inventors of the present invention were researching to develop virus-derived diseases such as vesicular stomatitis virus, Newcastle disease virus, Enterovirus 71 and foot-and-mouth disease virus derived from natural products. , Peppermint, Ephedra, Forgotten Cho, Rhubarb, Gypsum, Gilgyeong, Golden, Baekchul, Sanchija, Hyeonggae, Ginger, Talc, Licorice, Yinyanggwak, Geumeunhwa, Wonji and Mokhyang are mixed extracts to increase cell survival in cells infected with the above viruses. , It was confirmed that the number of viruses in the cell was reduced, it was confirmed that it inhibits the proliferation of the virus in the cell, and by confirming that the mixed extract of the present invention exhibits a remarkable effect in inhibiting viral infection compared to the peony extract or some combination extracts The present invention was completed by revealing that the mixed extract can be usefully used as an active ingredient of an antiviral composition against vesicular stomatitis virus, Newcastle disease virus, Enterovirus 71, and foot-and-mouth disease virus.

An object of the present invention is a mixture of cheonggung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, mangcho, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold silver flower, raw paper and mokhyang Against Vesicular Stomatitis Virus (VSV), Newcastle disease virus (NDV), Enterovirus 71 and Foot-and-mouth disease virus containing the extract as an active ingredient It is to provide an antiviral pharmaceutical composition, and a health functional food.

In order to achieve the above object, the present invention is cheonggung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, mangcho, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold and silver coins, Vesicular Stomatitis Virus (VSV), Newcastle disease virus (NDV), Enterovirus 71, and Foot-and-mouth disease virus (Foot-and-mouth disease) containing mixed extracts of raw paper and muk-hyang as active ingredients. disease virus).

In addition, the present invention provides a health functional food for preventing and improving any one virus selected from the group consisting of vesicular stomatitis virus, Newcastle disease virus, enterovirus 71 and foot-and-mouth disease virus containing the mixed extract as an active ingredient.

In addition, the present invention is a pharmaceutical composition for the prevention and treatment of any one viral disease selected from the group consisting of vesicular stomatitis, Newcastle disease, hand, foot and mouth disease, meningitis, herpes stomatitis and foot-and-mouth disease containing the mixed extract as an active ingredient Provides.

In addition, the present invention is a health functional food for preventing and improving any one viral disease selected from the group consisting of vesicular stomatitis, Newcastle disease, hand, foot and mouth disease, meningitis, herpes stomatitis and foot-and-mouth disease containing the mixed extract as an active ingredient. Provides.

Cheongung, windbreak, angelica, peony, Yeongyo, peppermint leaves, ephedra, forget-me-not, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold and silver flower, wonji and mokhyang mixed extracts of the present invention Compositions contained as active ingredients include Vesicular Stomatitis Virus (VSV), Newcastle disease virus (NDV), Enterovirus 71, and Foot-and-mouth disease virus. It was confirmed that the virus increases cell survival and decreases the number of intracellular viruses in the infected cells, and it was confirmed that it inhibits the proliferation of intracellular viruses, and the mixed extract of the present invention is compared with the extract of the peony extract or some combination of the virus infection. It can be usefully used as an antiviral composition against vesicular stomatitis virus, Newcastle disease virus, Enterovirus 71, and foot-and-mouth disease virus by confirming that it exhibits a remarkable effect in inhibition.

FIG. 1 is a diagram showing the results of observing with a fluorescence microscope the fluorescence that the virus replicates in cells infected with Vesicular Stomatitis Virus (VSV) after treatment with the mixed extract of the present invention.
2 is a diagram showing cell survival and the number of viruses present in cells in cells infected with vesicular stomatitis virus after treatment with the mixed extract of the present invention. *: The experimental results are the results of independent experiments three times, analyzed by Student's t-test and judged to be statistically significant when the p value is less than 0.05.
Figure 3 is a diagram showing the result of observing with a fluorescence microscope the fluorescence exhibited while the virus replicates in cells infected with the Newcastle disease virus (NDV) after treatment with the mixed extract of the present invention.
4 is a diagram showing the number of viruses present in the cells by measuring cell survival and M mRNA of the virus in cells infected with Newcastle disease virus after treatment with the mixed extract of the present invention. *: The experimental results are the results of independent experiments three times, analyzed by Student's t-test and judged to be statistically significant when the p value is less than 0.05.
5 is a diagram showing cell survival in cells infected with Enterovirus 71 (EV71) after treatment with the mixed extract of the present invention in photographs and graphs.
Figure 6 is a diagram showing the result of observing with a fluorescence microscope the fluorescence of the virus replicated in cells 12 hours after infecting the Newcastle disease virus after treating the mixed extract of the present invention, the peony extract, and the extract of <Comparative Example 1> .
FIG. 7 is a diagram showing the results of observing with a fluorescence microscope the fluorescence that the virus replicates in cells 24 hours after infecting the Newcastle disease virus after treating the mixed extract of the present invention, the peony extract, and the extract of <Comparative Example 1>. .
8 is a diagram showing the number of viruses present in the cells by measuring the M mRNA of the virus in cells infected with Newcastle disease virus after treatment with the mixed extract of the present invention, the peony extract, and the extract of <Comparative Example 1>.

Hereinafter, the present invention will be described in detail.

The present invention is a mixed extract of Cheongung, Bangpung, Angelica, Peony, Yeongyo, Peppermint, Ephedra, Mangcho, Rhubarb, Gypsum, Gilgyeong, Golden, Baekchul, Sanchija, Hyeonggae, Ginger, Talc, Licorice, Yinyanggwak, Geumeunhwa, Wonji and Mokhyang It provides an antiviral pharmaceutical composition containing as an active ingredient.

The mixed extract is cheonggung, windbreak, angelica, peony, Yeongyo, peppermint leaves, ephedra, forget-me-not, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, gold silver flower, original paper and mokhyang Is preferably extracted by mixing at a mixing ratio of 0.5 to 5 parts by weight, respectively, and the mixed extract is preferably prepared by extraction with water, _{a lower alcohol of C 1} to C ₂ , or a mixed solvent thereof, and the lower alcohol is methanol Or it is preferable that it is ethanol.

The virus is selected from the group consisting of Vesicular Stomatitis Virus (VSV), Newcastle disease virus (NDV), Enterovirus 71 and Foot-and-mouth disease virus. It is preferred, but is not limited thereto.

Cheongung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, gypsum, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold and silver flower, wonji and mokhyang mixed extracts of the present invention Viral infection compared to peony extract alone or some combinations of mixed extracts (Cheongung, Bangpung, Angelica, Peony, Yeongyo, Mint leaves, Ephedra, Forget-me-not, Rhubarb, Gypsum, Gilgyeong, Golden, Baekchul, Sanchija, Hyeonggae, Ginger, Talc and Licorice) It is characterized by showing a remarkable effect on inhibition.

In a specific embodiment of the present invention, the inventors of the present invention are Cheongung, Windbreak, Angelica, Peony, Yeongyo, Peppermint, Ephedra, Mangcho, Rhubarb, Gypsum, Gilgyeong, Gold, Baekchul, Sanchija, Hyeonggae, Ginger, Talc, Licorice, Yinyanggwak, Gold and Silver Coin , By preparing a mixed extract of raw paper and mukhyang, and as a result of confirming the inhibitory effect of the mixed extract of the present invention against vesicular stomatitis virus infection by a fluorescence microscope and trypan blue staining method, the present invention was compared to when only the virus was infected. When the virus was infected after the treatment of the mixed extract of the virus, it was confirmed that the fluorescence exhibited by the replication of the virus decreased (FIG. 1), compared to the case of infecting only the virus, the cells were infected with the virus after treatment with the mixed extract of the present invention. It was confirmed that the survival was increased and the number of viruses present in the cell decreased (FIG. 2).

In addition, the present inventors confirmed the Newcastle disease virus infection inhibitory effect of the mixed extract of the present invention by fluorescence microscopy, trypan blue staining method, and RT-PCR analysis. When infected with the virus, it was confirmed that the fluorescence indicated by replication of the virus decreased (FIG. 3), and when the virus was infected after treatment with the mixed extract of the present invention compared to when only the virus was infected, the cell survival increased, and the presence in the cell It was confirmed that the proliferation of the virus was inhibited (FIG. 4).

In addition, the present inventors confirmed the inhibitory effect of enterovirus 71 infection of the mixed extract of the present invention by fluorescence microscopy and trypan blue staining method. As the concentration of the mixed extract of the present invention increases Accordingly, it was confirmed that the cell survival was increased (FIG. 5).

In addition, the present inventors confirmed the Newcastle disease virus infection inhibitory effect of the peony extract and the extract of <Comparative Example 1> in addition to the mixed extract of the present invention by fluorescence microscopy and RT-PCR analysis, and confirmed by fluorescence microscopy 12 hours after infection with Newcastle disease virus When compared to the extract of the peony extract and the <Comparative Example 1>, it was confirmed that the fluorescence exhibited by the virus replication was significantly reduced when the virus was infected after the treatment of the mixed extract of the present invention (FIG. 6), and the Newcastle disease virus was When confirmed with a fluorescence microscope 24 hours after infection, the fluorescence became stronger than when confirmed after 12 hours, and when the virus was infected after treatment with the mixed extract of the present invention compared to the peony extract and the extract of <Comparative Example 1> It was confirmed that the fluorescence exhibited as the virus replicates was significantly reduced (FIG. 7 ), and when confirmed by RT-RCR analysis, the virus was treated with the mixed extract of the present invention compared to the extract of the peony extract and the <Comparative Example 1>. When infected, it was confirmed that the proliferation of the virus present in the cells was significantly suppressed (FIG. 8).

Therefore, the mixture of cheonggung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, mangcho, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold silver flower, raw paper and mokhyang The extract confirmed that viruses such as vesicular stomatitis virus, Newcastle disease virus, enterovirus 71, and foot-and-mouth disease virus increased cell survival in infected cells, decreased the number of intracellular viruses, and inhibited the proliferation of intracellular viruses. , It is useful as an antiviral composition for vesicular stomatitis virus, Newcastle disease virus, Enterovirus 71 and foot-and-mouth disease virus by confirming that the mixed extract of the present invention exhibits a remarkable effect in inhibiting viral infection compared to the extract of the peony extract or some combination of the present invention. Can be used.

The composition of the present invention may further include suitable carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions.

The composition of the present invention may be administered orally or parenterally, and when administered parenterally, it is preferable to select an injection method for external use of the skin or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. And, it is not limited thereto.

The composition of the present invention may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injectable solutions, respectively, according to a conventional method. have. Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, Methylcellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oils. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient, such as starch, calcium carbonate, in a mixture of saengjihwang, bokryeong, ginseng and honey. carbonate), sucrose or lactose, and gelatin. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as humectants, sweeteners, fragrances, and preservatives may be included. . Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The preferred dosage of the composition of the present invention varies depending on the condition and weight of the patient, the degree of disease, the form of the drug, the route and duration of administration, but may be appropriately selected by those skilled in the art. However, for a desirable effect, the composition is preferably administered at 0.0001 to 1 g/kg per day, preferably 0.001 to 200 mg/kg, but is not limited thereto. The administration may be administered once a day, or may be divided several times. The above dosage does not limit the scope of the present invention in any way.

In addition, the present invention is a mixture of Cheongung, Bangpung, Angelica, Peony, Yeongyo, Peppermint, Ephedra, Mangcho, Rhubarb, Gypsum, Gilgyeong, Gold, Baekchul, Sanchija, Hyeonggae, Ginger, Talc, Licorice, Yinyanggwak, Geumeunhwa, Wonji and Mokhyang Provides antiviral health functional foods containing extracts as active ingredients.

The mixed extract is cheonggung, windbreak, angelica, peony, Yeongyo, peppermint leaves, ephedra, forget-me-not, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, gold silver flower, original paper and mokhyang Is preferably extracted by mixing at a mixing ratio of 0.5 to 5 parts by weight, respectively, and the mixed extract is preferably prepared by extraction with water, _{a lower alcohol of C 1} to C ₂ , or a mixed solvent thereof, and the lower alcohol is methanol Or it is preferable that it is ethanol.

The virus is preferably selected from the group consisting of vesicular stomatitis virus, Newcastle disease virus, enterovirus 71, and foot-and-mouth disease virus, but is not limited thereto.

Cheongung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, gypsum, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold and silver flower, wonji and mokhyang mixed extracts of the present invention Viral infection compared to peony extract alone or a combination of some combinations (Cheongung, Bangpung, Angelica, Peony, Yeongyo, Mint leaves, Ephedra, Forgotten, Rhubarb, Gypsum, Gilgyeong, Golden, Baekchul, Sanchija, Hyeonggae, Ginger, Talc and Licorice) It is characterized by showing a remarkable effect on inhibition.

Cheongung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, gypsum, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold and silver flower, wonji and mokhyang mixed extracts of the present invention It was confirmed that viruses such as vesicular stomatitis virus, Newcastle disease virus, Enterovirus 71, and foot-and-mouth disease virus increase cell survival and decrease the number of intracellular viruses in infected cells, and inhibit the proliferation of intracellular viruses. It is useful as an antiviral health functional food against vesicular stomatitis virus, Newcastle disease virus, Enterovirus 71 and foot-and-mouth disease virus by confirming that the mixed extract of the present invention exhibits a remarkable effect in inhibiting viral infection compared to the peony extract or some combination extracts. Can be used.

In order to use the mixed extract of the present invention for antiviral use as described above, it can be prepared by various methods known in the field of food science or pharmaceuticals, and is mixed with itself or a food pharmaceutically acceptable carrier, excipient, diluent, etc. It can be prepared in any form of food that can be consumed as a food. It is preferably in the form of beverages, pills, granules, tablets or capsules.

The health functional food of the present invention may further include ingredients that are commonly added during food production and are food wise acceptable. For example, when prepared as a beverage, one or more components may be additionally included in citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, etc. in addition to the mixed extract of the present invention.

The amount that can be included as an active ingredient of the health functional food according to the present invention may be appropriately selected according to the age, sex, weight, condition, and symptoms of disease of the person who wants the antiviral health functional food, and preferably, based on adult 1 It is good to contain about 0.01g to 10.0g per day, and it is possible to obtain an antiviral effect by ingesting a health functional food having such a content.

In addition, the present invention is a mixture of Cheongung, Bangpung, Angelica, Peony, Yeongyo, Peppermint, Ephedra, Mangcho, Rhubarb, Gypsum, Gilgyeong, Gold, Baekchul, Sanchija, Hyeonggae, Ginger, Talc, Licorice, Yinyanggwak, Geumeunhwa, Wonji and Mokhyang It provides a pharmaceutical composition for preventing and treating viral diseases containing the extract as an active ingredient.

The mixed extract is cheonggung, windbreak, angelica, peony, Yeongyo, peppermint leaves, ephedra, forget-me-not, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, gold silver flower, original paper and mokhyang Is preferably extracted by mixing at a mixing ratio of 0.5 to 5 parts by weight, respectively, and the mixed extract is preferably prepared by extraction with water, _{a lower alcohol of C 1} to C ₂ , or a mixed solvent thereof, and the lower alcohol is methanol Or it is preferable that it is ethanol.

The viral disease is preferably selected from the group consisting of vesicular stomatitis, Newcastle disease, hand, foot and mouth disease, meningitis, herpes stomatitis, and foot-and-mouth disease, but is not limited thereto.

Cheongung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, gypsum, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold and silver flower, wonji and mokhyang mixed extracts of the present invention Viral infection compared to peony extract alone or a combination of some combinations (Cheongung, Bangpung, Angelica, Peony, Yeongyo, Mint leaves, Ephedra, Forgotten, Rhubarb, Gypsum, Gilgyeong, Golden, Baekchul, Sanchija, Hyeonggae, Ginger, Talc and Licorice) It is characterized by showing a remarkable effect on inhibition.

Cheongung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, gypsum, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold and silver flower, wonji and mokhyang mixed extracts of the present invention It was confirmed that viruses such as vesicular stomatitis virus, Newcastle disease virus, Enterovirus 71, and foot-and-mouth disease virus increase cell survival and decrease the number of intracellular viruses in infected cells, and inhibit the proliferation of intracellular viruses. Pharmaceutical for the prevention and treatment of viral diseases against vesicular stomatitis virus, Newcastle disease virus, Enterovirus 71 and foot-and-mouth disease virus by confirming that the mixed extract of the present invention exhibits a remarkable effect in the inhibition of viral infection compared to the peony extract or some combination extracts. It can be usefully used as a composition.

In addition, the present invention is a mixture of Cheongung, Bangpung, Angelica, Peony, Yeongyo, Peppermint, Ephedra, Mangcho, Rhubarb, Gypsum, Gilgyeong, Gold, Baekchul, Sanchija, Hyeonggae, Ginger, Talc, Licorice, Yinyanggwak, Geumeunhwa, Wonji and Mokhyang Provides health functional foods for preventing and improving viral diseases containing extracts as active ingredients.

The mixed extract is cheonggung, windbreak, angelica, peony, Yeongyo, peppermint leaves, ephedra, forget-me-not, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, gold silver flower, original paper and mokhyang Is preferably extracted by mixing at a mixing ratio of 0.5 to 5 parts by weight, respectively, and the mixed extract is preferably prepared by extraction with water, _{a lower alcohol of C 1} to C ₂ , or a mixed solvent thereof, and the lower alcohol is methanol Or it is preferable that it is ethanol.

The viral disease is preferably selected from the group consisting of vesicular stomatitis, Newcastle disease, hand, foot and mouth disease, meningitis, herpes stomatitis, and foot-and-mouth disease, but is not limited thereto.

Cheongung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, gypsum, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold and silver flower, wonji and mokhyang mixed extracts of the present invention Viral infection compared to peony extract alone or a combination of some combinations (Cheongung, Bangpung, Angelica, Peony, Yeongyo, Mint leaves, Ephedra, Forgotten, Rhubarb, Gypsum, Gilgyeong, Golden, Baekchul, Sanchija, Hyeonggae, Ginger, Talc and Licorice) It is characterized by showing a remarkable effect on inhibition.

Cheongung, windbreak, angelica, peony, Yeongyo, peppermint, ephedra, mangcho, rhubarb, gypsum, gilgyeong, gold, baekchul, sanchija, hyeonggae, ginger, talc, licorice, yinyanggwak, gold silver flower, wonji and mokhyang mixed extracts of the present invention It was confirmed that viruses such as vesicular stomatitis virus, Newcastle disease virus, enterovirus 71, and foot-and-mouth disease virus increase cell survival and decrease the number of intracellular viruses in infected cells, and inhibit the proliferation of intracellular viruses. Health function for preventing and improving viral diseases against vesicular stomatitis virus, Newcastle disease virus, Enterovirus 71 and foot-and-mouth disease virus by confirming that the mixed extract of the present invention exhibits a remarkable effect in the inhibition of viral infection compared to the peony extract or some combination extracts. It can be usefully used as a food.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

< Example 1> Cheongung, windbreak, angelica, peony, Yeongyo , Peppermint , Ephedra, forget-me-not, rhubarb , Plaster, Gilkyung , Golden, baekchul, sanchija, Mold , Ginger, Talc, Licorice, Yinyanggwak, Gold and Silver Flower, Raw Paper and Mokhyang Mixed Extract

All herbal medicines were purchased domestically and used as samples. After adding 1 ℓ of water to about 49 g of a herbal medicine having the composition of Table 1 below, it was allowed to stand at room temperature for 1 hour. Thereafter, hot water extraction was performed at 100° C. for 3 hours to obtain a mixed extract of about 100 ml volume, and the mixed extract was lyophilized to obtain about 9.6 g of a lyophilisate. The mixed extract or a lyophilized product thereof was used in the present invention. Hereinafter, it is described as the mixed extract of the present invention.

Raw material name Weight(g) Yin Yang Gwak 1.69 Gold and silver coins 1.69 Original paper 1.69 elecampane 1.69 Heavenly palace 1.69 Windproof 1.69 Angelica 1.69 Peony 1.69 Yeongyo 1.69 Peppermint 1.69 Ephedra 1.69 sulphate of soda 1.69 rhubarb 1.69 gypsum 2.62 Gilkyung 2.62 Gold 2.62 Baekchul 1.31 Mountain gardener 1.31 Mold 1.31 ginger 4.6 talc 6.37 licorice 4.5

<Comparative Example 1> Preparation of the firmament, wind, Angelica, peony, yeongyo, bakhayeop, ephedra, Glauber's salt, rhubarb, gypsum, gilgyeong golden baekchul, sanchija, mold opening, ginger, licorice extract and the talc

All herbal medicines were purchased domestically and used as samples. After adding 1 ℓ of water to about 43 g of a herbal medicine having the composition of Table 2 below, it was allowed to stand at room temperature for 1 hour. Thereafter, the extract was extracted with hot water at 100° C. for 3 hours to obtain a volume of about 100 ml of the extract, and the extract was lyophilized to obtain about 10.5 g of a lyophilisate. The extract or a lyophilisate thereof was used in the present invention. Hereinafter, it is described as the mixed extract of <Comparative Example 1>.

Raw material name Weight(g) Heavenly palace 1.69 Windproof 1.69 Angelica 1.69 Peony 1.69 Yeongyo 1.69 Peppermint 1.69 Ephedra 1.69 sulphate of soda 1.69 rhubarb 1.69 gypsum 2.62 Gilkyung 2.62 Gold 2.62 Baekchul 1.31 Gardenia 1.31 Mold 1.31 ginger 4.5 talc 6.37 licorice 4.5

< Comparative example 2> Preparation of peony extract

Peony was purchased domestically and used as a sample. After adding 1 ℓ of water to about 50 g of peony, it was left at room temperature for 1 hour. Thereafter, hot water extraction was performed at 100° C. for 3 hours to obtain a volume of about 100 ml of peony extract, and the peony extract was lyophilized to obtain about 8 g of a lyophilisate. The peony extract or a lyophilized product thereof was used in the present invention. Hereinafter, it is described as a peony extract.

< Example 2> cell culture

DMEM containing 10% Fetal bovine serum (FBS), 100 U/ml penicilin and 100 μg/ml streptomycin ( It was cultured using Dulbecco's modified Eagle's medium (Invitorgen Life Tehchnologies). The cells were cultured in an incubator under conditions of 37° C., 95% humidity, and 5% CO ₂ , and subcultured every 2 to 3 days with a new culture solution.

< Example 3> of the mixed extract of the present invention Vesicular stomatitis virus ( VSV - GFP ) Confirmation of infection suppression

<3-1> Confirmation of virus infection inhibition using fluorescence microscope

The effect of the mixed extract of the present invention on inhibiting vesicular stomatitis virus infection was confirmed.

Specifically, RAW 264.7 cells were dispensed in a 24-well plate at ^{a concentration of 1×10 5} cells/well, cultured in DMEM medium containing 10% FBS for 24 hours, and mixed prepared in Example <1-1>. After the extract was treated with 0.9 mg/ml, it was further cultured for 12 hours. Then, after 1 MOI infection with vesicular stomatitis virus VSV-GFP, it was further cultured for 12 hours. At this time, 1000 U/ml IFN-β (interferon-β) was used as a positive control. This was observed through a fluorescence microscope.

As a result, as shown in FIG. 1, it was confirmed that the fluorescence exhibited while the virus replicates was decreased when the virus was infected after treatment with the mixed extract of the present invention compared to when only virus was infected (FIG.

<3-2> Trypan blue dyeing( trypan Confirmation of virus infection inhibition using blue staining) method

In order to confirm the inhibitory effect of the mixed extract of the present invention against vesicular stomatitis virus infection, cell survival and the number of viruses present in the cells were confirmed using a trypan blue staining method.

Specifically, the cells cultured in the same manner as in Example <3-1> were removed from the cell medium and treated with 0.05% trypsin-EDTA to suspend the cells, and phosphate buffered saline (PBS) was added per well. Cells were collected by adding an appropriate amount, and then centrifuged for 5 minutes at 2,000 rpm. After removing the supernatant and leaving only the cells, 1 ml of PBS was added and mixed well. The cell suspension and 0.5% trypan blue (Gibco BRL) were mixed in the same amount, treated for 2 minutes, and then the living cells were counted using a microscope. At this time, 1000U/ml IFN-β was used as a positive control. Cell viability was expressed as a percentage of the medium.

As a result, as shown in FIG. 2, it was confirmed that the cell survival increased and the number of viruses present in the cell decreased when the virus was infected after treatment with the mixed extract of the present invention compared to when only the virus was infected (FIG. 2 ). .

< Example 4> Newcastle disease virus of the mixed extract of the present invention ( NDV - GFP ) Confirmation of infection suppression

<4-1> Confirmation of virus infection inhibition using fluorescence microscope

The effect of the mixed extract of the present invention on inhibiting infection with Newcastle disease virus was confirmed after infection with Newcastle disease virus (NDV-GFP) in the same manner as in Example <3-1>.

As a result, as shown in FIG. 3, it was confirmed that the fluorescence exhibited while the virus replicates was decreased when the virus was infected after treatment with the mixed extract of the present invention compared to when only the virus was infected (FIG. 3).

<4-2> Trypan blue Dyeing and Reverse transcription Polymerase chain reaction (RT- PCR , reverse transcription-polymerase chain reaction)

In order to confirm the inhibitory effect of the mixed extract of the present invention against Newcastle disease virus infection, cell survival was confirmed using trypan blue staining, and the number of viruses present in the cell was confirmed using RT-PCR analysis.

Specifically, trypan blue staining was performed using the same method as in Example <3-2>, and RT-PCR analysis was performed by storing cells cultured by the method described in Example <3-1> at 4°C. After washing with, the cells were separated using a scraper. The separated cells were centrifuged at 1,200 rpm and 4° C. for 2 minutes to discard the supernatant to obtain a pellet. Then, total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, Valencia, CA) with the protocol provided by the manufacturer. RNA dissolved using DEPC-treated distilled water was measured for absorbance with an A260/280 ratio (Versa Max microplate reader, Molecular Devices) to confirm purity and concentration. Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed to confirm the amount of transcribed mRNA expression. Raise the same amount of RNA (dt) ₁₅ Primer After synthesizing with cDNA, PCR was performed using a Power SYBR Green PCR Master Mix (Applied Biosystems) reagent and a 7500 Fast Real time-PCR system (Applied Biosystems) PCR machine. PCR conditions were graphs showing the relative band intensity between Matrix(M) protein and GAPDH at 50°C for 20 seconds and 95°C for 10 minutes. The primers used in the RT-PCR are shown in Table 3 below.

purpose
gene Primer designation order direction Sequence number APMV-1 M APMV-1M_F AGTGATGTGCTCGGACCTTC Forward direction SEQ ID NO: 1 APMV-1M_R CCTGAGGAGAGGCATTTGCTA Reverse SEQ ID NO: 2 GAPDH GAPDH_F TGACCACAGTCCATGCCATC Forward direction SEQ ID NO: 3 GAPDH_R GACGGACACATTGGGGGTAG Reverse SEQ ID NO: 4

As a result, as shown in FIG. 4, it was confirmed that when the virus was infected after treatment with the mixed extract of the present invention compared to when only the virus was infected, the cell survival increased and the proliferation of the virus present in the cell was inhibited (FIG. 4 ).

< Example 5> of the mixed extract of the present invention Enterovirus 71( EV71 ) Confirmation of infection suppression

The effect of inhibiting Enterovirus 71 infection of the mixed extract of the present invention was confirmed.

Specifically, HeLa cells were aliquoted into a 24-well plate at ^{a concentration of 1×10 5} cells/well and cultured in DMEM medium containing 10% FBS for 24 h, and the mixed extracts of the present invention were 0.5, 1, 2%, respectively. After treatment, it was further incubated for 12 hours. Then, enterovirus 71, EV71, was infected with 1 MOI and then cultured for 12 hours. At this time, 1000 U/ml IFN-β was used as a positive control. This was observed through a microscope, and cell survival was confirmed by staining with trypan blue in the same manner as in Example <3-2> using the cultured cells.

As a result, as shown in FIG. 5, when the virus was infected after the treatment of the mixed extract of the present invention compared to the case of infecting only the virus, the concentration of the mixed extract of the present invention increased. Accordingly, it was confirmed that the cell survival was increased (FIG. 5).

< Example 6> Newcastle disease virus of the mixed extract of the present invention and other extracts ( NDV - GFP ) Confirmation of infection suppression

<6-1> Confirmation of virus infection inhibition of various extracts 12 hours after virus infection

After treating each extract at two concentrations in the same manner as in Example <3-1>, the effect of the mixed extract of the present invention, the peony extract, and the extract of <Comparative Example 1> on inhibiting Newcastle disease virus infection ( NDV-GFP) was infected and confirmed 12 hours later.

As a result, as shown in FIG. 6, it was confirmed that the fluorescence exhibited while the virus replicates was significantly reduced when the virus was infected after treatment with the mixed extract of the present invention compared to the peony extract and the extract of <Comparative Example 1> (FIG. 6).

<6-2> Confirmation of virus infection inhibition of various extracts 24 hours after virus infection

After treating each extract at two concentrations in the same manner as in Example <3-1>, the effect of the mixed extract of the present invention, the peony extract, and the extract of <Comparative Example 1> on inhibiting Newcastle disease virus infection ( NDV-GFP) was infected and confirmed after 24 hours.

As a result, as shown in FIG. 7, the fluorescence became stronger than 12 hours after infection with the Newcastle disease virus, and when the virus was infected after treatment with the mixed extract of the present invention compared to the extract of Peony extract and <Comparative Example 1> It was confirmed that the fluorescence exhibited while the virus replicated was significantly reduced (FIG. 7).

<6-3> RT- PCR Confirmation of virus infection suppression using assay

In order to confirm the inhibitory effect of the mixed extract of the present invention, the peony extract, and the extract of <Comparative Example 1> against Newcastle disease virus infection, each extract was treated at two concentrations in the same manner as in Example <4-2>, The number of viruses present in the cells was confirmed using RT-PCR analysis.

As a result, as shown in FIG. 8, when only the Newcastle disease virus was infected as 100%, when the peony extract was treated, the proliferation of the virus was reduced by about 75%, and the extract of <Comparative Example 1> was treated. It was confirmed that the proliferation of virus was reduced by about 55%, whereas the proliferation of virus by about 100% was decreased when the mixed extract of the present invention was treated (FIG. 8). Accordingly, it was confirmed that the proliferation of the virus present in the cells was significantly suppressed when the virus was infected after treatment with the mixed extract of the present invention compared to the peony extract and the extract of <Comparative Example 1>.

<110> KOREA INSTITUTE OF ORIENTAL MEDICINE <120> Composition for the prevention and treatment of antiviral comprising extracts of crude drug complex <130> PN16286 <150> KR 14/134,095 <151> 2014-10-06 <160> 4 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APMV-1M_F <400> 1 agtgatgtgc tcggaccttc 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> APMV-1M_R <400> 2 cctgaggaga ggcatttgct a 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 3 tgaccacagt ccatgccatc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 4 gacggacaca ttgggggtag 20

Claims (10)

Extract of mixed extract of ginseng, persimmon, persimmon, persimmon, liquorice, ginseng, ginseng, persimmon, mackerel, mangrove, rhubarb, gypsum, gyeonggyeong, A pharmaceutical composition for the prevention and treatment of Newcastle disease virus (NDV). [3] The method according to claim 1, wherein the mixed extract is selected from the group consisting of citron, windbreak, Angelica keiskei, alfalfa, mulberry leaf, camphor, mangrove, rhododendron, gypsum, , Gingkohwa, raw paper, and wheat gum are respectively mixed and extracted at a mixing ratio of 0.5 to 5 parts by weight. The pharmaceutical composition according to claim 1, wherein the mixed extract is prepared by extracting with water, a C ₁ to C ₂ lower alcohol, or a mixed solvent thereof. 4. The pharmaceutical composition according to claim 3, wherein the lower alcohol is methanol or ethanol. Extract of mixed extract of ginseng, persimmon, persimmon, persimmon, liquorice, ginseng, ginseng, persimmon, mackerel, mangrove, rhubarb, gypsum, gyeonggyeong, A health functional food for the prevention and improvement of Newcastle disease virus (NDV). [Claim 6] The method according to claim 5, wherein the mixed extract is selected from the group consisting of citron, windbreak, Angelica keiskei, alfalfa, mulberry, mahwang, ganoderma, rhubarb, gypsum, , Gingkohwa, raw paper and moss are mixed and extracted at a mixing ratio of 0.5 to 5 parts by weight, respectively. Extract of mixed extract of ginseng, persimmon, persimmon, persimmon, liquorice, ginseng, ginseng, persimmon, mackerel, mangrove, rhubarb, gypsum, gyeonggyeong, A pharmaceutical composition for the prevention and treatment of Newcastle disease. [Claim 7] The method according to claim 7, wherein the mixed extract is added to 1 part by weight of a yin-yang, , Gingkohwa, raw paper, and wheat gum are respectively mixed and extracted at a mixing ratio of 0.5 to 5 parts by weight. Extract of mixed extract of ginseng, persimmon, persimmon, persimmon, liquorice, ginseng, ginseng, persimmon, mackerel, mangrove, rhubarb, gypsum, gyeonggyeong, A health functional food for prevention and improvement of Newcastle disease. [Claim 11] The method according to claim 9, wherein the mixed extract is selected from the group consisting of citron, windbreak, Angelica keiskei, alfalfa, rhizomes, mackerel, mangrove, rhododendron, gypsum, , Gingkohwa, raw paper and moss are mixed and extracted at a mixing ratio of 0.5 to 5 parts by weight, respectively.

Images