KR20160053091A - Pharmaceutical composition for prevention or treatment bone diseases comprising Alisma canaliculatum extract or fractions thereof, or compounds isolated from therefrom - Google Patents
Pharmaceutical composition for prevention or treatment bone diseases comprising Alisma canaliculatum extract or fractions thereof, or compounds isolated from therefrom Download PDFInfo
- Publication number
- KR20160053091A KR20160053091A KR1020140149524A KR20140149524A KR20160053091A KR 20160053091 A KR20160053091 A KR 20160053091A KR 1020140149524 A KR1020140149524 A KR 1020140149524A KR 20140149524 A KR20140149524 A KR 20140149524A KR 20160053091 A KR20160053091 A KR 20160053091A
- Authority
- KR
- South Korea
- Prior art keywords
- extract
- fraction
- composition
- fractions
- bone disease
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
Abstract
Description
본 발명은 택사(Alisma canaliculatum) 추출물, 이의 분획물 또는 이로부터 분리한 화합물을 유효성분으로 포함하는 골질환의 예방 또는 치료용 약학적 조성물 및 식품 조성물에 관한 것이다.
The present invention relates to a pharmaceutical composition and a food composition for preventing or treating osteoporosis comprising Alisma canaliculatum extract, fractions thereof or a compound isolated therefrom as an active ingredient.
인체의 골 조직은 조골세포에 의한 골 재형성(Bone formation)과 파골세포에 의한 골 재흡수(Bone resorption) 과정과 같은 골의 리모델링(Bone remodeling)이 평생동안 끊임없이 반복되어 이루어진 역동적인 기관이다. 골 조직은 연골과 골격계를 구성하며 기계적 기능으로 지지와 근 부착의 역할을 하고, 생체기관 및 골수를 보호하는 기능을 하며, 칼슘과 인 이온의 항상성 유지를 위해 이들을 보존하는 기능을 담당한다. 이와 같은 기능을 하는 골 조직은 교원질, 당단백질과 같은 세포 기질과 조골세포, 파골세포 및 골세포 등 여러 종류의 세포들로 이루어진다. 이들 중 파골세포는 조혈모세포로부터 유래한 세포로서 노화된 골의 흡수를 담당하며, 조골세포는 골수 내 간질세포(bone marrow stromal cell)로부터 유래한 세포로서 골 형성에 주된 역할을 담당한다.The human bone tissue is a dynamic organ that is constantly repeated throughout its lifetime, such as bone remodeling, such as bone formation and bone resorption by osteoblasts. Bone tissue constitutes the cartilage and skeletal system. It plays a role of support and muscle attachment by mechanical function, protects organism and bone marrow, and preserve calcium and phosphorus to maintain homeostasis. Bone tissue that functions like this is composed of many kinds of cells such as collagen, glycoprotein, and osteoblast, osteoclast, and osteocyte. Among them, osteoclasts are cells derived from hematopoietic stem cells, which are responsible for the absorption of aged bone. Osteoblasts are derived from bone marrow stromal cells and play a major role in osteogenesis.
이 중 파골세포는 마우스의 RAW264.7 단핵구 세포가 RANKL(receptor activator of nuclear factor κB (RANK) ligand)에 의해 다핵 파골세포(multinucleated osteoclasts)로 분화된다. 이러한 분화 과정은 세포 외부의 RANKL이 RANK에 결합하여 미토겐 활성 단백질 키나아제(mitogen-activated protein kinase, MAPK)의 활성을 촉진하고, 이는 NF-κB라는 전사 인자가 핵 내로 들어가서 파골세포 분화와 관련된 TRAP(tartrate-resistant acid phosphatase), MMP-9(matrix metalloproteinase-9), c-Src 티로신 키나아제(tyrosine kinase) 등의 발현을 증가시킴으로써 가능한데, 이러한 과정으로 형성된 다핵 파골세포는 무기질 골(mineralized bone)을 흡수하는 역할을 한다. 또한, RANKL이 RANK에 결합하면 TRAF6(tumor necrosis factor receptor-associated factor 6)의 활성을 촉진시켜 MAPK, 또는 NF-κB, AP-1, NFATc1과 같은 전사인자들의 활성을 촉진시킨다(Lee ZH, Kim HH. Signal transduction by receptor activator of nuclear factor kappa B in osteoclasts. Biochem Biophys Res Commun. 2003 May 30, 305, 211-4). 따라서 RANKL에 의해 활성화되는 신호전달 경로의 차단은 골다공증을 비롯한 골질환의 치료를 위한 치료적 접근 방법 중의 하나로 인지되고 있다.
The osteoclasts are differentiated into multinucleated osteoclasts by RAW264.7 mononuclear cells of the mouse by RANKL (receptor activator of nuclear factor κB (RANK) ligand). This differentiation process promotes the activation of mitogen-activated protein kinase (MAPK) by RANKL binding to RANK in the extracellular region, and this is because the transcription factor NF-κB enters into the nucleus and binds to osteoclast differentiation-related TRAP (MMP-9) and tyrosine kinase (tyrosine kinase). These multinuclear osteoclasts formed a mineralized bone, It plays a role of absorption. In addition, when RANKL binds to RANK, the activity of TRAF6 (tumor necrosis factor receptor-associated factor 6) is promoted to promote the activation of transcription factors such as MAPK or NF-κB, AP-1 and NFATc1 HH. Signal transduction by receptor activator of nuclear factor kappa B in osteoclasts. Biochem Biophys Res Commun 2003 May 30, 305, 211-4). Therefore, blocking of the signaling pathway activated by RANKL is recognized as one of the therapeutic approaches for the treatment of osteoporosis and other bone diseases.
상기 골질환의 대표적인 예인 골다공증은 골형성과 골흡수의 평형이 깨져 골밀도가 약화되어 일어나는 질환으로, 현재 미국에서만 약 1000만명이 이미 골다공증 질환을 앓고 있으며, 1천 8백만명이 골다공증의 발생 위험에 놓여 있다. 또한, 국내에서의 경우에도 약 400만명이 골다공증에 걸려있거나 그 위험에 노출되어 있다. 이는 노령화 사회로 접어들면서 더욱 증가할 것으로 추정되어, 이로 인한 사회적 지출과 가족 구성원의 정신적, 경제적 지출이 증가할 것으로 예상된다.Osteoporosis, which is a typical example of the above-mentioned bone disease, is a disease caused by weakening the balance of bone formation and bone resorption and weakening the bone density. Currently, about 10 million people already suffer from osteoporosis disease in the US and 18 million people are at risk of osteoporosis have. In addition, about 4 million people in Korea are exposed to or at risk for osteoporosis. This is expected to increase further as the society becomes more aged, and it is expected that social spending and mental and economic expenditure of family members will increase.
상기와 같은 골질환을 치료하기 위해서는 파골세포와 조골세포의 균형을 조절하는 것이 필요하며, 따라서 이에 대한 치료제로는 크게 골흡수 억제제 및 골형성 자극제가 있다. 일반적으로 상기 골흡수 억제제 또는 골형성 자극제 등의 골질환 치료제는 환자에게 장기 투여하여야 하기 때문에 독성이 적어야 하며, 투여의 번거로움을 해결하기 위하여 경구투여가 가능한 것이 바람직하므로, 이에 대한 연구가 절실히 필요한 실정이다. 한편, 상기 골질환 치료제 중 조골세포를 활성화 시킴으로써 골형성을 촉진하는 골형성 자극제에 대한 연구가 보다 활발하게 진행되고 있으나, 골형성 자극제로 인한 골밀도 강화가 반드시 골절의 감소를 의미하지는 않는다. 한편 현재 사용되고 있는 파골세포의 활성을 억제하는 골질환 치료제로는 데노수맙(Denosumab; Prolia™, Amgen®) 등이 있으며 이외에도 다양한 약물들이 개발되고 있으나, 약물치료는 장기간 지속되어야 함을 고려할 때 아직 부작용 등이 충분히 검증되지 않았으며, 파골세포의 정확한 메커니즘은 아직까지 밝혀지지 않은 상태이다.
In order to treat the above-mentioned bone diseases, it is necessary to control the balance between osteoclasts and osteoblasts. Accordingly, there are a bone resorption inhibitor and a bone formation stimulator. In general, the therapeutic agent for bone diseases such as the bone resorption inhibitor or the bone formation stimulating agent should be administered to a patient for a long period of time, so that it should be low in toxicity. Oral administration is preferable to solve the complication of administration. It is true. On the other hand, studies on osteogenesis stimulants promoting osteogenesis by activating osteoblasts in the bone disease treatment agent have been actively carried out, but strengthening of bone mineral density due to osteogenesis stimulation does not necessarily mean reduction of fracture. On the other hand, Denosumab (Prolia ™ , Amgen ® ), which is currently being used to treat osteoclast activity, has been developed and various drugs have been developed. However, considering that the drug treatment should be continued for a long time, Side effects have not been sufficiently verified, and the exact mechanism of osteoclasts has not yet been elucidated.
이에 본 발명자들은 인체에 부작용을 유발하지 않으면서 골질환의 예방 및 치료에 유용한 천연물질을 찾고자 예의 노력한 결과, 택사 추출물, 이의 분획물 또는 이로부터 분리한 화합물이 독성을 나타내지 않으면서 파골세포의 분화를 현저히 억제하는 활성을 가짐으로써 골밀도의 감소에 의한 골질환의 예방 또는 치료에 유용하게 사용될 수 있음을 확인하고 본 발명을 완성하였다.
Accordingly, the present inventors have made intensive efforts to find a natural substance useful for prevention and treatment of osteoporosis without causing adverse effects on the human body. As a result, it has been found that the extract of Taxa extract, the fraction thereof or the compound isolated therefrom does not show toxicity, The present invention has been accomplished based on the findings that it can be effectively used for prevention or treatment of osteopathy caused by a decrease in bone mineral density.
본 발명의 목적은 택사 추출물, 이의 분획물, 이로부터 분리한 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 골질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.It is an object of the present invention to provide a pharmaceutical composition for preventing or treating bone diseases, which comprises an extract of Taxa, a fraction thereof, a compound represented by the following general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient .
[화학식 1][Chemical Formula 1]
본 발명의 다른 목적은 택사 추출물, 이의 분획물, 또는 이로부터 분리한 상기 화학식 1로 표시되는 화합물을 유효성분으로 포함하는 골질환의 예방 또는 개선용 식품 조성물을 제공하는 것이다.
Another object of the present invention is to provide a food composition for preventing or ameliorating osteoporosis, which comprises the extract of Phytophthora exudata, fractions thereof or the compound represented by the formula (1) isolated therefrom as an active ingredient.
상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 택사(Alisma canaliculatum) 추출물, 이의 분획물, 이로부터 분리한 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 골질환의 예방 또는 치료용 약학적 조성물을 제공한다.In order to achieve the above object, the present invention provides a method for producing a bone marrow extract comprising an extract of Alisma canaliculatum , a fraction thereof, a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof isolated therefrom as an active ingredient A pharmaceutical composition for preventing or treating a disease is provided.
[화학식 1][Chemical Formula 1]
구체적으로, 본 발명의 골질환의 예방 또는 치료용 약학적 조성물은 택사 추출물, 이의 분획물, 이로부터 분리한 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염을 포함할 수 있다.
Specifically, the pharmaceutical composition for preventing or treating osteopathy of the present invention may include a taxa extract, a fraction thereof, a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof.
본 발명에서 용어, "택사(Alisma canaliculatum)"는 정수성 수생식물로 원줄기가 없고 뿌리줄기가 짧아 덩이뿌리를 형성하며, 수염뿌리가 많다. 못 언저리나 논 같은 습지에 살며, 우리나라 전국 각지에서 자라나 드물게 분포하며 한방에서는 덩이뿌리를 말려 약재로 사용한다. 약리 작용으로는 염증성 폐질환(한국공개특허 제2014-0013792호), 고지혈증 또는 동맥경화증(한국공개특허 제2013-0127088호), 폐기종 및 폐고혈압(한국공개특허 제2013-0030620호) 등이 알려져 있다.In the present invention, the term " Alisma canaliculatum "is a water-soluble aquatic plant having no main stem and short rootstock, forming root roots, and having many beard roots. They live in wetlands such as rice paddies or rice paddies. They grow in all over the country, but are rarely distributed. In one room, root roots are used as medicines. As pharmacological actions, inflammatory lung diseases (Korean Patent Laid-Open Publication No. 2014-0013792), hyperlipidemia or arteriosclerosis (Korean Patent Publication No. 2013-0127088), emphysema and pulmonary hypertension (Korean Patent Publication No. 2013-0030620) have.
본 발명에서 용어, "택사 추출물"은 택사를 추출하여 수득한 추출물을 의미한다. 상기 택사 추출물은 택사 분쇄물을 건조 중량의 약 2 내지 20배, 바람직하게는 약 3 내지 5배에 달하는 부피의 물, 메탄올, 에탄올 및 부탄올 등과 같은 탄소수 1(C1) 내지 4(C4)의 저급 알콜의 극성 용매 또는 이들의 약 1:0.1 내지 1:10의 혼합비를 갖는 혼합용매를 용출 용매로써 사용하고, 추출 온도는 20 내지 100℃, 바람직하게는 실온에서, 추출 기간은 약 12시간 내지 10일, 바람직하게는 5일 동안 열수 추출, 냉침 추출, 환류 냉각 추출 또는 초음파 추출 등의 추출방법을 사용하여 추출할 수 있으나, 골질환의 예방 또는 치료 활성이 있는 물질을 추출하는 방법이라면 제한없이 이용될 수 있다. 바람직하게는 냉침추출로 1회 내지 5회 연속 추출하여 감압여과하고, 그 여과추출물을 진공회전농축기로 20 내지 100℃, 바람직하게는 실온에서 감압 농축하여 물, 저급 알콜 또는 이들의 혼합용매에 가용한 택사 조추출물을 수득한 결과물이 될 수 있으나, 본 발명의 골질환의 예방 또는 치료 활성을 나타낼 수 있는 한, 이에 제한되지는 않고, 추출액, 추출액의 희석액 또는 농축액, 추출액을 건조하여 얻어지는 건조물, 또는 이들 조정제물 또는 정제물을 모두 포함할 수 있다. 상기 택사 추출물은 천연, 잡종, 변종식물의 다양한 기관으로부터 추출될 수 있고, 예를 들어, 뿌리, 근경, 지상부, 줄기, 잎, 열매 등으로부터 추출 가능하며, 특히 택사의 근경으로부터 추출될 수 있다.In the present invention, the term "taxa extract" means an extract obtained by extracting taxa. The above taxa extract may be prepared by mixing 1 to 4 (C 4 ) carbon atoms such as water, methanol, ethanol, and butanol in a volume of about 2 to 20 times, preferably about 3 to 5 times, Or a mixed solvent having a mixing ratio of about 1: 0.1 to 1:10 thereof is used as an elution solvent, and the extraction temperature is 20 to 100 DEG C, preferably room temperature, the extraction period is about 12 hours The extraction may be performed using an extraction method such as hot water extraction, cold extraction, reflux cooling extraction or ultrasonic extraction for 10 days to 5 days, preferably 5 days. However, if the method for extracting substances having a preventive or therapeutic activity for bone diseases is limited Can be used without. Preferably, the extract is continuously extracted one to five times by cold extraction, filtered under reduced pressure, and the filtrate is concentrated under reduced pressure at 20 to 100 ° C, preferably at room temperature, in a vacuum rotary condenser to be dissolved in water, a lower alcohol or a mixed solvent thereof But the present invention is not limited thereto. Examples thereof include a dry matter obtained by drying an extract, a diluted solution or concentrate of an extract, an extract, and the like, as long as it can exhibit the activity of preventing or treating bone diseases of the present invention, Or both of these controlled products or tablets. The taxa extract can be extracted from various organs of natural, hybrid, and variant plants and can be extracted from, for example, root, rootstock, root, stem, leaf,
본 발명에서 용어, "분획물"은 다양한 구성성분을 포함하는 혼합물로부터 특정 성분 또는 특정 그룹을 분리하는 분획방법에 의하여 얻어진 결과물을 의미한다. 본 발명의 택사 분획물은 택사 추출물을 현탁한 후, 물, 메탄올, 에탄올 등의 극성 용매 또는 헥산, 에틸아세테이트와 같은 비극성 용매를 사용하여 분획함으로써 극성 용매 분획물과 비극성 용매 분획물을 각각 수득할 수 있다. 구체적으로, 택사 조추출물을 증류수 등에 현탁한 후, 현탁액의 약 1 내지 100배, 바람직하게는 약 1 내지 5배 부피의 물, 탄소수 1(C1) 내지 4(C4)의 알코올, 클로로포름, 에틸아세테이트, 헥산, 부탄올 또는 이들의 혼합용매와 같은 극성 또는 비극성 용매를 가하여 1회 내지 10회, 바람직하게는 2회 내지 5회에 걸쳐 극성 또는 비극성 용매 가용층을 추출, 분리하여 수득할 수 있다. The term "fraction" in the present invention means a product obtained by a fractionation method for separating a specific component or a specific group from a mixture containing various constituents. The taxa fractions of the present invention can be obtained by suspending the taxa extract and then fractionating it with a polar solvent such as water, methanol or ethanol or a non-polar solvent such as hexane or ethyl acetate to obtain a polar solvent fraction and a non-polar solvent fraction, respectively. Specifically, the crude extract of Taxa is suspended in distilled water or the like, and then water, about 1 to 100 times, preferably about 1 to 5 times the volume of the suspension, the alcohol having 1 to 4 carbon atoms (C 1 ) to 4 (C 4 ) A polar or nonpolar solvent such as ethyl acetate, hexane, butanol or a mixed solvent thereof may be added thereto, and the polar or non-polar solvent soluble layer may be extracted and separated from 1 to 10 times, preferably 2 to 5 times .
본 발명의 일 실시예에서는 상기 얻어진 택사 에탄올 조추출물(100 g)에 증류수를 가하여 현탁한 후 동량의 에틸아세테이트를 가하여 에틸아세테이트 층과 물 층으로 분리하였고, 이를 여과, 감압농축하여 에틸아세테이트 분획물(18.0 g)을 수득하였다. In one embodiment of the present invention, distilled water was added to the obtained crude ethanolic extract (100 g) to suspend, and then an equal amount of ethyl acetate was added thereto to separate the ethyl acetate layer and the water layer. The filtrate was concentrated under reduced pressure to obtain ethyl acetate fraction 18.0 g).
또한 본 발명의 분획물은 추가로 통상의 분획 공정을 수행하여 수득한 것일 수도 있다(Harborne J.B. Plant Pathology, 1998, 3rd Ed. p6-7). 예컨대, 본 발명에 따른 택사 추출물을 일정한 분자량 컷-오프 값을 갖는 한외 여과막을 통과시켜 얻은 분획물, 다양한 크로마토그래피 (크기, 전하, 소수성 또는 친화성에 따른 분리를 위해 제작된 것)에 의한 분리 등으로 추가적으로 실시된 다양한 정제 방법을 통해 얻어진 활성분획물도 본 발명의 택사 분획물에 포함된다. 상기 활성분획물은 분획물로부터 보다 높은 생리활성 등을 가지는 분획을 분리한 것으로, 활성분획 또는 유효분획물이라고도 한다. The fraction of the present invention may also be obtained by further performing a conventional fractionation process (Harborne J. B. Plant Pathology, 1998, 3rd Ed. P6-7). For example, fractions obtained by passing the extract of the present invention through an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography Active fractions obtained through a variety of additional purification methods are also included in the taxa fractions of the present invention. The active fractions are obtained by separating fractions having higher physiological activities or the like from the fractions, and they are also referred to as active fractions or effective fractions.
또한, 상기 계통분획과 같은 통상의 분획과정을 통해 수득한 여러 성분이 혼합되어 있는 분획물 가운데 농도구배 컬럼 크로마토그래피 등을 통하여 구체적인 활성 성분을 분리할 수 있다. 상기 컬럼 크로마토그래피는 실리카겔, 세파덱스, LH-20, ODS 겔, RP-18, 폴리아미드, 도요펄(Toyopearl) 및 XAD 수지로 이루어진 군으로부터 선택된 충진제를 이용하는 컬럼 크로마토그래피를 수행하여 화합물을 분리 및 정제할 수 있고, 컬럼 크로마토그래피는 필요에 따라 적절한 충진제를 선택하여 수차례 실시할 수 있으나, 이에 제한되는 것은 아니다. 상기 크로마토그래피를 사용함에 있어 용출용매, 용출 속도 및 용출시간은 당업계에서 일반적으로 사용하는 용매, 속도 또는 시간을 적용할 수 있다.In addition, specific active components can be isolated from the fractions containing various components obtained through a conventional fractionation process such as the system fraction by concentration gradient column chromatography or the like. The column chromatography was carried out by performing column chromatography using a filler selected from the group consisting of silica gel, Sephadex, LH-20, ODS gel, RP-18, polyamide, Toyopearl and XAD resin, The column chromatography can be carried out several times by selecting an appropriate filler as necessary, but the present invention is not limited thereto. In using the chromatography, the elution solvent, the elution rate and the elution time may be the solvent, the rate, or the time generally used in the art.
상기 택사 추출물 또는 이의 분획물로부터 분리된 화합물은 트라이터펜계 화합물로서, 대표적인 예로 알리솔(alisol) A, B, C와 그 아세테이트 및 당류 등을 들 수 있다. 본 발명의 택사로부터 상기 트라이터펜계 화합물들을 분리하는 방법은 당업계에 공지된 방법에 의해 분리가능하다. 보다 구체적으로는, 상기에서 수득되는 분획물로부터 알리솔 A 24-아세테이트(Alisol A 24-acetate, 화합물 1이라 명명함)를 수득할 수 있으나, 이에 제한되는 것은 아니다.
Examples of the compound isolated from the above-mentioned taxa extract or its fractions are triphenyl-based compounds, and representative examples thereof include alisol A, B, C, its acetates and saccharides. The method of separating the triphenylamine compounds from the taxane of the present invention is separable by methods known in the art. More specifically, from the fraction obtained above, Alisol A 24-acetate (hereinafter referred to as Compound 1) can be obtained, but the present invention is not limited thereto.
본 발명의 상기 화합물들은 약학적으로 허용 가능한 염의 형태로 사용할 수 있으며, 염으로는 약학적으로 허용 가능한 유리산(free acid)에 의해 형성된 산 부가염이 유용하다. 산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산으로부터 얻는다. 이러한 약학적으로 무독한 염류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함할 수 있다.The compounds of the present invention may be used in the form of a pharmaceutically acceptable salt. As the salt, an acid addition salt formed by a pharmaceutically acceptable free acid is useful. Acid addition salts include those derived from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, and aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxyalkanoates, Dioleate, aromatic acid, aliphatic and aromatic sulfonic acids. Such pharmaceutically innocuous salts include, but are not limited to, sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate chloride, bromide, Butyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, succinate, maleic anhydride, maleic anhydride, , Sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzene sulfonate, toluene sulfonate, chlorobenzene sulfide Propyl sulphonate, naphthalene-1-yne, xylenesulfonate, phenylsulfate, phenylbutyrate, citrate, lactate,? -Hydroxybutyrate, glycolate, maleate, Sulfonate, naphthalene-2-sulfonate or mandelate.
본 발명에 따른 산 부가염은 통상의 방법, 예를 들면, 상기 화합물들을 과량의 산 수용액 중에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들면 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다.The acid addition salts according to the invention may be prepared by conventional methods, for example by dissolving the compounds in an excess of an aqueous acid solution and precipitating the salts using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile .
또한, 본 발명의 상기 화합물들은 염기를 사용하여 약학적으로 허용 가능한 금속염의 형태로 만들어 사용할 수 있다. 알칼리 금속 또는 알칼리 토금속 염은 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고, 여액을 증발, 건조시켜 얻을 수 있다. 이때, 금속염으로는 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하다. 또한, 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 은염(예, 질산은)과 반응시켜 얻을 수 있다.
In addition, the compounds of the present invention can be prepared in the form of a pharmaceutically acceptable metal salt using a base. The alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is preferable for the metal salt to produce sodium, potassium or calcium salt. In addition, the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (for example, silver nitrate).
본 발명에 따른 택사 추출물, 이의 분획물, 이로부터 분리한 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용가능한 염은 파골세포 분화관련 인자로 알려진 NFATc1(Nuclear factor of activated T-cells, cytoplasmic 1), TRAP(Tartrate-resistant acid phosphatase), DC-STAMP(dendritic cell-specific transmembrane protein) 및/또는 카텝신 K(cathepsin K) 유전자 또는 단백질의 발현 또는 활성을 억제함으로써 골밀도 감소에 의한 골질환의 예방 또는 치료용도로 사용될 수 있다.
The extract of the present invention, fractions thereof, the compound represented by the formula (1) or a pharmaceutically acceptable salt thereof according to the present invention can be used as an agent for preventing or treating osteoclast differentiation, comprising NFATc1 (Nuclear factor of activated T-cells, cytoplasmic 1) Prevention or treatment of osteoporosis by reduction of bone density by inhibiting the expression or activity of TRAP (Tartrate-resistant acid phosphatase), DC-STAMP (dendritic cell-specific transmembrane protein) and / or cathepsin K gene or protein It can be used for applications.
본 발명에서 용어, "골질환"은 골밀도가 감소되어 일어날 수 있는 모든 질환을 포함하는 것으로, 구체적으로는 골다공증(osteoporosis), 골연화증(osteomalacia), 골형성 부전증(osteogenesis imperfecta), 골화석증(osteopetrosis), 골경화증(osteosclerosis), 파제트병(Paget's disease), 무형성 골질환(adynamic bone disease), 대사성 골질환(metabolic bone disease), 구루병(rickets) 등을 포함할 수 있으나 이에 제한되는 것은 아니다.The term "bone disease" in the present invention encompasses all diseases that can be caused by a decrease in bone density, and specifically includes osteoporosis, osteomalacia, osteogenesis imperfecta, osteopetrosis But are not limited to, osteopenia, osteosclerosis, Paget's disease, adynamic bone disease, metabolic bone disease, rickets, and the like.
본 발명에서 용어, "예방"은 상기 조성물의 투여로 골질환의 발병을 억제 또는 지연시키는 모든 행위를 의미하며, "치료"는 상기 조성물에 의해 골질환에 의한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.In the present invention, the term "prevention" means any action that inhibits or delays the onset of bone disease by administration of the composition, and "treatment" .
본 발명의 택사 추출물, 이의 분획물, 이로부터 분리한 화합물 또는 이의 약학적으로 허용가능한 염을 포함하는 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형체 또는 희석제를 추가로 포함할 수 있다. 이때, 상기 조성물에 포함되는 택사 추출물, 이의 분획물, 이로부터 분리한 화합물 또는 이의 약학적으로 허용가능한 염의 함량은 특별히 이에 제한되지 않으나, 조성물 총 중량에 대하여 0.001 중량% 내지 99 중량%로, 바람직하게는 0.01 중량% 내지 50 중량%를 포함할 수 있다.The pharmaceutical composition comprising the taxa extract of the present invention, its fractions, the compound isolated therefrom, or a pharmaceutically acceptable salt thereof may further comprise a suitable carrier, adduct or diluent conventionally used in the production of a pharmaceutical composition can do. In this case, the content of the taxa extract, its fractions, the compound isolated therefrom, or the pharmaceutically acceptable salt thereof contained in the composition is not particularly limited, but is preferably 0.001% by weight to 99% by weight, May comprise from 0.01% to 50% by weight.
상기 약학적 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결 건조제 및 좌제로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있으며, 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용될 수 있다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테로 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
The pharmaceutical composition may be any one selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterilized aqueous solutions, nonaqueous solvents, suspensions, emulsions, And may be oral or parenteral formulations of various forms. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules, and the like, which may contain one or more excipients such as starch, calcium carbonate, sucrose or lactose lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate, talc, and the like may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, syrups and the like. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the non-aqueous solvent and the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. Examples of the suppository base include witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like.
또 하나의 양태로서, 본 발명은 상기 약학적 조성물을 골질환의 의심 개체에 투여하는 단계를 포함하는, 골질환의 예방 또는 치료방법을 제공한다.
In another aspect, the present invention provides a method for preventing or treating a bone disease, comprising administering the pharmaceutical composition to a suspected individual of a bone disease.
본 발명에서 상기 골질환의 의심 개체는 상기 질환이 발병하였거나 발병할 수 있는 인간을 포함한 모든 동물을 의미하며, 본 발명의 약학적 조성물을 골질환의 의심 개체에 투여함으로써, 개체를 효율적으로 치료할 수 있다. 상기 약학적 조성물 및 골질환에 대해서는 상기에서 설명한 바와 같다.In the present invention, the suspected individual of bone disease refers to all animals including humans, who have developed or are capable of developing the disease. By administering the pharmaceutical composition of the present invention to suspect individuals of bone disease, have. The pharmaceutical composition and bone diseases are as described above.
본 발명에서 용어, "투여"는 어떠한 적절한 방법으로 골질환의 의심 개체에게 본 발명의 약학적 조성물을 도입하는 것을 의미하며, 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다.The term "administration" as used herein means introduction of the pharmaceutical composition of the present invention to a suspected subject of bone disease by any appropriate method, and the administration route includes various routes of oral or parenteral administration ≪ / RTI >
본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여할 수 있다.The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount.
본 발명에서 용어, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 질병의 종류, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다. The term "pharmaceutically effective amount" as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will vary depending on the species and severity, age, sex, The type of drug, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And can be administered singly or multiply. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.
본 발명의 약학적 조성물은 골질환을 목적으로 하는 개체이면 특별히 한정되지 않고, 어떠한 것이든 적용가능하다. 예를 들면, 원숭이, 개, 고양이, 토끼, 모르모트, 랫트, 마우스, 소, 양, 돼지, 염소 등과 같은 비인간동물, 인간, 조류 및 어류 등 어느 것이나 사용할 수 있으며, 상기 약학적 조성물은 비 경구, 피하, 복강 내, 폐 내 및 비강 내로 투여될 수 있고, 국부적 치료를 위해, 필요하다면 병변 내 투여를 포함하는 적합한 방법에 의하여 투여될 수 있다. 본 발명의 상기 약학적 조성물의 바람직한 투여량은 개체의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 예를 들어, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관 내 주사에 의해 투여될 수 있으나, 이에 제한되는 것은 아니다.The pharmaceutical composition of the present invention is not particularly limited as long as it is an object for bone disease, and any of them can be applied. For example, any non-human animal such as a monkey, a dog, a cat, a rabbit, a guinea pig, a rat, a mouse, a cattle, a sheep, a pig or a goat can be used. Subcutaneous, intraperitoneal, intrapulmonary, and intranasal, and may be administered by a suitable method, including localized administration, if necessary, for localized treatment. The preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and body weight of the individual, the degree of disease, the type of drug, the route of administration and the period of time, but can be appropriately selected by those skilled in the art. For example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine dural or intracerebral injection.
적합한 총 1일 사용량은 올바른 의학적 판단범위 내에서 처치의에 의해 결정될 수 있으며, 일반적으로 0.001 내지 1000 mg/kg의 양, 바람직하게는 0.05 내지 200 mg/kg, 보다 바람직하게는 0.1 내지 100 mg/kg의 양을 일일 1회 내지 수회로 나누어 투여할 수 있다.
Suitable total daily doses may be determined by the treatment within the scope of sound medical judgment and are generally in the range of 0.001 to 1000 mg / kg, preferably 0.05 to 200 mg / kg, more preferably 0.1 to 100 mg / kg can be administered once or several times a day.
또 다른 양태로서, 본 발명은 택사 추출물, 이의 분획물, 또는 이로부터 분리한 하기 화학식 1로 표시되는 화합물을 유효성분으로 포함하는 골질환의 예방 또는 개선용 식품 조성물을 제공한다.In another aspect, the present invention provides a food composition for preventing or ameliorating osteoporosis comprising, as an active ingredient, a taxa extract, a fraction thereof, or a compound represented by the following formula (1).
[화학식 1] [Chemical Formula 1]
상기 택사, 이의 추출물, 분획물, 화학식 1의 화합물 및 골질환에 대해서는 상기에서 설명한 바와 같다.The above taxa, extracts thereof, fractions, compounds of formula (I) and bone diseases are as described above.
본 발명에서의 용어, "개선"은 택사 추출물, 이의 분획물, 또는 이로부터 분리한 하기 화학식 1로 표시되는 화합물을 유효성분으로 포함하는 조성물을 이용하여 예방 또는 치료되는 골질환과 같은 질환의 의심 및 발병 개체의 증상이 호전되거나 이롭게 되는 모든 행위를 말한다.The term "improvement" in the present invention refers to the use of a composition comprising, as an active ingredient, a composition comprising a taxane extract, a fraction thereof, or a compound represented by the following formula (1) Refers to any action that alleviates or alleviates symptoms of an onset entity.
구체적으로, 본 발명의 택사 추출물, 이의 분획물, 또는 이로부터 분리한 하기 화학식 1로 표시되는 화합물을 골질환의 예방 또는 개선을 목적으로 식품 조성물에 첨가할 수 있다.Specifically, the extract of the present invention, fractions thereof, or a compound represented by the following formula (1) isolated therefrom can be added to a food composition for the purpose of preventing or improving bone diseases.
본 발명의 식품 조성물은 환제, 분말, 과립, 침제, 정제, 캡슐 또는 액제 등의 형태를 포함할 수 있으며, 본 발명의 택사 추출물 또는 이의 분획물을 첨가할 수 있는 식품의 종류에는 별다른 제한이 없으며, 예를 들어 각종 음료, 껌, 차, 비타민 복합제, 건강보조 식품류 등이 있다.The food composition of the present invention may be in the form of pills, powders, granules, infusions, tablets, capsules or liquid preparations. There is no particular limitation on the type of food to which the extract of the present invention or the fraction thereof can be added, For example, various beverages, gums, tea, vitamin complex, and health supplement foods.
상기 식품 조성물에는 택사 추출물, 이의 분획물, 또는 이로부터 분리한 화합물 이외에도 다른 성분을 추가할 수 있으며, 그 종류는 특별히 제한되지 않는다. 예를 들어, 통상의 식품과 같이 여러 가지 생약 추출물, 식품학적으로 허용가능한 식품보조첨가제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있으며, 이에 제한되지 않는다. The food composition may further contain other ingredients in addition to the taxane extract, its fractions, or the compounds isolated therefrom, and the kind thereof is not particularly limited. For example, it may contain various herbal medicine extracts, food-acceptable food-aid additives or natural carbohydrates such as ordinary food, but is not limited thereto.
본 발명에서 용어, "식품보조첨가제"란 식품에 보조적으로 첨가될 수 있는 구성요소를 의미하며, 각 제형의 건강기능식품을 제조하는데 첨가되는 것으로서 당업자가 적절히 선택하여 사용할 수 있다. 식품보조첨가제의 예로는 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 충진제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등이 포함되지만, 상기 예들에 의해 본 발명의 식품보조첨가제의 종류가 제한되는 것은 아니다. The term "food supplementary additive " in the present invention means a component which can be added to foods in a supplementary manner, and is appropriately selected and used by those skilled in the art as added to produce health functional foods of each formulation. Examples of food-aid additives include flavors such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, , a pH adjusting agent, a stabilizer, a preservative, a glycerin, an alcohol, a carbonating agent used in a carbonated drink, and the like. However, the types of the food auxiliary additives of the present invention are not limited by these examples.
상기 천연 탄수화물의 예는 포도당, 과당 등의 단당류; 말토스, 수크로스 등의 이당류; 및 덱스트린, 시클로덱스트린 등의 다당류와, 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이 있으며, 상기한 것 이외의 향미제로서 천연 향미제(타우마틴 등), 스테비아 추출물(레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다.Examples of the natural carbohydrate include monosaccharides such as glucose and fructose; Disaccharides such as maltose, sucrose and the like; And polysaccharides such as dextrin and cyclodextrin and sugar alcohols such as xylitol, sorbitol and erythritol. In addition to the above, natural flavorings (such as tau mart), stevia extracts (rebaudioside A, Etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.
본 발명의 식품 조성물에는 건강기능성 식품이 포함될 수 있다. 본 발명에서 사용된 용어 "건강기능성 식품"이란 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 정제, 캅셀, 분말, 과립, 액상 및 환 등의 형태로 제조 및 가공한 식품을 말한다. 여기서 기능성이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건 용도에 유용한 효과를 얻는 것을 의미한다. 본 발명의 건강기능성 식품은 당업계에서 통상적으로 사용되는 방법에 의하여 제조가능하며, 상기 제조시에는 당업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어날 수 있다.The food composition of the present invention may include a health functional food. The term " health functional food " as used in the present invention refers to foods prepared and processed in the form of tablets, capsules, powders, granules, liquids, and rings using raw materials and ingredients having useful functions in the human body. Here, the term "functionality" means that the structure and function of the human body are controlled to obtain nutritional effects or effects useful for health use such as physiological actions. The health functional food of the present invention can be manufactured by a method commonly used in the art and can be prepared by adding raw materials and ingredients which are conventionally added in the art. Also, unlike general medicine, there is an advantage that there is no side effect that can occur when a medicine is used for a long time by using food as a raw material, and it is excellent in portability.
유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품의 제조 시에 본 발명의 택사 추출물 또는 이의 분획물은 원료 조성물 중 1 내지 50 중량%, 바람직하게는 5 내지 10 중량%의 양으로 첨가될 수 있으나, 이에 제한되는 것은 아니다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하로도 사용될 수 있다.The amount of the active ingredient to be mixed can be suitably determined according to the intended use (prevention, health or therapeutic treatment). Generally, the extract of the present invention or the fraction thereof may be added in an amount of 1 to 50% by weight, preferably 5 to 10% by weight, based on the weight of the raw material composition, but is not limited thereto. However, in the case of long-term ingestion intended for health and hygiene purposes or for the purpose of controlling health, the amount can also be used in the above-mentioned range.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알코올 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능성 식품을 모두 포함한다.
There is no particular limitation on the kind of the food. Examples of the food to which the above substances can be added include dairy products including meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, Alcoholic beverages, and vitamin complexes, all of which include health functional foods in a conventional sense.
또 다른 양태로서, 본 발명은 하기 화학식 1로 표시되는 화합물을 유효성분으로 포함하는 골질환의 예방 또는 치료용 약학적 조성물을 제공한다.In another aspect, the present invention provides a pharmaceutical composition for preventing or treating bone diseases, which comprises a compound represented by the following formula (1) as an active ingredient.
[화학식 1] [Chemical Formula 1]
또 다른 양태로서, 본 발명은 하기 화학식 1로 표시되는 화합물을 유효성분으로 포함하는 골질환의 예방 또는 개선용 식품 조성물을 제공한다.In another aspect, the present invention provides a food composition for preventing or ameliorating bone diseases, which comprises a compound represented by the following formula (1) as an active ingredient.
[화학식 1] [Chemical Formula 1]
본 발명의 택사 추출물, 이의 분획물 또는 이로부터 분리된 화합물은 오랫동안 천연약재로 사용되어온 천연물에서 유래되어 부작용이 없으면서도, 파골세포의 형성 또는 분화 억제활성이 우수하므로 골밀도 감소에 의한 골질환의 예방 또는 치료에 있어 유용하게 사용될 수 있다.
The extract of the present invention, its fractions or the compound isolated therefrom is derived from a natural product which has been used for a long time as a natural medicinal material and has no side effects and has excellent osteoclast formation or differentiation inhibiting activity. Therefore, Can be usefully used in therapy.
도 1은 택사 추출물의 처리 농도별 TRAP 염색 결과를 나타낸 사진(A), TRAP 양성 세포 수를 나타낸 그래프(B), 및 세포생존율(세포독성)을 나타낸 그래프(C)이다.
도 2a는 택사 추출물의 에틸아세테이트 분획물의 처리 농도별 TRAP 염색 결과를 나타낸 사진이다.
도 2b는 택사 추출물의 에틸아세테이트 분획물(3 μg/ml)의 TRAP 염색 결과를 나타낸 사진이다. TRAP 활성이 가장 현저히 억제된 9번 분획물에서 화합물을 분리하였다.
도 2c는 택사 추출물의 에틸아세테이트 분획물의 세포 독성을 나타낸 그래프이다.
도 3은 택사로부터 분리된 화합물(Alisol A 24-acetate) 처리 농도별 TRAP 염색 결과를 나타낸 사진(A), TRAP 양성 세포 수를 나타낸 그래프(B), 및 세포생존율(세포독성)을 나타낸 그래프(C)이다.
도 4는 택사 추출물 처리기간에 따른 파골세포 분화 관련 인자(NFATc1, TRAP, DC-STAMP, Cathepsin K)의 mRNA 발현 수준을 RT-PCR로 확인한 그래프이다.
도 5는 택사로부터 분리된 화합물(Alisol A 24-acetate)의 처리기간에 따른 파골세포 분화 관련 인자(NFATc1, TRAP, DC-STAMP, Cathepsin K)의 mRNA 발현 수준을 RT-PCR로 확인한 그래프이다.
도 6은 택사로부터 분리된 화합물(Alisol A 24-acetate)의 처리기간에 따른 파골세포 분화 관련 인자(NFATc1)의 단백질 발현 수준을 웨스턴블롯으로 확인한 도이다.
실험의 정량적인 결과는 평균값과 표준편차로 표시하였다. 통계적인 차이는 Student's t-test를 이용하여 분석하였고 p 값이 0.05 이하인 경우 통계적으로 유의한 것으로 간주하여 별표(*)로 표시하였다(P values *<0.05, **<0.01, ***<0.001).FIG. 1 is a photograph (A) showing the result of TRAP staining according to treatment concentration of the taxa extract, a graph (B) showing the number of TRAP positive cells, and a graph (C) showing the cell survival rate (cytotoxicity).
FIG. 2A is a photograph showing the result of TRAP staining for the treatment concentration of the ethyl acetate fraction of the taxa extract. FIG.
FIG. 2B is a photograph showing the results of TRAP staining of the ethyl acetate fraction (3 μg / ml) of the taxa extract. Compounds were isolated in
2c is a graph showing the cytotoxicity of the ethyl acetate fraction of Taxus extract.
FIG. 3 is a photograph (A) showing the result of TRAP staining for the compound concentration (Alisol A 24-acetate) separated from the taxa, a graph (B) showing the number of TRAP positive cells and a graph showing the cell survival rate (cytotoxicity) C).
FIG. 4 is a graph showing RT-PCR of mRNA expression levels of osteoclast differentiation-related factors (NFATc1, TRAP, DC-STAMP, Cathepsin K)
FIG. 5 is a graph showing the mRNA expression level of osteoclast differentiation-related factors (NFATc1, TRAP, DC-STAMP, Cathepsin K) by RT-PCR according to the treatment period of the compound (Alisol A 24-acetate)
FIG. 6 is a Western blot graph showing the protein expression level of the osteoclast differentiation-related factor (NFATc1) according to the treatment time of the compound (Alisol A 24-acetate) isolated from Taxa.
The quantitative results of the experiments were expressed as means and standard deviations. Statistical significance was analyzed using Student's t-test. P values less than 0.05 were considered to be statistically significant (P values * <0.05, ** <0.01, *** <0.001 ).
이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.
실험재료Experimental material
재조합 마우스 RANKL(receptor activator of nuclear factor-κB ligand)과 M-CSF(macrophage-colony stimulating factor)은 R&D Systems (MN)에서 구입하였고, 세포 배양배지, 우태아혈청(FBS), 및 페니실린/스트렙토마이신은 Invitrogen Life Technologies (NY)에서 구입하였다. CCK-8 어세이 키트는 Dojindo Molecular Technologies (ML)로부터 구입하였고, 역전사 및 실시간 PCR(real-time PCR) master mix에 사용되는 모든 시약은 Enzynomics (KR)사의 것이다. NFATc1 단일클론항체 및 액틴 다클론항체는 SantaCruz Biotechnology (CA, USA)로부터 구입하였다.
Recombinant murine RANKL and macrophage-colony stimulating factor (M-CSF) were purchased from R & D Systems (MN), and cell culture medium, fetal bovine serum (FBS), and penicillin / streptomycin Were purchased from Invitrogen Life Technologies (NY). The CCK-8 assay kit was purchased from Dojindo Molecular Technologies (ML) and all reagents used in reverse transcription and real-time PCR master mix are from Enzynomics (KR). NFATc1 monoclonal antibodies and actin polyclonal antibodies were purchased from SantaCruz Biotechnology (CA, USA).
제조예 1: 택사 추출물, 분획물 및 활성분획물의 제조Production Example 1: Preparation of Taxa extract, fraction and active fraction
택사(습중량 1.2kg)의 건조된 근경(뿌리줄기)을 분쇄하였고, 5일간 실온에서 에탄올 4.0 L로 추출하였다. Dried rhizome (rootstock) of phytase (wet weight 1.2 kg) was pulverized and extracted with 4.0 L of ethanol at room temperature for 5 days.
수득한 에탄올 추출물 100 g을 진공농축(감압농축)하였고, 그 이후 에틸아세테이트 및 물(1:1)을 분획용매로 하여 분획하였다. 이 중, 에틸아세테이트(EtOAc) 층을 진공농축하여 18.0g의 에틸아세테이트 가용 분획물을 수득하였다.
100 g of the obtained ethanol extract was concentrated in vacuo (concentration under reduced pressure), after which ethyl acetate and water (1: 1) were fractionated as a fraction solvent. Of these, the ethyl acetate (EtOAc) layer was concentrated in vacuo to give 18.0 g of ethyl acetate soluble fraction.
제조예 2: 택사 활성분획물로부터 화합물의 분리Production Example 2: Separation of Compounds from Taxane Active Fractions
상기 제조예 1에서 수득한 에틸아세테이트 가용 분획물 18.0 g을 100% 클로로포름(CH2Cl2)에서부터 100% 메탄올(MeOH)까지 용매의 극성을 점차 증가시키도록 구배한 실리카겔(0.04-0.063 mm) 컬럼 크로마토그래피에 투과시켰다. 18.0 g of the ethyl acetate-soluble fraction obtained in Preparation Example 1 was purified by silica gel (0.04-0.063 mm) column chromatography, which gradually gradient the solvent from 100% chloroform (CH 2 Cl 2 ) to 100% methanol (MeOH) .
상기 분획물을 2% CH2Cl2 을 포함한 메탄올로 용출시킨 후, 물(H2O) 내의 85% 아세토나이트릴의 등용매 시스템(isocratic solvent system)를 사용하여 RP-HPLC [Phenomenex Luna RP-C18(2), 5 μm, 250 x 10 mm, 2.5 mL/min]로 정제한 결과, 하기 화학식 1의 구조를 가지는 Alisol A 24-acetate(7.0 mg, tR 14 min)를 수득하였다.The fractions were eluted with methanol containing 2% CH 2 Cl 2 and then purified by RP-HPLC (Phenomenex Luna RP-C18 (R)) using an isocratic solvent system of 85% acetonitrile in water (H 2 O) (2), 5 μm, 250 × 10 mm, 2.5 mL / min]. As a result, Alisol A 24-acetate (7.0 mg, t R 14 min) having the structure represented by the following
[화학식 1][Chemical Formula 1]
상기 화합물의 구조는 하기 NMR 결과를 통해 확인하였다.The structure of the compound was confirmed by the following NMR results.
1H NMR (CDCl3,700MHz):δH 4.65 (1H, s, H-24), 3.89 (2H, overlapped, H-11 and H-23), 2.81 (2H, dd, J = 13.8, 5.9 Hz H-12), 2.68 (1H, m H-20), 2.35 (2H, ddd, J = 15.5, 9.6, 3.3 Hz, H-2), 2.25 (1H, m, Ha-1), 2.20 (3H, s,-COCH3), 2.15 (1H, m, Hb-1), 2.16 (2H, m, H-16), 2.10 (1H, m, H-5), 2.02 (2H, m, H-7), 1.89 (1H, m, H-15a), 1.74 (1H, d, J = 10.8 Hz, H-9), 1.45 (1H, m, H-6a), 1.39 (1H, m, H-6b), 1.38 (2H, m, H-22), 1.36 (1H, m, H-15b), 1.30 (3H, s, H-27), 1.16 (3H, s, H-26), 1.15 (3H, s, H-30), 1.07 (3H, d, J = 11.0 Hz, H-21), 1.06 (3H, s, H-28), 1.00 (3H, s, H-18), 0.99 (3H, s, H-19), 0.98 (3H, s, H-29). ; 1 H NMR (CDCl 3, 700MHz ): δH 4.65 (1H, s, H-24), 3.89 (2H, overlapped, H-11 and H-23), 2.81 (2H, dd, J = 13.8, 5.9 Hz H M), 2.20 (3H, s), 2.31 (2H, d, J = , -COCH 3), 2.15 (1H , m, Hb-1), 2.16 (2H, m, H-16), 2.10 (1H, m, H-5), 2.02 (2H, m, H-7), M, H-6a), 1.38 (1H, m, H-15a), 1.74 (1H, d, J = 10.8 Hz, H- (2H, m, H-22), 1.36 (1H, m, H-15b), 1.30 (3H, s, -30), 1.07 (3H, d , J = 11.0 Hz, H-21), 1.06 (3H, s, H-28), 1.00 (3H, s, H-18), 0.99 (3H, s, H- 19), 0.98 (3H, s, H-29). ;
13CNMR(175MHz,CDCl3):δC 220.5 (qC, C-3), 171.5 (-COCH3), 138.3 (qC, C-13), 135.5 (qC, C-17), 78.6 (CH, C-24), 73.9 (qC, C-25), 70.0 (CH, C-11), 69.0 (CH, C-23), 57.0 (qC, C-14), 49.6 (CH,C-9), 48.5 (CH,C-5), 47.0 (qC,C-4), 40.5 (qC,C-8), 39.7 (CH2,C-22),36.9 (qC,C-10), 34.5 (CH2,C-12), 34.3 (CH2,C-7), 33.8 (CH2,C-2), 30.9 (CH2,C-1), 30.5 (CH2,C-15), 29.6 (CH3,C-28), 29.1 (CH2,C-16), 27.9 (CH,C-20), 27.5 (CH3,C-26), 26.6 (CH3,C-27), 25.7 (CH3,C-19), 24.1 (CH3,C-30), 23.2 (CH3,C-18), 20.1 (-COCH3), 20.1 (CH3,C-29), 20.1 (CH3,C-21), 20.0 (CH2,C-6); LCMSm/z:515[M-H2O+H]+,497[M-2H2O+H]+
13 CNMR (175MHz, CDCl 3) : δC 220.5 (qC, C-3), 171.5 (-COCH 3), 138.3 (qC, C-13), 135.5 (qC, C-17), 78.6 (CH, C- C-23), 57.0 (q C, C-14), 49.6 (CH, C-9), 48.5 CH, C-5), 47.0 (qC, C-4), 40.5 (qC, C-8), 39.7 (CH 2, C-22), 36.9 (qC, C-10), 34.5 (CH 2, C -12), 34.3 (CH 2, C-7), 33.8 (CH 2, C-2), 30.9 (CH 2, C-1), 30.5 (CH 2, C-15), 29.6 (CH 3, C -28), 29.1 (CH 2, C-16), 27.9 (CH, C-20), 27.5 (CH 3, C-26), 26.6 (CH 3, C-27), 25.7 (CH 3, C- 19), 24.1 (CH 3, C-30), 23.2 (CH 3, C-18), 20.1 (-COCH 3), 20.1 (CH 3, C-29), 20.1 (CH 3, C-21), 20.0 (CH 2 , C-6); LCMSm / z: 515 [MH 2 O + H] +, 497 [M-2H 2 O + H] +
실시예: 파골세포의 배양 및 분화Example: Culturing and differentiation of osteoclasts
5-6주령 마우스의 넙다리뼈와 정강뼈를 분리하고 뼈속질 공간을 1cc 주사기로 수세하여 골수세포를 얻었다. 분리된 골수세포는 10% FBS, 항생제, M-CSF (30 ng/㎖)가 포함된 α-minimum essential medium (α-MEM)배지에서 하루동안 배양하였다. 비부착성 골수세포를 M-CSF (30 ng/ml) 내의 페트리디쉬 내에서 3일간 배양하였고, 부착된 세포를 포식세포(bone marrow macrophage, BMM)로 사용하였다. Bone marrow cells were obtained by separating the femur and tibial bones of 5-6 week old mice and washing the bone lumen space with a 1 cc syringe. Separated bone marrow cells were cultured in α-minimal essential medium (α-MEM) medium containing 10% FBS, antibiotics and M-CSF (30 ng / Non-adherent bone marrow cells were cultured in petri dishes in M-CSF (30 ng / ml) for 3 days and adherent cells were used as bone marrow macrophages (BMM).
파골세포의 형성을 위해 상기 포식세포는 M-CSF (30 ng/㎖)와 RANKL (10 ng/㎖)을 첨가하여 4일간 배양하였다. 이 때, 상기 제조예 1 및 2에서 제조한 택사 추출물, 이의 분획물 및 이로부터 분리한 화합물을 각 농도별로 처리하여 함께 배양하였다. For osteoclast formation, the proliferating cells were cultured for 4 days by adding M-CSF (30 ng / ml) and RANKL (10 ng / ml). At this time, the extracts of Taxa extract prepared in Preparation Examples 1 and 2, the fractions thereof and the compounds isolated therefrom were treated at the respective concentrations and cultured together.
배양 배지는 3일마다 갈아주었고, 파골세포의 형성 여부는 TRAP 염색에 의해 측정하였다. TRAP(tartarate resistance acid phosphatase) 용액(Sigma Aldrich,USA)으로 염색하였고, 붉은색으로 염색된 세포는 파골세포로 간주하였다.
Culture medium was changed every 3 days and osteoclast formation was measured by TRAP staining. (TRAP) solution (Sigma Aldrich, USA), and red stained cells were regarded as osteoclasts.
실험예 1: 택사 추출물, 분획물 및 이로부터 분리된 화합물의 세포독성 평가Experimental Example 1: Evaluation of cytotoxicity of the extracts, fractions and the compounds isolated therefrom
골수유래 포식세포를 96-웰 플레이트에 1×104 세포/웰의 밀도로 씨딩(seeding)한 후 M-CSF (30 ng/ml)의 존재 하에, 상기 제조예 1 및 2에서 제조 또는 분리한 택사 추출물, 분획물 및 화합물을 농도별로 처리한 후, 3일간 배양하였다. 3일 후, 10% CCK-8 시약을 포함한 α-MEM 배지에서 상기 포식세포를 3시간동안 추가로 배양하였고, ELISA reader (Molecular Devices, CA, USA)를 이용하여 450 nm에서 흡광도를 확인하였다.
The bone marrow-derived macrophages in a 96-well plate at 1 × 10 4 in the presence of a seeding (seeding) and then a M-CSF (30 ng / ml ) at the density of cells / well, prepared or separated in Preparative Examples 1 and 2 Taxa extract, fractions and compounds were treated by concentration and then cultured for 3 days. After 3 days, the phagocytic cells were further cultured in α-MEM medium containing 10% CCK-8 reagent for 3 hours and absorbance was confirmed at 450 nm using an ELISA reader (Molecular Devices, CA, USA).
그 결과, 상기 제조예 1 및 2에서 제조 또는 분리한 택사 추출물, 분획물 및 화합물 모두 실험한 농도에서 세포독성을 나타내지 않음을 확인하였다(도 1의 C, 도 2c, 도 3의 C). 이러한 결과는 추후에 확인할 파골세포 형성 억제활성이 포식세포 상에서의 독성 효과 때문이 아니라, 택사 추출물, 분획물 및 화합물에 의한 파골세포의 억제활성임을 보여주는 것이다.
As a result, it was confirmed that all the extracts, fractions and compounds produced or isolated in Preparation Examples 1 and 2 did not show cytotoxicity at the concentrations tested (C in FIG. 1, FIG. 2C, and FIG. 3C). These results indicate that the osteoclast formation inhibitory activity to be confirmed later is not the toxic effect on the predation cell but the osteoclast inhibitory activity by the taxa extract, fractions and compounds.
실험예 2: 택사 추출물, 분획물 및 이로부터 분리된 화합물의 파골세포 형성 억제활성 분석Experimental Example 2: Analysis of inhibitory activity on the osteoclast formation of the extracts, fractions and compounds isolated therefrom
실험예 2-1: TRAP 억제활성 분석Experimental Example 2-1: Analysis of TRAP inhibitory activity
상기 실시예의 세포를 3.7% 포르말린으로 5분간 고정시키고, 10분간 0.1% Triton X-100으로 처리하여 세포막의 투과성이 높아지면 다핵 파골세포의 경우, TRAP 용액의 처리에 의해 붉게 염색되는데, 이 때 붉게 염색된 파골세포 중 3개 이상의 핵을 갖는 것만 파골세포로 인정하였다.
When cells of the above example were fixed with 3.7% formalin for 5 minutes and treated with 0.1% Triton X-100 for 10 minutes to increase the permeability of the cell membrane, the polynuclear osteoclasts were reddish by treatment with TRAP solution, Only osteoclasts with three or more nuclei were recognized as osteoclasts.
그 결과, RANKL에 의하여 유도된 대조군은 확연하게 많은 수의 붉게 염색된 파골세포가 형성된 것을 관찰할 수 있었던 반면, 상기 제조예 1 및 2에서 제조한 택사 추출물, 이의 분획물 및 이로부터 분리한 화합물을 각 농도별로 처리한 실험군에서는 농도(용량) 의존적으로 TRAP 활성도를 억제하면서 붉게 염색된 파골세포 수를 현저하게 감소시키는 것을 확인하였다. 특히, 10 및 30 μM의 alisol A 24-acetate를 처리하였을 경우에는 파골세포로의 분화를 완전히 억제하였다(도 1의 A, B, 도 2a, 도 2b, 도 3의 A, B). As a result, it was observed that a large number of ruddy stained osteoclasts were formed in the control group induced by RANKL, while the extracts of Taxus extract prepared in Preparation Examples 1 and 2, fractions thereof and the compounds isolated therefrom In the experimental group treated with each concentration, it was confirmed that the number of red osteoclasted osteoclasts was significantly reduced while suppressing TRAP activity in a concentration (dose) - dependent manner. Particularly, treatment with 10 and 30 μM of alisol A 24-acetate completely inhibited osteoclast differentiation (FIGS. 1A and 1B, FIGS. 2A and 2B and FIGS. 3A and 3B).
이는 택사 추출물, 이의 분획물 및 이로부터 분리한 화합물이 RANKL-유도 파골세포 형성을 억제함을 시사하는 것이다.
This suggests that the extract of Taxa, its fractions and the compounds isolated therefrom inhibit RANKL-induced osteoclast formation.
실험예 2-2: 파골세포 분화관련 유전자 발현 억제활성 (RT-PCR)Experimental Example 2-2: Inhibitory activity of gene expression related to osteoclast differentiation (RT-PCR)
파골세포의 분화 과정에 관여하는 전사인자들의 mRNA 발현 양상을 확인하기 위하여 이에 대한 RT-PCR을 수행하였다. 구체적으로 파골세포 분화에 있어서의 파골세포-특이적 유전자로서 NFATc1, TRAP, DC-STAMP 및 cathepsin K의 mRNA 발현 수준을 대조군(DMSO)과 비교하였다.
RT-PCR was performed to confirm the mRNA expression pattern of transcription factors involved in osteoclast differentiation. Specifically, mRNA expression levels of NFATc1, TRAP, DC-STAMP and cathepsin K as osteoclast-specific genes in osteoclast differentiation were compared with control (DMSO).
구체적으로, 프라이머3 디자인 프로그램(Primer3 design program)을 사용하여 하기 표 1의 각 프라이머를 선별하였다. TRIzol 시약을 사용하여 상기 실시예 1의 세포로부터 총 RNA를 추출하였다. 0.5μg의 총 RNA, 1μM의 oligo-dT18 프라이머 및 M-MLV cDNA 합성키트(Enzynomics, KR)를 사용하여 cDNA를 합성하였다. 이후, TOPrealTM qPCR 2X PreMIX (Enzynomics, KR)를 가지고, Stratagene Mx3000P Real-Time PCR system을 통해 SYBR green-기반 QPCR를 수행하였다. 이후, 중합효소를 95℃에서 10분간 활성화시킨 후, 94℃에서 30초(변성), 60℃에서 30초(어닐링), 72℃에서 30초(증폭)로 40 사이클(cycle)을 반응시켰고, 95℃에서 1분, 55℃에서 30초, 95℃에서 30초에서의 PCR 산물 온도-해리 곡선(용융 곡선이라고도 함)을 생성하였다. 대조군(내부 표준)으로는 Glyceraldehyde-3-phosphate dehydrogenase(GAPDH)을 사용하였다. 모든 반응은 3회 반복 실시하였으며, 데이터는 2- ΔΔCT 방법에 의해 분석하였다.Specifically, each primer shown in Table 1 below was selected using
(서열번호 1)GGGTCAGTGTGACCGAAGAT
(SEQ ID NO: 1)
(서열번호 2)GGAAGTCAGAAGTGGGTGGA
(SEQ ID NO: 2)
(서열번호 3)GATGACTTTGCCAGTCAGCA
(SEQ ID NO: 3)
(서열번호 4)ACATAGCCCACACCGTTCTC
(SEQ ID NO: 4)
(서열번호 5)GGCCAACTCAAGAAGAAAAC
(SEQ ID NO: 5)
(서열번호 6)GTGCTTGCTTCCCTTCTGG
(SEQ ID NO: 6)
(서열번호 7)CCAAGGAGTCGTCCATGATT
(SEQ ID NO: 7)
(서열번호 8)GGCTGCTTTGATCGTTTCTC
(SEQ ID NO: 8)
(서열번호 9)ACCACAGTCCATGCCATCAC
(SEQ ID NO: 9)
(서열번호 10)TCCACCACCCTGTTGCTGTA
(SEQ ID NO: 10)
그 결과, 대조군에 비하여 택사 추출물 및 이로부터 분리한 화합물을 처리하여 배양한 세포에서 파골세포의 분화에 중요한 인자로 알려진 NFATc1과 같은 전사인자의 mRNA 발현을 유의적으로 억제시킴을 확인하였다(도 4). 또한, 파골세포의 분화마커로 알려진 TRAP, 융합(fusion)과 연관된 인자인 DC-STAMP, 및 골 흡수와 연관된 인자인 cathepsin K를 포함하는 파골세포-관련 분자 또한 발현을 감소시킴을 확인하였다(도 4).
As a result, it was confirmed that mRNA expression of transcription factors such as NFATc1, which is an important factor for differentiation of osteoclasts, was significantly inhibited in cells cultured and treated with Taxa extract and compounds isolated therefrom compared to the control group (Fig. 4 ). In addition, it has been shown that osteoclast-related molecules, including TRAP, a factor associated with fusion, DC-STAMP, a factor associated with osteoclast differentiation markers, and cathepsin K, a factor associated with bone resorption, 4).
실험예 2-3: 파골세포 분화관련 단백질 발현 억제활성 (웨스턴 블롯)Experimental Example 2-3: Inhibitory activity of osteoclast differentiation-related protein expression (Western blot)
파골세포의 분화 과정에 관여하는 핵심적인 분화 마커 중 NFATc1의 단백질 발현 양상을 확인하기 위하여 이에 대한 웨스턴 블롯 분석을 수행하였다.
Western Blot analysis was performed to confirm the expression pattern of NFATc1 protein among the key differentiation markers involved in osteoclast differentiation.
구체적으로 상기 실시예에서 배양한 세포는 용해 버퍼(50 mM tris-Cl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 1 mM sodium fluoride, 1 mM sodium vanadate, 1% deoxycholate, and 1:1000 protease inhibitors)를 이용하여 용해하였고, 세포 용해물(cell lysate)을 SDS-PAGE로 분리하였다. 분리된 단백질은 PVDF 막 (polyvinylidene difluoride membrane, Millipore)으로 옮기고 항체를 이용하여 단백질 발현 정도를 확인하였다. 상기 막을 TBST (10mM Tris-HCl pH 7.5, 150mM NaCl 및 0.1% Tween 20)로 세척하였고, 실온에서 1시간동안 블로킹 버퍼(5% nonfat milk in TBST) 내에서 배양하였다. 그 후 상기 막을 anti-NFATc1 (1:500) and anti-actin (1:1000)과 밤새(overnight) 배양시켰고, 3번의 세척을 마친 후 상기 막을 겨자무과산화효소(horseradish peroxidase)에 컨쥬게이트 시킨 2차 항체와 함께 실온에서 2시간동안 배양하였고, 30분동안 3번 세척하였다. LAS-3000 luminescent image analyzer (Fuji Photo Film Co., Ltd., Japan)를 사용하여 화학발광에 의해 특정 밴드를 시각화하였다.
Specifically, the cells cultured in the above example were lysed in a solution buffer (50 mM tris-Cl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 1 mM sodium fluoride, 1 mM sodium vanadate, 1% deoxycholate, and 1 : 1000 protease inhibitors), and the cell lysate was separated by SDS-PAGE. The separated proteins were transferred to a PVDF membrane (polyvinylidene difluoride membrane, Millipore) and the degree of protein expression was confirmed using an antibody. The membrane was washed with TBST (10 mM Tris-HCl pH 7.5, 150 mM NaCl and 0.1% Tween 20) and incubated in blocking buffer (5% nonfat milk in TBST) for 1 hour at room temperature. The membrane was then incubated overnight with anti-NFATc1 (1: 500) and anti-actin (1: 1000) and after 3 washes the membrane was conjugated to horseradish peroxidase The cells were incubated at room temperature for 2 h with the secondary antibody and washed three times for 30 min. Specific bands were visualized by chemiluminescence using a LAS-3000 luminescent image analyzer (Fuji Photo Film Co., Ltd., Japan).
그 결과, NFATc1 단백질의 발현은 RANKL로 인해 현저히 증가하였으나, Alisol A 24-acetate 화합물의 처리에 의해 현저히 감소하였음을 확인하였다(도 6). 이는 상기 화합물을 비롯하여, 이를 포함하는 택사 추출물, 이의 분획물 또한 NFATc1의 단백질 발현을 억제시키고, 나아가 파골세포 형성을 억제시킴을 시사하는 것이다.
As a result, it was confirmed that the expression of NFATc1 protein was significantly increased by RANKL but remarkably decreased by treatment with Alisol A 24-acetate compound (FIG. 6). This suggests that the above compounds, as well as the taxa extracts containing them, as well as fractions thereof, also inhibit protein expression of NFATc1 and further inhibit osteoclast formation.
이상의 결과를 통해 본 발명에 따른 택사 추출물, 이의 분획물 및 이로부터 분리된 화합물이 파골세포 형성 또는 분화의 억제 활성을 보유함을 확인하였다.
From the above results, it was confirmed that the extract of the present invention, its fractions and the compounds isolated therefrom have an inhibitory activity on osteoclast formation or differentiation.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며, 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허청구범위의 의미 및 범위, 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, as well as all changes or modifications derived from the meaning and scope of the appended claims and their equivalents.
<110> Industry-Academy Cooperation Corps of Sunchon National University <120> Pharmaceutical composition for prevention or treatment bone diseases comprising Alisma canaliculatum extract or fractions thereof, or compounds isolated from therefrom <130> KPA141113-KR <160> 10 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 forward primer <400> 1 gggtcagtgt gaccgaagat 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 reverse primer <400> 2 ggaagtcaga agtgggtgga 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRAP forward primer <400> 3 gatgactttg ccagtcagca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRAP reverse primer <400> 4 acatagccca caccgttctc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cathepsin K forward primer <400> 5 ggccaactca agaagaaaac 20 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Cathepsin K reverse primer <400> 6 gtgcttgctt cccttctgg 19 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP forward primer <400> 7 gtgcttgctt cccttctgg 19 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP reverse primer <400> 8 ggctgctttg atcgtttctc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 9 accacagtcc atgccatcac 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 10 tccaccaccc tgttgctgta 20 <110> Industry-Academy Cooperation Corps of Sunchon National University <120> Pharmaceutical composition for prevention or treatment bone Diseases comprising Alisma canaliculatum extract or fractions their, or compounds, from from therefrom <130> KPA141113-KR <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 forward primer <400> 1 gggtcagtgt gaccgaagat 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 reverse primer <400> 2 ggaagtcaga agtgggtgga 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRAP forward primer <400> 3 gatgactttg ccagtcagca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRAP reverse primer <400> 4 acatagccca caccgttctc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cathepsin K forward primer <400> 5 ggccaactca agaagaaaac 20 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Cathepsin K reverse primer <400> 6 gtgcttgctt cccttctgg 19 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP forward primer <400> 7 gtgcttgctt cccttctgg 19 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP reverse primer <400> 8 ggctgctttg atcgtttctc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 9 accacagtcc atgccatcac 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 10 tccaccaccc tgttgctgta 20
Claims (11)
[화학식 1]
Alismataceae (Alisma canaliculatum) extract, fractions thereof, or from which to remove a composition for preventing or treating bone disease comprising the compound or a pharmaceutically acceptable salt thereof represented by the general formula (1) as an active ingredient.
[Chemical Formula 1]
The method of claim 1, wherein the extract is water, carbon number 1 (C 1) to 4 will be extracted by using alcohol or a mixed solvent of (C 4) composition.
The composition of claim 1, wherein the extract is extracted with ethanol.
The method of claim 1, wherein the fraction is obtained by fractionation using alcohol, chloroform, ethyl acetate, hexane or a mixed solvent of ethanol extract of Alismataceae water, carbon number 1 (C 1) to 4 (C 4) / RTI >
The composition of claim 1, wherein the fraction is obtained by fractionating the ethanol extract of Phytase with water, ethyl acetate or a mixed solvent thereof.
The composition of claim 1, wherein said fraction is an active fraction that is further fractionated by column chromatography with ethyl acetate fraction of ethanol extract and separated using chloroform, methanol or a mixed solvent thereof.
The composition according to claim 1, wherein the extract of Taxa, a fraction thereof, or a compound represented by the formula (1) isolated therefrom or a pharmaceutically acceptable salt thereof inhibits osteoclast differentiation.
2. The method according to claim 1, wherein the extract, the fraction thereof, or the compound represented by formula (I) or a pharmaceutically acceptable salt thereof isolated from the extract is selected from the group consisting of NFATc1 (Nuclear Factor of Activated T-cells, -resistant acid phosphatase, DC-STAMP (dendritic cell-specific transmembrane protein) and cathepsin K (cathepsin K).
The method of claim 1, wherein the bone disease is selected from the group consisting of osteoporosis, osteomalacia, osteogenesis imperfecta, osteopetrosis, osteosclerosis, Paget's disease, Wherein the composition is at least one selected from the group consisting of adynamic bone disease, metabolic bone disease and rickets.
[화학식 1]
1. A food composition for preventing or ameliorating osteoporosis, comprising an extract of Phytophthora exudatum, a fraction thereof, or a compound represented by the following formula (1) isolated therefrom as an active ingredient.
[Chemical Formula 1]
11. The method of claim 10, wherein the bone disease is selected from the group consisting of osteoporosis, osteomalacia, osteogenesis imperfecta, osteopetrosis, osteosclerosis, Paget's disease, Wherein the composition is at least one selected from the group consisting of adynamic bone disease, metabolic bone disease and rickets.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140149524A KR101655554B1 (en) | 2014-10-30 | 2014-10-30 | Pharmaceutical composition for prevention or treatment bone diseases comprising Alisma canaliculatum extract or fractions thereof, or compounds isolated from therefrom |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140149524A KR101655554B1 (en) | 2014-10-30 | 2014-10-30 | Pharmaceutical composition for prevention or treatment bone diseases comprising Alisma canaliculatum extract or fractions thereof, or compounds isolated from therefrom |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20160053091A true KR20160053091A (en) | 2016-05-13 |
KR101655554B1 KR101655554B1 (en) | 2016-09-08 |
Family
ID=56023001
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020140149524A KR101655554B1 (en) | 2014-10-30 | 2014-10-30 | Pharmaceutical composition for prevention or treatment bone diseases comprising Alisma canaliculatum extract or fractions thereof, or compounds isolated from therefrom |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101655554B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101888578B1 (en) | 2017-03-23 | 2018-08-14 | 경희대학교 산학협력단 | A pharmaceutical composition for promoting osteogenesis comprising thiacremonone |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100497948B1 (en) * | 2001-06-26 | 2005-06-29 | 한국 한의학 연구원 | Extract of herb for promoting release of growth hormone |
-
2014
- 2014-10-30 KR KR1020140149524A patent/KR101655554B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100497948B1 (en) * | 2001-06-26 | 2005-06-29 | 한국 한의학 연구원 | Extract of herb for promoting release of growth hormone |
Non-Patent Citations (1)
Title |
---|
Bolat MAKABEL 외 6인. Stability and Structure Studies on Alisol A 24-Acetate. Chem. Pharm. Bull. Vol. 56, No. 1, 2008년 1월, pp. 41-45* * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101888578B1 (en) | 2017-03-23 | 2018-08-14 | 경희대학교 산학협력단 | A pharmaceutical composition for promoting osteogenesis comprising thiacremonone |
Also Published As
Publication number | Publication date |
---|---|
KR101655554B1 (en) | 2016-09-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101457570B1 (en) | A pharmaceutical composition comprising oleanolic acid acetate for preventing or treating metabolic disease | |
KR101668845B1 (en) | A pharmaceutical composition for preventing or treating bone diseases comprising Dendropanax morbifera extract | |
US8822705B2 (en) | Pharmaceutical composition for preventing and/or treating bone disease, functional food or health food and pharmaceutical preparation comprising thereof as active ingredient | |
KR101496834B1 (en) | Pharmaceutical compositions for the prevention and treatment of obesity containing biological active materials from Curcuma aromatica Salisb. extracts | |
KR20110007978A (en) | A composition for preventing and treating bone disease comprising colforsin daropate | |
KR20180135567A (en) | A composition for preventing or treating menopausal disorder comprising extract from young barley leaves | |
KR101655554B1 (en) | Pharmaceutical composition for prevention or treatment bone diseases comprising Alisma canaliculatum extract or fractions thereof, or compounds isolated from therefrom | |
KR20140045894A (en) | A pharmaceutical composition for preventing or treating il-6-mediated disease, comprising extract, fraction, or compounds derived from ampelopsis brevipedunculata | |
KR102372440B1 (en) | Phamaceutical Composition Comprising an Extract of Artemisia scoparia for Preventing or Treating Metabolic Bone Disease-induced Bone Loss | |
KR101257706B1 (en) | A composition comprising obacunone for treating or preventing vascular disease | |
KR101780939B1 (en) | Method for Seperation of Compound Derived from Ginseng and Composition for anti-inflammatory Using the same | |
KR101603279B1 (en) | Pharmaceutical composition for prevention or treatment of diseases induced by activation of NFAT5 containing protoberberine derivative or pharmaceutically acceptable salts as an active ingredient | |
KR20180077998A (en) | Novel caffeic acid compound from Stauntonia hexaphyll leaf extract and composition for anti-inflammatory, and improvement of bone tissue generation or cartilage tissue generation | |
KR101332074B1 (en) | Composition Comprising Esculetin for Inhibition of Bone Loss | |
US11464787B2 (en) | Composition comprising oleanolic acid acetate as active ingredient for preventing, alleviating, or treating renal toxicity induced by medicine | |
JP2010155821A (en) | Pharmaceutical composition-containing kinsenoside and extract usable for inhibiting formation of osteoclast, inhibiting function of osteoclast, and/or activating osteoblast | |
KR101089716B1 (en) | Compositions for the prevention or treatment of hyperlipidemia, hypercholestrolaemia, or complication thereof containing flavonoid compounds or pharmaceutically acceptable salts thereof as an active ingredient | |
KR101972657B1 (en) | Composition comprising extract of Angelica decursiva Franchet et Savatieras or compounds isolated therefrom for preventing or treating osteoporosis | |
KR20160053034A (en) | A pharmaceutical composition for preventing or treating bone diseases comprising Sinomenium acutum extract | |
KR102206831B1 (en) | Meroterpenoids and Their Use | |
KR102284073B1 (en) | An Extract of Umbilicaria antarctica Having Anti-inflammatory and Immuno-modulating Activity and Composition Comprising the Same | |
WO2018062895A1 (en) | Composition comprising osmundacetone or pharmaceutically acceptable salt thereof for preventing or treating bone disease | |
KR20190055600A (en) | Composition for preventing or treating neurodegenerative diseases comprising daphnane or phobor diterpenoid compound | |
KR101215797B1 (en) | A composition comprising a morus extract for preventing and treating liver cirrhosis | |
KR102112753B1 (en) | Benzophenones and their use |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
AMND | Amendment | ||
E601 | Decision to refuse application | ||
AMND | Amendment | ||
X701 | Decision to grant (after re-examination) | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20190731 Year of fee payment: 4 |