KR20160056367A - Composition for inducing dedifferentiation for induced pluripotent stem cells with Reptin and method for inducing induced pluripotent stem cells using the same - Google Patents

Abstract

The present invention relates to a composition for inducing dedifferentiation into induced pluripotent stem cells containing leptin protein or genes encoding the same; and a method for inducing dedifferentiation from somatic cells into induced pluripotent stem cells by using the composition. When inducing dedifferentiation from somatic cells into induced pluripotent stem cells by using leptin protein according to the present invention, stability is ensured since conventional c-myc genes or the like known to induce tumors are not used, and the induced pluripotent stem cells have excellent pluripotent properties or differentiation ability. Thus, the pluripotent stem cells are differentiated into myocardial cells, insulin-producing cells or nerve cells to be applied to stem cell transplantation for various diseases, such as heart failure, insulin-dependent diabetes, Parkinson′s disease or spinal cord injury.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for inducing differentiation into an inducible pluripotent stem cell comprising leptin, and a method for inducing differentiation into inducible pluripotent stem cells using induction induced pluripotent stem cells same}

The present invention relates to a composition for inducing the differentiation of stem cells into somatic-derived pluripotent stem cells, comprising a gene encoding a leptin protein or a leptin protein; And a method for inducing the differentiation of somatic cells into induced pluripotent stem cells using the composition.

Stem cells have the characteristics of pluripotent cells capable of self-renewal and differentiating into various cells that make up our body. Thus, when stem cells are used to regenerate damaged tissues, it is possible to treat various intractable diseases. Stem cells are largely embryonic stem cells, adult stem cells, and recently reported induced pluripotent stem cells (Watt, F.M., and Hogan, B.L. 2000. Science 287, 1427-1430).

Embryonic stem cells are pluripotent stem cells derived from the blastocyst and inner cell mass of a frozen embryo. Since embryonic stem cells are superior to adult stem cells and have no differentiation potential, autologous regeneration has received great attention for the purpose of therapeutic development and cell therapy of regenerative medicine. Adult stem cells, on the other hand, exist in adult tissues and can be easily separated from various tissues such as fat, bone marrow, and liver. However, adult stem cells have difficulty in securing many cells due to their ineffective growth, and have a problem in that their differentiation ability is lowered when compared with embryonic stem cells (Murry, CE, and Keller, G. 2008. Cell 132, 680).

Induced pluripotent stem cells (iPS cells) have been transformed into somatic cells by introducing specific de-differentiation transcription factors into the state of pluripotent cells. In 2006, Dr. Shinya Yamanaka of Japan (Takahashi, K., and Yamanaka, S. 2006. Cell 126, 663-676). Transcription factors that can be introduced for the differentiation are variously known, but Oct4, Sox2, Klf4 and c-Myc are representative. Of these, Oct4 is an octamer transcription factor and is a member of the POU family and is known to play an important role in maintaining undifferentiated state. When suppressed the expression of Oct4 in pluripotent cells, it lost its ability to replicate itself and differentiated into nutritional cells (Nichols, J., Zevnik, B. 1998. Cell 95, 379-391). Expression of the four genes induces a differentiation process and expression is inhibited by a progeny method. In the meantime, such a de-differentiation technique can eliminate the problem of bioethics, which is an object of controversy of embryonic stem cells, and can produce cells separated from their own adult cells, (Zaehres, H., and Scholer, HR 2007. Cell 131, 834-835), which is similar to embryonic stem cells.

As described above, the inducible pluripotent stem cells are used as a breakthrough technology for the treatment of patient-customized diseases by using cells derived from patients. However, there are various problems that must be overcome to be utilized in clinical applications for cell therapy. In particular, induced pluripotent stem cells produced through overexpression of genes capable of inducing tumors, such as c-Myc, are a critical threat to safety. Thus, recent studies have focused on the discovery of novel de-differentiation transcription factors that replace c-myc in order to increase the efficiency of de-differentiation.

Reptin is a member of RVBs and is an ATP-dependent DNA helicase and plays an important role in cell processes such as transcriptional regulation, histone modification and DNA damage. . It is known that the binding partner of leptin is Pontin and the two proteins bind as a complex and play an important role in regulating transcription. Previous reports have shown that inhibition of leptin expression reduces cell viability of embryonic stem cells and changes to a flat form (Fazzio TG, Huff JT, Panning B. 2008. Cell. 134, 162-174) . However, the role of leptin in the de-differentiation of somatic cells into induced pluripotent stem cells has not been elucidated.

Therefore, the inventors of the present invention have been studying a novel inducible factor of pluripotent stem cells capable of replacing the c-myc gene capable of inducing tumors. As a result of introducing leptin gene into somatic cells and overexpressing leptin protein, somatic cells Induced pluripotent stem cells, the pluripotent stem cells of the present invention have pluripotency or differentiation ability, and the present invention has been completed.

It is an object of the present invention to provide a composition for inducing the differentiation of somatic cells into induced pluripotent stem cells comprising a gene coding for leptin protein or leptin protein.

Another object of the present invention is to provide a method for inducing dedifferentiation from somatic cells to pluripotent stem cells, comprising introducing a leptin gene into somatic cells.

In order to solve the above problems, the present invention provides a composition for inducing the differentiation of somatic cells into induced pluripotent stem cells comprising a gene coding for leptin protein or leptin protein.

The present invention also provides a method for inducing dedifferentiation from somatic cells to pluripotent stem cells, comprising introducing a leptin gene into somatic cells.

When leptin protein according to the present invention is used to induce the differentiation from somatic cells into induced pluripotent stem cells, it is stable without using the c-myc gene, which is known to have a potential for tumorigenesis, and the pluripotent pluripotent stem cells And can be used for stem cell transplantation therapy for various diseases such as heart failure, insulin-dependent diabetes, Parkinson's disease and spinal cord injury by differentiating it into cells such as myocardial cells, insulin-producing cells or neurons.

FIG. 1 is a graph showing a result of Western blotting that the expression of leptin in somatic cells is decreased by shRNA.
FIG. 2 is a graph showing the degree of formation of induced pluripotent stem cells by alkaline phosphatase staining when leptin expression is inhibited simultaneously with overexpression of Oct4, Sox2, Klf4 and c-Myc in mouse somatic cells.
FIG. 3 shows the results of confirming that RNA expression of pluripotent specific markers is reduced in induced pluripotent stem cells whose leptin expression is inhibited by shRNA.
FIG. 4 is a graph showing the results of western blot analysis to confirm that leptin protein expression is increased by lentivirus.
FIG. 5 is a graph showing the results of confirming that the induction efficiency of induction of differentiation into induced pluripotent stem cells is increased by simultaneous overexpression of Oct4, Sox2, Klf4, c-Myc, and Reptin in mouse somatic cells through alkaline phosphatase staining.
6 is a graph showing the results of reprogramming efficiency quantification of simultaneous expression of Oct4, Sox2, Klf4, c-Myc, and Reptin in mouse somatic cells
FIG. 7 is a graph showing an increase in RNA expression of pluripotent specific markers in induced pluripotent stem cells with increased expression of leptin.
FIG. 8 shows the results obtained by immuno-staining using Oct4, Sox2, Nanog, and SSEA-1 for the pluripotency of induced pluripotent stem cells using leptin.
FIG. 9 shows the results of hematoxylin and Eosin (H & E) staining analysis of teratoma formation to differentiate inducible pluripotent pluripotent stem cells using leptin.
FIG. 10 is a graph showing the results of inhibition of leptin expression upon overexpression of Oct4, Sox2 and Klf4 in mouse somatic cells except for c-Myc, indicating that induced pluripotent stem cells were not formed, through alkaline phosphatase staining.
FIG. 11 is a graph showing the results of confirming that the induction efficiency of induction of differentiation into induced pluripotent stem cells by simultaneous overexpression of Oct4, Sox2, Klf4 and leptin except for c-Myc in mouse somatic cells was confirmed by alkaline phosphatase staining.

The present invention provides a composition for inducing the differentiation of somatic cells into induced pluripotent stem cells comprising a gene encoding leptin protein or leptin protein.

In the present invention, the term "induced pluripotent stem cell (iPS cell, iPSC)" means a cell having a starch characterization, and the inducible pluripotent stem cell includes pluripotent proliferation, infinite proliferation, But is not limited to, the ability of embryonic stem cells to include any ability to develop into any cell derived from any embryonic layer of the embryo. In the present invention, the inducible pluripotent stem cells may also be described as embryonic stem cell-like cells, or induced starchy stem cells.

In the present invention, "dedifferentiation" means an epigenetic regression process that returns partial or final differentiated cells to an undifferentiated state such as versatile or multifunctional, thereby enabling the formation of new differentiated tissues. This de-differentiation phenomenon is possible because the epigenetic changes of the cell genome are not fixed but are a reversible process that can be erased and re-formed. Degeneration is also referred to as "reprogramming" and involves the process of changing the genetic and expressional profile of a partially or terminally differentiated cell to be similar to that of embryonic stem cells. For example, the change includes a change in a methylation pattern, a change in an expression rate of a stem cell gene, and the like.

The lapatin protein comprises a lapatin protein consisting of the amino acid sequence of SEQ ID NO: 1 or functional equivalents thereof.

Is at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70%, more preferably at least 90%, more preferably at least 90% Refers to a protein having substantially the same physiological activity as a leptin protein having an amino acid sequence represented by SEQ ID NO: 1, having a sequence homology of 95% or more.

The leptin protein of the present invention includes not only a protein having a native amino acid sequence but also an amino acid sequence variant thereof within the scope of the present invention. A variant of a leptin protein means a protein having a sequence that differs by leptin native amino acid sequence and one or more amino acid residues by deletion, insertion, non-conservative or conservative substitution, or a combination thereof. Amino acid exchanges in proteins and peptides that do not globally alter the activity of the molecule are known in the art. The leptin protein or its variants can be prepared by natural extraction or synthesis (Merrifleld, J. Amer. Chem. Soc. 85: 2149-2156, 1963) or by genetic recombination methods based on DNA sequences (Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, Second Edition, 1989).

The leptin protein of the present invention can be coded with the nucleotide sequence of SEQ ID NO: 2, and variants which can function in the same manner as the above nucleotide sequence are included in the scope of the present invention.

In the present invention, the leptin gene may be synthesized artificially by using a nucleic acid synthesizer or the like with reference to the base sequence of the gene of interest, or an oligonucleotide having a sequence complementary to both ends of the desired leptin gene as a template by using leptin genomic DNA as a primer And then carrying out PCR. On the other hand, the leptin gene of the present invention can exist in various base sequences due to codon degeneracy, all of which are included in the scope of the present invention. In addition, variants of the nucleotide sequence shown in SEQ ID NO: 2 are included in the scope of the present invention. Specifically, the leptin gene has a base sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 2 . ≪ / RTI > "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

The leptin protein-encoding gene may be introduced into cells by known methods in the art, for example, naked DNA in the form of a vector (Wolff et al. Science, 1990: Wolff et al. J Cell Sci. 103: 1249-59, 1992), liposomes (cationic polymers), and the like.

The gene coding for the leptin protein may preferably be contained in an expression vector.

As used herein, the term "vector" refers to an expression vector capable of expressing a desired protein in a suitable host cell, including a necessary regulatory element operably linked to the expression of the gene insert.

The vector of the present invention may include a signal sequence or a leader sequence for membrane targeting or secretion in addition to an expression regulatory element such as a promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, an enhancer, and the like. The promoter of the vector may be constitutive or inducible. In addition, the expression vector includes a selectable marker for selecting a host cell containing the vector, and includes a replication origin in the case of a replicable expression vector. The vector may be self-replicating or integrated into the host DNA.

Such vectors include plasmid vectors, cosmid vectors, viral vectors, and the like. Preferably, it is a viral vector. Virus vectors include retroviruses such as human immunodeficiency virus (HIV), murine leukemia virus (MLV), Avian sarcoma / leukosis (ASLV), Spleen necrosis virus (SNV), Rous sarcoma virus (RSV) tumor viruses, adenoviruses, adenoassociated viruses, and herpes simplex viruses. In one embodiment of the present invention, pLOVE lentiviral vectors are used. It is not limited.

The composition for inducing the differentiation from the somatic cell into the inducible pluripotent stem cell comprises at least one protein selected from the group consisting of Oct4, Sox2 and Klf4 in addition to leptin; Or one or more genes encoding the protein.

In the present invention, the somatic cell may be derived from primates, mice, rats, dogs, cats, horses or cattle, but is not limited thereto. The type of the somatic cell is not particularly limited, and any somatic cell can be used.

In one embodiment of the present invention, a gene encoding a leptin protein and comprising the nucleotide sequence shown in SEQ ID NO: 2; And Oct4, Sox2 or Klf4 genes are inserted into an expression vector, and after transfection into a packaging cell line, lentiviruses and retroviruses produced in the transfected cells are obtained, and the virus solution is treated with somatic cells and cultured . Induced pluripotent stem cells from somatic cells do not utilize the c-myc gene. Therefore, the stem cells are stable because of low possibility of tumorigenesis, and have pluripotency or differentiation ability. Therefore, stem cell transplantation therapy for various diseases Can be used.

The present invention also provides a method for inducing dedifferentiation from somatic cells to pluripotent stem cells, comprising introducing a leptin gene into somatic cells.

In order to induce dedifferentiation from the somatic cell to the induced pluripotent stem cell, one or more genes selected from the group consisting of Oct4, Sox2 and Klf4 in addition to the leptin gene may be further introduced into somatic cells.

In one embodiment of the present invention, a gene encoding a leptin protein and comprising the nucleotide sequence shown in SEQ ID NO: 2; The expression vector containing the Oct4, Sox2 or Klf4 gene is transfected into a packaging cell line to generate a lentivirus or a retrovirus, and the virus solution is treated with somatic cells and cultured to transform the somatic cells into induced pluripotent stem cells Induced differentiation.

In the present invention, the term "cultivation" means that microorganisms are grown under moderately artificially controlled environmental conditions.

The somatic cells can be grown in a conventional medium, for example, in a nutrient broth medium. The culture medium may contain nutrients required for culturing, that is, a microorganism to be cultured in order to cultivate a specific microorganism, and may be a mixture in which a substance for a special purpose is further added and mixed. The medium is also referred to as an incubator or a culture medium, and is a concept including both natural medium, synthetic medium and selective medium. The somatic cells of the present invention can be cultured according to a conventional culture method.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention as defined by the appended claims. It will be obvious to you.

Example 1. Preparation of shRNA against leptin and transfection using it

In order to inhibit leptin expression, shRNA against leptin was prepared and the following experiment was carried out to transfect mouse somatic cells.

More specifically, shRNA (CCGGCCGAGAACAGATCAATGCAAACTCGAGTTATGCATTGATCTGTTCTCGGTTTTTG, TRCN0000047035, Sigma, USA) for leptin was used to inhibit the transcription of leptin in mouse somatic cells, and a virus was prepared using a pLKO-puro lentiviral vector as a control group, Respectively. First, shRNA and lentiviral packaging mix (pLP1, pLP2, pLP-VSV-G, and Invitrogen Life Technologies) for leptin were transfected into HEK293 cells to recover lentivirus and the virus was recovered 48 hours later. For transfection, Lipofectamine-Plus (Invitrogen Life Technologies) was used according to the manufacturer's instructions. The mouse somatic cells were cultured in the medium containing the above transfection mixture and 10 ug / ml polybrene (Sigma, USA) for 18 hours, and the medium was changed. After 72 hours of culture, the cells were harvested and protein expression was confirmed by western blotting. Antibodies were used for primary antibodies against Reptin (ab36569, abcam, Cambridge) and GAPDH (MAB374, EMD Millipore Corp., Billerica, MA). The results are shown in Fig.

As shown in Fig. 1, it was confirmed that leptin protein expression was normally suppressed in mouse somatic cells by shRNA against leptin.

Example 2 Inhibition of Leptin Expression Induces Induction Differentiation of Induced Multipotent Stem Cells and Expression of Specific Markers on the Cells

2-1. Effects of Inhibition of Leptin Gene Expression on the Induction Differentiation of Induced Allogeneic Stem Cells

In order to analyze the effect of inhibiting gene expression of leptin on the induction of reprogramming into induced pluripotent stem cells, the following experiment was conducted.

First, dedifferentiation transcription factors were introduced into mouse somatic cells using retroviruses. Each retrovirus was harvested on Plat-GP cells using the pVXs-Oct4, pMXs-Sox2, pMXs-Klf4 or pMXs-c-Myc genes and the rentroviral packaging mix (VSV, gag-pol). The collected viruses were mixed at a ratio of 1: 1: 1: 1, treated with 10 mg / ml polybrene, and reacted with fibroblasts for 18 hours. Then, the medium (DMEM + 10% FBS) was replaced. Two days later, 5x10 < ⁴ > cells in which the de-differentiation transcription factors were introduced were cultured and observed on fibroblasts treated with mitomycin C. Lentiviruses were prepared using the leptin shRNA prepared in Example 1 under the same conditions as those described above, and then transfected with lentiviruses at the same rate as the four kinds of reprogramming transcription factors. The formation of induced pluripotent stem cells induced by the inhibition of the expression of the control and leptin was identified by alkaline phosphatase (AP) staining. For this, colonies stained with alkaline phosphatase were quantified Respectively. Alkaline phosphatase was widely used as a marker to characterize undifferentiated pluripotent stem cells. Dyeing was performed with Vector Red Alkaline Phosphatase Substrate Kit I (86R, Sigma, USA) according to the manufacturer's instructions . The results are shown in Fig.

As shown in FIG. 2, it was confirmed that when ovine somatic cells were overexpressed with Oct4, Sox2, Klf4 and c-Myc and simultaneously suppressed leptin expression using shRNA, the degeneration of induced pluripotent stem cells was inhibited.

2-2. Effects of Inhibition of Leptin Gene Expression on the Expression of Induced Allogeneic Stem Cell-Specific Markers

In order to analyze the effect of inhibition of leptin gene expression on the expression of inducible pluripotent stem cell specific markers, the following experiment was conducted.

More specifically, the inducible pluripotent stem cells formed in Example 2-1 were collected after 28 days of culture, and the RNA was isolated therefrom, and the expression levels of leptin, Oct4, Sox2 and Nanog were quantitatively-real time PCR ). For qRT-PCR, first strand cDNA was synthesized using 2 μg total RNA sample, 0.5 μg oligo (dT) 15 primer, molomo murine leukemia virus reverse transcriptase (in vitro) according to the manufacturer's instructions. Then, 2x SYBR Green PCR master mix (Applied Biosystems) and 10 pM each specific primer (Reptin: 5'-TCCTAGCCGATTTCCGTTTC-3 '(SEQ ID NO: 3), 5'-GGATCTCAGGGACTTTGGTG-3' (SEQ ID NO: 4)); Oct4: 5'-GGAAAGCAACTCAGAGGGAA-3 '(SEQ ID NO: 5), 5'-TTCTAGCTCCTTCTGCAGGG-3' (SEQ ID NO: 6); Sox2: 5'-GCGGAGTGGAAACTTTTGTC-3 '(SEQ ID NO: 7), 5'-TATTTATAATCCGGGTGCTCCTT-3' (SEQ ID NO: 8); Nanog: 5'-CACCCACCCATGCTAGTCTT-3 '(SEQ ID NO: 9), 5'-ACCCTCAAACTCCTGGTCCT-3' (SEQ ID NO: 10); Zfp42: 5'-AGTGTGCAGTGCAGCCAG-3 '(SEQ ID NO: 11), 5'-TGCTTTCTTCTGTGTGCAGG-3' (SEQ ID NO: 12); The same amount of cDNA was amplified using 20 μl of the reaction solution containing β-actin: 5'-GTGGGCCGCTCTAGACACCA-3 '(SEQ ID NO: 13) and 5'-CGGTTGGCCTTAGGGTTCAGGGGGGG-3' (SEQ ID NO: 14) Were analyzed. The results are shown in Fig.

As shown in FIG. 3, it was confirmed that the expression of allelic specific markers Oct4, Sox2 and Nanog in the inducible pluripotent stem cells inhibited the expression of leptin by shRNA was decreased.

Therefore, it was confirmed that when the expression of leptin gene is inhibited, induction of dedifferentiation from somatic cells into induced pluripotent stem cells is inhibited.

Example 3 Effect of overexpression of leptin on induction efficiency of induction of pluripotent stem cells into induced pluripotent stem cells

3-1. Transfection for overexpression of leptin

In order to carry out transfection for overexpression of leptin, the following experiment was carried out.

More specifically, in the same manner as in Example 1, leptin introduced into pLOVE lentiviral vector was transfected into HEK293 cells, infected with mouse somatic cells, and the amount of leptin protein expressed was confirmed by Western blotting. The results are shown in Fig.

As shown in FIG. 4, leptin was overexpressed by lentivirus, and leptin expression in mouse somatic cells was normally increased.

3-2. Effects of over-expressing leptin on the induction of differentiation into induced pluripotent stem cells

In order to analyze the effect of over-expressing leptin on the induction efficiency of induction of differentiation into induced pluripotent stem cells, the following experiment was conducted.

More specifically, pLOVE-Reptin was transfected simultaneously with pMXs-Oct4, pMXs-Sox2, pMXs-Klf4 and pMXs-c-Myc in the same manner as in Example 2-1 to induce induction of induced pluripotent stem cells. After 21 days of dedifferentiation induction, colonies stained with alkaline phosphatase were quantified and analyzed, and the cells were collected to confirm changes in RNA expression of the universal specific markers. The results are shown in Fig. 5 to Fig.

As shown in FIG. 5 and FIG. 6, it was confirmed that the number of induced pluripotent stem cells was increased by simultaneously overexpressing Oct4, Sox2, Klf4, c-Myc and Reptin in mouse somatic cells.

As shown in FIG. 7, it was confirmed that the expression of Oct4, Sox2, Zfp42 and Nanog, specific markers for induced pluripotent stem cells, was highly expressed by overexpression of leptin.

Therefore, it was confirmed that overexpression of Oct4, Sox2, Klf4, c-Myc, and leptin in mouse somatic cells simultaneously increased the induction efficiency of dedifferentiation into induced pluripotent stem cells in somatic cells.

Example 4. Characterization of induced pluripotent stem cells similar to embryonic stem cells

[0154] In order to confirm the characteristics of induced pluripotent stem cells, the following experiment was conducted.

More specifically, in Example 3-2 After 28 days of the formation of the derived pluripotent stem cells, the degree of pluripotency and differentiation capacity was evaluated by immunostaining and teratoma formation. For immunostaining, a cover glass was attached to a 24-well culture dish and coated with 1% gelatin (Sigma, USA), followed by culturing induced pluripotent stem cells. Cells were collected and placed in 4% paraformaldehyde solution for 10 minutes, washed twice with phosphate buffered saline (PBS), and blocked with 2% Bovine serum albumin (BSA, Sigma, USA) for 1 hour . The cells were incubated for 1 hour with SSEA-1 (Santa Cruz, CA), Oct4 (Santa Cruz, CA), Sox2 (Abcam, Cambridge) and Nanog (Cell signaling, Danvers) Fluorescently labeled with fluor488 and alexa-luor568 (Invitrogen) secondary antibody. The cells were then mounted with Vectashield medium (Vector laboratories) containing DAPI (4 ', 6-diamidino-2-phenylindole) for fluorescent labeling of the cell nuclei. Immunofluorescent stained cells were photographed at a magnification of 800X with a confocal laser scanning microscope (Olympus Fluoview FV1000) to confirm the expression level.

All experiments were carried out in accordance with the provisions of the Institutional Animal Care and Use Committee. For teratoma formation, 2,2,2-tribromoethanol (Avertin, Sigma) was injected into a peritoneal cavity at a concentration of 400 mg / kg in a balb / c nude mouse (Orient Bio). Was mixed with the above-described embodiment 3-2 of the iPS cells ⁶ Matrigel (matrigel, BD, CA) diluted to 1x10 in DMEM, they were injected subcutaneously in each 100μl. Four weeks after the administration, malformed mice were sacrificed by CO ₂ inhalation, and the teratomas were isolated and placed in 4% paraformaldehyde solution. After washing with phosphate buffer, Hematoxylin and Eosin (H & E) were stained according to the manufacturer's instructions. The results of the above experiments are shown in Figs. 8 and 9. Fig.

As shown in FIG. 8, it was confirmed that the pluripotent markers SSEA-1, Oct4, Sox2 and Nanog, which are characteristic of embryonic stem cells, were expressed. Thus, the dedifferentiated induced pluripotent stem cells of Example 3-2 And that it possesses the universal characteristics of stem cells.

Further, as shown in FIG. 9, it was confirmed that malformed species were formed in the endoderm, mesoderm and ectoderm of the mice to which the induction-induced pluripotent stem cells of Example 3-2 were administered , It was confirmed that the dedifferentiated induced pluripotent stem cells of Example 3-2 had the differentiation ability characteristic of embryonic stem cells.

Thus, it was confirmed that the induced pluripotent stem cells according to the method of Example 3-2 of the present invention have pluripotency and differentiation ability, which are characteristics of embryonic stem cells.

Example 5. Effect of leptin on the induction of the differentiation into induced pluripotent stem cells without using c-Myc

The following experiment was carried out to analyze the effect of leptin on the induction of dedifferentiation into induced pluripotent stem cells without using c-Myc.

More specifically, in the same manner as in Example 2, suppression of leptin expression simultaneously with the overexpression of Oct4, Sox2 and Klf4 in the absence of c-Myc expression in mouse somatic cells resulted in the inverse differentiation into induced pluripotent stem cells Respectively. In addition, leptin was overexpressed at the same time as overexpression of Oct4, Sox2 and Klf4 in the absence of c-Myc expression in mouse somatic cells in the same manner as in Example 3, leading to the inversion of pluripotent stem cells into induced pluripotent stem cells. After 42 days of inversion of somatic cells into induced pluripotent stem cells by the above two methods, colonies stained by alkaline phosphatase staining were quantified and analyzed. The results are shown in Fig. 10 to Fig.

As shown in FIG. 10, it was confirmed that when the expression of leptin was inhibited simultaneously with the overexpression of Oct4, Sox2 and Klf4 except for c-Myc in mouse somatic cells, it was not induced to induce the induction into induced pluripotent stem cells.

In addition, as shown in FIG. 11, it was confirmed that overexpression of Oct4, Sox2, Klf4 and leptin except for c-Myc in mouse somatic cells simultaneously induces the dedifferentiation efficiency from somatic cells to induced pluripotent stem cells.

Therefore, it was confirmed that leptin overexpression increases the induction efficiency of induction of differentiation into inducible pluripotent stem cells even if c-Myc expression is excreted, and that the suppression of leptin expression reduces the induction efficiency of induction of pluripotent stem cells into induced pluripotent stem cells Respectively.

<110> Pusan National University Industry-University Cooperation Foundation <120> Composition for inducing dedifferentiation for induced          pluripotent stem cells with Reptin and method for inducing          induced pluripotent stem cells using the same <130> pnu1-200 <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 463 <212> PRT <213> Amino acid sequence of Reptin <400> 1 Met Ala Thr Val Thr Ala Thr Thr Lys Val Pro Glu Ile Arg Asp Val   1 5 10 15 Thr Arg Ile Glu Arg Ile Gly Ala His Ser His Ile Arg Gly Leu Gly              20 25 30 Leu Asp Asp Ala Leu Glu Pro Arg Gln Ala Ser Gln Gly Met Val Gly          35 40 45 Gln Leu Ala Ala Arg Arg Ala Ala Gly Val Val Leu Glu Met Ile Arg      50 55 60 Glu Gly Lys Ile Ala Gly Arg Ala Val Leu Ile Ala Gly Gln Pro Gly  65 70 75 80 Thr Gly Lys Thr Ala Ile Ala Met Gly Ale Gln Ala Leu Gly Pro                  85 90 95 Asp Thr Pro Phe Thr Ala Ile Ala Gly Ser Glu Ile Phe Ser Leu Glu             100 105 110 Met Ser Lys Thr Glu Ala Leu Thr Gln Ala Phe Arg Arg Ser Ile Gly         115 120 125 Val Arg Ile Lys Glu Glu Thr Glu Ile Ile Glu Gly Glu Val Val Glu     130 135 140 Ile Gln Ile Asp Arg Pro Ala Thr Gly Thr Gly Ser Lys Val Gly Lys 145 150 155 160 Leu Thr Leu Lys Thr Thr Glu Met Glu Thr Ile Tyr Asp Leu Gly Thr                 165 170 175 Lys Met Ile Glu Ser Leu Thr Lys Asp Lys Val Gln Ala Gly Asp Val             180 185 190 Ile Thr Ile Asp Lys Ala Thr Gly Lys Ile Ser Lys Leu Gly Arg Ser         195 200 205 Phe Thr Arg Ala Arg Asp Tyr Asp Ala Met Gly Ser Gln Thr Lys Phe     210 215 220 Val Gln Cys Pro Asp Gly Glu Leu Gln Lys Arg Lys Glu Val Val His 225 230 235 240 Thr Val Ser Leu His Glu Ile Asp Val Ile Asn Ser Arg Thr Gln Gly                 245 250 255 Phe Leu Ala Leu Phe Ser Gly Asp Thr Gly Glu Ile Lys Ser Glu Val             260 265 270 Arg Glu Gln Ile Asn Ala Lys Val Ala Glu Trp Arg Glu Glu Gly Lys         275 280 285 Ala Glu Ile Pro Gly Val Leu Phe Ile Asp Glu Val His Met Leu     290 295 300 Asp Ile Glu Ser Phe Ser Phe Leu Asn Arg Ala Leu Glu Ser Asp Met 305 310 315 320 Ala Pro Val Leu Ile Met Ala Thr Asn Arg Gly Ile Thr Arg Ile Arg                 325 330 335 Gly Thr Ser Tyr Gln Ser Pro His Gly Ile Pro Ile Asp Leu Leu Asp             340 345 350 Arg Leu Leu Ile Val Ser Thr Thr Pro Tyr Ser Glu Lys Asp Thr Lys         355 360 365 Gln Ile Leu Arg Ile Arg Cys Glu Glu Glu Asp Val Glu Met Ser Glu     370 375 380 Asp Ala Tyr Thr Val Leu Thr Arg Ile Gly Leu Glu Thr Ser Leu Arg 385 390 395 400 Tyr Ala Ile Gln Leu Ile Thr Ala Ala Ser Leu Val Cys Arg Lys Arg                 405 410 415 Lys Gly Thr Glu Val Gln Val Asp Asp Ile Lys Arg Val Tyr Ser Leu             420 425 430 Phe Leu Asp Glu Ser Ser Ser Thr Gln Tyr Met Lys Glu Tyr Gln Asp         435 440 445 Ala Phe Leu Phe Asn Glu Leu Lys Gly Glu Thr Met Asp Thr Ser     450 455 460 <210> 2 <211> 1392 <212> DNA <213> nucleotide sequence of Reptin gene <400> 2 atggcaaccg ttacagccac aaccaaagtc ccggagatcc gtgatgtaac aaggattgag 60 cgaatcggtg cccactccca catccgggga ctggggctgg acgatgcctt ggagcctcgg 120 caggcttcgc aaggcatggt gggtcagctg gcggcacggc gggcggctgg cgtggtgctg 180 gagatgatcc gggaagggaa gattgccggt cgggcagtcc ttattgctgg ccagccgggc 240 acggggaaga cggccatcgc catgggcatg gcgcaggccc tgggccctga cacgccattc 300 acagccatcg ccggcagtga aatcttctcc ctggagatga gcaagaccga ggcgctgacg 360 caggccttcc ggcggtccat cggcgttcgc atcaaggagg agacggagat catcgaaggg 420 gaggtggtgg agatccagat tgatcgacca gcaacaggga cgggctccaa ggtgggcaaa 480 ctgaccctca agaccacaga gatggagacc atctacgacc tgggcaccaa gatgattgag 540 tccctgacca aggacaaggt ccaggccggg gacgtgatca ccatcgacaa ggcgacgggc 600 aagatctcca agctgggccg ctccttcaca cgcgcccgcg actacgacgc tatgggctcc 660 cagaccaagt tcgtgcagtg cccagatggg gagctccaga aacgcaagga ggtggtgcac 720 accgtgtccc tgcacgagat cgacgtcatc aactctcgca cccagggctt cctggcgctc 780 ttctcaggtg acacagggga gatcaagtca gaagtccgtg agcagatcaa tgccaaggtg 840 gctgagtggc gcgaggaggg caaggcggag atcatccctg gagtgctgtt catcgacgag 900 gtccacatgc tggacatcga gagcttctcc ttcctcaacc gggccctgga gagtgacatg 960 gcgcctgtcc tgatcatggc caccaaccgt ggcatcacgc gaatccgggg caccagctac 1020 cagagccctc acggcatccc catagacctg ctggaccggc tgcttatcgt ctccaccacc 1080 ccctacagcg agaaagacac gaagcagatc ctccgcatcc ggtgcgagga agaagatgtg 1140 gagatgagtg aggacgccta cacggtgctg acccgcatcg ggctggagac gtcactgcgc 1200 tacgccatcc agctcatcac agctgccagc ttggtgtgcc ggaaacgcaa gggtacagaa 1260 gtgcaggtgg atgacatcaa gcgggtctac tcactcttcc tggacgagtc ccgctccacg 1320 cagtacatga aggagtacca ggacgccttc ctcttcaacg aactcaaagg cgagaccatg 1380 gacacctcct ga 1392 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer of Reptin <400> 3 tcctagccga tttccgtttc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Reptin <400> 4 ggatctcagg gactttggtg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer of Oct4 <400> 5 ggaaagcaac tcagagggaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Oct4 <400> 6 ttctagctcc ttctgcaggg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer of Sox2 <400> 7 gcggagtgga aacttttgtc 20 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Sox2 <400> 8 tatttataat ccgggtgctc ctt 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer of Nanog <400> 9 cacccaccca tgctagtctt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Nanog <400> 10 accctcaaac tcctggtcct 20 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer of Zfp42 <400> 11 agtgtgcagt gcagccag 18 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Zfp42 <400> 12 tgctttcttc tgtgtgcagg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer of beta-actin <400> 13 gtgggccgct ctagacacca 20 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of beta-actin <400> 14 cggttggcct tagggttcag gggggg 26

Claims (7)

A composition for inducing the differentiation of a stem cell into an inducible pluripotent stem cell comprising a gene encoding a leptin protein or a leptin protein. The method according to claim 1,
Wherein the leptin protein comprises the amino acid sequence of SEQ ID NO: 1. The method according to claim 1,
Wherein the gene coding for the leptin protein comprises the nucleotide sequence shown in SEQ ID NO: 2. The method according to claim 1,
Wherein the leptin protein-encoding gene is contained in an expression vector. The method according to claim 1,
Wherein the composition comprises at least one protein selected from the group consisting of Oct4, Sox2 and Klf4; Or at least one gene coding for the protein. The composition for inducing the differentiation of stem cells into somatic-derived pluripotent stem cells. The method according to claim 1,
Wherein the inducible pluripotent stem cell has pluripotency or differentiation ability. And introducing the leptin gene into somatic cells.

Images