KR20160053091A - Pharmaceutical composition for prevention or treatment bone diseases comprising Alisma canaliculatum extract or fractions thereof, or compounds isolated from therefrom - Google Patents

Abstract

The present invention relates to a pharmaceutical composition as an Alisma canaliculatum extract, fractions thereof, or a compounds isolated from the same as an active component for preventing or treating bone diseases. The Alisma canaliculatum extract, the fractions thereof, or the compound isolated from the same of the present invention has no side effects by being derived from a natural material used as a natural medicinal material for a long time, and has an excellent activity of inhibiting formation or diffraction of an osteophage, thereby being used in prevention or treatment of bone diseases caused by reduction of bone density.

Description

[0001] The present invention relates to a pharmaceutical composition for prevention or treatment of bone diseases, which comprises extracts of phytophthora, extracts thereof, fractions thereof or compounds isolated therefrom,

The present invention relates to a pharmaceutical composition and a food composition for preventing or treating osteoporosis comprising Alisma canaliculatum extract, fractions thereof or a compound isolated therefrom as an active ingredient.

The human bone tissue is a dynamic organ that is constantly repeated throughout its lifetime, such as bone remodeling, such as bone formation and bone resorption by osteoblasts. Bone tissue constitutes the cartilage and skeletal system. It plays a role of support and muscle attachment by mechanical function, protects organism and bone marrow, and preserve calcium and phosphorus to maintain homeostasis. Bone tissue that functions like this is composed of many kinds of cells such as collagen, glycoprotein, and osteoblast, osteoclast, and osteocyte. Among them, osteoclasts are cells derived from hematopoietic stem cells, which are responsible for the absorption of aged bone. Osteoblasts are derived from bone marrow stromal cells and play a major role in osteogenesis.

The osteoclasts are differentiated into multinucleated osteoclasts by RAW264.7 mononuclear cells of the mouse by RANKL (receptor activator of nuclear factor κB (RANK) ligand). This differentiation process promotes the activation of mitogen-activated protein kinase (MAPK) by RANKL binding to RANK in the extracellular region, and this is because the transcription factor NF-κB enters into the nucleus and binds to osteoclast differentiation-related TRAP (MMP-9) and tyrosine kinase (tyrosine kinase). These multinuclear osteoclasts formed a mineralized bone, It plays a role of absorption. In addition, when RANKL binds to RANK, the activity of TRAF6 (tumor necrosis factor receptor-associated factor 6) is promoted to promote the activation of transcription factors such as MAPK or NF-κB, AP-1 and NFATc1 HH. Signal transduction by receptor activator of nuclear factor kappa B in osteoclasts. Biochem Biophys Res Commun 2003 May 30, 305, 211-4). Therefore, blocking of the signaling pathway activated by RANKL is recognized as one of the therapeutic approaches for the treatment of osteoporosis and other bone diseases.

Osteoporosis, which is a typical example of the above-mentioned bone disease, is a disease caused by weakening the balance of bone formation and bone resorption and weakening the bone density. Currently, about 10 million people already suffer from osteoporosis disease in the US and 18 million people are at risk of osteoporosis have. In addition, about 4 million people in Korea are exposed to or at risk for osteoporosis. This is expected to increase further as the society becomes more aged, and it is expected that social spending and mental and economic expenditure of family members will increase.

In order to treat the above-mentioned bone diseases, it is necessary to control the balance between osteoclasts and osteoblasts. Accordingly, there are a bone resorption inhibitor and a bone formation stimulator. In general, the therapeutic agent for bone diseases such as the bone resorption inhibitor or the bone formation stimulating agent should be administered to a patient for a long period of time, so that it should be low in toxicity. Oral administration is preferable to solve the complication of administration. It is true. On the other hand, studies on osteogenesis stimulants promoting osteogenesis by activating osteoblasts in the bone disease treatment agent have been actively carried out, but strengthening of bone mineral density due to osteogenesis stimulation does not necessarily mean reduction of fracture. On the other hand, Denosumab (Prolia ^™ , Amgen ^® ), which is currently being used to treat osteoclast activity, has been developed and various drugs have been developed. However, considering that the drug treatment should be continued for a long time, Side effects have not been sufficiently verified, and the exact mechanism of osteoclasts has not yet been elucidated.

Accordingly, the present inventors have made intensive efforts to find a natural substance useful for prevention and treatment of osteoporosis without causing adverse effects on the human body. As a result, it has been found that the extract of Taxa extract, the fraction thereof or the compound isolated therefrom does not show toxicity, The present invention has been accomplished based on the findings that it can be effectively used for prevention or treatment of osteopathy caused by a decrease in bone mineral density.

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating bone diseases, which comprises an extract of Taxa, a fraction thereof, a compound represented by the following general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient .

[Chemical Formula 1]

Another object of the present invention is to provide a food composition for preventing or ameliorating osteoporosis, which comprises the extract of Phytophthora exudata, fractions thereof or the compound represented by the formula (1) isolated therefrom as an active ingredient.

In order to achieve the above object, the present invention provides a method for producing a bone marrow extract comprising an extract of Alisma canaliculatum , a fraction thereof, a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof isolated therefrom as an active ingredient A pharmaceutical composition for preventing or treating a disease is provided.

[Chemical Formula 1]

Specifically, the pharmaceutical composition for preventing or treating osteopathy of the present invention may include a taxa extract, a fraction thereof, a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof.

In the present invention, the term " Alisma canaliculatum "is a water-soluble aquatic plant having no main stem and short rootstock, forming root roots, and having many beard roots. They live in wetlands such as rice paddies or rice paddies. They grow in all over the country, but are rarely distributed. In one room, root roots are used as medicines. As pharmacological actions, inflammatory lung diseases (Korean Patent Laid-Open Publication No. 2014-0013792), hyperlipidemia or arteriosclerosis (Korean Patent Publication No. 2013-0127088), emphysema and pulmonary hypertension (Korean Patent Publication No. 2013-0030620) have.

In the present invention, the term "taxa extract" means an extract obtained by extracting taxa. The above taxa extract may be prepared by mixing ₁ to 4 (C ₄ ) carbon atoms such as water, methanol, ethanol, and butanol in a volume of about 2 to 20 times, preferably about 3 to 5 times, Or a mixed solvent having a mixing ratio of about 1: 0.1 to 1:10 thereof is used as an elution solvent, and the extraction temperature is 20 to 100 DEG C, preferably room temperature, the extraction period is about 12 hours The extraction may be performed using an extraction method such as hot water extraction, cold extraction, reflux cooling extraction or ultrasonic extraction for 10 days to 5 days, preferably 5 days. However, if the method for extracting substances having a preventive or therapeutic activity for bone diseases is limited Can be used without. Preferably, the extract is continuously extracted one to five times by cold extraction, filtered under reduced pressure, and the filtrate is concentrated under reduced pressure at 20 to 100 ° C, preferably at room temperature, in a vacuum rotary condenser to be dissolved in water, a lower alcohol or a mixed solvent thereof But the present invention is not limited thereto. Examples thereof include a dry matter obtained by drying an extract, a diluted solution or concentrate of an extract, an extract, and the like, as long as it can exhibit the activity of preventing or treating bone diseases of the present invention, Or both of these controlled products or tablets. The taxa extract can be extracted from various organs of natural, hybrid, and variant plants and can be extracted from, for example, root, rootstock, root, stem, leaf,

The term "fraction" in the present invention means a product obtained by a fractionation method for separating a specific component or a specific group from a mixture containing various constituents. The taxa fractions of the present invention can be obtained by suspending the taxa extract and then fractionating it with a polar solvent such as water, methanol or ethanol or a non-polar solvent such as hexane or ethyl acetate to obtain a polar solvent fraction and a non-polar solvent fraction, respectively. Specifically, the crude extract of Taxa is suspended in distilled water or the like, and then water, about 1 to 100 times, preferably about 1 to 5 times the volume of the suspension, the alcohol having 1 to 4 carbon atoms (C ₁ ) to 4 (C ₄ ) A polar or nonpolar solvent such as ethyl acetate, hexane, butanol or a mixed solvent thereof may be added thereto, and the polar or non-polar solvent soluble layer may be extracted and separated from 1 to 10 times, preferably 2 to 5 times .

In one embodiment of the present invention, distilled water was added to the obtained crude ethanolic extract (100 g) to suspend, and then an equal amount of ethyl acetate was added thereto to separate the ethyl acetate layer and the water layer. The filtrate was concentrated under reduced pressure to obtain ethyl acetate fraction 18.0 g).

The fraction of the present invention may also be obtained by further performing a conventional fractionation process (Harborne J. B. Plant Pathology, 1998, 3rd Ed. P6-7). For example, fractions obtained by passing the extract of the present invention through an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography Active fractions obtained through a variety of additional purification methods are also included in the taxa fractions of the present invention. The active fractions are obtained by separating fractions having higher physiological activities or the like from the fractions, and they are also referred to as active fractions or effective fractions.

In addition, specific active components can be isolated from the fractions containing various components obtained through a conventional fractionation process such as the system fraction by concentration gradient column chromatography or the like. The column chromatography was carried out by performing column chromatography using a filler selected from the group consisting of silica gel, Sephadex, LH-20, ODS gel, RP-18, polyamide, Toyopearl and XAD resin, The column chromatography can be carried out several times by selecting an appropriate filler as necessary, but the present invention is not limited thereto. In using the chromatography, the elution solvent, the elution rate and the elution time may be the solvent, the rate, or the time generally used in the art.

Examples of the compound isolated from the above-mentioned taxa extract or its fractions are triphenyl-based compounds, and representative examples thereof include alisol A, B, C, its acetates and saccharides. The method of separating the triphenylamine compounds from the taxane of the present invention is separable by methods known in the art. More specifically, from the fraction obtained above, Alisol A 24-acetate (hereinafter referred to as Compound 1) can be obtained, but the present invention is not limited thereto.

The compounds of the present invention may be used in the form of a pharmaceutically acceptable salt. As the salt, an acid addition salt formed by a pharmaceutically acceptable free acid is useful. Acid addition salts include those derived from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, and aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxyalkanoates, Dioleate, aromatic acid, aliphatic and aromatic sulfonic acids. Such pharmaceutically innocuous salts include, but are not limited to, sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate chloride, bromide, Butyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, succinate, maleic anhydride, maleic anhydride, , Sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzene sulfonate, toluene sulfonate, chlorobenzene sulfide Propyl sulphonate, naphthalene-1-yne, xylenesulfonate, phenylsulfate, phenylbutyrate, citrate, lactate,? -Hydroxybutyrate, glycolate, maleate, Sulfonate, naphthalene-2-sulfonate or mandelate.

The acid addition salts according to the invention may be prepared by conventional methods, for example by dissolving the compounds in an excess of an aqueous acid solution and precipitating the salts using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile .

In addition, the compounds of the present invention can be prepared in the form of a pharmaceutically acceptable metal salt using a base. The alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is preferable for the metal salt to produce sodium, potassium or calcium salt. In addition, the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (for example, silver nitrate).

The extract of the present invention, fractions thereof, the compound represented by the formula (1) or a pharmaceutically acceptable salt thereof according to the present invention can be used as an agent for preventing or treating osteoclast differentiation, comprising NFATc1 (Nuclear factor of activated T-cells, cytoplasmic 1) Prevention or treatment of osteoporosis by reduction of bone density by inhibiting the expression or activity of TRAP (Tartrate-resistant acid phosphatase), DC-STAMP (dendritic cell-specific transmembrane protein) and / or cathepsin K gene or protein It can be used for applications.

The term "bone disease" in the present invention encompasses all diseases that can be caused by a decrease in bone density, and specifically includes osteoporosis, osteomalacia, osteogenesis imperfecta, osteopetrosis But are not limited to, osteopenia, osteosclerosis, Paget's disease, adynamic bone disease, metabolic bone disease, rickets, and the like.

In the present invention, the term "prevention" means any action that inhibits or delays the onset of bone disease by administration of the composition, and "treatment" .

The pharmaceutical composition comprising the taxa extract of the present invention, its fractions, the compound isolated therefrom, or a pharmaceutically acceptable salt thereof may further comprise a suitable carrier, adduct or diluent conventionally used in the production of a pharmaceutical composition can do. In this case, the content of the taxa extract, its fractions, the compound isolated therefrom, or the pharmaceutically acceptable salt thereof contained in the composition is not particularly limited, but is preferably 0.001% by weight to 99% by weight, May comprise from 0.01% to 50% by weight.

The pharmaceutical composition may be any one selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterilized aqueous solutions, nonaqueous solvents, suspensions, emulsions, And may be oral or parenteral formulations of various forms. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules, and the like, which may contain one or more excipients such as starch, calcium carbonate, sucrose or lactose lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate, talc, and the like may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, syrups and the like. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the non-aqueous solvent and the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. Examples of the suppository base include witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like.

In another aspect, the present invention provides a method for preventing or treating a bone disease, comprising administering the pharmaceutical composition to a suspected individual of a bone disease.

In the present invention, the suspected individual of bone disease refers to all animals including humans, who have developed or are capable of developing the disease. By administering the pharmaceutical composition of the present invention to suspect individuals of bone disease, have. The pharmaceutical composition and bone diseases are as described above.

The term "administration" as used herein means introduction of the pharmaceutical composition of the present invention to a suspected subject of bone disease by any appropriate method, and the administration route includes various routes of oral or parenteral administration ≪ / RTI >

The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount.

The term "pharmaceutically effective amount" as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will vary depending on the species and severity, age, sex, The type of drug, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And can be administered singly or multiply. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.

The pharmaceutical composition of the present invention is not particularly limited as long as it is an object for bone disease, and any of them can be applied. For example, any non-human animal such as a monkey, a dog, a cat, a rabbit, a guinea pig, a rat, a mouse, a cattle, a sheep, a pig or a goat can be used. Subcutaneous, intraperitoneal, intrapulmonary, and intranasal, and may be administered by a suitable method, including localized administration, if necessary, for localized treatment. The preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and body weight of the individual, the degree of disease, the type of drug, the route of administration and the period of time, but can be appropriately selected by those skilled in the art. For example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine dural or intracerebral injection.

Suitable total daily doses may be determined by the treatment within the scope of sound medical judgment and are generally in the range of 0.001 to 1000 mg / kg, preferably 0.05 to 200 mg / kg, more preferably 0.1 to 100 mg / kg can be administered once or several times a day.

In another aspect, the present invention provides a food composition for preventing or ameliorating osteoporosis comprising, as an active ingredient, a taxa extract, a fraction thereof, or a compound represented by the following formula (1).

 [Chemical Formula 1]

The above taxa, extracts thereof, fractions, compounds of formula (I) and bone diseases are as described above.

The term "improvement" in the present invention refers to the use of a composition comprising, as an active ingredient, a composition comprising a taxane extract, a fraction thereof, or a compound represented by the following formula (1) Refers to any action that alleviates or alleviates symptoms of an onset entity.

Specifically, the extract of the present invention, fractions thereof, or a compound represented by the following formula (1) isolated therefrom can be added to a food composition for the purpose of preventing or improving bone diseases.

The food composition of the present invention may be in the form of pills, powders, granules, infusions, tablets, capsules or liquid preparations. There is no particular limitation on the type of food to which the extract of the present invention or the fraction thereof can be added, For example, various beverages, gums, tea, vitamin complex, and health supplement foods.

 The food composition may further contain other ingredients in addition to the taxane extract, its fractions, or the compounds isolated therefrom, and the kind thereof is not particularly limited. For example, it may contain various herbal medicine extracts, food-acceptable food-aid additives or natural carbohydrates such as ordinary food, but is not limited thereto.

 The term "food supplementary additive " in the present invention means a component which can be added to foods in a supplementary manner, and is appropriately selected and used by those skilled in the art as added to produce health functional foods of each formulation. Examples of food-aid additives include flavors such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, , a pH adjusting agent, a stabilizer, a preservative, a glycerin, an alcohol, a carbonating agent used in a carbonated drink, and the like. However, the types of the food auxiliary additives of the present invention are not limited by these examples.

Examples of the natural carbohydrate include monosaccharides such as glucose and fructose; Disaccharides such as maltose, sucrose and the like; And polysaccharides such as dextrin and cyclodextrin and sugar alcohols such as xylitol, sorbitol and erythritol. In addition to the above, natural flavorings (such as tau mart), stevia extracts (rebaudioside A, Etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.

The food composition of the present invention may include a health functional food. The term " health functional food " as used in the present invention refers to foods prepared and processed in the form of tablets, capsules, powders, granules, liquids, and rings using raw materials and ingredients having useful functions in the human body. Here, the term "functionality" means that the structure and function of the human body are controlled to obtain nutritional effects or effects useful for health use such as physiological actions. The health functional food of the present invention can be manufactured by a method commonly used in the art and can be prepared by adding raw materials and ingredients which are conventionally added in the art. Also, unlike general medicine, there is an advantage that there is no side effect that can occur when a medicine is used for a long time by using food as a raw material, and it is excellent in portability.

The amount of the active ingredient to be mixed can be suitably determined according to the intended use (prevention, health or therapeutic treatment). Generally, the extract of the present invention or the fraction thereof may be added in an amount of 1 to 50% by weight, preferably 5 to 10% by weight, based on the weight of the raw material composition, but is not limited thereto. However, in the case of long-term ingestion intended for health and hygiene purposes or for the purpose of controlling health, the amount can also be used in the above-mentioned range.

There is no particular limitation on the kind of the food. Examples of the food to which the above substances can be added include dairy products including meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, Alcoholic beverages, and vitamin complexes, all of which include health functional foods in a conventional sense.

In another aspect, the present invention provides a pharmaceutical composition for preventing or treating bone diseases, which comprises a compound represented by the following formula (1) as an active ingredient.

 [Chemical Formula 1]

In another aspect, the present invention provides a food composition for preventing or ameliorating bone diseases, which comprises a compound represented by the following formula (1) as an active ingredient.

 [Chemical Formula 1]

The extract of the present invention, its fractions or the compound isolated therefrom is derived from a natural product which has been used for a long time as a natural medicinal material and has no side effects and has excellent osteoclast formation or differentiation inhibiting activity. Therefore, Can be usefully used in therapy.

FIG. 1 is a photograph (A) showing the result of TRAP staining according to treatment concentration of the taxa extract, a graph (B) showing the number of TRAP positive cells, and a graph (C) showing the cell survival rate (cytotoxicity).
FIG. 2A is a photograph showing the result of TRAP staining for the treatment concentration of the ethyl acetate fraction of the taxa extract. FIG.
FIG. 2B is a photograph showing the results of TRAP staining of the ethyl acetate fraction (3 μg / ml) of the taxa extract. Compounds were isolated in fraction 9, where TRAP activity was most significantly inhibited.
2c is a graph showing the cytotoxicity of the ethyl acetate fraction of Taxus extract.
FIG. 3 is a photograph (A) showing the result of TRAP staining for the compound concentration (Alisol A 24-acetate) separated from the taxa, a graph (B) showing the number of TRAP positive cells and a graph showing the cell survival rate (cytotoxicity) C).
FIG. 4 is a graph showing RT-PCR of mRNA expression levels of osteoclast differentiation-related factors (NFATc1, TRAP, DC-STAMP, Cathepsin K)
FIG. 5 is a graph showing the mRNA expression level of osteoclast differentiation-related factors (NFATc1, TRAP, DC-STAMP, Cathepsin K) by RT-PCR according to the treatment period of the compound (Alisol A 24-acetate)
FIG. 6 is a Western blot graph showing the protein expression level of the osteoclast differentiation-related factor (NFATc1) according to the treatment time of the compound (Alisol A 24-acetate) isolated from Taxa.
The quantitative results of the experiments were expressed as means and standard deviations. Statistical significance was analyzed using Student's t-test. P values less than 0.05 were considered to be statistically significant (P values * <0.05, ** <0.01, *** <0.001 ).

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

Experimental material

Recombinant murine RANKL and macrophage-colony stimulating factor (M-CSF) were purchased from R & D Systems (MN), and cell culture medium, fetal bovine serum (FBS), and penicillin / streptomycin Were purchased from Invitrogen Life Technologies (NY). The CCK-8 assay kit was purchased from Dojindo Molecular Technologies (ML) and all reagents used in reverse transcription and real-time PCR master mix are from Enzynomics (KR). NFATc1 monoclonal antibodies and actin polyclonal antibodies were purchased from SantaCruz Biotechnology (CA, USA).

Production Example 1: Preparation of Taxa extract, fraction and active fraction

Dried rhizome (rootstock) of phytase (wet weight 1.2 kg) was pulverized and extracted with 4.0 L of ethanol at room temperature for 5 days.

100 g of the obtained ethanol extract was concentrated in vacuo (concentration under reduced pressure), after which ethyl acetate and water (1: 1) were fractionated as a fraction solvent. Of these, the ethyl acetate (EtOAc) layer was concentrated in vacuo to give 18.0 g of ethyl acetate soluble fraction.

Production Example 2: Separation of Compounds from Taxane Active Fractions

18.0 g of the ethyl acetate-soluble fraction obtained in Preparation Example 1 was purified by silica gel (0.04-0.063 mm) column chromatography, which gradually gradient the solvent from 100% chloroform (CH ₂ Cl ₂ ) to 100% methanol (MeOH) .

The fractions were eluted with methanol containing 2% CH ₂ Cl ₂ and then purified by RP-HPLC (Phenomenex Luna RP-C18 (R)) using an isocratic solvent system of 85% acetonitrile in water (H ₂ O) (2), 5 μm, 250 × 10 mm, 2.5 mL / min]. As a result, Alisol A 24-acetate (7.0 mg, t _R 14 min) having the structure represented by the following formula 1 was obtained.

[Chemical Formula 1]

The structure of the compound was confirmed by the following NMR results.

_{^{1 H NMR (CDCl 3, 700MHz}} ): δH 4.65 (1H, s, H-24), 3.89 (2H, overlapped, H-11 and H-23), 2.81 (2H, dd, J = 13.8, 5.9 Hz H M), 2.20 (3H, s), 2.31 (2H, d, J = _{, -COCH 3), 2.15 (1H} , m, Hb-1), 2.16 (2H, m, H-16), 2.10 (1H, m, H-5), 2.02 (2H, m, H-7), M, H-6a), 1.38 (1H, m, H-15a), 1.74 (1H, d, J = 10.8 Hz, H- (2H, m, H-22), 1.36 (1H, m, H-15b), 1.30 (3H, s, -30), 1.07 (3H, d , J = 11.0 Hz, H-21), 1.06 (3H, s, H-28), 1.00 (3H, s, H-18), 0.99 (3H, s, H- 19), 0.98 (3H, s, H-29). ;

_{^{13 CNMR (175MHz, CDCl 3)}} : δC 220.5 (qC, C-3), 171.5 (-COCH 3), 138.3 (qC, C-13), 135.5 (qC, C-17), 78.6 (CH, C- C-23), 57.0 (q C, C-14), 49.6 (CH, C-9), 48.5 CH, C-5), 47.0 (qC, C-4), 40.5 (qC, C-8), 39.7 (CH 2, C-22), 36.9 (qC, C-10), 34.5 (CH 2, C _{-12), 34.3 (CH 2,} C-7), 33.8 (CH 2, C-2), 30.9 (CH 2, C-1), 30.5 (CH 2, C-15), 29.6 (CH 3, C _{-28), 29.1 (CH 2,} C-16), 27.9 (CH, C-20), 27.5 (CH 3, C-26), 26.6 (CH 3, C-27), 25.7 (CH 3, C- _{19), 24.1 (CH 3,} C-30), 23.2 (CH 3, C-18), 20.1 (-COCH 3), 20.1 (CH 3, C-29), 20.1 (CH 3, C-21), 20.0 (CH ₂ , C-6); _{LCMSm / z: 515 [MH 2} O + H] +, 497 [M-2H 2 O + H] +

Example: Culturing and differentiation of osteoclasts

Bone marrow cells were obtained by separating the femur and tibial bones of 5-6 week old mice and washing the bone lumen space with a 1 cc syringe. Separated bone marrow cells were cultured in α-minimal essential medium (α-MEM) medium containing 10% FBS, antibiotics and M-CSF (30 ng / Non-adherent bone marrow cells were cultured in petri dishes in M-CSF (30 ng / ml) for 3 days and adherent cells were used as bone marrow macrophages (BMM).

For osteoclast formation, the proliferating cells were cultured for 4 days by adding M-CSF (30 ng / ml) and RANKL (10 ng / ml). At this time, the extracts of Taxa extract prepared in Preparation Examples 1 and 2, the fractions thereof and the compounds isolated therefrom were treated at the respective concentrations and cultured together.

Culture medium was changed every 3 days and osteoclast formation was measured by TRAP staining. (TRAP) solution (Sigma Aldrich, USA), and red stained cells were regarded as osteoclasts.

Experimental Example 1: Evaluation of cytotoxicity of the extracts, fractions and the compounds isolated therefrom

The bone marrow-derived macrophages in a 96-well plate at 1 × 10 ⁴ in the presence of a seeding (seeding) and then a M-CSF (30 ng / ml ) at the density of cells / well, prepared or separated in Preparative Examples 1 and 2 Taxa extract, fractions and compounds were treated by concentration and then cultured for 3 days. After 3 days, the phagocytic cells were further cultured in α-MEM medium containing 10% CCK-8 reagent for 3 hours and absorbance was confirmed at 450 nm using an ELISA reader (Molecular Devices, CA, USA).

As a result, it was confirmed that all the extracts, fractions and compounds produced or isolated in Preparation Examples 1 and 2 did not show cytotoxicity at the concentrations tested (C in FIG. 1, FIG. 2C, and FIG. 3C). These results indicate that the osteoclast formation inhibitory activity to be confirmed later is not the toxic effect on the predation cell but the osteoclast inhibitory activity by the taxa extract, fractions and compounds.

Experimental Example 2: Analysis of inhibitory activity on the osteoclast formation of the extracts, fractions and compounds isolated therefrom

Experimental Example 2-1: Analysis of TRAP inhibitory activity

When cells of the above example were fixed with 3.7% formalin for 5 minutes and treated with 0.1% Triton X-100 for 10 minutes to increase the permeability of the cell membrane, the polynuclear osteoclasts were reddish by treatment with TRAP solution, Only osteoclasts with three or more nuclei were recognized as osteoclasts.

As a result, it was observed that a large number of ruddy stained osteoclasts were formed in the control group induced by RANKL, while the extracts of Taxus extract prepared in Preparation Examples 1 and 2, fractions thereof and the compounds isolated therefrom In the experimental group treated with each concentration, it was confirmed that the number of red osteoclasted osteoclasts was significantly reduced while suppressing TRAP activity in a concentration (dose) - dependent manner. Particularly, treatment with 10 and 30 μM of alisol A 24-acetate completely inhibited osteoclast differentiation (FIGS. 1A and 1B, FIGS. 2A and 2B and FIGS. 3A and 3B).

This suggests that the extract of Taxa, its fractions and the compounds isolated therefrom inhibit RANKL-induced osteoclast formation.

Experimental Example 2-2: Inhibitory activity of gene expression related to osteoclast differentiation (RT-PCR)

RT-PCR was performed to confirm the mRNA expression pattern of transcription factors involved in osteoclast differentiation. Specifically, mRNA expression levels of NFATc1, TRAP, DC-STAMP and cathepsin K as osteoclast-specific genes in osteoclast differentiation were compared with control (DMSO).

Specifically, each primer shown in Table 1 below was selected using Primer 3 design program (Primer 3 design program). Total RNA was extracted from the cells of Example 1 using the TRIzol reagent. CDNA was synthesized using 0.5 μg of total RNA, 1 μM of oligo-dT18 primer, and M-MLV cDNA synthesis kit (Enzynomics, KR). Subsequently, SYBR green-based QPCR was performed on a Stratagene Mx3000P Real-Time PCR system with TOPrealTM qPCR 2X PreMIX (Enzynomics, KR). Then, the polymerase was allowed to react at 95 ° C for 10 minutes, followed by 40 cycles of reaction at 94 ° C for 30 seconds (denaturation), 60 ° C for 30 seconds (annealing) and 72 ° C for 30 seconds (amplification) A PCR product temperature-dissociation curve (also referred to as the melting curve) was generated at 95 ° C for 1 minute, 55 ° C for 30 seconds, and 95 ° C for 30 seconds. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a control (internal standard). All reactions were performed in ^triplicate and the data were ^analyzed using 2- ^{DELTA CT} .

Target gene Forward (5'-3 ') Reverse (5'-3 ') NFATc1 GGGTCAGTGTGACCGAAGAT
(SEQ ID NO: 1) GGAAGTCAGAAGTGGGTGGA
(SEQ ID NO: 2) TRAP GATGACTTTGCCAGTCAGCA
(SEQ ID NO: 3) ACATAGCCCACACCGTTCTC
(SEQ ID NO: 4) Cathepsin K GGCCAACTCAAGAAGAAAAC
(SEQ ID NO: 5) GTGCTTGCTTCCCTTCTGG
(SEQ ID NO: 6) DC-STAMP CCAAGGAGTCGTCCATGATT
(SEQ ID NO: 7) GGCTGCTTTGATCGTTTCTC
(SEQ ID NO: 8) GAPDH ACCACAGTCCATGCCATCAC
(SEQ ID NO: 9) TCCACCACCCTGTTGCTGTA
(SEQ ID NO: 10)

As a result, it was confirmed that mRNA expression of transcription factors such as NFATc1, which is an important factor for differentiation of osteoclasts, was significantly inhibited in cells cultured and treated with Taxa extract and compounds isolated therefrom compared to the control group (Fig. 4 ). In addition, it has been shown that osteoclast-related molecules, including TRAP, a factor associated with fusion, DC-STAMP, a factor associated with osteoclast differentiation markers, and cathepsin K, a factor associated with bone resorption, 4).

Experimental Example 2-3: Inhibitory activity of osteoclast differentiation-related protein expression (Western blot)

Western Blot analysis was performed to confirm the expression pattern of NFATc1 protein among the key differentiation markers involved in osteoclast differentiation.

Specifically, the cells cultured in the above example were lysed in a solution buffer (50 mM tris-Cl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 1 mM sodium fluoride, 1 mM sodium vanadate, 1% deoxycholate, and 1 : 1000 protease inhibitors), and the cell lysate was separated by SDS-PAGE. The separated proteins were transferred to a PVDF membrane (polyvinylidene difluoride membrane, Millipore) and the degree of protein expression was confirmed using an antibody. The membrane was washed with TBST (10 mM Tris-HCl pH 7.5, 150 mM NaCl and 0.1% Tween 20) and incubated in blocking buffer (5% nonfat milk in TBST) for 1 hour at room temperature. The membrane was then incubated overnight with anti-NFATc1 (1: 500) and anti-actin (1: 1000) and after 3 washes the membrane was conjugated to horseradish peroxidase The cells were incubated at room temperature for 2 h with the secondary antibody and washed three times for 30 min. Specific bands were visualized by chemiluminescence using a LAS-3000 luminescent image analyzer (Fuji Photo Film Co., Ltd., Japan).

As a result, it was confirmed that the expression of NFATc1 protein was significantly increased by RANKL but remarkably decreased by treatment with Alisol A 24-acetate compound (FIG. 6). This suggests that the above compounds, as well as the taxa extracts containing them, as well as fractions thereof, also inhibit protein expression of NFATc1 and further inhibit osteoclast formation.

From the above results, it was confirmed that the extract of the present invention, its fractions and the compounds isolated therefrom have an inhibitory activity on osteoclast formation or differentiation.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, as well as all changes or modifications derived from the meaning and scope of the appended claims and their equivalents.

<110> Industry-Academy Cooperation Corps of Sunchon National University <120> Pharmaceutical composition for prevention or treatment bone          Diseases comprising Alisma canaliculatum extract or fractions          their, or compounds, from from therefrom <130> KPA141113-KR <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 forward primer <400> 1 gggtcagtgt gaccgaagat 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 reverse primer <400> 2 ggaagtcaga agtgggtgga 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRAP forward primer <400> 3 gatgactttg ccagtcagca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRAP reverse primer <400> 4 acatagccca caccgttctc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cathepsin K forward primer <400> 5 ggccaactca agaagaaaac 20 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Cathepsin K reverse primer <400> 6 gtgcttgctt cccttctgg 19 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP forward primer <400> 7 gtgcttgctt cccttctgg 19 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP reverse primer <400> 8 ggctgctttg atcgtttctc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 9 accacagtcc atgccatcac 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 10 tccaccaccc tgttgctgta 20

Claims (11)

Alismataceae (Alisma canaliculatum) extract, fractions thereof, or from which to remove a composition for preventing or treating bone disease comprising the compound or a pharmaceutically acceptable salt thereof represented by the general formula (1) as an active ingredient.
[Chemical Formula 1]

The method of claim 1, wherein the extract is water, carbon number ₁ (C 1) to 4 will be extracted by using alcohol or a mixed solvent of (C ₄₎ composition.
The composition of claim 1, wherein the extract is extracted with ethanol.
The method of claim 1, wherein the fraction is obtained by fractionation using alcohol, chloroform, ethyl acetate, hexane or a mixed solvent of ethanol extract of Alismataceae water, carbon number ₁ (C 1) to ₄ (C 4) / RTI &gt;
The composition of claim 1, wherein the fraction is obtained by fractionating the ethanol extract of Phytase with water, ethyl acetate or a mixed solvent thereof.
The composition of claim 1, wherein said fraction is an active fraction that is further fractionated by column chromatography with ethyl acetate fraction of ethanol extract and separated using chloroform, methanol or a mixed solvent thereof.
The composition according to claim 1, wherein the extract of Taxa, a fraction thereof, or a compound represented by the formula (1) isolated therefrom or a pharmaceutically acceptable salt thereof inhibits osteoclast differentiation.
2. The method according to claim 1, wherein the extract, the fraction thereof, or the compound represented by formula (I) or a pharmaceutically acceptable salt thereof isolated from the extract is selected from the group consisting of NFATc1 (Nuclear Factor of Activated T-cells, -resistant acid phosphatase, DC-STAMP (dendritic cell-specific transmembrane protein) and cathepsin K (cathepsin K).
The method of claim 1, wherein the bone disease is selected from the group consisting of osteoporosis, osteomalacia, osteogenesis imperfecta, osteopetrosis, osteosclerosis, Paget's disease, Wherein the composition is at least one selected from the group consisting of adynamic bone disease, metabolic bone disease and rickets.
1. A food composition for preventing or ameliorating osteoporosis, comprising an extract of Phytophthora exudatum, a fraction thereof, or a compound represented by the following formula (1) isolated therefrom as an active ingredient.
[Chemical Formula 1]

11. The method of claim 10, wherein the bone disease is selected from the group consisting of osteoporosis, osteomalacia, osteogenesis imperfecta, osteopetrosis, osteosclerosis, Paget's disease, Wherein the composition is at least one selected from the group consisting of adynamic bone disease, metabolic bone disease and rickets.

Images