KR20160087419A - Marker for discrimination of fagopyrum tataricum and triticum aestivum using chloroplast sequence and detecting method - Google Patents

Abstract

The present invention relates to a marker to discriminate between Fagopyrum tartaricum and Triticum aestivum. Furthermore, according to the present invention, provided is a primer set to discriminate between Fagopyrum tartaricum and Triticum aestivum. In addition, the present invention relates to a method for discriminating between Fagopyrum tartaricum and Triticum aestivum, which comprises the following steps: isolating genomic DNA from a target sample; using the isolated genomic DNA as a template, and using the primer set to perform a polymerase chain reaction (PCR), thereby amplifying a target sequence; and identifying an amplified product. Furthermore, the present invention relates to a quantitative detection method of Fagopyrum tartaricum and Triticum aestivum. The method for discriminating between Fagopyrum tartaricum and Triticum aestivum allows people to check the varieties and mixing ratio of Fagopyrum tartaricum and Triticum aestivum which are included in a processed buckwheat product.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for distinguishing between wheat buckwheat and wheat using a chloroplast base sequence and a method for distinguishing between wheat buckwheat and wheat,

The present invention relates to a process for the production of wheat semolina ( Fagopyrum tartaricum ) and wheat ( Triticum aestivum ), a primer set for amplifying the marker, and a detection method using the primer set.

Consumers are showing a strong interest in quality labeling for food safety. Composition and quality labeling for food are indispensable for consumers to judge and select food quality. Buckwheat has been processed into a variety of food products through various processing processes and is circulating in the market. Examples of representative buckwheat processed products include buckwheat noodles using buckwheat, buckwheat tea, buckwheat noodles using bitter buckwheat, and buckwheat tea. However, whether or not the processed product contains 100% buckwheat content can not be known without backtracking the manufacturing process. That is, there is a possibility that wheat flour is mixed with buckwheat in addition to buckwheat. However, there is no qualitative or quantitative discrimination technology therefor, and therefore, a molecular labeling method which is the most effective assay method is needed.

Thus, RFLPs (Restriction Fragment Length Polymorphisms) have been developed using the difference in nucleotide sequence length caused by mutation of restriction enzyme recognition sites in the chromosome. However, this method requires the use of radioactive isotopes. Thereafter, a randomly amplified polymorphic DNA (RAPD) method has been developed as a nucleic acid fingerprinting method using PCR (Polymerase Chain Reaction). In the PCR method, a small oligonucleotide composed of 10 to 20 nucleotides (hereinafter referred to as a "primer") is annealed with DNA or RNA of an organism, and then a heat-resistant DNA polymerase It is a way to lose. This requires only a small amount of DNA (1-50 ng) compared to other methods, and has the advantage of being able to confirm the results easily and quickly. Among these methods, the RAPD method has the disadvantage that the reproducibility is low because the nonspecific PCR product is amplified. The AFLP (Amplified Fragment Length Polymorphism) method is a method for detecting a high DNA polymorphism, The SSR (Single Sequence Repeat) method is a method for analyzing a supersampler in an individual by preparing a PCR primer based on nucleotide sequence information in a microsatellite region, which is a DNA repeat sequence, The number of SSR markers developed in rice is increasingly used for genetic mapping of high-density genes, and the number of SSR markers developed in rice is increasing. Is not sufficient.

On the other hand, the In / del (insertion or deletion) marker maintains the advantage of exhibiting polymorphism when amplified by a PCR reaction and complements the disadvantage of the SSR marker which is not sufficient for high density gene mapping. It is a method to make PCR primer based on insertion or deletion of base sequence between cultivars through sequence analysis.

Korean Patent Laid-Open Publication No. 2012-0123360 discloses a method for qualitatively and quantitatively detecting a bovine germ wheat. However, until now there has been no description of a molecular marker for distinguishing wheat from bitter buckwheat. Accordingly, the inventors of the present invention have invented In / del markers for distinguishing between wheat and bitter buckwheat to determine whether or not bitter buckwheat and wheat flour are mixed in the processed buckwheat.

Korean Patent No. 2012-0123360

The object of the present invention is to provide a process for the production of bitter buckwheat ( Fagopyrum tartaricum ) and wheat ( Triticum aestivum ).

Another object of the present invention is to provide a primer set for distinguishing between wheat buckwheat and wheat.

It is still another object of the present invention to provide a method for qualitatively and quantitatively detecting bitter buckwheat and wheat.

In order to achieve the above object, SEQ ID NOS: 3 and 4; SEQ ID NOS: 5 and 6; SEQ ID NOS: 7 and 8; ( Fagopyrum tartaricum ) and wheat ( Triticum aestivum ). < / RTI >

As used herein, the term " bitter buckwheat " refers to " wheat " (scientific name: Triticum aestivum ), the scientific name of which is Fagopyrum It is tataricum . About 20 kinds of buckwheat species are distributed on the earth including cultivars and wild species. The cultivars usually consist of two kinds of buckwheat (buckwheat) and bitter buckwheat. It is usually buckwheat (sweet buckwheat) which is introduced in Korea and used until now to grow and is sometimes called buckwheat. Bitter buckwheat (bitter buckwheat) is a species that is naturally grown or cultivated in China and Nepal. The scientific name is Fagopyrum tartaricum , also known as tartar buckwheat.

In an embodiment of the present invention, the primers are selected from the group consisting of the bitter buckwheat ( Fagopyrum tartaricum ) and wheat ( Triticum aestivum ). < / RTI >

The marker may be an In / del marker. The term " In / del (Insertion Deletion) marker " refers to a site where insertion or deletion of a base occurs in the buckwheat diacetate, and is used as a molecular indicator for distinguishing wheat buckwheat from wheat according to the present invention. Can be used in combination with In / del or Indel in the present specification.

For the analysis of the entire chloroplast genome sequence of bitter buckwheat, it is possible to complete chloroplast genetic map by performing next generation sequencing (NGS). This process can be performed by extracting whole genomic DNA of bitter buckwheat and assembling the chloroplast genome to create a contig. The assembled conic can be used as a reference to wheat, as reported in the gene bank, to predict and structure the gene.

Specifically, the present invention relates to a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 and 2; SEQ ID NOS: 3 and 4; SEQ ID NOS: 5 and 6; SEQ ID NOS: 7 and 8; ( Fagopyrum tartaricum ) and wheat ( Triticum aestivum ). < / RTI > The primer set may include forward and reverse primers for amplifying the In / del marker. More specifically, a primer set for distinguishing between bitter buckwheat and wheat comprises a primer set capable of discriminating between wheat and bitter buckwheat using a wheat and a buried buckwheat dielectric insert / deletion (In / del, Insertion and Deletion) , Preferably a primer set capable of amplifying the gene so as to distinguish between wheat and bitter buckwheat.

As used herein, the term "primer " refers to a single stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

When PCR amplification is performed using the In / del (insertion deletion) marker of the present invention and a primer for amplifying the marker, the polymorphism is exhibited, thereby making up for the shortcomings of the SSR marker which is not sufficient for high density gene mapping, It has the advantage that it is easy to distinguish bitter buckwheat.

Further, according to the present invention,

i) isolating the genomic DNA from the sample of interest; ii) performing PCR (polymerase chain reaction) using the separated genomic DNA as a template and using the primer set; And iii) identifying the amplified PCR product of step ii). ≪ / RTI > The method of the present invention may further comprise: iv) analyzing the identification product and analyzing whether the buckwheat and wheat used in the target sample are present alone or in admixture.

When the method of the present invention is used, it is possible to distinguish between wheat buckwheat and wheat, specifically wheat and bitter buckwheat contained in food raw materials or processed foods can be specifically and qualitatively detected. The method of the present invention can also detect whether wheat and bitter buckwheat are present singly or in admixture in a sample of interest.

Specifically, the method of the present invention comprises isolating genomic DNA from a sample of interest. In an embodiment of the present invention, the target sample may be a sample for analyzing whether wheat buckwheat and wheat are singly or mixed together, preferably a food for analyzing wheat buckwheat and wheat singly or mixed together, Preferably, it may be a processed buckwheat to analyze whether the bitter buckwheat and wheat are singly or in combination. As used herein, the term "processed buckwheat" includes all processed foods made from buckwheat, preferably including bitter buckwheat and / or processed goods made from wheat.

Extraction of the genomic DNA in the above method can be carried out using phenol / chloroform extraction method, SDS extraction method (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB separation method (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), or commercially available DNA extraction kits.

Using the separated genomic DNA as a template, amplification reaction can be performed using the primer set described above to amplify the target sequence. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used. The PCR can be carried out using a PCR reaction mixture containing various components known in the art necessary for the PCR reaction. The PCR reaction mixture includes a proper amount of DNA polymerase, dNTP, PCR buffer solution and water in addition to the genomic DNA extracted from ginseng to be analyzed and the primer set provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl2, KCl, and the like.

The amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material can be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as 32P or 35S is added to the PCR reaction solution, the amplification product is synthesized and the radioactivity is incorporated into the amplification product, so that the amplification product can be labeled as radioactive. One or more sets of primers used to amplify the target sequence are as described above.

The method of the present invention comprises the step of identifying said amplification product. The identification of the amplification products can be performed by gel electrophoresis of the amplification products in the case of In / del markers. Electrophoresis can be performed by agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product.

The present invention also relates to a method for detecting genomic DNA comprising: i) separating genomic DNA from a sample of interest; ii) performing real-time PCR using the separated genomic DNA as a template and using the primer set of claim 2; And ii) measuring the fluorescence signal in the real-time PCR amplification product to analyze whether or not bitter buckwheat and wheat are mixed; And a method for quantitatively detecting bitter buckwheat and wheat.

The DNA amplification may be performed using real time PCR. The real-time PCR can monitor the PCR amplification product in real time to enable accurate quantification of the amplification product, and can measure the intensity of the fluorescence to determine the amount of the PCR amplification product.

In an embodiment of the present invention, real-time PCR was carried out using the above method, so that bitter buckwheat and wheat incorporation could be detected quantitatively.

The detection limit of the quantitative PCR of the present invention may be about 2 pg to 20 pg.

The present invention also provides a kit for distinguishing between wheat buckwheat and wheat comprising the primer of the present invention. The kit may include a reagent for performing an amplification reaction and a restriction enzyme as necessary, and the reagent for performing the amplification reaction may include a heat-resistant DNA polymerase, dNTPs, and a buffer. The dNTP mixture may include dATP, dCTP, dGTP, dTTP, and the heat-resistant DNA polymerase may be a commercially available heat-resistant DNA polymerase such as Taq DNA polymerase or Tth DNA polymerase. In addition, the kit of the present invention may further include a user's manual describing optimal reaction performing conditions.

The present invention also provides a composition for distinguishing between wheat buckwheat and wheat comprising the primer set. Wherein said composition comprises at least one of SEQ ID NOS: 1 and 2; SEQ ID NOS: 3 and 4; SEQ ID NOS: 5 and 6; SEQ ID NOS: 7 and 8; Lt; / RTI >

In the embodiment of the present invention, by performing the PCR using the primer of the present invention and the above method, it was confirmed that the specific bands of bitter buckwheat and wheat were detected, so that two buckwheat could be discriminated at the same time. In addition, by using the PCR method of the present invention using buckwheat noodles, a processed bitter buckwheat commercially available in domestic market, it was possible to qualitatively and quantitatively analyze wheat and bitter buckwheat mixed in the processed products.

When the method of distinguishing the markers, the primers and the wheat from the bitter buckwheat of the present invention is utilized, the kinds and contents of wheat and bitter buckwheat contained in the main buckwheat processed products can be confirmed. Therefore, producers can prevent unintentional incorporation of buckwheat in advance, thereby improving the reliability of the product to the consumer, and QC (quality control) of the processed buckwheat of the producer.

Figure 1 shows chloroplast genetic map of bitter buckwheat according to the present invention and four regions of Indel markers with a wheat chloroplast genome (Marker area marking with arrows, numbers 1 to 8).
2 shows electrophoretic results of wheat buckwheat and wheat using five Indel markers and a PCR method according to an embodiment of the present invention (WT_01, WT_02, WT_03, WT_04, WT_05: Indel marker, M: 100 bp DNA marker ; T: bitter buckwheat; W: wheat).
FIG. 3 shows the result of differentiating between wheat buckwheat and wheat mixed sample using four kinds of Indel markers and PCR method according to the embodiment of the present invention (1: 9 (bitter buckwheat 10%: wheat 90%), 2: 8 50% wheat, 50% wheat), 3: 7 (bitter buckwheat 30%: wheat 70%), 4: 6 (bitter buckwheat 40% , 6: 4 (bitter buckwheat 60%: wheat 40%), 7: 3 (bitter buckwheat 70%: wheat 30%), 8: 2 (bitter buckwheat 80% %: Wheat 10%)).
4 is a result of checking the DNA detection limit using the WT_02 and WT_04 markers according to the embodiment of the present invention (WT_02, WT_04: bitter buckwheat and wheat markers)
Figure 5 shows the quantitative PCR conditions for bitter buckwheat (top) using the WT_02 marker and the amount of bitter buckwheat quantitative PCR (bottom) using the WT_04 marker according to embodiments of the present invention.
6 shows the results of quantitative PCR of bitter buckwheat using the WT_02 marker according to the embodiment of the present invention.
Figure 7 shows the results of quantitative PCR of wheat using the WT 04 marker according to an embodiment of the present invention.
8 is a result of discriminating whether wheat buckwheat and wheat were mixed in the processed product (noodle) using WT_04 marker and PCR according to the embodiment of the present invention (A: 30% of wheat buckwheat and 70% of wheat flour, B: 100% noodles).

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example  One: Bitter buckwheat  And wheat primer  Design and Marker  Selection

For the present invention, wheat ( Triticum ) registered at the gene bank (http://www.ncbi.nlm.nih.gov) aestivum (NC_002762) and the chloroplast gene of bitter buckwheat (KM201427). The bitter buckwheat was composed of 159,599 bp, while the wheat was 134,545 bp, indicating a difference of 25,054 bp. In addition, it was found that various in / del were present as a result of analysis of chloroplast genomes between two species. In order to distinguish indel from agarose gel, in / del of 100 bp or more was selected and 5 in / del were selected as shown in Fig. The five in / del regions are mainly inter-genic regions ranging from 85 bp to 258 bp (Table 1). In order to distinguish between wheat buckwheat and wheat among these five in / del, the primers were prepared to amplify five regions (Table 2) after comparing nucleotide sequences (Table 2 to Table 4).

Primer information to amplify the In / del marker on the chloroplast genome of bitter buckwheat and wheat Marker name position Sequence (5 'to 3') expected size (bp) Forward Reverse Wheat Bitter buckwheat
(Tartari buckwheat) WT_01 trnK, rps16 TTCATCCAAATGTGTAAAAGA GAACTGTTTATGATATTTTAA 708 894 WT_02 pSBK, trn S TAGCCTTTGTTTGGCAAGCTGCTGTAAGTTT TACCGAGGGTTCGAATCCCTCTCTTTCCG 685 572 WT_03 trn L GGGGATATGGCGAAATCGGTAGACG TGGGGATAGAGGGACTTGAACCCTC 673 588 WT_04 trnF, ndhJ TGAAAATCCTCGTGTCACCA AATTTTATGAAATACAAGATGCT 518 776 WT_05 petG, trn P TTCTATTTGGAATCGTCTTAGG TGGGATGTAGCGCAGCTTGGTAGCGCGT 509 600

In the above table,

Primer sequence for WT_01 marker amplification: forward primer (SEQ ID NO: 1), reverse primer (SEQ ID NO: 2);

Primer sequence for WT_02 marker amplification: forward primer (SEQ ID NO: 3), reverse primer (SEQ ID NO: 4);

Primer sequence for WT_03 marker amplification: forward primer (SEQ ID NO: 5), reverse primer (SEQ ID NO: 6);

Primer sequence for WT_04 marker amplification: forward primer (SEQ ID NO: 7), reverse primer (SEQ ID NO: 8);

Primer sequence for WT_05 marker amplification: forward primer (SEQ ID NO: 9), reverse primer (SEQ ID NO: 10); to be.

The gene sequence in the in / del region of bitter buckwheat and wheat (primer sequence is underlined; bold, italic: In / del region) Marker location Base sequence Bitter buckwheat wheat WT_01
trn_K ~ rps16
TTCATCCAAATGTGTAAAAGA CCCTAGCCGCACTTAAAAGCCGAGTACTCTACCGTTGAGTTAGCAACCCAAA AAGAGTATAAAATACAATCGAGAT CAAAAAAAAGAAAGTTTTATAAT AAAAAACAGATCAACTGACAATCCAAGTAACAATACAA GAAATTAAAAAATAAA AAAATTCTAGACCACTTCTTAGATATTCTTATCGTTATATATATTTT TTAAAATAT CATAAACAGTTC TTCATCCAAATGTGTAAAAGA TTAAAATATCATAAACAGTTC

WT_02
psbK to trn_S
TAGCCTTTGTTTGGCAAGCTGCTGTAAGTTTT CGATGAGATTCAAAATATTGTCCTATCGTATAAACTCGCGATTTCATTTTCAACTATAAAAAGTCTTGGATAGCCTCGAAAAATGGGAATCAATTCCTTTCTCGTTCTAACAAGAATTTCCGTGAAAGACCCTGTGAGGTTTTCCACAAAAATTGTGGGCAGGAAAGCCCTTTTTTATATTTGATACAAATCCTAATACTTAACAAAACAAATAAATTAATTTTTTTTTTCGAGTTACAGAAACTACTAAAATTCGCGATGTCAAAGTAAAAACTGTATATATGGGGGAATCTATTCTCTTTTTTCCACAAAAAGATCTTGGAGATTGTGTAATGCTTACTCTCAAACTCTTCGTTTACACAGTAGTGATATTCTTTGTTTCTCTCTTCATTTTCGGATTTCTATCTAATGACCCAGGACGTAATCCTGGACGGGAAGAATAAAAGAAGAGTTTCTTTTTATTCCTAAAAAAATTATAAAGATAAATAAAATAGTAAATCACCAACAGAAA CGG AAAGAGAGGGATTCGAACCCTCGGTA & Lt ; RTI ID =

Marker location Base sequence Bitter buckwheat wheat WT_03
trnL
GGGGATATGGCGAAATCG GAGGGTTCAAGTCCCTCTATCCCCA GGGGATATGGCGAAATCG GTAGACGCTACGGACTTGATTGTATTGAGCCTTGGTATGGAAACCTGCTAAGTGGTAACTTCCAAATTCAGAGAAACCCTGGAATTAAAAAAGGGCAATCCTGAGCCAAATCCGTGTTTTGAGAAAACAAGGGGTTCTCGAACTAGAATACAAAGGAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATCGAGTTAATTACGTTGTGTTGTTAGTGGAATTCCTTCTAATTCTAAATTAGAGAAAGAGGGG TTTTATACCTTAT ACATTTAATAAACACGTATAGATACTGACATAGCAAACGATTAATCACAGAACTCATATTATATTATAATTATAATA TAGGTTCTTTATCTTTTTTAAAAATGAAATTAGAAATGATA ATGATTATGAAATAAAAAACTCATAAAAACTCATATCATAATTTTTTTTCATTATTGTGAATCCACTCCAATCGAATATTGAATAATCAAATTCTTCAATTCAAATTCAAAGTTTTCGAGATCTTTAAAAAAGTGGATTAATCGGACGAGGACAAAGAGAGAGTCCCATTCTACATGTCAATACTGACAACAATGAAATTTCTAGTAAAAGGAAAATCCGTCGACTTTATAAGTTGT GAGGGTTCAAGTCCCTCTATCCC CA WT_04
trnF to ndhJ
TGAAAATCCTCGTGTCACCA GTTCAAACCTGGTTCCTGGCACATGATTCATTTTGATGAGTAGCGACTTTACAAACAAATTAATTGATATGGATCGATATTCATTGCACATATGTAACTTATTTCTTTTCTCTCGATGTCTAGAGATATACCCCACCTATAAAAATAGATGGGTAACGAATATATCAAAAGATGTAAAAGAGTTAGGTTTTCTTTTCGTTTTTTATTTGTTGTTTATTCTGTGTCTCTTCTCATTGAAAAAGAATATGACTTCTTCATGCGGATTCGAAAAAGAGGTGTAATTTGTTAAATTAGTTGCAAGACGCGAAAAATAGGGGAGTTAAGGTAAAGGATAAAAAT AGACAAGATGTATCTCAGATACAGTACAAATAGAACGC GACCTCCTCTCATTTATTTTTTTTATTCTATTTCTGTATTTTCCCCTACATTACGTGACTTTCTACAGAACATCCAAGTGGTGTTCGATGTTCGAGGTACAAAATTCATGATCCAATTTTTTTTTTAATTCTATTAGCTCGGCTAATTCAAAACA AAAGTATCTTCCCAACTTTCAAATTTCAATGAATTCCTAATTTTATTTTTTGCTTTTTTAACCAACCTAATCCGAATAAAATGTCAACTACTCCGATTG TTTGCTCTAGAGCAGAGTGTACAAAAATGACTTATACTTATAATCTATATTTGTTTGATTTGAAATTGTTGAAGTGAAGATAAGTTTCTTATAATTCAATA AGCA TCTTGTATTTCATAAAAATT TGAAAATCCTCGTGTCACCA GTTCAAATCTGGTTCCTGGCAGAGAAAAAAAAAAAAAAAGATCCACCGAATAGGTATTGATCCAAATACCTCGAGATGGATTGTGATACATATTCATTAATAATATTTATTCATCTAATTTGTATTCCGCTATTCCGACGAATATTTTTTTAGTCTTGCTTATCTTTATCTTATCTTATTTTCCTAGTTGTGCTAAGTAATGTGCGCGGTACAAAGTTCCTGGTAGAGAACTTCTTTGAGTCATCCTATTTTTCTGCTCATATGAAGGAAATTAATATGCGATTTTCAAAATAGGGGAATCCAAATGAAACCCTTTTTTTGCTCAGTCTATCTGGAATGCTTTTGTATAATTAGGAATTAATTATAAATAGGTATTCCGTTTCATCTAGGAAAAGAACCTAAAAATATTCCTTGACTTGAATAAAATCTGGAGTTGTGTTGTATAAGTGAGCATGAATTTCTTATCATTCAATG AGCATCTTGT ATTTCATAAAAATT

Marker location Base sequence Bitter buckwheat wheat WT_05
petG trnP
TTCTATTTGGAATCGTCTTAGG TTTGATTCCTATTACTTTGGCTGGATTATTCGTAACTGCATATTTACAATATAGACGTGGCGATCAGTTGGACCTTTGATTAGTTAACAAATCTTTGTTGATTGACCTCCTCTGGCTTAAATAAAGAAAGGAGGTCAATTTTCTATTATTATTTACGTCTAATTAGAACTAACAAGACTGGACTCACGCTCTGTAGGATTTGAACCTACGACATCGGGTTTTGGAGACCCACGTTCTACCGAACTGAACTAAGAGCGCTTTCTTATCACAAACAGTAAAGAAAAAAATGCCTTTTGTAACCCAAAACTCCATCTTGCATT CACAGATATAGTTAAAATTGCATACGCGTTAT ATGTATATATAGTATT ATATACTATATAGAATATATCTAAATAGAATATGA TATGGATTCGAATAATATTC TAAAAAAGACGG ATTCTATATGTCCAGTTTGCCTCTATTTCGTCGATCTTAATTAATTTTTCTCAGAGGAAAAGCAATAGGTAGGGATGACAGGATTTGAACCCGTGACATTTTGTACCCAAAACAA ACGCGCTACCAAGCTG CGCTACATCCCA TTCTATTTGGAATCGTCTTAGG CCTAATTCCTATTACTTTAGCGGGATTATTCGTGACTGCGTATTTGCAATACAGGCGTGGGGATCAGTTGGATCTTTGATTGAGTCATTTTTTTTTGATTGACCTCCTCCAGACCAGAGAGGAGGTCAAATTGAAATTGGAGTTACAATTCAATTTTGTTAAGTTATTTTACTCTGCTTCGACATAAGATAGATGGAATCACGCTCTGTAGGATTTGAACCTACGACATCGGGTTTTGGAGACCCGCGTTCTACCGAACTGAACTAAGAGCGCTTTCATTCATTCAAAAAGAAAATCTTTTTCTATTCCTAATGTATCTCACGTACGTATAGTCTCCACAAATTCAAGTTATACCCACTTTACTTTAATTGATCTCGTCGCTACTGCCTATAAAGAAGAAAGAAGTAATAGGTAGGGATGACAGGATTTGAACCTGTGACATTTTGTACCCAAAACAA ACGCGCTACCAAGCTGCGCTACAT CCCA

In addition, clustalW 2.1 was used to determine the In / del region in the marker, and the results are shown in Tables 5 to 9 below.

Table 5 below shows the clustal W 2.1 sequence alignment in the In / del region of the WT_01 marker.

Table 6 below shows the clustalW 2.1 sequence alignment of the In / del region of the WT_02 marker.

Table 7 below shows the clustalW 2.1 sequence alignment of the In / del region of the WT_03 marker.

Table 8 below shows the clustalW 2.1 sequence alignment of the In / del region of the WT_04 marker.

Table 9 below shows the clustalW 2.1 sequence alignment of the In / del region of the WT_05 marker.

Example  2: Marker  Used With bitter buckwheat  Distinction of wheat

A total of 5 primers were used to perform PCR to distinguish wheat between wheat and wheat with only PCR band difference on agarose gel using bitter buckwheat and wheat DNA. The PCR conditions were as follows: 1) pre denaturation at 95 ° C for 5 minutes, 2) 35 cycles (denaturation at 95 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, extension at 72 ° C for 1 minute), 3) final extension at 72 ° C for 10 minutes. For PCR, 2ul of 10ng / ml of DNA and 0.5ul of forward and reverse primers of 10pmol were added, and then 17ul of sterilized water was added to adjust the total reaction solution to be 20ul, and AccuPower PCR premix (Bioneer , K-2016) reagents. After PCR, electrophoresis on 1.8% agarose gel (FIG. 2) revealed amplification of the buckwheat and wheat-specific bands of the four markers.

Example  3: Using the present invention With bitter buckwheat  Test for mixed specimens of wheat

Using the present invention, mixed specimens were prepared using two kinds of bitter buckwheat and wheat DNA, and specific band detection was confirmed in two species. A solution of bitter buckwheat and wheat genomic DNA in a volume ratio of 100: 0, 10:90, 20:80, 30:70, 40:60, 50:50, 60:40, 70:30, 80:20, 10:90 And the total DNA concentration was quantified to 20 ng / ul. Four primers developed in the present invention were used to confirm the detection of bitter buckwheat or wheat specificity. The PCR was carried out in the same manner as in Example 2, and as a result, primer 1 (SEQ ID No. 1 and SEQ ID No. 2 primer set), 2 (SEQ ID No. 3 and SEQ ID No. 4 primer set), 4 (SEQ ID No. 7 and SEQ ID No. 8 primer set ) Showed species specific bands in mixed specimens ranging from 10:90 to 70:30 in quantitative ratio of buckwheat and flour DNA (FIG. 3).

Example  4: Marker  Used With bitter buckwheat  Setting the detection limit of wheat

Using the present invention, two types of specific band detection were confirmed using two types of wheat and bitter buckwheat DNA. The concentration of each DNA of wheat and bitter buckwheat was adjusted using WT_02 and WT_04 markers adjusted to 20ng / ul, 10ng / ul, 5ng / ul, 1ng / ul, 500pg / ul, 250pg / PCR was performed as in Example 2. As a result of the electrophoresis after the PCR, it was found that detection by 100 pg / ul was possible using the marker of the present invention, so that it could be used even in a sample containing a trace amount (FIG. 4).

Example  5: Marker  Quantity of wheat used PCR

Using the present invention, the detection specificity of the two species was confirmed by using a primer set and a quantitative PCR which specially amplified bitter buckwheat and wheat. Real-time quantitative PCR conditions were as follows (1) pre-denaturation at 95 ° C for 3 minutes, 2) 50 cycles of denaturation at 95 ° C for 10 seconds, annealing at 66 ° C (TW_02 marker), (49 ° C (TW_04 marker) (TW_02 marker, increasing at 0.5 ° C at 61 ° C and increasing to 0.5 ° C at 95 ° C) (95 ° C at 55 ° C, increasing by 0.5 ° C) ℃ for each step). The PCR conditions were as follows: 5 ul and 10 pmol of forward and reverse primers were added in 0.5 μl increments to 2 ng / μl, 0.2 ng / μl, 0.02 ng / μl and 0.002 ng / Then, 10ul of Thunderbird SYBR qPCR preMix (Toyobo, Japan) and 3ul of sterilized water were added to adjust the total reaction solution to 20ul, and quantitative PCR was performed. The quantitative PCR machine was CFX 96-1000 (Bio-Rad). Ct values were calculated by measuring the amount of fluorescence for each well in the reaction step and 4 replicates per reaction were performed. Quantitative PCR of the bitter buckwheat using the Wt_02 marker revealed a detection limit of 20 pg and the number of cycles (Ct value) at which the amplification signal reached the threshold was shown in Table 10 (FIG. 6).

Quantitative PCR results using WT_02 marker and bitter buckwheat DNA density 20 ng 2 ng 0.2 ng 0.02 ng Ct value 18.64 22.7 27.21 31.16 18.46 22.92 26.99 31.36 18.34 22.98 26.75 31.69 18.07 23.01 27.1 31.42 Average 18.3775 22.9025 27.0125 31.4075 S.D. 0.239217 0.140089 0.196702 0.218689

In addition, the detection limit of the wheat using the WT_04 marker was found to be 2 pg, and the number of cycles (Ct value) at which the amplification signal reached the threshold was shown in Table 11 (FIG. 7).

Quantitative PCR using WT_04 marker and wheat DNA density 20 ng 2 ng 0.2 ng 0.02 ng 0.002 ng Ct value 18.35 22.01 26.79 31.09 34.24 17.81 22.15 27.01 31.04 35.03 18.39 22.19 26.96 31.02 35.37 18.43 22.26 26.43 30.85 34.99 Average 18.245 22.1525 26.7975 31 34.9075 S.D. 0.291833 0.105317 0.262472 0.104243 0.476541

Example  6: For the workpiece using the present invention With bitter buckwheat  Detection of Wheat

In order to investigate the applicability of processed buckwheat products to the present invention, seven buckwheat noodles, which are commercial processed bitter buckwheat products, were purchased and DNA was extracted using the NucleoSpin Food kit of Macherey-Nagel (MN). After the extraction, 20 ng / ul was quantified, and PCR was performed using the same PCR conditions as in Example 2 and the WT_02 and WT_04 primers. As a result, noodles (A) containing 30% of bitter buckwheat and 70% of wheat flour and noodles (B) made of 100% bitter buckwheat were identified (Fig. 8).

Having described specific portions of the present invention in detail, those skilled in the art will appreciate that these specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby Will be clear. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> REPUBLIC OF KOREA <120> MARKER FOR DISCRIMINATION OF FAGOPYRUM TATARICUM AND TRITICUM          AESTIVUM USING CHLOROPLAST SEQUENCE AND DETECTING METHOD <130> p14r12d1289 <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> WT_01 forward primer <400> 1 ttcatccaaa tgtgtaaaag a 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> WT_01 reverse primer <400> 2 gaactgttta tgatatttta a 21 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> WT_02 forward primer <400> 3 tagcctttgt ttggcaagct gctgtaagtt t 31 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> WT_02 reverse primer <400> 4 taccgagggt tcgaatccct ctctttccg 29 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> WT_03 forward primer <400> 5 ggggatatgg cgaaatcggt agacg 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> WT_03 reverse primer <400> 6 tggggataga gggacttgaa ccctc 25 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> WT_04 forward primer <400> 7 tgaaaatcct cgtgtcacca 20 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> WT_04 reverse primer <400> 8 aatttttatg aaatacaaga tgct 24 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> WT_05 forward primer <400> 9 ttctatttgg aatcgtctta gg 22 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> WT_05 reverse primer <400> 10 tgggatgtag cgcagcttgg tagcgcgt 28 <210> 11 <211> 894 <212> DNA <213> Fagopyrum tartaricum <400> 11 ttcatccaaa tgtgtaaaag accctagccg cacttaaaag ccgagtactc taccgttgag 60 ttagcaaccc aaaaagagta taaaatacaa tcgagatcaa aaaaaagaaa gttttataat 120 aaaaaacaga tcaactgaca atccaagtaa caatacaaga aattaaaaaa taaaaaaatt 180 ctagaccact tcttagatat tcttatcgtt atatatattt tctatgttct ttctctatct 240 tttcagatat ttttttttgt attattatct atccatttca aaattgagat gaatttgttt 300 ttgtatgtag gacaaaaaaa tagcgaaaaa aagcacccat ttacacttga attatatttg 360 ttcactacac tcttgtcaat atgtatgtta aaaaaagaaa gaacttgtgt tggattggca 420 ctatctaaat aaggtccagg gttagaaagt aatgtagata aaaataaaaa agaaatagaa 480 aaaataggaa taactatata caaaataatt cattcttttt ttagtatagt tccaaggaaa 540 atcccccaac tgaaataaat gttagaattt tctattacta gatccaactc ctaccattag 600 ttacttggtc aatataactt tctgcatttg ttcgtttgat cttttttcta gacatcttat 660 agcaaaaaaa tctcttttga tcattgatta gaagacgcag tctcttccag gaacagtgca 720 aaatagatat gaatagagca aacaaagggt gggaataaaa aagaaaggat tcgatcaaac 780 tatatacgaa tccctcaagt ctgtttcttg ttgtatttaa ttaagtgaat tttggttcag 840 tcgggcgaag ttctttaaaa acctctgcct tctttaaaat atcataaaca gttc 894 <210> 12 <211> 708 <212> DNA <213> Triticum aestivum <400> 12 ttcatccaaa tgtgtaaaag atcatagtcg cacttaaaag ccgagtactc taccattgag 60 ttagcaaccc agataaaaaa aggatcttag atacgatcga aatccaaaaa tcaatggaat 120 tacaccgcgc gcttctgtca aaacattgaa ctagtaagac atcaaaagat tttttttatc 180 gaccatgaaa aacactcaaa tgccaaaacg aacaggtccg gttaaattcc actaaagtaa 240 agttaaaaaa cgagcgaccc taatcacgat ggccaaattc tccttatttt tagcgatttt 300 tattaaaaat atatattata ttgtatgaga atacatgcaa gaggaacacc cttatcattt 360 gagcgaagtg tagggagaaa aatggaatat ggagtgagga taaagagacc catctatcta 420 caaattctat ttgttcaata gacctctgtc attggaaata caatggtaag aaaacaaatt 480 agatagaaaa agtaaataaa ataggggctt atgttggatt agcacgatat aatataaatc 540 caaataggat taagaaagag gtaaattgtg tctaaataat tatacaacta ggaatactaa 600 taatcttctc ctatcctact ttttgattca tttagttctt caattaactc aaagtgcttt 660 ctttttcttt aaagaattcc gccttcctta aaatatcata aacagttc 708 <210> 13 <211> 572 <212> DNA <213> Fagopyrum tartaricum <400> 13 tagcctttgt ttggcaagct gctgtaagtt ttcgatgaga ttcaaaatat tgtcctatcg 60 tataaactcg cgatttcatt ttcaactata aaaagtcttg gatagcctcg aaaaatggga 120 atcaattcct ttctcgttct aacaagaatt tccgtgaaag accctgtgag gttttccaca 180 aaaattgtgg gcaggaaagc ccttttttat atttgataca aatcctaata cttaacaaaa 240 caaataaatt aatttttttt ttcgagttac agaaactact aaaattcgcg atgtcaaagt 300 aaaaactgta tatatggggg aatctattct cttttttcca caaaaagatc ttggagattg 360 tgtaatgctt actctcaaac tcttcgttta cacagtagtg atattctttg tttctctctt 420 cattttcgga tttctatcta atgacccagg acgtaatcct ggacgggaag aataaaagaa 480 gagtttcttt ttattcctaa aaaaattata aagataaata aaatagtaaa tcaccaacag 540 aaacggaaag agagggattc gaaccctcgg ta 572 <210> 14 <211> 685 <212> DNA <213> Triticum aestivum <400> 14 tagcctttgt ttggcaagct gctgtaagtt ttcgatgaaa tctttagtac tctgtatgcc 60 aaattgaatg atgtgttcat tccaaaaaaa ttttaaaatg ggtaaaagcc gagaagtttt 120 atatttttat attatgaacc ttcgattctc aaatttaaat tcttctacat tgaatgggta 180 gctacagcaa taaatttggg tcagcctttc tactcccctg cacctaggtt gagcaggtac 240 ctacacaata cctaaccacc taaccctatt tttgctattg ataagagtgc ttattataaa 300 tgaattcttg caattttttt caagaattca tttttgcatt ttaggtatca aaaaaaaacc 360 atcctagtgg atccgtgtgg taaggaaaaa ctggtaatct attccttaaa aaaaaatctt 420 ggagattatg taatgcttac tctcaaactt tttgtttata cagtagtgat attctttgtt 480 tcactcttta tctttggatt cttatctaat gacccaggac ggaatcctgg acgcgaggag 540 taataattcc gttttttttt ttttttctta ttggatttgt ttcgttcatt tatctatgag 600 aaaatccggg ggtcagaatt ctttccaatt cgaaagtccc aaatgatcca agggagcgga 660 aagagaggga ttcgaaccct cggta 685 <210> 15 <211> 588 <212> DNA <213> Fagopyrum tartaricum <400> 15 ggggatatgg cgaaatcggt agacgctacg gacttaatta ggttgagcct tagtagggaa 60 acctactagg tgagaacttt caaattcaga gaaaccctgg aatcaaaaaa cgggtaatcc 120 tgagccaact cctgctttcc aaaagaaaga ataaatacag gataggtgca gagactcaat 180 ggaagctgtt ctaacaaaat ggagttgact gtcttgcgtt gttacaagaa ctcttccgtc 240 gaaactcaaa aaaggatgaa gaataaacgt atacgcatac atacgtcaat ataaaatact 300 aaaaaaaatg aaaaatattc ataacgaccc gactttttct tttatgacta tgaaaaaagg 360 aagaattgtt atgaatcgat ttcacgatga agaaagaatc gaatattctt ttagtaaata 420 aaagcattta cttccccgtc tgatagatct tttgaaaaac cgatccatcg gatgagaatg 480 aagatagagt cccattctac gtgtcaatcc tgacaacaaa gaaatttata gtaagaggaa 540 aatccgtcga ctttataaat cgtgagggtt caagtccctc tatcccca 588 <210> 16 <211> 673 <212> DNA <213> Triticum aestivum <400> 16 ggggatatgg cgaaatcggt agacgctacg gacttgattg tattgagcct tggtatggaa 60 acctgctaag tggtaacttc caaattcaga gaaaccctgg aattaaaaaa gggcaatcct 120 gagccaaatc cgtgttttga gaaaacaagg ggttctcgaa ctagaataca aaggaaaagg 180 ataggtgcag agactcaatg gaagctgttc taacgaatcg agttaattac gttgtgttgt 240 tagtggaatt ccttctaatt ctaaattaga gaaagagggg ttttatacct tatacattta 300 ataaacacgt atagatactg acatagcaaa cgattaatca cagaactcat attatattat 360 aattataata taggttcttt atctttttta aaaatgaaat tagaaatgat aatgattatg 420 aaataaaaaa ctcataaaaa ctcatatcat aatttttttt cattattgtg aatccactcc 480 aatcgaatat tgaataatca aattcttcaa ttcaaattca aagttttcga gatctttaaa 540 aaagtggatt aatcggacga ggacaaagag agagtcccat tctacatgtc aatactgaca 600 acaatgaaat ttctagtaaa aggaaaatcc gtcgacttta taagttgtga gggttcaagt 660 ccctctatcc cca 673 <210> 17 <211> 776 <212> DNA <213> Fagopyrum tartaricum <400> 17 tgaaaatcct cgtgtcacca gttcaaacct ggttcctggc acatgattca ttttgatgag 60 tagcgacttt acaaacaaat taattgatat ggatcgatat tcattgcaca tatgtaactt 120 atttcttttc tctcgatgtc tagagatata ccccacctat aaaaatagat gggtaacgaa 180 tatatcaaaa gatgtaaaag agttaggttt tcttttcgtt ttttatttgt tgtttattct 240 gtgtctcttc tcattgaaaa agaatatgac ttcttcatgc ggattcgaaa aagaggtgta 300 atttgttaaa ttagttgcaa gacgcgaaaa ataggggagt taaggtaaag gataaaaata 360 gacaagatgt atctcagata cagtacaaat agaacgcgac ctcctctcat ttattttttt 420 tattctattt ctgtattttc ccctacatta cgtgactttc tacagaacat ccaagtggtg 480 ttcgatgttc gaggtacaaa attcatgatc caattttttt tttaattcta ttagctcggc 540 taattcaaaa caaaagtatc ttcccaactt tcaaatttca atgaattcct aattttattt 600 tttgcttttt taaccaacct aatccgaata aaatgtcaac tactccgatt gtttgctcta 660 gagcagagtg tacaaaaatg acttatactt ataatctata tttgtttgat ttgaaattgt 720 tgaagtgaag ataagtttct tataattcaa taagcatctt gtatttcata aaaatt 776 <210> 18 <211> 518 <212> DNA <213> Triticum aestivum <400> 18 tgaaaatcct cgtgtcacca gttcaaatct ggttcctggc agagaaaaaa aaaaaaaaag 60 atccaccgaa taggtattga tccaaatacc tcgagatgga ttgtgataca tattcattaa 120 taatatttat tcatctaatt tgtattccgc tattccgacg aatatttttt tagtcttgct 180 tatctttatc ttatcttatt ttcctagttg tgctaagtaa tgtgcgcggt acaaagttcc 240 tggtagagaa cttctttgag tcatcctatt tttctgctca tatgaaggaa attaatatgc 300 gattttcaaa ataggggaat ccaaatgaaa cccttttttt gctcagtcta tctggaatgc 360 ttttgtataa ttaggaatta attataaata ggtattccgt ttcatctagg aaaagaacct 420 aaaaatattc cttgacttga ataaaatctg gagttgtgtt gtataagtga gcatgaattt 480 cttatcattc aatgagcatc ttgtatttca taaaaatt 518 <210> 19 <211> 600 <212> DNA <213> Fagopyrum tartaricum <400> 19 ttctatttgg aatcgtctta ggtttgattc ctattacttt ggctggatta ttcgtaactg 60 catatttaca atatagacgt ggcgatcagt tggacctttg attagttaac aaatctttgt 120 tgattgacct cctctggctt aaataaagaa aggaggtcaa ttttctatta ttatttacgt 180 ctaattagaa ctaacaagac tggactcacg ctctgtagga tttgaaccta cgacatcggg 240 ttttggagac ccacgttcta ccgaactgaa ctaagagcgc tttcttatca caaacagtaa 300 agaaaaaaat gccttttgta acccaaaact ccatcttgca ttcacagata tagttaaaat 360 tgcatacgcg ttatatgtat atatagtatt atatactata tagaatatat ctaaatagaa 420 tatgatatgg attcgaataa tattctaaaa aagacggatt ctatatgtcc agtttgcctc 480 tatttcgtcg atcttaatta atttttctca gaggaaaagc aataggtagg gatgacagga 540 tttgaacccg tgacattttg tacccaaaac aaacgcgcta ccaagctgcg ctacatccca 600                                                                          600 <210> 20 <211> 508 <212> DNA <213> Triticum aestivum <400> 20 ttctatttgg aatcgtctta ggcctaattc ctattacttt agcgggatta ttcgtgactg 60 cgtatttgca atacaggcgt ggggatcagt tggatctttg attgagtcat ttttttttga 120 ttgacctcct ccagaccaga gaggaggtca aattgaaatt ggagttacaa ttcaattttg 180 ttaagttatt ttactctgct tcgacataag atagatggaa tcacgctctg taggatttga 240 acctacgaca tcgggttttg gagacccgcg ttctaccgaa ctgaactaag agcgctttca 300 ttcattcaaa aagaaaatct ttttctattc ctaatgtatc tcacgtacgt atagtctcca 360 caaattcaag ttatacccac tttactttaa ttgatctcgt cgctactgcc tataaagaag 420 aaagaagtaa taggtaggga tgacaggatt tgaacctgtg acattttgta cccaaaacaa 480 acgcgctacc aagctgcgct acatccca 508

Claims (8)

SEQ ID NOS: 1 and 2; SEQ ID NOS: 3 and 4; SEQ ID NOS: 5 and 6; SEQ ID NOS: 7 and 8; A set of primers for distinguishing between wheat buckwheat and wheat. i) isolating the genomic DNA from the sample of interest;
ii) performing PCR (polymerase chain reaction) using the separated genomic DNA as a template and using the primer set of claim 1; And
iii) identifying the amplified PCR product of step ii);
&Lt; / RTI &gt; wherein the wheat is selected from the group consisting of wheat and wheat. 3. The method of claim 2,
iv) analyzing the identified product and analyzing whether the buckwheat and wheat used in the subject sample are present alone or in admixture. i) isolating the genomic DNA from the sample of interest;
ii) performing real-time PCR using the separated genomic DNA as a template and using the primer set of claim 1; And
ii) measuring the fluorescence signal in the real-time PCR amplification product and analyzing whether or not bitter buckwheat and wheat are mixed;
&Lt; / RTI &gt; wherein the method comprises quantitatively detecting bitter buckwheat and wheat. The method according to claim 2 or 4, wherein the object sample is food. The method according to claim 2 or 4, wherein the target sample is a buckwheat processed product. A kit for distinguishing wheat buckwheat from wheat comprising the primer set of claim 1. A composition for distinguishing between wheat buckwheat and wheat comprising the primer set of claim 1.

Images