KR20090132236A - Method of manufacturing ips (induced pluripotent stem) cells using nonviral gene delivery system and use thereof - Google Patents

Abstract

PURPOSE: A method for establishing induced pluripotent stem cells through non-viral transformation is provided to induce induced pluripotent stem cells without virus and introduce gene with high efficiency. CONSTITUTION: A method for producing induced pluripotent stem cells comprises: a step of preparing gene vector relating to induced pluripotency; a step of introducing the induced pluripotent relating gene to a cell using a nanoparticle; a step of culturing stem cells containing LIF(leukemia inhibitory factor) in a culture device; and a step of replating the cells on a dish having a support cell. The cell is fibroblast. The support cell is STO embryonic fibroblast cell line of rat.

Description

Method for manufacturing induced pluripotent stem cells using nonviral transformation method and its use {Method of manufacturing iPS (induced pluripotent stem) cells using nonviral gene delivery system and use

The present invention relates to a method for establishing induced pluripotent stem cells using a non-viral transformation method and its use.

Stem cell research, which can differentiate into various cell tissues, has been focused on embryonic carcinoma cells since the 1960s, but only limited results were obtained due to the characteristics of tumor cells and unstable chromosomal conditions. After the establishment of mouse embryonic stem cells by MJ Evans, MH Kaufman, Establishment in culture of pluripotential cells from mouse embryos, Nature, 292, 154 ,.

In 1998 human embryonic stem cells were established by Thomson (JA Thomson, J Itskovitz-Eldor, SS Shapiro, et al., Embryonic stem cell lines derived from human blastocysts, Science, 282: 1145 1998.). Currently, many reports have identified adult stem cells with differentiation potential in various tissues of the human body, and they have been reported to have differentiation diversity. Stem cells are an important part of cell replacement therapy, which is the center of new regenerative medicine in the 21st century. It is considered a research project (Asahara T., Kalka C., Isner JM, Stem cell therapy and gene transfer for regeneration, Gene Therapy, 7: 451-457,2000)

If stem cells can be differentiated into various organs or tissues of the body, it is also possible to produce new cells that can regenerate or replace diseased tissues and organs. Especially, embryonic stem cells are expected to be most useful for treating diseases. It has been researched to treat various incurable diseases such as diabetes, heart disease, Alzheimer's disease, cancer and Parkinson's disease. In addition, a combination of animal cloning and human embryonic stem cell technology has facilitated the development of customized therapies to produce and clinically use stem cells from individual patients. These stem cells can be used for cell transplantation derived from allogeneic embryonic stem cells. It can overcome immune rejection and can be used as an experimental model for studying complex human diseases. However, there are ethical and technical limitations in applying these methods to the treatment of human diseases. Therefore, methods for reprogramming somatic cells into different cells rather than using stem cells are being studied.

Induced pluripotent stem cells (iPSc) dispel the ethical controversy surrounding embryonic cells and provide an opportunity to study therapeutic stem cells for treatment.Aug. 2006 By inserting Oct4, Sox2, c-Myc, and Klf4 into mouse fibroblasts, primitive cells similar to embryonic stem cells were generated. These cells were named induced Pluripotent Stem cells (iPSc) (Takahashi K, Yamanaka S). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.Cell. 126 (4): 663-76. 2006). This is significant because it has succeeded in culturing pluripotent cells that function like embryonic stem cells using skin cells without duplicating or destroying human embryos. Mixing and processing branch key transcription factors has been shown to be reprogramming into stem cells that can differentiate into various cells. However, the experimental procedure used in this paper can cause cancer because c-Myc oncogene randomly intersects various parts of the cell genome. Therefore, there is a limit to the clinical use of stem cells converted to c-Myc due to these safety issues. The latest issue of Nature Biotechnology (Nakagawa 2008) reported the derivation of induced pluripotent stem (iPS) cells from mice and human fibroblasts without the use of oncogenes. Chimeric mice produced by injecting iPSc generated without c-Myc into blastocysts have a lower incidence of tumors than mice made with iPSc expressing c-Myc. Two recently published papers (Nakagawa, M., Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., Okita, K., Mochiduki, Y., Takizawa, N., and Yamanaka, S. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts.Nature biotechnology 26: 101-106, 2008.Meissner, A., Wernig, M., and Jaenisch, R. Direct reprogramming of Genetically unmodified fibroblasts into pluripotent stem cells.Nature biotechnology 25: 1177-1181, 2007.) presents the results of reprogramming human fibroblasts with genes into stem cells. Commonly used genes in these two papers were Oct4 and Sox2, key factors that regulate stem cell states. In this study, no oncogenes such as c-Myc were used, but since the Oct4 or Sox2 genes also randomly intervene in the genome, there is the potential for mutations and reactivation after reprogramming, which may adversely affect cell differentiation. have. Another approach is to identify and use small molecules that induce reprogramming of fibroblasts using chemical compound libraries. Recent studies report that human iPSc can form teratoma (Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, BE, and Jaenisch, R. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state.Nature 448: 318-324, 2007). However, from a scientific point of view, there are some problems. First, there is a need to develop a method for short-term expression and reprogramming of genes rather than permanently inserting them into the genome. Second, to induce iPSc, There is a possibility that reverse transcriptase may need to be integrated into specific loci of the gene. Finally, iPSc appears to require minor genetic changes or epigenetic changes that cannot be detected in karyotype analysis.

The present invention solves the above problems, and the object of the present invention as devised by the necessity of the above, while avoiding ethical problems such as embryo destruction or oocyte donation, it is possible to create a customized pluripotent stem cells for each patient / disease In view of safety problems, including carcinogenicity caused by underlying and reverse transcriptase viruses, it provides a new method for introducing genes that is economical, simple, high in gene transfer efficiency, and stable in gene expression.

The present invention to achieve the above object

(a) cloning a gene associated with induction pluripotency into a vector to prepare an induced pluripotency related gene vector; And

(b) providing a method for producing induced pluripotent stem cells into which an induced pluripotency related gene has been introduced by introducing the induced pluripotency related gene into a cell using nanoparticles using the induced pluripotency related gene vector and the combined vector. .

In the present invention, the method of claim 1, wherein the method is added to the stem cell culture medium containing the LIF after step (b) and cultured in the incubator, the cells in a dish on which the supporting cells are laid And further comprising the step of replating.

In the present invention, the induced pluripotency-related gene is preferably Oct4 (Pouf5f1), Sox2 (SRY-box containing gene 2), Klf4 (Kruppel-like factor 4, or c-Myc (myelocytomatosis oncogene), but is not limited thereto. Not.

In one embodiment of the present invention, the cells are preferably fibroblasts, but not limited thereto, and the fibroblasts are more preferably mouse fibroblasts, but are not limited thereto.

The nanoparticles are made of iron oxide coated with a polymer such as cationic polymer polyethyleneimine (PEI) (magnetic Fe ₃ O _4). Nanoparticles) (Chemicell, Germany, product name: Magnetofection ^™ ), the size of which is preferably 100 to 200 nm in diameter, and the polymer concentration is w / v: 1 mg / mlT. The number of particles per mg can be calculated using the formula, according to the particle size (100 nm-200 nm) of the present invention the number of particles is about 1,800E + 15 (100 nm) Particles / gram; 2,202E + 14 (200 nm) Particles / gram, but not limited to.

In addition, in the present invention, the support cells are mouse STO cell line (embryonic fibroblast cell line), hES cells (human embryonic stem cells, human embryonic stem cells), hNP cells (human neural progenitor, human neural stem or neuroprogenitor cells) And it is preferably at least one cell selected from the group consisting of hNPST-1 cells (cells combined with hNP and STO), the support cell is more preferably an embryonic fibroblast cell line of the mouse (but not limited to this) .

The present invention also provides an induced pluripotent stem cell produced by the method of the present invention.

Hereinafter, the present invention will be described.

The present invention provides a method of cloning four genes related to induced pluripotency into a vector to prepare an induced pluripotency related gene vector, using the induced pluripotency related gene vector and a combined vector to induce pluripotency related genes using nanoparticles. Provided is a method for producing induced pluripotent stem cells to which the induced pluripotency related gene has been introduced by transfection into mouse fibroblasts.

Induced pluripotency related gene-introduced stem cells and a method for producing the same according to the present invention can induce induced pluripotent stem cells without using a virus for generation of patient-specific stem cells. It is also economical and simple, and has high efficiency of gene introduction.

Hereinafter, the present invention will be described in more detail with reference to non-limiting examples.

DMEM and DMEM / F12 used in the present invention were purchased from Invitrogen. STO cells were purchased from ATCC. Fetal bovine serum was purchased from Hyclone and retinoic acid, glutamine, penicillin and streptomycin, and DAPI were purchased from Sigma. Leukemia inhibitory factor (LIF) was purchased from Chemicon, nanoparticles from chemicell, and basic fibroblast growth factor from Koma Biotech. Oct-4, SSEA-1, Brychury, and HNF antibodies were purchased from Santa Cruz, and β-tubulin III was purchased from Sigma-Aldrich.

Mouse embryonic fibroblasts (MEFs) were mated to c57BL 6-week-old mice, and 3 weeks later, embryos were harvested and surgically disclosed. PGEM-T easy and pcDNA3 vectors used for cloning were purchased from invitrogen.

Production Example : magnetic Fe ₃ O ₄ Preparation of Nanoparticles

Nanoparticles of the present invention is iron oxide coated with cationic polymer polyethyleneimine (PEI) (magnetic Fe ₃ O ₄ Nanoparticles) (Chemicell, Germany, product name: Magnetofection ^™ ) was used.

Example  1: From embryonic stem cells total RNA  extraction

1 ml of Trizol reagent (manufactured by Trizol reagent Sigma) was added to the recovered embryonic stem cells, and left at room temperature for 5 minutes to destroy cells to elute cell contents. 200 ul of chloroform was added and mixed, and the mixture was left at room temperature for 15 minutes and centrifuged at a rotational speed of 1300 rpm for 15 minutes at a temperature of 4 degrees Celsius to recover only the supernatant except the precipitation site, which is a solid body of DNA and protein. It was. Next, 500 ul of isopropanol was further added and left at room temperature for 10 minutes, followed by centrifugation at a rotational speed of 1300 rpm for 10 minutes at a temperature of 4 degrees Celsius to remove the remaining chloroform components. After washing with 1 ml of 75% EtOH and centrifuged at 8000 rpm for 5 minutes at 4 degrees Celsius, the supernatant was removed and the pellet was dried. Then, the pellet was dissolved in 20 ul of DEPC (diethyl pyrocarbonate) water to prepare total RNA.

Example  2: Reverse transcription  Polymerase chain reaction ( RT - PCR With) Induction pluripotency  Cloning of related genes cloning )

(1) cDNA synthesis

In order to synthesize cDNA, 5 ug of total RNA and oligo dT 2 ul were mixed and reacted at 70 ° C. for 5 minutes, and then left at 4 ° C. for 5 minutes. 5.6 ul of water, MLVv RT 5X buffer 4 ul, 25 mM magnesium chloride (MgCl ₂ ) 2.4 ul, 10 mM dNTP 1 ul, RNasin Ribonuclease inhibitor 1 ul and MLV-RTase reverse transcriptase (promega) 1 ul mixed reverse transcription mixture (reverse transcription mixture) prepared It was. 15 ul of the reverse transcription mixture was further added to the mixture of total RNA and oligo dT, followed by annealing at 25 ° C. for 5 minutes, extending at 37 ° C. for 60 minutes, and MLV- for 15 minutes at 70 ° C. RTase reverse transcriptase was inactivated.

(2) Reverse Transcription Polymerase Chain Reaction (RT-PCR)

Synthesized cDNA was repeated 30 cycles for 15 minutes at 95 ℃, 1 minute at 53 ℃, 1 minute at 72 ℃ using I-Taq polymerase (manufactured by Taq polymerase invitrogen), 5 at 72 ℃ It was extended for minutes. Primers used for gene cloning include mOCT4 (F-EcoRI: gaattcatggctggacacctggcttcag (SEQ ID NO: 1), R-NotI: gcggccgcttaaccccaaagctccaggttc (SEQ ID NO: 2)), Sox2 (F-EcoR1: ggggga gagatct atagata Number 3) R-Sal I: gggaa gtcgac tcacatgtgcgacaggggcagtgtgcc (SEQ ID NO: 4)), Klf4 (F-EcoR I: gggaa gaattct atgaggcagccacctggcgagtctgac (SEQ ID NO: 5) R-Sal I: gggaa gtcgac ttaaaagtgta cgt MYC (F-EcoR I: gggaa gaattct ctggatttcctttgggcgttggaaacc (SEQ ID NO: 7) R-Sal I: gggaa gtcgac ttatgcaccagagtttcgtcgaagctgttc (SEQ ID NO: 8)) was used. After PCR, the DNA band was electrophoresed, stained with ethidum bromide, and observed under ultraviolet (UV) light. T-vector cloning was performed.

(3) recombination into expression vectors

  Four induced pluripotency related genes (Oct4, Sox2, Klf4, c-Myc) were cloned into T-vector and recombined into pcDNA 3 and pDS-xb GFP expression vectors, respectively (see FIGS. 1A and 1B).

Example  3: Gene introduction using nanoparticles into mouse fibroblasts

Total 2 ug of nanoparticles and four cloned induced pluripotent genes (Oct4: Sox2: Klf4: c-Myc) were 1: After mixing at a ratio of 1: 1: 1, the mixture is left at room temperature for 15 minutes, and then applied to mouse fibroblasts (1x10 ⁴ / ml) pre-cultured in a 96 well culture vessel, and then formed a magnetic field in the vertical direction of the culture vessel. Nanoparticles and gene conjugates were introduced into MEF cells for 15 minutes using. After the introduction, the mixed solution was removed and the stem cell culture solution (DMEM + 15% FBS + antibiotics + NEAA) containing LIF related to the autologous proliferation of mouse stem cells was added to the incubator.

Example  4: induction Versatility  Establishment of Stem Cells

Six days after the gene was introduced, the cells were separated by trypsin treatment, and then replated in a dish coated with STO support cells at a concentration of 1 × 10 ⁴ / ml. After replating, the cells were replaced with a stem cell culture solution every two days. Each colony was physically recovered and replated in a dish on which new support cells were laid. From this time it was named subculture 1.

Example  5: Weston Blotting

Extraction of protein samples for electrophoresis was performed by washing the induced pluripotent stem cells with ice-cold Tris buffered saline (TBS; 20 mM Tris-HCl, pH 8.0, 137 mM NaCl) three times, followed by lysis buffer (TBS, 1). % NP-40, 1 mM sodium orthovanadata, 10 μg / ml leupeptin and 1 mM PMSF) were added and reacted at 4 ° C. for 20 minutes and centrifuged at 12,000 × g for 15 minutes. After measuring the absorbance at 562 nm using a protein quantitative kit, the protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with the same amount of protein, and then the protein was transferred to nitrocellulose membrane. The membrane was reacted for 1 hour in a blocking buffer (TBS solution containing 5% non-fat milk and 0.1% Tween 20) to block nonspecific binding of the antibody, followed by addition of an antibody to each test protein. The reaction was carried out for 2 hours. Subsequently, the cells were washed three times for 10 minutes with a TBS-T solution containing 0.1% Tween 20. Then, peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG was reacted with a secondary antibody for 1-2 hours. After washing three times for 10 minutes with a TBS-T solution containing 0.1% Tween 20, and then reacted with an ECL system, the protein was verified on an X-ray film. Protein quantification of each sample was performed by measuring the absorbance at 565 nm using a BCA protein assay kit.

Example  6: immunological cell staining

For immunological cell staining, induced pluripotent stem cells were fixed in 4% paraformaldehyde solution and treated with 0.2% Triton X-100 solution for 10 minutes. Thereafter, washing with PBS was performed for 1 hour in 10% normal goat serum solution. The primary antibody was reacted overnight at 4 ° C. and washed with PBS for 1 hour with a secondary antibody labeled with fluorescent material. After washing with PBS several times, it was mounted on the cover glass using a mounting solution containing DAPI and observed under a fluorescence microscope.

Example  7: RT - PCR

In order to synthesize cDNA, 5 ug of total RNA and oligo dT 1 ul were mixed and reacted at 70 ° C. for 5 minutes and then left at 4 ° C. for 10 minutes. 5.6 ul of water, MLV- RT 5X buffer 4 ul, 25 mM magnesium chloride (MgCl ₂ ) A reverse transcription mixture was prepared in which 2.4 ul, 10 mM dNTP 1 ul, RNasin Ribonuclease inhibitor 1 ul, and 1 ul of MLV-RTase reverse transcriptase (manufactured by reverse transcriptase Promega) were mixed.

15 ul of the reverse transcription mixture was further added to the mixture of total RNA and oligo dT, followed by annealing at 25 ° C. for 5 minutes, extending at 37 ° C. for 60 minutes, and MLV- for 15 minutes at 70 ° C. RTase reverse transcriptase was inactivated.

Synthesized cDNA was amplified for 30 cycles at 55-60 ° C using I-Taq polymerase (manufactured by Taq polymerase invitrogen). Primer sequences used are as follows. HA (5-tac cca tac gat gtt cca gat tac gct -3 (SEQ ID NO: 9)); Oct-4 (499 bp, up, 5-ctc ttt gga aag gtg ttc ag-3 (SEQ ID NO: 10), down, 5-tca gga aaa ggg act gag ta -3 (SEQ ID NO: 11)); Nanog (450 bp, up, 5-cag atg caa ctc tcc tc-3 (SEQ ID NO: 12), down, 5-aat tca cct cca aat cac tg-3 (SEQ ID NO: 13)); Brachyury (230 bp, up, 5-gag aga gcg agc ctc caa ac-3 (SEQ ID NO: 14), down, 5-gct gtg act gcc tac cag aat g-3 (SEQ ID NO: 15)); Fectoprotein (466 bp, up, 5-atg tat gcc cca gcc att ctg tcc -3 (SEQ ID NO: 16), down, 5-gag ata agc ctt cag gtt tga cgc-3 (SEQ ID NO: 17)). Sox1 (250 bp, up, 5-aga acc cca aga tgc aca ac-3 (SEQ ID NO: 18), down, 5-gcc agc gag tac ttg tcc tt-3 (SEQ ID NO: 19)) G3PDH (450 bp, up, 5-gtc gtg gag tct act ggt gt-3 (SEQ ID NO: 20), down, 5-gtc atc ata ctt ggc agg tt-3 (SEQ ID NO: 21).

The result of the above example is as follows.

Judo Versatility  Introduction and testing of related genes

First, the cloned IPS gene was transfected into mouse fibroblasts using nanoparticles, and as a result, expression of the GFP protein tagged in the introduced gene was confirmed as shown in FIG. 2. Therefore, it was confirmed that the transduced gene was stably expressed in mouse fibroblasts.

Judo Versatility Stem cell line  Establish

Nanoparticles and four cloned induced pluripotency genes were mixed and applied to mouse fibroblasts (1 X 10 ⁴ / ml), transduced on a magetic plate, and then the mixed solution was removed and a stem cell culture containing LIF was added. After injecting into the incubator and incubated. After transduction, the cells were separated by trypsin treatment, replated in a dish coated with STO support cells at a concentration of 1 X 10 ⁴ / ml, and replaced with cultured stem cells every two days. Each colony was physically recovered and replated in a dish with new donor cells. After passage in the indicator cells, cell lines in which colonies were formed and maintained in the form similar to those of stem cells were established at the 4th passage.

Established iPS  In the cell line RT - PCR Analysis of Endogenous Gene Expression Using

RT-PCR was performed to analyze the gene expression patterns of established cell lines. It was confirmed that all endogenous iPS-related genes (Oct4, Sox2, Klf4, c-Myc) were expressed in established iPS cells. In cultured cells (up to passage 8), four exogenous iPS genes used for transformation were expressed. However, these four exogenous genes were not expressed in cell lines passaged over 15 passages (Figure 4).

Established iPS  In cell lines Western blotting Expression Analysis of Endogenous Gene Proteins

As a result of performing Westerm blotting to confirm the protein expression pattern of the induced pluripotency related genes, the protein expression of the induced pluripotency related gene was not confirmed or low in the MEF control group as shown in FIG. 5. However, it was confirmed that the expression of induced pluripotency-related proteins in the established induced pluripotent cell lines L1 and L3 was similar to that of embryonic stem cell line D3. From these results, it was confirmed that the iPS cell line using MEF established by the present inventors was established through reprogramming to induced pluripotent stem cells.

Established induction Versatility  Stem cell Omnipotence  black

As a result of re-validation through immunological cell staining to verify the pluripotency of the cell line established through gene and protein expression analysis, the expression of pluripotency-related markers Oct4 and SSEA1 was similar to that of gene and protein expression verification. It was confirmed that it is expressed as high. Therefore, even when iPS cells were generated by transforming mouse fibroblasts through gene introduction using nanoparticles, these cells were expected to have the potential of stem cells.

Established Induction Through Immunological Cytostaining Versatility  Stem Cell Attention Omnipotence  black

In order to investigate the formation of embryonic body (embryonic body), one of the characteristics of stem cells using the cell line, as a result of culturing in a bacterial culture tank for 4 days, as shown in FIG. Confirmed that it can.

Established induction Versatility  Stem cell Tricotyledonous  Differentiation Test

Induction of differentiation from embryonic body formation to trioderm using established induced pluripotent stem cells resulted in the expression of all three ectoderm (Ectoderm: Tuj1, Mesoderm: Brachury, Endoderm: HNF) markers through immunological cell staining. I could confirm it. In addition, as a result of examining the expression pattern of the trioderm genes, it was confirmed that each marker gene is expressed by the RT-PCR method (FIG. 8).

1 is a diagram showing the structure of an expression vector used for recombination; Schematic diagram of the pcDNA3 (FIG. 1A) and pds_XB GFP (FIG. 1B) expression vectors used to synthesize four genes,

Figure 2 is a photograph showing the confirmation of IPS gene expression in MEF cells; Photograph confirming the expression of the IPS gene through the expressed GFP fluorescence protein when observed under fluorescence microscope 48 hours after transduction using nanoparticles in MEF cells,

3 is a photograph showing cell line establishment having iPS cell morphology formed from MEF cells; Photo showing several ips cell lines generated after passage in STO support cells after transduction using nanoparticles,

Figure 4 is a photograph showing the endogenous gene expression analysis using RT-PCR in the established iPS cell line; The top left picture shows the expression analysis of the endogenous IPS-related genes in the established cell line. The GFP fluorescent gene is not expressed at the 15th passage. Figure 4 shows the expression of four endogenous ips-related genes by RT-PCR. The picture below shows the expression of the transduced genes expressed at the 8th passage through RT-PCR.

5 is a photograph showing endogenous gene protein expression analysis using Western blotting in established iPS cell lines; Analysis of protein expression of four IPS-related genes in established cell lines by Western blotting assayed in MEF cells and IPS cell lines.

6 is a photograph showing an omnipotent assay of established induced pluripotent stem cell lines via immunological cell staining; Photopotential assay using immunological cell staining using oct4 and SSEA1 antibodies, which are omnipotent markers of stem cells,

7 is a photograph of the embryogenic formation ability of the established induced pluripotent stem cell line through immunological cell staining; Photograph showing the shape of the embryoid body formed by inducing suspension culture for 4 days to determine the embryonic body forming ability of the established cell line,

Figure 8 is a photograph showing the trioderm differentiation assay of the established induced pluripotent stem cells.

In order to test the differentiation ability from the formed embryoid body to ectoderm, endoderm and mesoderm, cells formed by differentiation induction after floating culture for 4 days were assayed through immunological cell staining (FIG. 8A) and the bottom photo (FIG. 8B). Triploid gene expression was assayed by RT-PCR.

<110> Konkuk University Industrial Cooperation Corp. <120> Method of manufacturing iPS (induced pluripotent stem) cells          using nonviral gene delivery system and use <160> 21 <170> KopatentIn 1.71 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> F-EcoRI <400> 1 gaattcatgg ctggacacct ggcttcag 28 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> R-NotI <400> 2 gcggccgctt aaccccaaag ctccaggttc 30 <210> 3 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> F-EcoR1 <400> 3 gggaagaatt ctatgtataa catgatggag acggag 36 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> R-Sal I <400> 4 gggaagtcga ctcacatgtg cgacaggggc agtgtgcc 38 <210> 5 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> F-EcoR I <400> 5 gggaagaatt ctatgaggca gccacctggc gagtctgac 39 <210> 6 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> R-Sal I <400> 6 gggaagtcga cttaaaagtg cctcttcatg tgtaag 36 <210> 7 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> F-EcoR I <400> 7 gggaagaatt ctctggattt cctttgggcg ttggaaacc 39 <210> 8 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> R-Sal I <400> 8 gggaagtcga cttatgcacc agagtttcgt cgaagctgtt c 41 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HA <400> 9 tacccatacg atgttccaga ttacgct 27 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oct-4 <400> 10 ctctttggaa aggtgttcag 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oct-4 <400> 11 tcaggaaaag ggactgagta 20 <210> 12 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Nanog <400> 12 cagatgcaac tctcctc 17 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nanog <400> 13 aattcacctc caaatcactg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Brachyury <400> 14 gagagagcga gcctccaaac 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Brachyury <400> 15 gctgtgactg cctaccagaa tg 22 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Fectoprotein <400> 16 atgtatgccc cagccattct gtcc 24 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Fectoprotein <400> 17 gagataagcc ttcaggtttg acgc 24 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sox1 <400> 18 agaaccccaa gatgcacaac 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sox1 <400> 19 gccagcgagt acttgtcctt 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> G3PDH <400> 20 gtcgtggagt ctactggtgt 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> G3PDH <400> 21 gtcatcatac ttggcaggtt 20  

Claims (10)

(a) cloning a gene associated with induction pluripotency into a vector to prepare an induced pluripotency related gene vector; And (b) A method of producing induced pluripotent stem cells into which an induced pluripotency related gene has been introduced by introducing an induced pluripotency related gene into a cell using nanoparticles using the induced pluripotency related gene vector and the combined vector. The method according to claim 1, wherein the method further comprises the step of (b) adding a stem cell culture medium containing LIF and culturing in an incubator and replating the cells in a dish on which support cells are laid. Method for producing pluripotent stem cells. The method of claim 1, wherein the induced pluripotency related gene is Oct4, Sox2, Klf4, or c-Myc. The method of claim 1, wherein the cells are fibroblasts. The method of claim 4, wherein the fibroblasts are mouse fibroblasts. The method of claim 1, wherein the nanoparticles are made of magnetic iron oxide coated with a polymer. The method of claim 6, wherein the polymer is a cationic polymer polyethyleneimine (PEI). 3. The method of claim 2, wherein said support cell is an embryonic STO cell line (embryonic) fibroblast cell line), hES cells (human embryonic stem cells), hNP cells (human neural progenitors) or hNPST-1 cells (hNP and STO cells combined) Method for producing induced pluripotent stem cells, characterized in that at least one cell selected from the group. The method of claim 8, wherein the support cell is an STO cell line (embryonic fibroblast cell line) of a mouse. Induced pluripotent stem cells produced by the method of claim 1 or 2.

Images