KR20160056209A - Primer set for detection of Clostridium botulinum, composition, and kit comprising the same - Google Patents

Abstract

The present invention relates to a primer set for a polymerase chain reaction of a coding gene for the light chain area of a Clostridium botulinum toxin type C, a composition for detection of botulinum type C/D and type C including the primer set, and a detection kit including the primer set. When a single tube double polymerase chain reaction is performed using a primer set of the present invention, wherein the primer set that binds with both a gene that codes for N-terminals of Clostridium botulinum toxin type C/D and C proteins, and an oligonucleotide that suppresses nonspecific reactions, the sensitivity to botulinum can be improved and the detection threshold can be lowered, therefore, the detection can be performed rapidly without the enrichment process.

Description

TECHNICAL FIELD The present invention relates to a primer set for the detection of botulinum toxin of Clostridium botulinum, a detection composition containing the primer set, and a detection kit for detecting Clostridium botulinum,

The present invention is Clostridium botulinum (Clostridium botulinum toxin small set C / D and C detection primers, oligonucleotides, detection compositions containing them, detection kits, and methods for providing information for diagnosis.

Clostridium botulinum (Clostridium botulinum ) is an anaerobic bacterium, and the botulinum toxin produced by this bacterium causes an animal's relief paralysis. The exotoxin of Clostridium botulinum blocks the synaptic release of acetylcholine from the neuromuscular junction or the autonomic nerve synapse, resulting in botulism (botulism).

Clostridium botulinum is classified into A, B, C, D, E, F and G types based on the antigen specificity of the resulting neurotoxin and classified into four groups based on its metabolism and serological basis. Group I consisted of strains with strong proteolytic activity, including protein degradation types A, B, and F. Group II consisted of strains without protein degradation, and consisted of all E type, and B and F non-resolving strains. Group III contains poisons C and D, Group IV is mainly isolated from the soil, and no botulism has been reported.

Doxoidal C / D and C correspond to biochemical group III. A feature of this group is that the gene of the toxin is transmitted by bacteriophage and is present in the form of a plasmid in bacteria. Botulism caused by poisonous C / D and C causes laxative paralysis of livestock and high mortality from infestation in birds and other livestock. From 2004 to 2008, botulism occurred in five wild birds, and there was a lot of mortalities. Since 2012, it has been endemic to domestic chickens, pheasants, ducks, geese and quails,

Because the causative bacteria are able to generate spores and are difficult to remove during contamination, and because the bacteria are cultured in the cecum and are discharged into the feces, rapid culling of the affected shaft is the best way to reduce the damage to date. Clostridium botulinum is resistant to disinfectants other than disinfectants based on hydrogen peroxide, formalin, flood (aqueous solution of hydrogen peroxide), hypochlorous acid, etc., at temperatures above 70 degrees in apohedral form.

As a method for analyzing Clostridium botulinum, the method currently recommended by the International Bureau of OIE is a mouse neutralization test, which is not only low in sensitivity of detection but also has a disadvantage that it is difficult to prepare countermeasures through rapid detection . In Europe, however, sensitive detection methods have been developed using real-time polymerase chain reaction (PCR), but the use of expensive consumables and equipment and the use of purely purified DNA Is a disadvantage.

There is a need for a method capable of detecting and isolating Clostridium botulinum with high sensitivity, short detection time and low cost by solving the above problems.

An object of the present invention is to provide a primer or a primer set for a polymerase chain reaction for amplifying a gene encoding a light chain region of toxin protein C of Clostridium botulinum. Clostridium botulinum, which contains a gene encoding the light chain region of the toxin protein C, is a poisonous C or poisonous C / D.

It is still another object of the present invention to provide a nonspecific reaction-suppressing oligonucleotide of a toxin protein gene polymerase chain reaction of Clostridium botulinum toxin small C / D and C wherein the oligonucleotide set comprises a nucleic acid sequence of the primer set And some complementary nucleic acid sequences.

It is another object of the present invention to provide a composition for the detection of Clostridium botulinum toxin small C / D and C.

Another object of the present invention is to provide a kit for the detection of Clostridium botulinum toxin small C / D and C.

It is another object of the present invention to provide a method for detecting toxin protein genes of Clostridium botulinum toxin small C / D and C.

The present inventors investigated genetic detection methods of Clostridium botulinum. When the polymerase chain reaction was performed using a primer set commonly bound to the N-terminus of botulinum toxin small C / D and C toxin genes, It was confirmed that the sensitivity could be improved without the coagulation process, the contamination by the external environment was blocked, and the detection rate of Clostridium botulinum was significantly increased and selectively detected.

In addition, when the oligonucleotide for suppressing non-specific reactions is added to the above-mentioned polymerase chain reaction, the nonspecific reaction that occurs during the polymerase chain reaction is more preferably inhibited. For example, single tube nested polymerase chain reaction (single tube nested PCR) is preferable.

The present invention is Clostridium botulinum (Clostridium a primer or a primer set for a polymerase chain reaction for amplification of the light chain region of the toxin protein C of botulinum . Clostridium botulinum, which contains a gene encoding the light chain region of the toxin protein C, is a poisonous C or poisonous C / D.

Specifically, the primer includes at least one selected from the group consisting of polynucleotides consisting of the nucleic acid sequences of SEQ ID NO: 1 to SEQ ID NO: 4, for example, a primer set consisting of the nucleic acid sequences of SEQ ID NOs: 1 and 2, And a nucleic acid sequence represented by SEQ ID NOS: 3 and 4, respectively. Preferably, the primer binds to a gene encoding a light chain region located at the N-terminus of the toxin protein of Clostridium botulinum toxin small C / D and C. The polymerization reaction is preferably a nested-PCR, for example, a single-tube double-polymerase chain reaction, wherein an outer-primer set consisting of the nucleic acid sequences of SEQ ID NOS: 1 and 2 and an inner- Primer set.

Name of the primer The base sequence (5 '- > 3') Amplification Size (bp) BCSTNP out F AGCTAATGAGCCTGAAAAAGCCTTTCGCAT (SEQ ID NO: 1) 424 BCSTNP out R AGCACCAAATCCTTCTTGTGCCGCAAA (SEQ ID NO: 2) BCSTNP in F CTCGAGTTACAAGCCC (SEQ ID NO: 3) 256 BCSTNP in R ACCCAGTTGTTACCTT (SEQ ID NO: 4)

As used herein, the term "primer" refers to a primer that is hybridized under appropriate conditions in a suitable buffer solution (for example, four different nucleotide triphosphates (dNTPs) and a polymer such as DNA, RNA polymerase or reverse transcriptase) Quot; refers to single stranded oligonucleotides that can serve as a starting point for directed DNA synthesis.

Generally, the length of the primer is closely related to the temperature at which the template and the stable hybrid are formed. Generally, the longer the length, the higher the temperature. It may vary depending on the purpose of use, but usually has a length of 15 to 40 nucleotides. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

A primer set composed of the nucleic acid sequences of SEQ ID NOs: 1 and 2 is prepared as a primer set for the first PCR reaction, which can obtain amplification products of 424 base pairs each of the C / D toxin gene and the C toxin gene. In the case of the primer for the first round of PCR, the annealing temperature can be specifically bound to each amplification target gene at a temperature of 68 to 74 ° C, preferably 72 ° C.

In addition, a primer set (SEQ ID NOS: 3 and 4) for a secondary PCR reaction, which can obtain an amplification product of 256 bases each of C / D toxin gene and C toxin gene, was prepared, Primer set can be specifically bound to each gene at a temperature of 50 to 60 ° C, or 52 to 58 ° C, and can specifically bind to each gene at 58 ° C, for example.

A schematic diagram showing the position of a PCR primer set for specifically detecting C / D toxin gene and C toxin gene is shown in FIG. The botulinum neurotoxin (BoNT) consists of a heavy chain (H chain) domain with a molecular weight of about 100 kDa and a light chain domain with a molecular weight of about 50 kDa. The heavy chain domain includes C-terminal heavy chain (Hc) and N-terminal heavy chain (Hn) rules. As shown in FIG. 1, the primer set may bind to a light chain of a C-type toxin protein and a C / D toxin protein to produce a toxin gene-specific amplification product.

The present invention also relates to a method of amplifying a toxin gene using a primer set that binds to a gene coding for a toxin protein N terminus of Clostridium botulinum toxin small C / D and C, wherein the primer set is non- , And provides a nonspecific amplification-suppressing oligonucleotide or oligonucleotide set.

The nonspecific amplification-suppressing oligonucleotide set may be complementarily bound to each of 15 to 30 consecutive nucleic acid sequences of the nucleic acid sequence of the outer-primer, and two or three bases located at one end thereof may be complementary to the outer- - contains the base and non-complementary sequence of the nucleic acid sequence of the primer. Specifically, the set of oligonucleotides comprises a base complementary to 15 to 30 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 1 in the outer-primer set, and at least one terminal has two or three non-complementary bases And a base complementary to 15 to 30 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 2, wherein at least one of the two oligonucleotides comprises two or three non-complementary bases Or a nonspecific amplification inhibiting oligonucleotide set comprising an oligonucleotide comprising a nucleotide sequence complementary thereto.

In a specific example, the nonspecific amplification-suppressing oligonucleotide set may comprise a nucleic acid sequence represented by SEQ ID NO: 5 or 6. The oligonucleotide can be specifically bound to each gene at a temperature of 50 to 60 ° C or 52 to 58 ° C. For example, the oligonucleotide can specifically bind to each gene at 58 °, Are shown in Table 2 below.

designation The base sequence (5 '- > 3') BCSTNP anti F CATATGCGAAAGGCTAAA (SEQ ID NO: 5) BCSTNP anti R TGATTTGCGGCACAACTT (SEQ ID NO: 6)

For example, in the nested-PCR reaction, the nonspecific amplification-suppressing oligonucleotide set according to the present invention is hybridized with the outer-primer set, and then, in the secondary amplification reaction with the inner-primer set, the outer- And the set of oligonucleotides includes an outer-primer set and a non-complementary base so that the amplified product can be used as an additional PCR reaction It can not act as a primer.

The term "polymerase chain reaction (PCR) " in the present invention refers to a method of amplifying a target nucleic acid from a primer set that specifically binds to a target nucleic acid using a polymerase, It is one. The polymerase chain reaction is preferably a single tube double polymerase chain reaction, but is not limited thereto.

In one embodiment, a primer set that binds to a gene encoding the N-terminus of a toxin protein of Clostridium botulinum toxin small C / D and C according to the present invention, and a set of single-tube duplexes using a nonspecific inhibitory oligonucleotide set. When polymerase chain reaction is performed, the sensitivity to botulism is improved to have low detection limit, to shorten the detection time, to prevent contamination by the external environment, and to be specific for toxic C / D and C , Which can be useful for disease control through rapid detection of botulism in birds and livestock.

Further, the present invention provides an inner-primer set comprising an outer-primer set consisting of the nucleic acid sequence shown in SEQ ID NO: 1 and 2 and a nucleic acid sequence shown in SEQ ID NO: 3 and 4; And an oligonucleotide comprising a base complementary to 15 to 30 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 1 in the outer-primer set, wherein at least one of the oligonucleotides comprises 2 or 3 bases, And a nucleotide sequence complementary to a consecutive 15 to 30 nucleotide sequences of the nucleotide sequence of SEQ ID NO: 2 among the outprimmer sets, wherein at least one terminal thereof comprises an oligonucleotide comprising 2 or 3 bases Specific inhibitory oligonucleotides, and the non-specific inhibitory oligonucleotides may have a size of about 17 bases to 36 bases.

For example, a composition for detection of Clostridium botulinum toxin small C / D and C comprising the oligonucleotide set of SEQ ID NOS: 5 and 6, or a detection kit.

The composition or kit can detect, but is not limited to, agents including botulism infected individuals and environmental agents. The infected individual may be, but is not limited to, one or more species selected from the group consisting of algae and mammals, for example, rheumatoid or primate.

The composition or kit for the toxin gene amplification of Clostridial botulinum toxin small C / D and C may optionally contain reagents necessary for nucleic acid amplification, such as a buffer DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth) Thermostable DNA polymerases obtained from Thermus filliformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu), DNA polymerase joins, and four other nucleotide triphosphates (dNTPs). The kit may also be made from a number of separate packaging or compartments containing the reagent component.

(1) a primer set represented by SEQ ID NO: 1 and 2, a primer set represented by SEQ ID NO: 3 and 4, and an oligonucleotide set represented by SEQ ID NO: 5 and 6, step; And (2) detecting the amplification product. The present invention also provides a method for detecting Clostridium botulinum toxin small C / D and C.

The method may further include a step of extracting the sample DNA before performing the sample DNA amplification step.

The sample DNA may be derived from an organism including a botulism infectious agent and an environmental material, and the infectious organism may be one or more selected from the group consisting of algae, rheumatoid arthritis, and primates, It is not.

Methods for extracting genomic DNA from the sample include phenol / chloroform extraction, SDS extraction (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB separation method Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), using a commercially available DNA extraction kit, or by simply boiling the culture broth in distilled water.

Amplification of the sample DNA in the amplification step can be carried out using a polymerase chain reaction (PCR), a ligase chain reaction (LCR), a Gap-LCR, a repair chain reaction ), Transcription-mediated amplification (TMA), self-sustained sequence replication, selective amplification of target polynucleotide sequences, consensus priming polymerase chain (CP-PCR), consensus sequence primed polymerase chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-PCR) , Nucleic acid sequence based amplification (NASBA), strand displacement amplification, (LAMP), multiplex polymerase chain reaction (PCR), nested polymerase chain reaction (nested-PCR), single-tube double-polymerase Single-tube nested-PCR, reverse trans- ferase, polymerase chain reaction (PCR) (RT-PCR), inverse polymerase chain reaction (RTCR), real-time polymerase chain reaction (RT-PCR) and real-time quantitative polymerase chain reaction -PCR), and the like, but the present invention is not limited thereto.

In the amplification step according to the present invention, the amplification step may include a step of denaturing the sample DNA, a first amplification step using the outer-primer set, A reaction step using an oligonucleotide set; A secondary amplification step using the inner-primer set; And a stretching step.

The amplification step may be performed by injecting the outer-primer set, the inner-primer set, and the oligonucleotide set at a time or sequentially.

Specifically, the amplification step may include the following steps (a) to (d).

(a) using an outer-primer set of SEQ ID NOS: 1 and 2 at a temperature of 94 캜 for 15 seconds; 72 ° C for 60 seconds; A first amplification step of performing a process of processing the amplified nucleic acid in 15 cycles;

(b) an oligonucleotide reaction step in which the oligonucleotide set for inhibiting nonspecific amplification according to the present invention is used to react at 58? for 5 minutes;

(c) the secondary PCR reaction was carried out using the inner-primer set of SEQ ID NOs: 3 and 4 at a temperature of 94 DEG C for 15 seconds; 58 ° C for 90 seconds; 72 ° C for 60 seconds; A second amplification step of performing the process of performing the amplification process in 30 cycles; And

 (d) DNA elongation step of treating at a temperature of 72 캜 for 3 minutes.

The temperature and time conditions in the polymerase chain reaction are the values set for generating the polymerase chain reaction product of the present invention and can be changed to appropriate values by appropriate selection of those skilled in the art depending on experimental methods and equipment changes . The annealing temperature in the primary amplification step may be 68 to 74 캜, such as 72 캜, and the annealing temperature in the secondary amplification step may be 50 to 60 캜, such as 58 캜.

The use molar ratio of the outer-primer set and the oligonucleotide set may be 1: 1.5 to 10, for example, 1: 2, 1: 4 or 1: 8, and the outer-primer set It is preferable that the amount of the oligonucleotide set to be used is larger than the amount used. In one embodiment of the present invention, in the amplification step, the outer-primer set consisting of the nucleic acid sequences of SEQ ID NOS: 1 and 2 has a concentration of 31.25 nM, the inner-primer set of SEQ ID NOS: 3 and 4 has 250 nM , And the oligonucleotide pair is added at a concentration of 250 nM.

The Clostridium botulinum toxin small C / D and C detection methods are excellent in sensitivity, have low detection limit, can be rapidly inspected, have been verified for their specificity, and have remarkably excellent effect compared to the conventional method because they are economical.

The detection method according to the present invention is characterized in that when the target amplification product is present in the product of the amplification of the sample DNA, one or more Clostridium botulinum toxin C / Lt; RTI ID = 0.0 > botulinum toxin < / RTI > size is present in the sample.

The detection step according to the present invention may be determined by determining the band of the target amplification product by electrophoresis of the amplification product or by detecting the presence or absence of the amplification product to which the detectable label is bound. The detectable label may be coupled to an amplification product, which may be, but is not limited to, a fluorescent, phosphorescent or radioactive material. For example, the labeling substance may be Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling Cy-5 or Cy-3 at the 5 'end of the primer and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as 32P or 35S is added to the PCR reaction solution in the PCR using the radioactive material, the amplified product may be synthesized and the radioactive isotope may be incorporated into the amplification product and the amplified product may be labeled as radioactive.

A single-tube double-stranded polymerase chain reaction (PCR) was performed using a primer set and a non-specific reaction-suppressing oligonucleotide that commonly bind to the gene coding for the N-terminus of Clostridium botulinum toxin small C / D and C toxin protein according to the present invention , The sensitivity to botulinum improves and exhibits a lower detection limit, so botulinum can be detected quickly without enrichment.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a graph showing the effect of Clostridium botulinum according to the present invention botulinum ) Group III toxin and primer.
FIG. 2 is an electrophoresis image showing the result of inhibiting the nonspecific reaction of the polymerase chain reaction using the nonspecific reaction-suppressing oligonucleotide set according to the present invention.
FIG. 3 is an electrophoresis image showing the results of a polymerase chain reaction according to the concentration of primers and oligonucleotides used in the present invention.
FIG. 4 is an electrophoresis image showing the result of measuring the detection limit according to the genomic DNA concentration of Clostridium botulinum toxin small C / D and poisonous C according to the present invention.
FIG. 5 is an electrophoresis image showing the detection specificity of Clostridium botulinum toxin small C / D and toxin small C according to the present invention.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example  1. For amplification primer  Set production

Clostridium botulinum toxin To create a primer set binding to the N-terminus of the small C / D and C toxin proteins, three strains of the poisonous C / D (National Center for Biotechnical Information (NCBI, GenBank) (accession number AB745658, X72793, AB061780) of the small-sized C gene of the present invention. A primer set, i.e., a primary and a secondary amplification primer set, was prepared by searching for a common portion of the nucleotide sequences of the six strains at the N-terminal portion of the C / D and C toxin proteins from the nucleotide sequence. Table 3 shows the results.

Name of the primer The base sequence (5 '- > 3') Amplification Size (bp) BCSTNP out F AGCTAATGAGCCTGAAAAAGCCTTTCGCAT (SEQ ID NO: 1) 424 BCSTNP out R AGCACCAAATCCTTCTTGTGCCGCAAA (SEQ ID NO: 2) BCSTNP in F CTCGAGTTACAAGCCC (SEQ ID NO: 3) 256 BCSTNP in R ACCCAGTTGTTACCTT (SEQ ID NO: 4)

As shown in Table 3, primer sets (SEQ ID NOS: 1 and 2) for primary amplification capable of amplifying nucleic acid sequences of 424 bases in size of C / D toxin gene and C toxin gene, respectively, were prepared. In the case of the primer for primary amplification, it was prepared so as to specifically bind to each gene to be amplified at a temperature of 72 ° C.

In addition, a secondary amplification primer set (SEQ ID NOS: 3 and 4) capable of amplifying a nucleic acid sequence of 256 bases each of C / D toxin gene and C toxin gene was prepared. The primer set for the second amplification was prepared so as to specifically bind to each gene at a temperature of 52 to 58 ° C.

On the other hand, a schematic diagram showing the position of a PCR primer set for specifically detecting C / D toxin gene and C toxin gene is shown in FIG. The prepared primary and secondary primer sets were then used in a polymerase chain reaction.

Example  2. Nonspecific reaction  Production of inhibitory oligonucleotide set

Polymerase chain reaction was performed using the primer set prepared in Example 1, and electrophoresis was performed on the resultant reaction product. As a result, it was confirmed that the primer of the first amplification step affects the second amplification step to generate a nonspecific band. Nonspecific reactions have a problem of significantly lowering the specificity in multiple diagnosis. Therefore, a set of oligonucleotides capable of complementary binding with the primer set used in the first amplification step was prepared in order to eliminate non-specific reactions.

The non-specific reaction inhibiting oligonucleotides of the present invention were able to complementarily bind to bases of BCSTNP out F and BCSTNP out R, wherein 2 to 3 bases located at the 5 'and 3' ends of the oligonucleotide The combination of BCSTNP out F and BCSTNP out R was impossible. And the other base has a base sequence complementary to the base sequence of the amplification primer set 2. The oligonucleotides were prepared so as to be able to specifically bind to each gene at a temperature of 58 ° C, and the nucleotide sequences thereof were shown in Table 4 below.

designation The base sequence (5 '- > 3') BCSTNP anti F CATATGCGAAAGGCTAAA (SEQ ID NO: 5) BCSTNP anti R TGATTTGCGGCACAACTT (SEQ ID NO: 6)

As shown in Table 4, the nonspecific inhibitory oligonucleotide of the present invention is composed of 18 bases, and the 3 bases located at the 5 'or 3' end have the same base sequence as the amplified gene base sequence, The foreign base is a structure having a base sequence complementary to the base sequence for amplification. The oligonucleotide was designed to specifically bind to each gene at a temperature of 58 ° C. The prepared non-specific reaction inhibiting oligonucleotide was used in a single tube double polymerase chain reaction.

Example  3. Isolate  Used Clostridium  Botulinum toxin small C / D and C detection

In order to design the Clostridium botulinum toxin small C / D and C detection of the present invention to be suitable for a single tube double polymerase chain reaction and to specify the optimal concentration of the PCR primer and the nonspecific reaction suppressing oligonucleotide, The domestic isolate of botulinum toxin small C / D (accession number KVCC-1400025 Korea Veterinary Research Institute) was used as a sample.

Genomic DNA was extracted from the strain using a QIAamp DNA mini kit (QIAGEN) according to the manufacturer's manual. The extracted DNA was subjected to PCR with the primer set prepared in Example 1 and the oligonucleotide set and I star taq DNA polymerase intron prepared in Example 2, magnesium chloride (MgCl ₂ ), PCR buffer solution and distilled water The DNA was denatured at a temperature of 96 캜 for 2 minutes and then treated at a temperature of 94 캜 for 15 seconds and at 72 캜 for 60 seconds for 15 cycles to carry out a first amplification process. Thereafter, the reaction was carried out at 58 ° C for 5 minutes and then subjected to a secondary amplification step of 30 cycles of treatment at 94 ° C for 15 seconds, 58 ° C for 90 seconds, and 72 ° C for 60 seconds. Finally, the final DNA elongation step was performed at a temperature of 72 ° C for 3 minutes, and the DNA elongation step was performed in a PCR amplifier (Eppendorf Mastercycler gradient; Eppendorf).

The PCR and amplification products were electrophoresed and the results are shown in FIG. 2 (Lane 1). This process is summarized in Table 5 below.

process Temperature (℃) Time (seconds) cycle Pre-DNA denaturation step 96 120 Primary amplification step 94 15 15 72 60 Oligonucleotide reaction step 58 300 Second amplification step 94 15 40 58 90 72 60 Final DNA elongation step 72 60

Comparative Example  One

The amplification product was electrophoresed in the same manner as in Example 3, except that the nonspecific reaction-suppressing oligonucleotide set prepared in Example 2 was not added. The result was shown in FIG. 2 (Lane 2).

As can be seen in FIG. 2, it was confirmed that the primary and secondary primer sets reacted at different positions in a single tube double polymerase chain reaction. Specifically, in the comparative example, it was confirmed that the primer of the first amplification step affects the second amplification step to generate a nonspecific band (Lane 2). On the other hand, in Example 3, it was confirmed that the oligonucleotide inhibited the primer of the first amplification step from affecting the second amplification step, and thus no nonspecific band was generated (Lane 1).

Therefore, although the nonspecific reaction has a problem of significantly lowering the specificity in the multiple detection, the detection specificity can be improved by using the oligonucleotide set.

Example  4. Various concentrations of primer  And oligonucleotide use experiment

PCR was performed in the same manner as in [Table 5] by adjusting concentrations and ratios of respective primers and oligonucleotides as shown in Table 6 below in order to optimize concentrations of primers and oligonucleotides to be added during the polymerase chain reaction, The resultant reaction product was subjected to electrophoresis and the results are shown in FIG.

Concentration ratio location Primer set 1 Oligonucleotide Primer set 2 1: 2: 2 Lane 1 250 nM 500 nM 500 nM Lane 2 125 nM 250 nM 250 nM Lane 3 62.5 nM 125 nM 125 nM Lane 4 31.25 nM 62.5 nM 62.5 nM 1: 4: 4 Lane 5 125 nM 500 nM 500 nM Lane 6 62.5 nM 250 nM 250 nM Lane 7 31.25 nM 125 nM 125 nM Lane 8 15.625nM 62.5 nM 62.5 nM 1: 8: 8 Lane 9 62.5 nM 500 nM 500 nM Lane 10 31.25 nM 250 nM 250 nM Lane 11 15.625nM 125 nM 125 nM Lane 12 7.8125nM 62.5 nM 62.5 nM

As can be seen in FIG. 3, since the result of Lane 10 was the strongest and the bands suspected to be non-specific bands were not found, the concentration of Lane 10 was determined to be the optimum concentration and it is shown in Table 7 below.

Name of the primer Final concentration (nM) BCSTNP out F (SEQ ID NO: 1) 31.25 BCSTNP out R (SEQ ID NO: 2) 31.25 BCSTNP in F (SEQ ID NO: 3) 250 BCSTNP in R (SEQ ID NO: 4) 250 BCSTNP anti F (SEQ ID NO: 5) 250 BCSTNP anti R (SEQ ID NO: 6) 250

Example  5: Detection limit and detection rate evaluation

Example  5-1: Strain genome DNA  Evaluation using samples

According to the same conditions of the polymerase chain reaction according to Example 3, the primer set in Example 1 and the oligonucleotide in Example 2 were used as the concentration of [Table 7] determined in Example 5, Were evaluated.

Specifically, the genomic DNA of the Korean isolate of Clostridium botulinum toxin small C / D (registered number KVCC-1400025) was used as a sample. Genomic DNA extracted using QIAamp DNA mini kit (QIAGEN) according to the manufacturer's manual was diluted stepwise by 10 times with distilled water and used as a template. Specifically, Lane 1 was negative control, Lane Lane 2, Lane 2, and Lane 7 were treated at a concentration of 1100 pg / ul, 110 pg / ul, 11 pg / ul, 11 pg / Polymerase chain reaction was performed (M: 100 bp ladder). The amplified products were electrophoresed and the results are shown in Fig.

As shown in Fig. 4, since the expected band due to the amplification products was observed from 1100 pg / 占 부터 to 1.1 pg / 占,, it was determined that the lowest detectable concentration was 1.1 pg / 占..

Example  5-2: Strain spore  Evaluation using inoculated cecal contents sample

Clostridium botulinum toxin Detection limits in apical inoculum contents by small C / D and C toxin gene detection were performed in substantially the same manner as in Example 5-1.

In order to evaluate the detection concentration for the contents of the apical inoculum of the strain, apostrophes of the domestic isolate of Clostridium botulinum toxin small C / D (registered No. KVCC-1400025) were diluted stepwise 10 times in distilled water to obtain Clostridium botulinum toxin small C / D and C, (a) a genomic DNA extraction kit for extracting genomic DNA from the cecal contents without enriching with a genomic DNA extraction kit, (b) a genomic DNA extraction kit (C) a strain obtained from the contents of the cecum using a genomic DNA extraction kit was inoculated into a liquid medium for 3 days, and genomic DNA was extracted from the cecum DNA by using a genomic DNA extraction kit (D) a strain obtained from the contents of the cecum was inoculated in a liquid medium for 3 days and centrifuged at 13,000 rpm to dilute the precipitate in distilled water PCR was performed using 4 samples including genomic DNA obtained by boiling. The detection limit was measured using the lowest concentration of the expected band due to the amplification product through electrophoresis. The results are shown in Table 8.

Example  5-3: Evaluation using clinical samples

Clostridium botulinum toxin The detection rate in the actual clinical sample (cecum contents) using the small C / D and C toxin gene detection method was measured in substantially the same manner as in Example 5-1.

In order to measure the detection rate of actual clinical samples, polymerase chain reaction was carried out in the same manner as in Example 5-1, using 200 mg of cecum contents in eight cecal algae with botulism, and the results were measured. Specifically, the sample is prepared by (a) a sample obtained by extracting genomic DNA for genetic analysis from the contents of the cecum without enrichment using a genomic DNA extraction kit, (b) a strain obtained from the contents of the cecum using a genomic DNA extraction kit, (C) a sample obtained by inoculating the culture obtained from the contents of the cecum with the genomic DNA into a liquid medium for 3 days and extracting genomic DNA, (d) a sample obtained from the contents of the cecum, Liquid culture medium was inoculated for 3 days and centrifuged at 13,000 rpm to dilute the precipitate in distilled water. Then, PCR was performed using 4 samples including genomic DNA obtained by boiling. The results are shown in Table 8.

sample Detection minimum concentration (pieces) Detection rate (a) 4.3 * 10 ⁶ 7/8 (b) 43 8/8 (c) 4.3 8/8 (d) 4.3 * 10 ³ 8/8

As shown in Table 8, when the single-tube double-polymerase chain reaction was performed using the primer set according to the present invention and the oligonucleotide for suppressing non-specific reactions, the sensitivity to botulinum was improved, The detection limits were 43 positive (8/8) in 8 clinical specimens, 8 positive in 8 out of 8 clinical specimens (8/8), and a detection limit of 4.3 positive Which is superior to the detection method used in Europe.

In the case of the detection method used in Europe, the detection limit of 50 apo1 was reached when 1000 mg was inoculated in the 1st day bacterium, but the detection limit was lower than 200 mg in the case of the present invention.

In addition, when the enema is carried out in the cecal contents without the procedure, the detection limit is positive (7/8) in 7 out of 8 clinical specimens of 4.3 × 10 ⁶ apos; s and can be used as rapid detection method.

In addition, in the case of simple DNA extraction (sample (d)), the detection limit was positive (8/8) in 8 of 8 out of 4300 apo-clinical samples And that this detection method can be used as a convenient and economical detection method.

Example  6: detection specificity survey

In order to confirm the specificity of the Clostridial botulinum toxin small C / D and C toxin gene detection methods of the present invention, 19 strains shown in Table 9 were used.

Fungi Poison small Registration Number lane 음적 제어 One Clostiridium botulinum A CVI 61884 2 B QIA 1-031-CBB-CO-044 3 C CVI CKIII-u 4 D CVI 16878 5 CD BKT 15925 6 Clostiridium difficile ATCC 9689 7 Clostiridium perfringens A KVCC BA1100001 8 B KVCC BA1100002 9 C KVCC BA1100003 10 D KVCC BA1100004 11 E KVCC BA1100005 12 Bacillus subtilis ATCC 6633 13 Bacillus cereus ATCC 11778 14 Enterococcus faecalis ATCC 29212 15 Salmonella enteritidis ATCC 13076 16 Salmonella typhimurium ATCC 14028 17 E. coli ATCC 25922 18 Campylobacter jejuni ATCC 33560 19 Campylobacter coli ATCC 43484 20

M: 100 bps

In Table 9, if Clostridium spp. And Bacillus spp. Are capable of apoptosis, the remaining strains are not capable of apoptosis. "CVI" means the Central Veterinary Institute of the Netherlands; "QIA" means agriculture, forestry and livestock quarantine headquarters; "BKT" refers to the Swedish National Veterinary Institute; "ATCC" refers to the American Type Culture Collection; "KVCC" is Korea Veterinary Culture Collection; It says.

The 19 strains were enriched in the nutrient medium for 1 day and then genomic DNA was extracted using a genomic DNA extraction kit (QIAamp DNA mini kit; QIAGEN), and used as a polymerase chain reaction template. The primers of Example 1 And oligonucleotides of Example 2 were used and a single tube polymerase chain reaction was performed in substantially the same manner as in Example 5-1. The amplified products were electrophoresed and the results are shown in Fig.

As can be seen in FIG. 4, the 256 bp amplification product expected from lane 4 (docking C) and lane 6 (docking C / D) was found to be present, and 256 bp amplification products were not observed in other species Respectively. Therefore, it was specifically amplified only in strains belonging to Clostridium botulinum toxin C (Lane 4) and C / D (Lane 6) among the above 19 strains (CVI CKIII-u and BKT 15925) Respectively.

Therefore, when the information providing method for diagnosis according to the present invention is used, the specificity for Clostridium botulinum toxin small C / D and C is excellent, / D and C, respectively.

<110> Animal and plant quarantine agency <120> Primer set for detection of Clostridium botulinum, composition,          and kit comprising the same <130> DPP20145978KR <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > BCSTNP out F <400> 1 agctaatgag cctgaaaaag cctttcgcat 30 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > BCSTNP out R <400> 2 agcaccaaat ccttcttgtg ccgcaaa 27 <210> 3 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> BCSTNP in F <400> 3 ctcgagttac aagccc 16 <210> 4 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> BCSTNP in R <400> 4 acccagttgt tacctt 16 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BCSTNP anti F <400> 5 catatgcgaa aggctaaa 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BCSTNP anti R <400> 6 tgatttgcgg cacaactt 18

Claims (18)

And at least one polynucleotide selected from the group consisting of polynucleotides composed of the nucleic acid sequences of SEQ ID NOS: 1 to 4,
Clostridium botulinum (Clostridium A primer set for polymerase chain reaction (PCR) for the amplification of the light chain region of the toxin protein C of botulinum . The primer set according to claim 1, wherein at least one primer set selected from the group consisting of the nucleic acid sequences of SEQ ID NOs: 1 and 2 and the nucleic acid sequences of SEQ ID NOs: 3 and 4 is selected. An oligonucleotide comprising a base complementary to 15 to 30 contiguous nucleotides of the nucleic acid sequence of SEQ ID NO: 1 and comprising 2 or 3 bases which are non-complementary to at least one terminus,
An oligonucleotide comprising a base complementary to a sequence of 15 to 30 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 2 and comprising at least one end of the non-complementary two or three bases,
Clostridium botulinum (Clostridium A set of oligonucleotides for the inhibition of nonspecific reactions of polymerase chain reaction for the amplification of the light chain region of the toxin protein C of botulinum . 4. The oligonucleotide set of claim 3, wherein the set of oligonucleotides comprises a nucleic acid sequence of SEQ ID NO: 5 or 6. An outer-primer set composed of the nucleic acid sequences of SEQ ID NOS: 1 and 2,
An inner-primer set composed of the nucleic acid sequences of SEQ ID NOS: 3 and 4, and
An oligonucleotide comprising a base complementary to 15 to 30 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 1 in the outer-primer set, at least one end of which comprises 2 or 3 bases, And a nucleotide sequence complementary to a consecutive 15 to 30 nucleotide sequences of the nucleotide sequence of SEQ ID NO: 2 among the set of outprimers, wherein at least one of the oligonucleotides comprises an oligonucleotide comprising two or three bases A non-specific reaction inhibiting oligonucleotide set,
A composition for detecting Clostridium botulinum in at least one selected from the group consisting of Clostridium botulinum poison small C / D and poison small C. 6. The composition of claim 5, wherein the set of oligonucleotides comprises a nucleic acid sequence of SEQ ID NO: 5 or 6. 6. The composition according to claim 5,
Wherein the composition further comprises at least one member selected from the group consisting of a buffer DNA polymerase, a DNA polymerase joinder, and a nucleotide triphosphate. 8. A composition according to any one of claims 5 to 7, wherein said composition is for single tube nested-PCR. An outer-primer set composed of the nucleic acid sequences of SEQ ID NOS: 1 and 2,
An inner-primer set composed of the nucleic acid sequences of SEQ ID NOS: 3 and 4, and
An oligonucleotide comprising a base complementary to 15 to 30 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 1 in the outer-primer set, at least one end of which comprises 2 or 3 bases, And a nucleotide sequence complementary to a consecutive 15 to 30 nucleotide sequences of the nucleotide sequence of SEQ ID NO: 2 among the set of outprimers, wherein at least one of the oligonucleotides comprises an oligonucleotide comprising two or three bases Amplifying the sample DNA with a polymerase chain reaction using a non-specific reaction inhibiting oligonucleotide set; And
And detecting the amplification product,
Clostridium botulinum (Clostridium botulinum ) poison small C / D and poison small C. &lt; / RTI &gt; 10. The method of claim 9, wherein the set of oligonucleotides comprises a nucleic acid sequence of SEQ ID NO: 5 or 6. 10. The method of claim 9, wherein the usage mole ratio of the outer-primer set to the oligonucleotide set is from 1: 1.5 to 10. 10. The method according to claim 9, wherein the primer set consisting of the nucleic acid sequences of SEQ ID NOS: 1 and 2 has a concentration of 31.25 nM, the primer set set forth in SEQ ID NOS: 3 and 4 has a concentration of 250 nM and the oligonucleotide pair has a concentration of 250 nM &Lt; / RTI &gt; by weight. 10. The method of claim 9, wherein the amplifying step is to insert and perform the outer-primer set, the inner-primer set, and the oligonucleotide set at a time. 10. The method of claim 9, wherein the step of amplifying comprises a step of denaturing the sample DNA, a first amplification step using the outer-primer set, A reaction step using an oligonucleotide set; A secondary amplification step using the inner-primer set; And a stretching step. 15. The method of claim 14 wherein the annealing temperature in the first amplification step is 68-74 占 폚 and the annealing temperature in the second amplification step is 50-60 占 폚. 15. The method of claim 14, wherein the sample DNA is derived from an infected individual or environmental material. 17. The method of claim 16, wherein the infectious agent is at least one selected from the group consisting of algae and mammals. 10. The method of claim 9, wherein said detecting step detects a detectable labeling substance labeled with an electrophoresis or amplification product.

Images