KR101954392B1 - Molecular marker for detecting Erwinia amylovora and uses thereof - Google Patents

Abstract

The present invention relates to a molecular marker for detecting Erwinia amylovora and uses thereof. By using a PNA probe containing single nucleotide polymorphism (SNP) between Erwinia amylovora and Erwinia pyrifoliae developed in the present invention or between domestic and overseas Erwinia amylovora, Erwinia amylovora strains are specifically detected, thereby making it possible to more accurately and quickly diagnose fire blight, and being used to establish quarantine regulation standards by distinguishing domestic and overseas Erwinia amylovora.

Description

Molecular marker for detecting Erwinia amylovora and uses thereof -

The present invention relates to molecular markers for detection of avian amylolbora and uses thereof.

Fire blight is one of the representative bacterial botanical quarantine bottles, and Erwinia amylovora has been identified as a causative organism. It is known that the fire blight is caused by burning of flowers, branches, It is called a burn illness in Korea because it is called a death.

In the case of fruit sickness disease, which has been pointed out to be the case that pathogens are buried in foreign agricultural products that have increased since the conclusion of a free trade agreement (FTA), it is likely that imports and exports of agricultural products and agricultural products may be restricted. In addition, in the case of onset fruit farms, it is a plant disease that can cause a ripple effect on the national agriculture and economy by causing economic loss to the farmhouse such as removal of the host plant and the range burial of the neighboring occurrence area and the closure of the orchard.

Erwinia amylovora was first reported in the United States around 1780, and has been reported to spread to Europe in 1957 and to Europe in 1971, and to North America and the Middle East. In recent years, Erwinia pyrifoliae has been found in Japan and Korea. However, there have been no reports of fruit blight disease in neighboring countries such as Northeast Asia. In 2015, Since the causative organism Winiah amilobora has been isolated and confirmed, the disease has been reported every year.

Real-time PCR and LAMP (Loop Mediated Isothermal Amplification) techniques using PCR, SYBR Green or TaqMan probes have been developed and used for the diagnosis of pathogenic microorganisms. Among them, it is possible to switch to a high-throughput diagnostic system Development of biomarkers using real-time PCR has been developed to obtain accurate diagnosis results. In particular, studies have been actively conducted on systems capable of accurately verifying false negatives as well as fine diagnosis using PNA (peptide nucleic acid), an artificial synthetic material having a similar structure to DNA.

PNA forms a double strand by causing a hybridization reaction with a natural nucleic acid of a complementary base sequence. When the number of nucleic acid bases is the same, PNA / DNA or PNA / RNA double strand is more stable than DNA / DNA double strand or DNA / RNA double strand, and is stable by chemical stability, nuclease or protease And is biologically stable. Also, since PNA is electrically neutral, the stability of PNA / DNA and PNA / RNA duplexes is not affected by salt concentration. Because of this property, PNAs are more likely to recognize complementary nucleic acid sequences than natural nucleic acids and are therefore applicable for diagnostic or other biological and medical purposes.

(Tm) value according to the difference between the nucleotides of the DNA complementary to the nucleotides of the PNA probe and the nucleotide complementary thereto, it is possible to precisely discriminate the species or strain of the pathogen using such a method It is possible. In addition, the PNA probe can be analyzed using a hybridization method different from the hydrolysis method of the TaqMan probe. In addition, the PNA probe differs from the Taqman probe in the melting curve by a false- positive), which is useful for the diagnosis of bacteria.

Therefore, the combination of the strain-specific sequence and the PNA probe-based detection technology targeted by the comparative genomic analysis of the pathogenic microorganism can provide more accurate and rapid diagnosis results. This is because it is difficult to control, These are the techniques necessary for diagnosis to prevent the spread of bacterial plant diseases such as diseases.

Korean Patent Laid-Open Publication No. 2012-0081896 discloses a 'primer for diagnosis of black blight, a diagnosis method of black blight disease using the same, and a method for diagnosis of blight of black blight', but the molecular marker for detection of aviania amylobora according to the present invention Its use has not been described.

The present invention has been made in view of the above-mentioned needs. The present inventors have found that, in order to prepare a PNA probe for detection of Earwinia amylobora , the present inventors have found that Erwinia amylovora , E. pyrifoliae , a causative agent of blight; (SNP) marker which can discriminate the genus Ewiniah from the nine genes and the SNP markers which can discriminate between domestic and overseas Ewinia amilobora by analyzing the genome sequence of domestic and foreign Awwinia amilobolas, Thus completing the present invention.

In order to solve the above problems, the present invention provides a nucleotide polymorphism (hereinafter, referred to as " nucleotide polymorphism ") position of each SNP in the nucleotide sequence of SEQ ID NOS: 1-8 (position 672 or 673 of SEQ ID NO: 1; The sequence of SEQ ID NO: 3, the sequence No. 693, the sequence of SEQ ID NO: 1266, the sequence of SEQ ID NO: 5, the sequence of 2573, the sequence of SEQ ID NO: 6, the sequence of 514, the sequence of SEQ ID NO: 7, consisting of more than 15 consecutive nucleotides comprising the polynucleotide or a complementary polynucleotide containing at least one polynucleotide selected from the group consisting of, see in domestic air Winiah amyl (Erwinia amylovora ). < / RTI >

In the nucleotide sequence of SEQ ID NOS: 1 to 8, the nucleotide sequence of each SNP position (position 684 of SEQ ID NO: 1, position 684 of SEQ ID NO: 2, position 681 of SEQ ID NO: 3, The nucleotide sequence of SEQ ID NO: 5 is 2571 or 2577, the nucleotide sequence of SEQ ID NO: 6 is 513, the nucleotide of SEQ ID NO: 7 is the 1080th nucleotide, and the nucleotide of SEQ ID NO: 8 is the 246th nucleotide) Wherein the polynucleotide comprises at least one polynucleotide selected from the group consisting of polynucleotides or complementary polynucleotides thereof.

The present invention also relates to a method for detecting an Erwinia amyloborrhoeae comprising a polynucleotide consisting of 15 or more consecutive nucleotides comprising the 912th base of the nucleotide sequence of SEQ ID NO: 9 or a complementary polynucleotide thereof, A SNP marker composition for genotype identification of amylobora is provided.

Also, the present invention provides a polynucleotide comprising a SNP located at the 514 base of the yjcD gene of SEQ ID NO: 6 or a SNP located at the 681 base of the nucleotide sequence of the pot F gene of SEQ ID NO: 3, A polynucleotide selected from the group consisting of polynucleotides selected from the group consisting of polynucleotides, polynucleotides, polynucleotides, polynucleotides, polynucleotides, polynucleotides, polynucleotides, polynucleotides, polynucleotides, polynucleotides,

The present invention also relates to a plasmid comprising a yjcD gene-specific PNA probe consisting of the nucleotide sequence of SEQ ID NO: 13 or its complementary base sequence and a yjcD gene-specific primer set consisting of the nucleotide sequence of SEQ ID NO: 14 and SEQ ID NO: A kit for PNA-mediated real-time PCR for discrimination by Winiah Amil is provided.

In addition, the present invention provides a plasmid comprising a pot F gene specific PNA probe consisting of the nucleotide sequence of SEQ ID NO: 19 or a complementary base sequence thereof, and a pot F gene-specific primer set consisting of the nucleotide sequence of SEQ ID NO: 20 and SEQ ID NO: A kit for PNA-mediated real-time PCR for detection of amyloboride is provided.

The invention also specifically yjcD gene consisting of the nucleotide sequence or a complementary base sequence of SEQ ID NO: 13 ever PNA probe and SEQ ID NO: 14 and SEQ ID NO: 15 yjcD consisting of the nucleotide sequence of Performing real-time PCR on the yjcD gene of a strain of Erwinia amilobora in domestic and foreign countries using a gene-specific primer set; And analyzing the gene amplification result by the real-time PCR.

In addition, the present invention using a potF gene-specific PNA probes with SEQ ID NO: 20 and a specific primer set potF gene consisting of the nucleotide sequence of SEQ ID NO: 21 consisting of a nucleotide sequence or a complementary base sequence of SEQ ID NO: 19 Fruit image bottle Performing real-time PCR on the potF gene of the suspect sample; And analyzing the gene amplification result by the real-time PCR.

The SNP markers of the present invention and the PNA probes capable of identifying the SNP markers are: A. wilia amyloboracea and A. vinifiri polyol; Or genetic type discrimination between domestic and foreign strains of A. vinia amilobora may be useful for diagnosis of fruit sickness disease by detection and discrimination of A. vivax amylobora.

Figure 1 is a schematic diagram showing sequence alignment and genomic comparative analysis between alleles in Erwinia . E. amylovora ; Ewinia amilobora , Korean E. amylovora strain; E. wilia amilobora isolate, E. pyrifoliae ; E. vannamei , E. tasmaniensis ; E. vinite tasmaniensis , E. billingiae ; Awiniah Bilin devotion.
FIG. 2 is a schematic diagram of a PNA (peptide nucleic acid) comprising a single nucleotide polymorphism (SNP) base, wherein A is a PNA probe containing SNPs for the detection of Erwinia amylolbora and genetic determinations of Erwinia polypore , And B shows a schematic diagram of a PNA probe containing specific SNPs for genotyping of domestic and overseas Awinia amylobora.
Fig. 3 shows the result of nucleotide sequence alignment showing the SNP position on purH (reference genome CFBP 1430 strain locus_tag EAMY_0262) gene which determines the genotype of Erwinia amylobora. EAF; Eun Waniah Amilo, EAK; Dom Winiah Amilova, EP; Erwinia Pirie Polyey, others; Glycyrrhizae sp.
Fig. 4 shows the nucleotide sequence alignment result showing the SNP position on EAMY_0860 gene determining the genotype of Erwinia amylobora .
Fig. 5 is a nucleotide sequence alignment result showing the SNP position on the gene potF (reference genome CFBP 1430 strain locus_tag EAMY_1305) which determines the genotype of Erwinia amylobora.
Fig. 6 is a nucleotide sequence alignment result showing a SNP position on sufB (reference genome CFBP 1430 strain locus_tag EAMY_1676) gene which determines the genotype of Erwinia amylobora.
Fig. 7 is a nucleotide sequence alignment result showing the SNP position on yegN (reference genome CFBP 1430 strain locus_tag EAMY_2263) gene which determines the genotype of Erwinia amylobora.
Fig. 8 is a nucleotide sequence alignment result showing the SNP position on yjcD (reference genome CFBP 1430 strain locus_tag EAMY_3283) gene, which determines the genotype of Erwinia amylobora.
FIG. 9 is a nucleotide sequence alignment result showing the SNP position on livM (reference genome CFBP 1430 strain locus_tag EAMY_3487) gene which determines the genotype of Erwinia amylobora.
Fig. 10 is the result of base sequence alignment showing the SNP position on yeiU (reference genome CFBP 1430 strain locus_tag EAMY_2308) gene which determines the genotype of Earwinia amylobora.
Fig. 11 is a nucleotide sequence alignment result showing the SNP position on ribF (reference genome CFBP 1430 strain locus_tag EAMY_2938) gene that determines the genotype of Erwinia amylobora.
12 is a graph showing fluorescence melting curve analysis (FMCA) using a PNA probe and a primer set capable of detecting the SNP position base of the present invention. As a result, when the PNA probe reacts at the SNP position, B is a probe (SEQ ID NO: 13) capable of detecting a SNP located in the 514th base of the base sequence of the yjcD gene (SEQ ID NO: 13) and a primer set (SEQ ID NO: 14 and 15) and a PNA probe (SEQ ID NO: 19; FB-5) and a primer set (SEQ ID NO: 20 and SEQ ID NO: 20) capable of detecting SNPs located in the 681st base of the base sequence of the pot F gene 21) is used (b).
13 shows the results of analysis of the sensitivity of a PNA probe (SEQ ID NO: 19; FB-5) and a primer set (SEQ ID NOs: 20 and 21) capable of detecting SNPs located at the 681st base in the nucleotide sequence of the pot F gene. A; See, Awwinia Amilo, B; Awiniafilipolea.

In order to accomplish the object of the present invention, the present invention provides a nucleotide sequence of SEQ ID NOS: 1 to 8 wherein each SNP (single nucleotide polymorphism) position (672 th or 673 th in the case of SEQ ID NO: 1, 685 The 5'-th position in SEQ ID NO: 3, the 6'nd position in SEQ ID NO: 3, the 1266th position in SEQ ID NO: 4, the 2573th position in SEQ ID NO: 5, the 514th position in SEQ ID NO: 6, the 1093rd position in SEQ ID NO: 7, ) Base or a polynucleotide consisting of at least one polynucleotide consisting of at least one polynucleotide consisting of at least 15 contiguous nucleotides comprising a nucleotide sequence complementary to the polynucleotide of SEQ ID NO: amylovora ). < / RTI >

The genome-type SNP marker composition of Domesticia and Amiloboracea is preferably a polynucleotide consisting of 15 or more consecutive nucleotides comprising the SNP located in the 514 base of the nucleotide sequence of the yjcD gene of SEQ ID NO: 6 or a complement thereof 0.0 > polynucleotide < / RTI >

In the SNP marker composition according to an embodiment of the present invention, the nucleotide sequence of SEQ ID NO: 6 is a base sequence of yjcD gene, and the yjcD gene may be DNA or RNA encoding putative ATP-dependent DNA helicase YjcD protein. It is not limited. DNA includes cDNA, genomic DNA, or artificial synthetic DNA. The DNA may be single stranded or double stranded. The DNA may be a coding strand or a non-coding strand.

In one embodiment of the present invention, the contiguous nucleotides may be 15 to 100 contiguous nucleotides, but are not limited thereto.

As used herein, the term " nucleotide " is a deoxyribonucleotide or ribonucleotide present in single-stranded or double-stranded form and includes analogs of natural nucleotides unless specifically stated otherwise.

The SNP markers of the present invention can be used for the genotyping of A. wilia amylobora in domestic and overseas strains, The 672nd and 673rd bases in the nucleotide sequence of the gene are G or A; The 685th base in the base sequence of the EAMY 08860 gene represented by SEQ ID NO: 2 is A or G; The 693rd base in the nucleotide sequence of the pot F gene represented by SEQ ID NO: 3 is C or T; The base 1266 of the sufB gene represented by SEQ ID NO: 4 is G or A; The base 2573 of the yegN gene represented by SEQ ID NO: 5 is C or T; The base 514 of the yjcD gene represented by SEQ ID NO: 6 is C or T; The 1093rd base in the nucleotide sequence of the livM gene represented by SEQ ID NO: 7 is G or A; And the 245th base in the nucleotide sequence of the yeiU gene represented by SEQ ID NO: 8 is different from G or A; In the SNP locus, the previously described base is the base of CFBP 1430 from Earwinia amiloba, and the base described below is the base of the strain of Dominantia wilia amilobora. For example, a SNP corresponding to the 672nd and 673rd nucleotides of SEQ ID NO: 1 represents a base polymorphism with G or A. In this SNP, an exonia amilobor which has a G genotype, Winiah amilobora is a domestic species.

The present invention also relates to a nucleotide sequence encoding the nucleotide sequence of SEQ ID NOS: 1 to 8, wherein the single nucleotide polymorphism (SNP) position (684th nucleotide in SEQ ID NO: 1, 684th nucleotide in SEQ ID NO: 2, The nucleotide sequence of SEQ ID NO: 4 is 1260, the nucleotide sequence is 2571 or 2577, the nucleotide sequence is 513, the nucleotide sequence of SEQ ID NO: 7 is 1080, Wherein the polynucleotide comprises at least one polynucleotide consisting of at least two consecutive nucleotides, or at least one polynucleotide selected from the group consisting of complementary polynucleotides thereof.

The SNP marker composition for detection of avian amylolbora preferably has a potency of SEQ ID NO: 3 And at least one polynucleotide selected from the group consisting of a polynucleotide consisting of at least 15 consecutive nucleotides or a complementary polynucleotide thereof comprising a SNP located at the 681st base in the nucleotide sequence of the gene.

In the SNP marker composition according to one embodiment of the present invention, the nucleotide sequence of SEQ ID NO: 3 is a base sequence of the pot F gene, and the pot F gene is a DNA or RNA encoding Putrescine-binding periplasmic protein. Do not. DNA includes cDNA, genomic DNA, or artificial synthetic DNA. The DNA may be single stranded or double stranded. The DNA may be a coding strand or a non-coding strand.

The SNP marker of the present invention can be used for the detection of Earwinia amiloborrhoea purpurin expressed by SEQ ID NO: 1 of Escherichia coli CFBP 1430 The nucleotide sequence at position 684 is T or C; The 684th base in the base sequence of the EAMY 08860 gene represented by SEQ ID NO: 2 is G or C; The 681st base in the nucleotide sequence of the pot F gene represented by SEQ ID NO: 3 is G or A; The nucleotide sequence of the sufB gene represented by SEQ ID NO: 4 is C or T; The 2571st base in the base sequence of the yegN gene represented by SEQ ID NO: 5 is T or G, or the 2577th base is T or C; The base 513 of the yjcD gene represented by SEQ ID NO: 6 is A or T; The 1080th base in the base sequence of the livM gene represented by SEQ ID NO: 7 is A or G; And the 246th base in the nucleotide sequence of the yeiU gene represented by SEQ ID NO: 8 is different from A or G; In the SNP locus, the bases described above are polymorphic bases specific for the species Earinia amiloboracea, and the bases described below are polymorphic bases for other species of the awwinia. For example, a SNP corresponding to the 684th nucleotide of SEQ ID NO: 1 indicates a base polymorphism with T or C, in which a T-genotype is an Erwinia amyloborous species and a C genotype is a heterozygous heterozygote It can be judged as a strain.

The SNP marker for detection of the avian amylolbora of the present invention is capable of distinguishing a strain of Earinia amilobolas from a heterologous strain of aviania, and preferably distinguishes between avian amylolobia and avinia pyripolyol, It is possible to diagnose a burning bottle (Earwani amilobora) and a black blight of a branch (earwiniia floli polyp).

The present invention also provides a method for detecting an Erwinia amyloborrhoeae comprising a polynucleotide consisting of 15 or more consecutive nucleotides comprising the 912th base of the nucleotide sequence of SEQ ID NO: 9 or a complementary polynucleotide thereof, A SNP marker composition for genotype identification of amylobora is provided.

The above SNP marker can be used for the detection of Earwinia amylobora and for genotyping between domestic and foreign earwani amilobora by the use of ribF It is based on the fact that the 912th base in the nucleotide sequence of the gene appears differently as T, G or A. For example, a SNP corresponding to the 912th nucleotide of SEQ ID NO: 9 represents a base polymorphism of T, G or A, wherein when the SNP has the A genotype, it is a strain of Erwinia sp. It can be judged as a species of Erwinia amyloloba. Further, when having the G genotype at the SNP position, it can be judged to be a domestic Erwinia amilobolas species.

The present invention relates to a base mutant at each SNP position in the sequence of SEQ ID NO: 1 to SEQ ID NO: 9, but when such a SNP base mutation is found in double stranded gDNA (genomic DNA) It is interpreted to include nucleotide sequences. Thus, the base at the SNP position in the complementary polynucleotide sequence is a complementary base. In this regard, all sequences provided herein are based on sequences in the sense strand of the genomic DNA unless otherwise noted. In the SNP composition according to one embodiment of the present invention, the SNP polymorphic base information is shown in Table 3.

The present invention also provides a polynucleotide comprising a SNP located in base 514 of the base sequence of the yjcD gene of SEQ ID NO: 6 or a SNP located in the 681 base of the base sequence of the pot F gene of SEQ ID NO: 3, or a polynucleotide consisting of 15 or more consecutive nucleotides see from the group consisting of a nucleotide or a polynucleotide complementary to, domestic air Winiah amyl comprising selected polynucleotide (Erwinia amylovora ) or a microarray for detection of an avian amiloba . Preferably, the polynucleotide can be immobilized on a substrate coated with an activator of amino-silane, poly-L-lysine or aldehyde, but is not limited thereto. Preferably, the substrate may be a silicon wafer, glass, quartz, metal or plastic, but is not limited thereto. As a method for immobilizing the polynucleotide on a substrate, a micropipetting method using a piezo electric method, a method using a pin-type spotter can be used.

The microarray according to the present invention can be produced by a conventional method known to those skilled in the art using a polynucleotide according to the present invention or a complementary polynucleotide thereof, a polypeptide encoded thereby, or cDNA thereof.

The present invention also relates to a method for producing a YJcD gene-specific PNA probe comprising the yjcD gene-specific PNA probe consisting of the nucleotide sequence of SEQ ID NO: 13 or a complementary base sequence thereof and the yjcD gene-specific primer set consisting of the nucleotide sequences of SEQ ID NOs: A kit for PNA-mediated real-time PCR for discrimination by Erwinia amil; or,

An aviania amylolbora detection method comprising a pot F gene specific PNA probe consisting of the nucleotide sequence of SEQ ID NO: 19 or a complementary base sequence thereof and a pot F gene specific primer set consisting of the nucleotide sequence of SEQ ID NO: 20 and SEQ ID NO: A PNA-mediated real-time PCR kit is provided.

The PNA probe of the present invention can be produced based on the sequence of the SNP position base shown in Table 3, but is not limited thereto.

The term " PNA " in the present invention is a pseudo-DNA in which a nucleic acid base is connected to a peptide bond rather than a phosphate bond, and forms a double strand through a hybridization reaction with a natural nucleic acid having a complementary base sequence. PNA / DNA double strand is more stable than DNA / DNA double strand, DNA strand is more stable than DNA / RNA double strand, and double strand is unstable due to single base mismatch The ability to detect SNPs is superior to natural nucleic acids. For example, since a melting temperature (Tm) value differs by about 10 to 15 ° C even in one nucleotide mismatch, a change in nucleotide such as SNP can be detected using the difference in binding force.

The term " probe " in the present invention refers to a hybridization probe, which means a linear oligomer having a natural or modified monomer or bond, including a deoxyribonucleotide and a ribonucleotide capable of sequence-specific binding to a complementary strand of a nucleic acid. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member but does not hybridize to a fragment derived from another member . Preferably, the probe may be a single strand, more preferably a deoxyribonucleotide, but is not limited to, for maximum efficiency in hybridization.

The term " hybridization " in the present invention means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur between two nucleic acid strands that are completely matched or substantially matched by some mismatch. Complementarity for hybridization may vary depending on hybridization conditions, especially temperature.

The probe of the present invention may be used in a perfectly complementary sequence to a sequence containing the SNP position base, but a substantially complementary sequence is used to the extent that it does not interfere with the specific hybridization It is possible. Conditions suitable for hybridization can be determined with reference to contents commonly known in the art. The stringent conditions used for hybridization should be sufficiently stringent to hybridize to only one of the alleles and may be determined by controlling the temperature, the ionic strength (buffer concentration) and the presence of a compound such as an organic solvent, and the like. This stringent condition can be determined differently depending on the sequence to be hybridized.

The PNA probe according to the present invention preferably has a sequence corresponding to the SNP position base at one or more positions in the middle base sequence when it comprises a polynucleotide composed of 10 or more consecutive nucleotides or a complementary polynucleotide thereof Thereby making it possible to further increase the melting temperature difference with a perfect match that makes perfect hybridization.

In one embodiment of the present invention, the primer set for detection of Erwinia amylobora may be composed of an oligonucleotide primer set of SEQ ID NO: 20 and SEQ ID NO: 21, The primer set may be, but is not limited to, a set of oligonucleotide primers of SEQ ID NOS: 14 and 15.

The primers include oligonucleotides consisting of fragments of at least 15, at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NOS: 14, 15, 20 and 21, . ≪ / RTI > For example, the primer (21 oligonucleotides) of SEQ ID NO: 14 is a fragment of at least 15, at least 16, at least 18, at least 19, at least 20 contiguous nucleotides in the sequence of SEQ ID NO: 14 Lt; RTI ID = 0.0 > oligonucleotides < / RTI > The primers may also include additional, deleted, or substituted sequences of the nucleotide sequences of SEQ ID NOS: 14, 15, 20, and 21. The oligonucleotide primer of even number in the sequence number is a forward primer, and the odd number of oligonucleotide primer is a reverse primer.

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent. In addition, primers can incorporate additional features that do not alter the primer properties of primers that serve as a starting point for DNA synthesis. The primer nucleic acid sequence of the present invention may, if necessary, comprise a label that is detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g. horse radish peroxidase (HRP), alkaline phosphatase), radioactive isotopes (e.g., 32P), fluorescent molecules, chemical groups (e.g. biotin) . The appropriate length of the primer is determined by the characteristics of the primer to be used, but is usually 15 to 30 bp in length. The primer need not be exactly complementary to the sequence of the template, but should be complementary enough to form a hybrid-complex with the template.

In the kit of the present invention, the reagent for carrying out the amplification reaction may further include a DNA polymerase, dNTPs, a buffer, and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The manual includes instructions on the surface of the package including a brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

According to the present invention,

A yjcD gene-specific PNA probe consisting of the nucleotide sequence of SEQ ID NO: 13 or its complementary base sequence and the yjcD gene-specific primer set consisting of the nucleotide sequence of SEQ ID NO: 14 and SEQ ID NO: 15, Performing real-time PCR on the yjcD gene of < RTI ID = 0.0 > And analyzing the gene amplification result by the real-time PCR; or

SEQ ID NO: 19 of the nucleotide sequence or a base sequence complementary potF gene-specific PNA probes with SEQ ID NO: 20, and specific primers fruit image potF gene of the disease suspected samples using a set potF gene consisting of the nucleotide sequence of SEQ ID NO: 21 consisting of Performing real-time PCR on the PCR product; And analyzing the gene amplification result by the real-time PCR.

The method according to the present invention comprises isolating the genomic DNA from the suspect sample of the fruit bottle. As a method for separating the genomic DNA from the sample, a method known in the art may be used. For example, a CTAB method may be used, and a Wizard prep kit (promega, USA) may also be used. Using the separated genomic DNA as a template, the target sequence can be amplified by carrying out an amplification reaction using a primer for amplifying a base according to an embodiment of the present invention. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

The detection of the amplification product according to an embodiment of the present invention can be carried out by hybridizing the PNA probe of the present invention to the amplification product and analyzing the melting temperature (Tm) of the corresponding PNA / DNA double strand, It is possible to distinguish the genotype of the earwax amylobora.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1. fruit number Burn bottle  The causative strain, Erwinia Amilova ( E. amylovora Detection and Analysis of Nucleotide Sequence of Domestic Isolated Strain

By carrying out genomic sequencing, crystallization and tinization of the causative strain of domestic fruit sickness strain Awwinia amilobora, we obtained genomic information to be used for the comparison of the imaging bacterium genome and the molecular marker sequence. The genomic DNA of the domestic strains used in the present invention was provided from the Agriculture, Forestry and Livestock Quarantine Headquarters, and the genome sequence of the strains was decoded with PacBio RS II system and Illumina HiSeq 2500.

First, the sequences were assembled using the PacBio RS II system and sequencing readings generated by the Next Generation Sequencing method using the Illumina hiseq 2500 were used to generate sequences of errors Respectively. In order to correct the error sequences, a consensus sequence was extracted after mapping the leads generated by NGS to a sequence assembled with HGAP3, which is a program for assembly of PacBio sequencing leads, The results of mapping showed that the mapping of the paired sequences of Illumina was not properly performed and the final genome sequence was determined by reassembly. Thereafter, genetic prediction and genomic information of the new burn pathogen strains were analyzed (Table 1).

Example  2. Earnia  Comparison of strains belonging to the genus Escherichia

The genomic sequence of the CFBP 1430 and ATCC 49946 strains belonging to the vaccinia virus strain Ernia Amylobora deposited in the NCBI GenBank, the draft genomic sequence of the other pathogenic fungi strains and the causative agent of the fungal pathogen, Ke (E. prifoliae), fish Winiah Tasman Mani N-Sys (E. tasmaniensis), fish Winiah borrowed giae (E. billingiae), fish Winiah in 9145, control Winiah in using the genome sequence of Ejp617 new decrypted local strain genome Sequences and comparison and homology genes were analyzed (Table 2). In order to compare the genomic structure of the strains, sequencing and comparative analysis of genomic sequences were performed using sequencing programs Mauve and ProgressiveMauve.

As a result, the genetic synteny of the genome was observed through the difference in genome structure between the strains, and single nucleotide polymorphism (SNP) nucleotide sequences were identified and extracted from the sorted nucleotide sequences (FIG. 1).

Example  3. Selection of molecular markers for detection of burned germs among the isolated foreign fruit bacterium-specific genes

It is difficult to distinguish between the two strains because of their physiological and morphological similarities, and it is difficult to distinguish them from each other. In addition, it is also important to establish quarantine control standards related to the introduction and export of the germs at home and abroad by distinguishing the strains of domestic and foreign amilobolas. In the present invention, it is possible to specifically detect the avian amyloloba, And to develop a molecular marker for the discrimination of Erwinia amylobora.

For this purpose, a number of SNP sequences between strains belonging to the genus Erwinia and SNPs from strains of Erwinia amyloborrh were analyzed, and the gene regions having the respective specific sequences were selected. A SNP sequence applicable to real-time PCR diagnosis using PNA probes was used as a diagnostic and discrimination target, and a specific sequence between A. wilia amiloborrhoeae and other ewinia species was present in a nucleotide sequence fragment of about 15 mer or more In this case, the Tm value of the PNA probe is changed so that the strain can be distinguished. Therefore, the biomarker candidates are selected in consideration of this. The specific sequences contained in the PNA probes can be present in one or two SNPs, and selected for the avian amylolobase species-specific molecular markers and the localized burn bacterium-specific molecular markers meeting the above conditions 2).

In order to select the SNPs usable as the molecular markers, SNPs that can distinguish Domulia amiloborrhoeae were first compared with the complete genomic sequence of CFBP 1430 and ATCC 49946 to select a Korean specific sequence, To further narrow the SNP range to be selected by comparing the SNP position between the robora and the A. superfamily polyketide sequence. In addition, in order to select only the SNP at the gene position, the case where the gene containing the specific sequences exist in the comparative strain is considered as the core gene.

The core gene was derived from the analysis of the homology gene group and 2,016 genes were selected by performing BlastP under the condition of 50% identity and 80% coverage, and the core gene containing the specific sequence in the more strict criteria Were selected under the conditions of 85% similarity and 80% coverage, and 1,009 core genes were selected.

Therefore, the SNP sequences included in the core gene sets of the strict criteria were culled out, and the SNP sequences existing in the core genes with the similarity degree of 50% and the cover rate of 80% were examined. A sequence listing for specific detection of the A. winiah amilobora species was obtained. The genes containing the specific sequences were sorted using clustalW, and regions containing all of the sequences specific for A. wilia amilobolas and Domestic A. amilobolas were selected among the sorted gene sequences, and PNA probes Were identified.

Example  4. Detection of Erwinia amylolbora and identification of Erwinia amylobora Marker  Selection

Through the selection process of the molecular marker candidates, the SNP portion (Fig. 3) of the purH gene consisting of the nucleotide sequence of SEQ ID NO: 1; SNP portion of EAMY _0860 gene consisting of the nucleotide sequence of SEQ ID NO: 2 (Figure 4); Of SEQ ID NO: 3 consisting of a nucleotide sequence potF The SNP portion of the gene (Figure 5); The SNP portion of the sufB gene consisting of the nucleotide sequence of SEQ ID NO: 4 (Fig. 6); The SNP portion of the yegN gene consisting of the nucleotide sequence of SEQ ID NO: 5 (Fig. 7); The SNP portion of the yjcD gene consisting of the nucleotide sequence of SEQ ID NO: 6 (Fig. 8); The SNP portion of the livM gene consisting of the nucleotide sequence of SEQ ID NO: 7 (Fig. 9); The SNP portion of the yeiU gene consisting of the nucleotide sequence of SEQ ID NO: 8 (Fig. 10); And the SNP portion of the ribF gene consisting of the nucleotide sequence of SEQ ID NO: 9 (Fig. 11), the final nine molecular markers were selected. Table 3 shows the position and base information of each SNP of each gene.

By analyzing the melting temperature (Tm) value of the sample through real time PCR by preparing a PNA probe containing the selected 9 SNPs of the present invention, it is possible to detect not only Ammonia amylobora, It is considered that the strain can be identified.

Example  5. PNA The probe  Used Earnia Look at Amilo  division Marker  design

Four SNP candidate regions (EAMY_0860, EAMY_3283, EAMY_2938, and EAMY_1305) were selected from among the selected marker candidates for use as fluorescent PNA probes in real-time PCR equipment. An SNP region capable of distinguishing between E. amylovora and E. pyrifoliae , and a SNP region capable of discriminating between a domestic sickness and a foreign disease, PNA probes were designed. Depending on the type of SNP, a quencher was labeled at the 5 'end of the PNA probe and a fluorescent material (FAM or Texas Red) at the 3' end (Table 4).

PNA probes and primer information for real-time PCR analysis No CFBP
1430
locus
tag CFBP 1430
Dielectric
SNP location 0860 gene Opposition
gene The probe /
primer
designation Sequence information (5 '- > 3') (SEQ ID NO: Neon One

EAMY_0860

949123
949124
EAMY
_0860
C / G
A / G
FB -2 (Dabcy1) -TCCACTTCCGCTTTCA
- OK - (FAM) (10) FAM EAMY_0860-F CCACGCTTTCCGCTTACCT (11) EAMY_0860-R TGCTTTCAGCCACCGTTCG (12) 2
EAMY_3283

33922173

yjcD

T / C

FB -3 (Dabcy1) -CCGGGATTGCCG- OK
- (FAM) (13) FAM EAMY_3283-F GGCTGTTTTTGCTGCTTATCG (14) EAMY_3283-R GCAGGATCGAATATCAGACCA (15) 3

EAMY_2938

3037086

ribF

G / T / A

FB -4 (Dabcy1) -CGACGGTTTTTTGGG
- OK - (FAM) (16) FAM EAMY_2938-F CTGTACGGGCGACATATTGA (17) EAMY_2938-R CGGCAAATTCAGGGTAGATTT (18) 4

EAMY_1305

1376378

potF

G / A

FB -5 (Dabcy1) -CATCGCAATACATCAATG
- OK - (TxR) (19) Texas Red FB-5_1305-F AGGGTAAAGACCCGAACAGC (20) FB-5_1305-R TTCTTCGCCTGCAGAACGTC (21)

(O-K means a linker connecting an oligonucleotide and a fluorescent dye)

Example  6. SNP Marker  Screened and screened SNPs Marker  Verification

For real-time PCR analysis, 1 μl of genomic DNA (10 ng / μl), 10 μl of 2x qPCR PreMix (Seasun Biomaterials, Korea), 1 μl of forward primer (4 pmole / μl), 1 μl of reverse primer (40 pmole / PNA probe (10 pmole / 占 퐇) and 6.5 占 퐇 of distilled water were added so that the total content became 20 占 퐇.

PCR was performed using a CFX96 Touch ™ real-time PCR detection system (Bio-Rad, USA). PCR was carried out under the conditions of 95 ° C for 5 minutes, 95 ° C for 30 seconds, 56 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by 50 cycles. The temperature was gradually increased from 95 ° C to 40 ° C After the temperature was lowered, the temperature was increased from 40 ° C to 95 ° C at 1 ° C / sec, and fluorescence was detected during a hold of 5 seconds to confirm each SNP type. The experiment was repeated twice each and the SNP type was identified according to the melting temperature finally confirmed. For this purpose, five isolates were identified from domestic Awinia amilobor, three isolates from Awinia amilobo and three isolates from Awinia pyrifolia were selected. A total of 11 isolates were used.

To confirm the discrimination ability of the four selected candidate SNPs, fluorescence melting curve analysis (FMCA) was performed with a PNA probe and a primer set As a result of analyzing the genotypes, No.1 and No.3 (see Table 4) among the four PNA probes and primer sets in total did not show a clear melting curve due to poor reaction efficiency with PCR amplification products. Thus, PNA probes and primer sets No. 2 and No. 4 were finally selected.

First, in the case of a probe (SEQ ID NO: 13; FB-3) and a primer set (SEQ ID NOs: 14 and 15) capable of detecting a SNP located in the 514th base among the nucleotide sequences of the yjcD gene, (Table 5). The Tm value was found to be 67 ° C in the case of Bacillus thuringiensis, 53 ° C or 54 ° C in the case of Abyssinia amilobora, and the fluorescence value was not shown in the case of Acanthopiri polyp. The SNP type of domestic earwax amylobolas was classified as T by the difference of Tm values and the SNP type of foreign earwini amilobolas was classified as C (Fig. 12B-a and Table 5).

In addition, in the case of the PNA probe (SEQ ID NO: 19; FB-5) and the primer set (SEQ ID NOs: 20 and 21) capable of detecting the SNP located at the 681st base in the base sequence of the pot F gene, Tm The value of Tm was found to be 60 ° C and the value of Tm was found to be 69 ° C. The difference in Tm value indicated that the SNP type of Ewinia amyloborrhoe was G and the SNP type of Erwinia polypore was A (Fig. 12B-b and Table 5).

Analysis of Tm values of domestic and foreign Awinia amilobora and Awiniapiri polya using SNP markers Sample
FB-3 FB-5 Tm1 (占 폚) Tm2 (占 폚) Tm1 (占 폚) Tm2 (占 폚) FB5 domestic
Look at Ewiniah Amilo.
(Domestic fruit bruising) 67.00 67.00 60.00 60.00 FB10 67.00 67.00 60.00 60.00 FB20 67.00 67.00 60.00 60.00 FB31 67.00 67.00 60.00 60.00 FB34 67.00 67.00 60.00 60.00 Ea246 Oversea
Look at Ewiniah Amilo.
(Foreign fruit bruises) 53.00 53.00 60.00 60.00 Ea356 54.00 54.00 60.00 60.00 Ea495 54.00 53.00 60.00 60.00 Smoke gate Ewiniafiri Polyey
(Black blight of branches) - - 69.00 69.00 Pre-sale 1 - - 69.00 69.00 Pre-Sale 3 - - 69.00 69.00 NTC - - - -

NTC; No Template Control (negative control)

Example  7. SNP Marker  Screened and screened SNPs Marker  Sensitivity analysis

To examine the diagnostic sensitivity of a PNA probe (SEQ ID NO: 19; FB-5) and a primer set (SEQ ID NOs: 20 and 21) capable of detecting SNPs located in the 681st base of the base sequence of the potF gene, And PNA probe assay was performed by diluting genomic DNA of Earwinia pyripolyzia from 10 ng to 0.1 pg.

As a result, the PNA probe and the primer set were able to diagnose up to 1 pg of E. amylovora FB20, a fruit bruising strain, and the E. pyrifoliae strain It was confirmed that diagnosis was possible up to 0.1 pg (Fig. 13).

<110> Industry-Academic Cooperation Foundation, Yonsei University          XENOTYPE CO., LTD <120> Molecular marker for detecting Erwinia amylovora and uses thereof <130> PN18363 <160> 21 <170> Kopatentin 2.0 <210> 1 <211> 1590 <212> DNA <213> Erwinia amylovora <400> 1 atgcaactac atcgtcctgt acgccgcgcg ctgctcagcg tgtctgacaa agccggtatc 60 ctcgaattcg cacaggcgct ttcccggcgc ggcgtcgaac tgctctccac cggcgggact 120 gt; ccggaaatga tggatgggcg cgttaaaacg ttacatccga aagtgcatgg cggtatttta 240 ggacgccgtg gtcaggatga tgccgttatg gccgaacacg gtatctcgcc cgttgatatg 300 gtcgtcgtta acctttatcc cttcgcccaa accgtagctc gtgcagactg ttcgctggaa 360 gatgcggttg aaaatatcga tatcggtggc cccacaatgg tgcgctctgc cgccaagaat 420 cataaggacg tggctatcgt ggtgaagagc agcgactatc aggccatcat tgcagaactg 480 gatgccaatg agaattcact gacgctggca acccgttttg atctggcgat caaagctttt 540 gaacacactg cggcttacga cagtatgatt gccaactact ttggcagtat ggtccccgcc 600 tatcacggtg agacaaccga acccgccggc cgtttcccgc gcacgctgaa tctgaacttt 660 attaaaaagc aggatatgcg ctatggcgaa aacagccacc agcaggctgc cttctatata 720 gaagaggagg tcagtgaggc gtccgttgcc accgcacagc aggtacaggg taaagccctc 780 tcttataaca acatcgctga taccgacgcc gcgctggagt gcgtaaagga gttcaaccag 840 ccggcctgcg ttatcgtcaa gcatgcgaac ccgtgcggcg tggcgacagg cagctcaatt 900 ctcgatgcct acgggcgtgc ttaccaaacc gaccccactt ctgctttcgg cggcattatc 960 gccttcaacc gtgagctgga tgaagccacc gcacaggcga tcagcagccg ccagtttgta 1020 gaggttatca ttgcgccttc cgccagcgat gcggcgctga aggtgaccgc tactaaacag 1080 aacgtgcgcg tgctgacctg tggtcagtgg cagcagcgtc agacgggtct cgacttcaag 1140 cgtgtcaacg gtggcctgct ggtgcaggat cgcgatctcg gcatggtagg tgaaagccag 1200 ctacgcgtgg tcagtaagcg ccagccaggc gagcaggaac tgcgtgatgc gctgttctgc 1260 tggaaagtgg ctaaatttgt taagtcaaac gccattgttt atgcccgtga taatatgacc 1320 atcggcatag gggccggtca gatgagccgc gtttactcga ctaaaatcgc cggtatcaaa 1380 gccgctgatg aaggtctggc agtcacaggt tcggcgatgg cttctgacgc tttcttcccg 1440 ttccgcgacg gtattgatgc cgccgccgcc gttggcgtga cctgcgtgat ccagccggga 1500 ggctcaattc gagatgatga agtgatcgct gcggcagatg aacacggcat tgccatgatc 1560 tttaccgaca tgcgtcactt ccgccattaa 1590 <210> 2 <211> 786 <212> DNA <213> Erwinia amylovora <400> 2 atgaaaaaag gcttatcgac tttactggcc gctgcgctgc tgttttctca gataagcgtg 60 gtacaggctg accagctaca ggacgttgaa aaacgtggcg ttctgcgcgt tgccgtgccg 120 caggacttcc cgccgtttgg ttctgtcggc accgatttac agccgcaggg ttatgacatt 180 gatatggcga cgtatctggc taagcagatg aaacttaaat tgcagctggt gccggtgacc 240 agcgctaacc gcgtgcctta tctgcaaacc ggtaaggtcg atctggtgat ttccagcctg 300 ggcaagaacc cggaacgcga gaaagtgatt gatttcagcc gcgcctacgc accgttcttc 360 ctcggcgtct tcggcgcaaa gccgggggcg ctgaaggacg ccgccggact gagcggtaaa 420 tcggtcgggg taacgcgcgg cgcggtggaa gatatggtgc tgaccagcgt ggcgccgaaa 480 gatgcacagg taaaacgtta cgaagataac aacaccacgc tttccgctta cctttccggt 540 caggtgcagt acgtagcgac cggcaacctg gtggtggcag caatagcgcg ccagcaggcc 600 gataaagcgc cggtggcgca atttatgcta aaagactcgc cgtgctttat cggcatgaag 660 aaaggcgaac cggcgttgaa agcgaaagtg gatgcgctga ttgaacaggc gctgaaagac 720 aaaaccctga accgccttgc cgaacggtgg ctgaaagcac cgctgccggc cgatctcggc 780 gcgtaa 786 <210> 3 <211> 1110 <212> DNA <213> Erwinia amylovora <400> 3 atgctcaacc aaggtaaaaa atggttatct gctggtgctg tggcaatgct gatggcagtt 60 tcagctggct cgcccgccgc cgacaaaacg ctccacgtct acaactggtc cgattacatt 120 gcgccaaata ccgtggcgga ttttgagaaa caaaccggca tcaaagtagt gtacgacgtt 180 ttcgattcca atgaagttct ggaggggaaa ctgatggccg gcaacaccgg atatgatgtg 240 gtagtgcctt cttccagctt ccttgcgcgc cagttacagt ccggcgtgtt tcagccactg 300 gaccgcagca agctgccgaa ttacaagaat cttgatacgg atttgctgaa gaaactggag 360 caacacgacc cgggcaataa atatgctatc ccttatctgt gggccaccac cggcatcggc 420 tacaacgttg aaaaagtcaa agcggcgctg ggcaaagacg cgccggtgga cagctgggat 480 ctggtactga agcctgaaaa tctcgctaag ctgaaaagct gtggcgtttc cttccttgac 540 gctcctgagg aaatatttgc caccgtgctg aattatcagg gtaaagaccc gaacagcagt 600 gaggcaaaag attactcggg agcagccact gacctgttgc tgaagctgcg tccaaacatt 660 cgttacttcc actcatcgca gtacatcaat gacctggcga acggcaacac gtgcgtggct 720 atcggctggg cgggggacgt tctgcaggcg aagaaccgcg cgctggcggc gaaaaatggt 780 gtcgatattg cctacagcat cccaaaagag ggcgcactgg cgttcttcga tacgctggcc 840 atccctaaag atgcgaaaaa tgttgatgaa gcctggcagt tccttaacta cctgatgaaa 900 cctgaagtgg cggcgcagat ttccaatgcg gttttctacg ccagtggtaa taaagcttcg 960 gtgccgttgg ttgatgccgc catccgtaat aaccctggcg tttatcctcc ggcggacatt 1020 atggcaaaac tgttcacgct caaggtgcag gacccgaagc ttgaccgtgt gcgcacacgt 1080 gcatggacta aggtaaaaag tggtcagtga 1110 <210> 4 <211> 1494 <212> DNA <213> Erwinia amylovora <400> 4 atgtctcgta atactgacgc atctgacgat gtacaggttt gggaaggcag ccatcagaaa 60 tacaaagaag gcttctttac ccaactgcaa accgaagagt tcgaacacgg catcaacgaa 120 gatgtggtgc gcgctatctc ggccaaacgt aatgaacctg agtggatgct ggaattccgc 180 ttgaaggcgt ttgctgcatg gctggaaatg gaagaacccc actggttaaa agcgaattat 240 aaacagctgg attatcagga ttacagttac tactctgcgc catcctgtgg cagttgcgac 300 gacagctgcg cttcggaacc cggtgccaca caggcctcgg gcggcagcgc gcctgactat 360 ctgacccggg aagttgaaga ggccttcaaa cagctgggtg taccggtgcg ggaagggcag 420 gaagtggcgg ttgacgccat ttttgactcg gtatccgtgt cgacaaccta ccgcgacaag 480 ctggcaaaag aggggatcat cttctgctcc ttcggcgagg caatccacga atacccggag 540 ctggtcaaac agtatctggg tacagtggta ccggctaatg acaacttttt cgctgcgctc 600 aactctgctg tggcctccga tgggactttc gtctatatcc ctaaaggcgt gcgttgcccg 660 atggaactgt cgacctattt ccgtatcaat gcggcaaaga ccggccagtt cgagcgtacc 720 atcctgattg ccgatgaagg cagttacgtc agctacattg agggctgctc tgcccctgtt 780 cgtgacacct atcagctgca cgcagcggtg gtcgaagtga tcatccataa gaacgctgaa 840 gtgaaatatt ccacggtgca aaactggttc tccggtggcg actcagaagg cggcatcctt 900 aatttcgtga ctaagcgtgc gctttgcgaa ggtgaaaaca gcaaaatgtc ctggacgcag 960 tcagaaaccg gttcagccat cacctggaag tacccaagcg ttattctgcg cggtgataac 1020 tctatcggcg aatttttctc agtggcgctc accagcggtc gtcaacaggc cgacacgggc 1080 accaagatga tccatattgg caaaaatacc aaatcaacca ttatctcgaa gggtatttcg 1140 gcgggcaaaa gccagaatac ctatcgtggg ttggtgaaga tcatgcccac tgccaccaat 1200 gcacgcaatt tcactcagtg tgactcgatg ctgattggtg ccgaatgcgg cgcgcatacc 1260 ttcccgtatg tcgaggtgcg caatcacacc gcccagctgg agcacgaggc gaccacatcg 1320 cgtattggtg aagatcagct tttctactgc ctgcagcgcg ggatcagtga agatgatgct 1380 atttcgatga ttgtcaacgg cttctgcaag gatgttttct cggaactgcc gctggaattc 1440 gcggtggaag cacagaagct gctggccatc agtctggaac atagcgtggg ctaa 1494 <210> 5 <211> 3120 <212> DNA <213> Erwinia amylovora <400> 5 atgcaggtta tgcccccatc gcccggcggc ggcccgtcac gccagtttat tctaaggccg 60 gtcgccacca cgctgctgat gatagccatt ttacttgccg ggattattgg ctaccgcgcc 120 ctgccggttt ctgcgctgcc ggaggtagat tatcccacca tccaggtggt cacgctgtac 180 ccgggggcca gcccggacgt ggtaacctcg gcaattaccg ccccgctgga gcgccagttc 240 gggcagctgt ccggtctgaa acagatggac tcgcaaagct cgggcggcgc ctcggtgatc 300 aacctgcaat tccagctgaa cctggctttg gatgttgccg ggcaggaagt acaggcggcg 360 ataaacgccg cgaccaacct gctgccagac gacctgccca accaaccggt ttacagcaag 420 gtcaatccgg ccgatccgcc gatgatgacg ctggccgtca ccagctccac catgccaatg 480 acccaggttg ccgatatggt ggaaacccgc gtggcgcaga agatatccca ggtttccggc 540 gtgggcctgg tgacgctttc cggcggacaa cgcccggcgg tgcgggtgaa actgaacgcg 600 ccggcgctgg ccgcgctcgg catcagcagc gaaacggtgc gcagtgcgat cggcaatgcc 660 aacgtcaatt cggcaaaagg cagcctcgat ggcccggaac gttcaattac cctgtcagcc 720 aacgaccaga tcaaaaccgc tgatggcttc cgccagctga ttatcagcta tcaaaacgga 780 tcgccggtac gcctcggcga tgtcgcaacg gttgaacagg gggcggaaaa cagctggctg 840 ggtgcctggg ccaaccgcca gccggcaatc gtgctgaacg tgcagcgcca gccgggggcc 900 aacattattg ccaccgccga tcatatccgt cgcctgctgc cgtcactgac cgcctcgctg 960 ccaaaatcgg tcgaggttaa gctgcttagc gaccgcagca gcctgatccg cgcctcggtg 1020 cgtgatgtgc agttcgagct gctgctggcg ctggcgctgg tggtgatgat tatctccctt 1080 tttctgcgca acctggcggc taccctgatc ccggcggtgg cggtaccgct gtcgcttatt 1140 ggcacttttg cggcgatgta tttcctcggt ttttcgctca acaatctgac gctgatggcg 1200 ctaaccatcg ccaccggctt tgtggtcgat gacgccatcg tggtggtgga aaatatctca 1260 cgccacctcg aaaagggcga taaaccgctg gcggcggcgc tgaagggagc gggcgaaatc 1320 ggctttacca ttatttcact gactttctcg ctgattgcgg tgctgatccc gctgctgttt 1380 atgggcgaca tcgtcggccg cctgttccgc gaatttgccg tcaccctggc cgtggcgatc 1440 ctgatttcgg cgtttgtctc actgacgctg acgccgatga tgtgcgcccg aatgttaagc 1500 gccgggtcgc tgcgccagca gaaccgcttc tcgcgcgcca gcgaagcgct gtttgaccgc 1560 atcattgccc gctatggcct cctgctgcaa cgcgtgctgc atcatccctg gctaacgctc 1620 ggcgtggcgc ttggcaccct ggcgatcacc gtgctgctgt ggatcagcat cccgaagggg 1680 tttttccccc tgcaggataa cggcatcatc cagggtacgg tgcaggcccc acaatcggtt 1740 tcctatgcca atatggcgca gcgccagcag gcggtggcct cggtaattat gcaagatccg 1800 gcggtacaaa gtctgaccgc cttcgtcggc gtggacggca gcaatccggc gatcaacagc 1860 ggacggctgc acattaacct gaaaccgctg gaccagcgcg acgaccgtat cagcgcagtg 1920 atagctcgcc tgcaacagca ggttgcaaag ctgcccggca tccggctcta cctgcagccg 1980 gtgcaggatc tgaccattga tacccaggcc agccgcaccc agtaccagtt caccttacag 2040 gccggctcgc tcgacgcgct tagcctgtgg gtcactaaac tgctggcggc gttgcagggt 2100 ttacctgaac tgcgggacgt cagcagcgac tggcaggatc gggggctgga agcttacatt 2160 cgcgttgatc gtgacagcgc cagccgcctc ggcatttcgc tggccgatgt ggacaacgcg 2220 ctgtataacg ctttcggcca gcggctggtg tccaccattt ttactcaggc aaaccagtat 2280 cgcgtggtgc tggaacacga cacggcggcc acgccggggc tggcggcgtt gcagaacgtg 2340 cgtctgaaaa gcagcgatgg cggcagcgtt ccgttgagcg ccattgccag cgttgaacag 2400 cgtcatggcg cactgagcat taatcacctc gaccagttcc cgtccaccac tttctcgttc 2460 aacgtcagcg acgacgcttc gctggaacag gcggtggatg ccattagcct ggcgcagcag 2520 aaactggcga tgccagcgga tattaccacc cggtttcagg gcagcacgct tgcctttaag 2580 acggcgcttg ccaacaccgt atggctgatc gtcgccgcta ttgtggcgat gtatattgtg 2640 cttggcgtgc tgtatgagag ctttatccac ccggtgacca tcctttctac cctgcctacc 2700 gccggtgccg gtgcgttgct ggcactgatg atcgccggca acgagctgga tgtgatcgcc 2760 atcatcggta tcattctgct tatcggcata gtaaagaaaa atgccatcat gatgatcgac 2820 tttgcgctgg ctgccgagcg tgatcaggga atgatgccgt atcaggccat ctatcaggcc 2880 tgcctgctgc gcttccgtcc aatcctgatg accacgctgg ccgcgctgtt tggcgcgctg 2940 ccgttgatgc taagtcacgg cgtgggggcc gagttacggc gtccgctcgg catcgccatg 3000 gtcggcgggc tggtggtcag ccaggtgctg acgctgttca ccacgccggt gatttacctg 3060 ctgttcgatc ggctggcgcg ggctgcccgc cgtcgtatga tgccacgggt gacagagtga 3120                                                                         3120 <210> 6 <211> 1350 <212> DNA <213> Erwinia amylovora <400> 6 atgtctactc cttctcaacc ggcgagcggc tctttagacg cctggtttaa aatttccgca 60 cgcggcagta gcgtacgcca ggaagtgatc gccggcttga cgaccttcct ggcgatggtt 120 tattcagtga ttgttgtccc atctatgctc ggtaaagcgg gttttccgcc ggctgccgtc 180 ttcgttgcaa cctgcctggt tgccggattt ggttctctgc tgatggggct gtgggccaat 240 ctgccgatgg caattggttg tgccctttct ctgacggcgt ttaccgcttt cagcctggta 300 ctgggccagc aaattagcct ggcggtggcg ttgggggcgg tattcctgat gggggggctg 360 tttaccctga tctccgcgac cggcatccgc gcctggattt tgcgcaatct gccaatgggc 420 gtggcacacg gcaccggcgt gggtatcggg ctgtttttgc tgcttatcgc ggcggacggc 480 gtcggtctgg tgataaaaaa tccggggccg ggactgccgg tcgcattggg gcatttccct 540 tttttcccga ttgtcatgac tttgctgggc ctggcggtga tttttggtct ggaaaagcgg 600 cgcgtccccg gcggtatttt actgaccatt attgtgatat cggtcattgg tctgatattc 660 gatcctgccg tgcgctatca agggctgttt tccatgccaa gcctgagcga caagcagggg 720 aactcactgg tatttagcct ggatattatt ggtgcgctga aaccggcagt gctgccaagc 780 gtgctggcgc tggtgatgac ggccgtattt gatgccaccg ggaccattcg tgccgtggcg 840 ggtcaggcta atctgttgga taaaaacaat cagattatca gcggcggtag ggcgctgacc 900 agcgactcac tgagcagcat cttctctgga ttggtcggtg cggctcctgc cgcggtgtat 960 atcgagtcgg cggccggtac ggcagcgggc ggcaaaaccg ggctgacggc ggttgtggtc 1020 ggcgtgatgt tcctgctcat cctgtttttg tcaccgctgg cctacctggt tccgggttat 1080 gccaccgcac cagcactgat gtacgtcggg ctgctgatgc tgagcaacgt gtcaaaaatc 1140 gactttaacg attttgtcga tgcgatgtct ggtttgctgg cagcggtatt tatcgtgcta 1200 acctgcaata tcgtcaccgg tatcatgctc ggtttcggtt cgttgatcgt tggccgcctt 1260 gttgccggtg agtggcgtaa gctgaacgtg ggcacggtcg ttattggtgt catcctggtc 1320 gcattctatg ccggcggttg ggcaatttaa 1350 <210> 7 <211> 1275 <212> DNA <213> Erwinia amylovora <400> 7 atgaaaaagc tccatctgct taacgccgtg gcatcagcac tgatgctgct ggttctggcg 60 gcgttcttta tggggctgcg cctgaacctt gacggtacgc atctggtggt gaataacgcc 120 gggaagtgc gctggaactg gatcgccctc ggctgcggcg tggtgtttct gttccagctg 180 ctgcgcccgc tgttgcaccg tggcctgaaa aaagtgtccg ccccggtgct gatgctaccg 240 ggcattgatg gctccaccgt gaagcagaag ctgctgctgc tggcgctgat cgttgccgct 300 gcgctgtggc catttctggt atctcgcggc acggtggata ttgccaccct gacgctgatt 360 tacgtcatgc tcgggctggg gctgaatgtg gtggtcgggc tgtccgggct gctggtgctt 420 gt; gggctgggtt tctggcaatg cctgccgctg gccgggctgg tcgcggcggc ctttgggctg 540 ctgctcggtt ttccggtgct gcgtctgcgc ggtgattacc tggcgattgt gacgcttggc 600 ttcggggaga tcgtgcgtat tttactgctc aacaacacgg aaataaccgg tgggccaaac 660 ggcatcagcc agatccccaa accgaccttc tttggtctgg agtttaaccg cagcgtgcgc 720 gacggcggtt gggacacctt ccaccacttc tttggcctgc agtacgatcc gggcgaccgg 780 attatcttcc tgtatctggt ggcgctgctg ctggtggtga tgactctgtt tgttatcaat 840 cgcctgctgc gcatgccgct ggggcgcgcc tgggaagcgc tgcgtgaaga tgaaatcgcc 900 tgtcgctcgc tgggccttag cccgacacgg atcaagctga ccgcctttac catcagcgct 960 gctttcgccg gattcgccgg tagcctgttt gccgcccgcc agggctttgt cagcccggaa 1020 tccttcacct ttgccgaatc ggcctttgtg ctggcgatcg tggtgctggg cgggatggga 1080 tcgcagtttg cggtgatcct cgccgccgtg ctgctggtgg tatcacgcga gctgatgcgt 1140 gaccttaacg aatacagcat gctggtactg ggtggcctga tggtattgat gatgatctgg 1200 cgtccgcaag ggctgctgcc gatgaaacgt ccgcatctga agttgcaaca ggcgcagcag 1260 gaggaacagc catga 1275 <210> 8 <211> 708 <212> DNA <213> Erwinia amylovora <400> 8 atgactgtta aacgtatgtt gctcatcctg ctgctaaata cagccgggct gctgctgttt 60 tattcctggt atctgccagc cgatcatggc ctgtggttca ccattgataa aacgattttc 120 tactggttca acacgcatat ggtcaccagt ccggccctgc tgtggctggt ggcgatgacc 180 aatttccggg ctttcgacgg cgtatcgcta ctggcgatgg gaggactgta tttctggttc 240 tggcgacggg agacgcccgc cgggcgtcgc cgcatgttcg ccatcggtat aactatgctt 300 atcagtgcga taggtttgaa ccagctcggt catctgatcc ccgtttcgca ccccagccca 360 acccgtttct tcccggacgt gaaccatgtc gcagagctga ccggcattgc gaccaaagat 420 tctgccgctg acagtttccc aggcgaccac ggcttaatgc tgatgatatt cgcctgcttt 480 atgctgcgct atttcacccg tggcgctttt gctgtcgcag tattcattgt gctgctcttt 540 gccctgccac gcgtcatgat cggcgcacac tggtttaccg atattgccgt cggatcgctg 600 tcgattgcgc tggttggcat gagctggtgg ctgcttaccc cggccagcga ttatctggtg 660 aactggctat atcgtaattt gccgggaaaa tataaaccgc tgaaataa 708 <210> 9 <211> 939 <212> DNA <213> Erwinia amylovora <400> 9 atgaagttga tacgcggcat acataacctt agagagcagc atcgcggctg cgtactgact 60 atcggcaact tcgatggtgt acatcgcggg caccaggcgc tgctggcgca gctgtgcgca 120 gaagggcgtc aacgtcattt gccggtggtg gtcatgctgt ttgaacctca gccgctggaa 180 atgttcgcgg cagaaaaagc gcccgcccgg ctaacaaggc tgcgcgaaaa actgcgttac 240 ctggaacagg ctggcgttga tgcggtgctg tgtataggct tcgaccgcca ttttgccgcg 300 cacagtgcgc aacgatttat aactgacctg ctggtgaaaa aactccgcgt gcagctgctg 360 gcggtgggcg atgattttcg ctttggcgct ggtcgccagg gcgatttcct gttattacag 420 aaagctggcg ttgaatatgg ctttaatgtc atcagtaccc agactttttg cgatggcgga 480 aaacgcatca gcagtacggc ggtgcgccag gcgctggctg aagatgattt accgctggcg 540 caatccctgc tggggcgtcc gttcagcata tccggtcggg tggtgcatgg cgatgcgctt 600 ggccgtactc tgggtttccc tactgccaac ctgccactca ggcgtaccgt ttctccggta 660 aaaggggtat atgccgttga agtgctgggg ctgggcgagc gcgcgctgcc cggcgtggca 720 aatattggta caaggcccac cgttgccggg ctacgtcagc agctggaagt gcatctgctg 780 gacgtcgcca ttgacctgta cgggcgacat attgaggtgg tattgctgga taaaatacgc 840 gatgagcagc gcttcacatc gctcgacgca ctgaaagaac aaattgctaa cgatgtggtg 900 acagcccgac gtttttttgg gcagcaaaca tcggtctaa 939 <210> 10 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tccacttccg ctttca 16 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ccacgctttc cgcttacct 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tgctttcagc caccgttcg 19 <210> 13 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ccgggattgc cg 12 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ggctgttttt gctgcttatc g 21 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gcaggatcga atatcagacc a 21 <210> 16 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 cgacggtttt ttggg 15 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ctgtacgggc gacatattga 20 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 cggcaaattc agggtagatt t 21 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 catcgcaata catcaatg 18 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 agggtaaaga cccgaacagc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 ttcttcgcct gcagaacgtc 20

Claims (8)

delete A polynucleotide consisting of 15 or more consecutive nucleotides comprising a single nucleotide polymorphism (SNP) located in the 681 base of the nucleotide sequence of the pot F gene of SEQ ID NO: 3, or a complementary polynucleotide thereof, SNP marker composition for detecting Erwinia amylovora . delete A polynucleotide consisting of 15 or more consecutive nucleotides comprising a SNP located in the 681 base of the nucleotide sequence of the pot F gene of SEQ ID NO: 3 or a complementary polynucleotide thereof. delete An aviania amylolbora detection method comprising a pot F gene specific PNA probe consisting of the nucleotide sequence of SEQ ID NO: 19 or a complementary base sequence thereof and a pot F gene specific primer set consisting of the nucleotide sequence of SEQ ID NO: 20 and SEQ ID NO: Kit for real-time PCR. delete SEQ ID NO: 19 of the nucleotide sequence or a base sequence complementary potF gene-specific PNA probes with SEQ ID NO: 20, and specific primers fruit image potF gene of the disease suspected samples using a set potF gene consisting of the nucleotide sequence of SEQ ID NO: 21 consisting of Performing real-time PCR on the PCR product; And analyzing the gene amplification result by the real-time PCR.

Images