KR20160048232A - Method for mass production of nucleic acid nanostructure and use thereof in drug delivery systems - Google Patents

Abstract

The present invention relates to a method for mass-producing a DNA or RNA nucleic acid nanostructure and a delivery usage of an activator of the nucleic acid nanostructure produced through the method. According to a method for mass-producing a DNA nanostructure or an RNA nanostructure, a cutting position exists in an amplification matrix, so desired nucleic acid may be mass-produced at high efficiency through position-specific cutting, and a nanostructure capable of easily transferring a targeted activator into a cell by using the same or transferring siRNA by directly including a targeted siRNA sequence in a matrix may be directly produced. Accordingly, effective nucleic acid amplification is achieved, so a nucleic acid nanostructure may be mass-produced and usefully used in transferring an activator into a cell. The method comprises the steps of: 1) producing a circular DNA matrix connected with an end part of a sequence by treating one polynucleotide connected with unit sequences of number K represented by (P-Mk-Nk) to (P-M(K-n)-N(K-n)) through a DNA ligase; 2) obtaining an amplification byproduct in which complementary sequences are repeated in a unit sequence by treating DNA polymerase on the circular DNA matrix; 3) obtaining an amplified sequence group by cutting a restriction enzyme recognition part formed in the amplification byproduct; and 4) obtaining a DNA nanostructure through self-assembly of the amplified sequence group.

Description

TECHNICAL FIELD The present invention relates to a method for mass production of nucleic acid nanostructures and their use as a drug delivery system,

The present invention relates to a method for mass-producing DNA or RNA nucleic acid nanostructures and the utilization of nucleic acid nanostructures prepared by such a method as drug carriers.

Recently, a nucleic acid that has been recognized as a genome to store and transmit biological genetic information has recently been recognized as a functional biopolymer based on self-assembling properties due to the complementary sequence of a nucleic acid. Research is being conducted in various technical fields such as making sophisticated structures. The nucleic acid nanostructures thus produced are not only for the manufacture of nanostructures themselves, but also have potential to be applied to a variety of fields such as therapeutic fields, medical diagnoses, crime medicine fields, and environmental fields.

The only enzyme required in bacteriophage p29 for cloning the genome is its DNA polymerase, a 66 kDa monomeric protein capable of catalyzing both the replication initiation and elongation of the synthesized strand. For initiation, the polymerase is coupled to a protein known as "terminal" (TP), recognizing the end of Pi 29 DNA and catalyzing the formation of a TP-dAMP covalent complex. After polymerization of 10 nucleotides, the DNA polymerase / TP heterodimer is dissociated and extension of the strand from the DNA is carried out. Reproducible DNA polymerases require interaction with accessory proteins that stabilize the binding between the enzyme and DNA (Kuriyan and O'Donnell. J Mol Biol. 1993; 234: 915-925). On the other hand, since the DNA polymerases require functional association with helicase-type proteins, they need to be linked to the polymerization upon isolation of unreplicated DNA strands. In this sense, the DNA polymerase of the bacteriophage pie 29 has various inherent functional characteristics that make it unique, such as high processability, high strand resolution and high accuracy.

All these features have led to the development of protocols for a wide variety of isothermal processes (i.e., constant temperature) to amplify double stranded DNA (dsDNA) based on the use of this polymerase. In a simple structure, the ability to utilize the circular single-stranded DNA (ssDNA) of the Pie 29 DNA polymerase enables the amplification of DNA by the rolling circle method (or RCA-rolling circle amplification) Long-length single-stranded DNA molecules. However, in spite of reports on such DNA amplification methods, there is a continuing need for the development of techniques for efficiently amplifying nucleic acids starting from a smaller amount of nucleic acids, and particularly capable of rapidly and accurately amplifying nucleic acids having specific functionalities .

In particular, it is known that in the case of a specific disease, diseases can be effectively treated by RNA interference. Therefore, attempts have been made to treat siRNAs against cancer and various genetic diseases, and nucleic acid constructs There is an attempt to. The discovery of RNA interference (RNAi) has paved the way for a whole new field of biology and pharmacy. The ability of RNAi to specifically silence the target gene has resulted not only as a new tool for basic research, but also as an initiative for the development of drugs based on RNAi. RNAi targets mRNA through sequence-specific binding, resulting in degradation of target mRNA or its translation, leading to loss of protein expression. This is achieved pharmacologically through the introduction of small 19-21 bp dsRNA molecules called small interfering RNAs (siRNAs). From this discovery 10 years ago, siRNA has been extensively studied in vitro for its use in the treatment of a variety of diseases such as cancer, neurodegenerative and infectious diseases.

However, in such a disease treatment method using siRNA, there is a limit in that siRNA can not effectively be delivered in vivo by a relatively large molecular weight (e.g., 13 kDa) of siRNA and polyanionic characteristic (for example, . Naked siRNAs are not able to freely pass through cell membranes and unmodified ex-siRNAs are relatively unstable in blood and serum because they are rapidly degraded by endonuclease or exonuclease, In order to solve this problem, a method of performing chemical modification on the RNA double structure to improve the biological stability without adversely affecting the gene-silencing activity has been reported. Or alternatively can be formulated into delivery systems that provide biological stability as well as enhance cell uptake. Several chemical modifications to the backbone, base or sugar of RNA have been used to improve siRNA stability and activity. However, the need for promoting siRNA access to intracellular functional sites in such delivery systems continues to be a problem.

To solve this problem, a method of using cationic particles to promote effective interactions between negatively charged siRNA nucleotides and particles and to facilitate their entry into cells has been studied. However, it has been reported that the delivery of such particles to the site of interest due to the rapid ingestion by the reticuloendothelial organ of the reticuloendothelial system can not effectively take place when the siRNA is delivered as a system of these cationic particles .

Therefore, studies on nanoreversors for loading and delivering siRNA have been attempted. However, the number of clinically relevant nanocarriers used for this purpose is scarce, and major disorders remain unresolved, particularly with regard to their effective delivery through the administration of parenteral routes. siRNAs represent hydrophilic bio-polymer classes that require the application of appropriate nanocarriers to take full therapeutic potential.

Therefore, there is still a need to study a method for efficiently delivering a small molecule, i.e., a drug or siRNA, into a cell to treat a genetic disease such as cancer, and there is a desperate need for studies on the most efficient drug delivery construct .

In studying nucleic acid nanostructures for effectively delivering an active agent into a cell, the present inventors have found that when DNA or RNA is amplified using DNA having a specific sequence as a template, DNA or RNA nanostructures Can be obtained by amplification with high efficiency and can be used for activator delivery, and the present invention has been completed.

Accordingly, an object of the present invention is to provide a DNA amplification product in which a specific unit sequence is prepared as a circular template and a sequence complementary to the unit sequence is repeated, DNA for producing a DNA nanostructure replicated in large quantities Thereby providing a mass production method of the nanostructure.

It is also an object of the present invention to provide a DNA nanostructure for delivering an active agent having an adhesive end made by the above method.

It is also an object of the present invention to provide a template DNA amplification product in which a plurality of specific unit sequences are respectively prepared as a circular template and amplified to obtain a template DNA amplification product in which a sequence complementary to a unit sequence is repeated, To provide a method to do so.

It is also an object of the present invention to provide a DNA nanostructure for activator delivery produced by the above method.

It is also an object of the present invention to prepare a plurality of specific unit sequences as a circular DNA template and transcribe the same into an RNA polymerase to obtain an amplified RNA product in which a sequence complementary to the template DNA unit sequence is repeated, To provide a method for mass-producing RNA nanostructures.

It is also an object of the present invention to provide an RNA nanostructure for activator delivery, which is produced by the above method.

It is another object of the present invention to prepare a plurality of unitary sequences each having a specific unit sequence as a plurality of circular DNA templates and transcribe the same into an RNA polymerase to obtain individual amplified RNA products in which a sequence complementary to the template DNA unit sequence is repeated , And a method of mass-producing the RNA nanostructure by cutting and mixing and self-assembling the RNA nanostructure.

It is also an object of the present invention to provide an RNA nanostructure for activator delivery, which is produced by the above method.

In order to achieve the above object, the present invention provides 1) (PM _{k k} -N) to _{(PM (Kn)} -N process one polynucleotide sequence associated with a K of unit represented by _(Kn)) DNA Kinase in Riga Thereby preparing a circular DNA template to which the end of the sequence is connected; 2) treating the circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to the unit sequence is repeated; 3) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain an amplified sequence group; And 4) obtaining a DNA nanostructure by self assembly of the amplified sequence group. (Herein, P is a primer binding site containing a restriction enzyme recognition site, M and N are single stranded DNA sequences of 3 to 300 nt in length, N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k , N is an integer of 90 or less, and n = {n | 1 | n | k-1}.

More specifically, the polynucleotides of the above methods are polynucleotides in which K unit sequences represented by '(PM _k -N _k ) to (PM _(Kn) -N _{(Kn) k} -N _k), hereinafter _{(PM (Kn) -N (Kn} )) comprises would be to refer to each of unit sequences, as each of the unit sequence is' P (primer binding sequence, a restriction enzyme recognition site therein) Quot; first portion - second portion ". The second portion of any one of the unit sequences other than the first unit sequence located at the 3 'end of the polynucleotide is complementary to the first portion of the other unit sequence linked to the 3' end of the unit sequence , The second part of the unit sequence located at the 3 'end of the polynucleotide is complementary to the first part of the unit sequence located at the 5' end of the polynucleotide. Since the polynucleotide has K unit sequences linked thereto, a single strand having a structure in which K (K is an integer of 3? K? 90 or less) unit sequences having a structure of 'P-first portion-second portion' Polynucleotide < / RTI >

In more detail, the 'circular DNA template' in the above method means that the polynucleotide of the above method is treated with an DNA ligase, whereby the 5 'end and the 3' end are linked to each other. However, since the complementary sequence portions exist in the polynucleotide, the complementary sequence portions in the circular internals are combined with each other as shown in the upper left part of FIG.

The present invention also relates to a DNA polymerase which is selected from the group consisting of Bst DNA polymerase, exonuclease minus, Tth DNA polymerase, PyroPhage TM 3173 DNA polymerase, BcaBEST DNA polymerase and Phi, 29 < / RTI > DNA polymerase, wherein the DNA nanostructure is at least one selected from the group consisting of DNA polymerases.

The present invention also provides a method for mass production of DNA nanostructures wherein the restriction enzyme recognition site is palindromic.

The present invention also relates to a method for producing a recombinant DNA of the present invention, wherein the above restriction enzyme is BamHI, HindIII, EcoRI, EcoRII, TaqI, SacI, KpnI, EcoP15I, and PstI. The present invention provides a method for mass production of DNA nanostructures.

In addition, the present invention provides a method for mass-producing DNA nanostructures, which further comprises: 5) binding an activator to a DNA nanostructure in the mass production method.

The present invention also provides a DNA nanostructure having an adhesive end produced by a mass production method of DNA nanostructure.

The structure of the DNA nanostructure will now be described in more detail. Since the second portion of one unit sequence in the DNA nanostructure is complementary to the first portion of the other unit sequence, the resulting nucleic acid has the same number of double-stranded nucleic acid branches as the number of unit sequences, (That is, a spider or a spiral extending from a central point in two dimensions or three dimensions on all sides). Also, the P moiety present in each unit sequence is present as a single-stranded nucleic acid at the respective ends of the prepared nucleic acid nanostructure, which acts as a sticky end to which other active agents can be attached. A method for producing a DNA nanostructure using each of the K unit sequences described below as a template or a method for producing an RNA nanostructure prepared by a method for producing an RNA nanostructure using one polynucleotide or K unit sequences as a template, Likewise, the double stranded nucleic acid branches of the same number as the number of the unit sequences have a radially extending shape, and a single stranded nucleic acid exists which can act as an adhesive end at the end of each branch.

In one embodiment of the present invention, when K is 3, that is, when a nucleic acid nano-structure is produced using one polynucleotide to which three unit sequences are linked, the produced nucleic acid nano-structure has a Y-shape. The nucleic acid may be DNA or RNA.

The present invention also provides a DNA nanostructure for activator delivery produced by the above method.

The present invention also provides an activator-bound DNA nanostructure wherein said activator is at least one selected from the group consisting of siRNA and its chemical derivatives, oligonucleotides, polynucleotides, small molecules and drugs.

The present invention also relates to the use of the medicament in combination with at least one selected from the group consisting of mitonafide, amonafide, bisnaphthalimide, ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin which is an anticancer agent selected from the group consisting of doxorubicin, adriamycin, echinomycin, benzimidazo [1,2-c] quinazoline, and imidazodiquinolinium cation naphthalimides. . Also particularly particularly preferred are doxorubicin and adriamycin.

The present invention also relates to a method for producing K circular DNA templates, each of which comprises treating K DNA units represented by (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) with DNA ligase, Lt; / RTI > 2) treating the circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to the unit sequence is repeated; 3) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain K amplified sequence groups; And 4) mixing the K groups and obtaining a DNA nanostructure through self assembly of the sequence, wherein the P is a restriction enzyme recognition site, M and N are single stranded DNA sequences of 3 to 300 nt in length, N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k , K is a sequence complementary to M 3? K? 90, and n = {n | 1? N? K-1}}.

More specifically, the method does not use one polynucleotide to which K unit sequences are linked, but uses a K unit sequence to prepare a circular template. Each primer pair sequence (PM _k -N _k ) and (PM _(Kn) -N _(Kn) ) is referred to as P (primer binding sequence including a restriction enzyme recognition site) 2 moiety ", and the second portion of any one unitary sequence is complementary to the first portion of the other unitary sequence. When each of the unit sequences becomes a circular template, the DNA polymerase does not form a complementary bond in the template step, and the energy consumed to solve the binding is relatively decreased, so that the DNA nanostructure is produced with higher efficiency There is an advantage that it can be. In some cases, it is also advantageous to synthesize and use shorter unit sequences than to synthesize one long polynucleotide, which may be more economical.

The present invention also relates to a method for preparing a DNA template having K nicks by combining K unit sequences represented by (P - first part - second part) and combining complementary parts with each other;

2) A circular DNA template may be prepared by treating the DNA template with DNA ligase to prepare a circular DNA template to which each nick is ligated. The following steps can be performed by amplifying with RCA and digesting with restriction enzymes as described above.

The present invention also provides a method for mass-producing DNA nanostructures, which further comprises the step of binding an active agent to the DNA nanostructure of step 5).

The present invention also provides a DNA nanostructure for activator delivery produced by the above method.

The present invention also provides an activator-bound DNA nanostructure wherein said activator is at least one selected from the group consisting of siRNA and its chemical derivatives, oligonucleotides, polynucleotides, small molecules and drugs.

In addition, the present invention provides _{1) (Pr-M k -N} k) to _{(Pr-M (Kn)} one to the K unit sequences represented by -N _(Kn)) DNA Riga handle azepin the distal end of the linked sequences Preparing a circular DNA template; 2) obtaining an amplified RNA product in which a circular DNA template is treated with an RNA polymerase to repeat a sequence complementary to the unit sequence of the template DNA; 3) adding a DNA helper sequence to the amplified RNA product to form a double strand of DNA / RNA; 4) cleaving the double strand of DNA / RNA with RNase H to obtain a sequence mixture complementary to the unit sequence; And 5) obtaining the RNA nanostructure by self assembly of the unit sequences in the amplified unit sequence complementary sequence mixture. (Herein, Pr is an RNA polymerase and kinase promoter sequence of the La recognizes the RNA polymerase to dehydratase, and M and N are 15 to 25nt long siRNA sequences, N _k is a sequence complementary to M _(k-1) and, N ₁ is M _k complementary K is an integer of 3? K? 90 or less, and n = {n | 1? N? K-1}}.

In one embodiment of the present invention, the DNA helper may be 2'-O-methylated 1 to 6 nucleotides from the 3 'and 5' ends, respectively.

(Pr- _Mk - _Nk ) and (Pr-M _(Kn) -N _(Kn) ), which means the respective unit sequences, Promoter sequence) - first part - second part '. As described above, the second portion of one unitary sequence is complementary to the first portion of another unitary sequence.

In the above, K DNA units represented by 'Pr-M _k -N _k ' to (Pr-M _(Kn) -N _(Kn) ) are treated with DNA ligase to form a circular DNA template More specifically, the complementary parts between the unit sequences are mutually combined to form a K-nicked template. The DNA ligase is then treated to bind the nicks together to form a circular DNA template .

The present invention also provides K circular DNA templates by treating DNA sequences of each of K unit sequences, amplifying the circular DNA templates with RCA, mixing the amplified sequence groups, and synthesizing RNA nano Lt; RTI ID = 0.0 > a < / RTI > structure. In addition to producing K circular DNA templates and amplifying each with RCA to produce a sequence group, specific methods can be performed as described above.

The present invention also provides a method for mass-producing RNA nanostructures wherein the RNA polymerase is a T7-RNA polymerase.

The present invention also provides RNA nanostructures for activator delivery produced by the above method.

The present invention also provides an RNA nanostructure comprising an siRNA sequence.

The present invention also provides an RNA nanostructure in which an activator is further bound to the RNA nanostructure.

The present invention also relates to the use of the active agent in combination with at least one selected from the group consisting of mitonafide, amonafide, bisnaphthalimide, ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin wherein the anticancer agent is at least one anticancer agent selected from the group consisting of doxorubicin, adriamycin, echinomycin, benzimidazo [1,2-c] quinazoline, and imidazodiquinolinium cation naphthalimides.

In another aspect, the present invention _{1) (Pr-M k -N} k) to _{(Pr-M (Kn) -N} (Kn)) K of unit sequence to the kinase or DNA ligase treatment circligase K circular each represented by the following DNA Producing a mold; 2) treating each circular DNA template with an RNA polymerase to obtain a separate amplified RNA product in which the sequence complementary to the unit sequence of the template DNA is repeated; 3) adding DNA helper sequences to amplified RNA products to form DNA / RNA duplexes; And 4) cleaving the double strand of DNA / RNA with RNase H to obtain a sequence group complementary to the unit sequence; And 5) obtaining an RNA nanostructure by self-assembly of the sequence by mixing the amplified single sequence group, wherein the Pr is an RNA polymerase M and N are siRNA sequences of 15 to 25 nt in length, N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k , K is an integer equal to or less than 3? K? 90, and n = {n | 1? N? K-1}}.

(Pr- _Mk - _Nk ) and (Pr-M _(Kn) -N _(Kn) ) representing the respective unit sequences can also be expressed as 'Pr-first part-second part' have. As described above, the second portion of one unitary sequence is complementary to the first portion of another unitary sequence.

The present invention also provides RNA nanostructures for activator delivery produced by the above method.

The present invention also provides an RNA nanostructure in which an activator is further bound to the RNA nanostructure.

According to the mass production method of the DNA nanostructure or RNA nanostructure of the present invention, since the cleavage site exists in the amplification template, the nanostructure based on the desired nucleic acid can be mass produced with high efficiency through the site-specific cleavage, The desired active agent can be easily transferred into the cell or a nano structure capable of directly delivering siRNA can be directly produced by including the desired siRNA sequence in the template. Therefore, efficient nucleic acid amplification can be achieved and mass production of the nucleic acid nano- , And may be useful for delivering the active agent into cells.

FIG. 1 is a view illustrating an example of loading siRNA into the protruding adhesive end and using it as a drug delivery vehicle.
Figure 2 is a simplified representation of a method for amplifying a Y-form DNA nanostructure through a single stranded DNA template.
FIG. 3 is a graph showing the results of the products produced in each step of the mass production method through 10% PAGE (L: DNA ladder, 1: primer, 2: Y-DNA template and 3: hybridized Y-DNA / primer Product, 4: circular Y-DNA template, 5: RCA product, 6: cut / self-assembled product, 7: purified Y-DNA product)
FIG. 4 is a diagram showing a result of checking a Y-shaped nanostructure formed using an AFM image
(a: RCA product; Upper: single-stranded DNA amplified and extended by Pie 29 DNA polymerase, bottom: comparison of single strand nucleic acid height with amplified strand / b: self-assembled Y- Disconnected nano-sized spherical shape through cutting / connecting process, bottom: Double-strand confirmation through height confirmation).
FIG. 5 (a) is a graph showing the results of Y-type DNA / FA-siRNA nanostructures confirmed by 10% PAGE analysis (L: DNA ladder, 1: Y-DNA nanostructure, 2: Y- gt; siRNA < / RTI >
Figure 5 (b) shows the result of confirming gene silencing effect of the gene transporter through GFP-KB cell infection.
FIG. 5C shows the results of confirming the gene silencing effect by fluorescence microscopy after culturing GFP-KB cells and Y-FA-siRNA.
Figure 6 is a simplified representation of a method for amplifying a Y-form DNA nanostructure through three single stranded DNA templates.
FIG. 7 is a graph showing the results of 10% PAGE analysis of the products produced in each step of the mass production method (L: DNA ladder).
8 is a view showing the result of confirming the formation of a Y-shaped DNA nanostructure through Y1 to Y3 hybridization.
Fig. 9 is a diagram showing the shape of a DNA template and its sequence.
10 is a schematic view illustrating a process of mass-producing a Y-shaped RNA nanostructure through a single-stranded DNA template.
FIG. 11 is a graph showing the results obtained by the 5% PAGE analysis (L: DNA ladder, 1: S1, 2: S1 + S2, + S3), 4: primer, 5: hybridized Y-DNA / primer product, 6: circular Y-DNA template, 7: RCT product, 8; 18nt DNA helper hybridization and RNase-
FIG. 12 is a schematic representation of a method for mass-producing Y-shaped RNA nanostructures through three single-stranded DNA templates. FIG. 12A shows a method using Circligase, FIG. 12B shows a method using T4 DNA ligase to be.
FIG. 13 is a diagram showing the result of a 5% PAGE analysis (A: ligase, B: circligase) in the products produced in each step of the mass production method.
FIG. 14 shows the use of a 2'-O-methylated DNA helper to briefly illustrate the process of mass-producing Y-shaped RNA nanostructures through a single stranded DNA template.
FIG. 15 is a diagram showing the result of confirming the products produced in each step of the mass production method by 10% PAGE analysis.
FIG. 16 is a graph showing the results of confirming the gene silencing effect through Flow Cytometry after treating GFP-KB cells and Y-shaped RNA nanostructures.

The present invention relates to a method for producing a polynucleotide comprising the steps of: 1) treating a polynucleotide in which K unit sequences represented by (PM _k -N _k ) to (PM _(Kn) -N _(Kn) Preparing a DNA template; 2) treating the circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to the unit sequence is repeated; 3) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain an amplified sequence group; And 4) obtaining a DNA nanostructure by self assembly of the amplified sequence group. (Herein, P is a primer binding site containing a restriction enzyme recognition site, M and N are single stranded DNA sequences of 3 to 300 nt in length, N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k , N is an integer of 90 or less, and n = {n | 1 | n | k-1}.

According to the mass production method of the present invention, it is possible not only to mass-produce DNA and RNA nanostructures with high efficiency, but also to have a cleavage sequence in the inside of the nanostructure, so that a desired unit sequence can be obtained through a simple method, By including the sequence in its own form, it is possible to produce the siRNA transporter with high efficiency without a separate loading step.

The term "unitary sequence " of the present invention refers to a sequence repeatedly appearing in an endless copying or transcription of a nucleic acid, and may be a nucleic acid sequence of 3 to 500 nt in length, preferably 9 to 300 nt, Sequence. Further, the unitary sequence of the present invention may be a single-stranded polynucleotide, more preferably a single-stranded DNA polynucleotide, but not limited thereto.

The unit sequence of the present invention is capable of endless replication or transcription until termination of the reaction through the endless replication or transcription of the nucleic acid, and it is possible to obtain a copy sequence of the unit sequence unit or a transcription sequence complementary thereto Can be obtained in large quantities.

The unit sequence in the mass production method of the DNA nanostructure can be expressed as (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ).

Herein, P is a primer binding sequence including an endonuclease restriction enzyme recognition site. A primer of a complementary sequence recognizes and binds to a primer binding sequence, thereby forming a 3'-OH terminal of a unit sequence and a 5'-phosphate The ends may be located close together and then be linked by DNA ligase. The length of such a primer binding sequence may be 6 to 40 nt, preferably 12 nt to 30 nt, as long as it includes a restriction enzyme recognition site and fulfills the above-mentioned role. In one embodiment of the present invention, an exemplary primer sequence includes a sequence recognized by a primer represented by 'TTCAAGGCGAGGTAGCTGCAGGG (SEQ ID NO: 2)' in a unit sequence. It can be confirmed that the primer sequence of SEQ ID NO: 2 contains the restriction enzyme recognition site CTGCAG sequence.

The unit sequences " (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) "in the above method are preferably in the form of linear polynucleotide strands in which all unit sequences are connected together. During the construction of the construct, a circular template can be formed by connecting the 5 'phosphate end with the 3' OH end.

Most preferably, M and N are linear single-stranded DNA polynucleotides in the unit sequences of (PM _k -N _k ) to (PM _(Kn) -N _(Kn) 300 nt long, preferably 6 to 200 nt long, more preferably 6 to 100 nt long.

P and M, a nucleotide in the hydroxyl group of the 3 'end as a polynucleotide represented by N are well known in the art and linked form by phosphodiester ester bond, in this way the same connection specification of the present invention, for example, PM _k -N _k . In such a connection, any polynucleotide of P, M, or N may also be inserted between the polynucleotides of any length of short nucleotides, as long as it does not interfere with the object of the present invention.

In the unit sequence, N _k is a sequence complementary to M _(K-1), and N ₁ is a sequence complementary to M _k . Illustratively, when K is 5, N ₅ may be a sequence complementary to M ₄ , N ₄ to M ₃ , N ₃ to M ₂ , N ₂ to M ₁ , and N ₁ to M ₅ , When K is 4, it means that N ₄ can be a sequence complementary to M ₃ , N ₃ to M ₂ , N ₂ to M ₁ , and N ₁ to M ₄ .

In the present invention, the term "complementary sequence" means a sequence complementary to the complementary sequence of 100 to 100%, preferably 80 to 100% Preferably 90 to 100% complementary sequence, even more preferably 95 to 100% complementary sequence.

If in one embodiment of the present invention K = _3, N 3 is M ₂ and, N ₂ is M ₁ and, N ₁ is one of the polynucleotide is three unit sequence having a M ₃ and the complementary sequences attached to each other , Which is represented by the 159 nt long polynucleotide sequence of SEQ ID NO: 1.

Marking the polynucleotide sequence of SEQ ID NO: 1 in a unit sequence may be represented by the _{pho-M 3 -N 3 -M 2} -N 2 -M 1 -N 1 as follows. That is, one polynucleotide in which the unit sequences are linked to each other is preferably a polynucleotide that is aligned in a descending order of K and linked together.

These complementary sequences can recognize and bind to each other at the time of preparing the template DNA by linking the 5 'end and the 3' end, thereby forming a template having a specific form such as a Y- .

The "DNA polymerase" may be any DNA polymerase capable of producing a template DNA amplification product in which a unit sequence is repeated from a DNA template, and any of those known in the art may be used without limitation, preferably Bst DNA polymerase, exonuclease minus , Tth DNA polymerase, PyroPhage (TM) 3173 DNA polymerase, BcaBEST DNA polymerase and Phi 29 DNA polymerase, and more preferably, pie DNA polymerase (Phi) 29 DNA polymerase. The Phi 29 DNA polymerase enables the amplification of DNA by the rolling circle method (or RCA-rolling circle amplification) using a circular single stranded DNA template, It is possible to produce single-stranded DNA molecules that are repeatedly long.

In the present invention, the "restriction enzyme recognition site" formed in the DNA amplification product preferably forms a palindromic structure. The term "translational structure" means that the nucleotide sequence on the DNA molecule is the same in structure even when read at the right or left side. Such a restriction enzyme recognition site is repeatedly present in the sequence amplified by the restriction enzyme sequence region contained in the primer sequence of the unit sequence and is recognized by the restriction enzyme and can be precisely . The presence of such restriction enzyme recognition sites is advantageous in that a desired unit sequence can be obtained simply by restriction enzyme treatment.

In the present invention, the term "restriction enzyme" is preferably an endonuclease that recognizes and cleaves a specific restriction enzyme site in the polynucleotide sequence. In addition, preferably, BamHI, HindIII, EcoRI, EcoRII, TaqI, NotI, Sau3AI, PvuII, SmaI, HaeIII, HgaI, EcoRV, KpnI, EcoP15I, AluI, XbaI, StuI, SphI, SpeI, ScaI, SalI , SacI, KpnI, EcoP15I, and PstI. In the present invention, PstI is used as a preferred example. The restriction enzyme recognition sequences that the endonuclease recognizes and cleaves are well known in the art and can be readily derived by those skilled in the art.

The restriction enzyme recognizes and specifically cleaves a restriction enzyme recognition site in an amplified long polynucleotide sequence repeatedly comprising a unit sequence, whereby a large number of sequences cleaved into unit sequence units can be obtained. In particular, it is preferable that the restriction enzyme of the present invention cleaves the cleaved polynucleotide sequence asymmetrically, and the amplified unit sequence group thus obtained may each consist of a unit sequence polynucleotide having an adhesive end (sticky end) .

The present invention further provides a method for mass-producing DNA nanostructures, which further comprises the step of binding the DNA nanostructure produced by the mass production method to the active agent.

Since the unit sequence group obtained by amplification and cleavage by the method of the present invention is composed of a unit sequence polynucleotide having an adhesive end (sticky end), it has an advantage that the active agent can be easily loaded at the adhesive end region .

Accordingly, the present invention provides a DNA nanostructure having an active agent bound thereto, which is produced by the above method.

In the present invention, the "active agent" may be any substance that can be loaded into the DNA nanostructure produced and expressed into the cell by the nanostructure so that the desired effect can be exhibited. Or a chemical derivative thereof, an oligonucleotide, a polynucleotide, a small molecule, and a drug, more preferably a drug such as an siRNA and its chemical derivative, an anticancer agent, a contrast agent or the like, or a drug such as mitonafide, amonafide, The compounds of the present invention may be used in combination with other drugs such as bisnaphthalimide, ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin, adriamycin, echinomycin ), Benzimidazo [1,2-c] quinazoline, and imidazodiquinolinium cation naphthalimides. , Active agents that can be loaded and delivered in this way are described variously in "Intercalators as Anticancer Drugs (A. Ramos et al., Current Pharmaceutical Design, 2001, 7, 1745-1780) ≪ / RTI > may be cited herein by reference in their entirety.

The present invention also relates to a method for producing K circular DNA templates, each of which comprises treating K DNA units represented by (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) with DNA ligase, Lt; / RTI > 2) treating the circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to the unit sequence is repeated; 3) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain K amplified sequence groups; And 4) mixing the K groups and obtaining a DNA nanostructure through self assembly of the sequence, wherein the P is a restriction enzyme recognition site, M and N are single stranded DNA sequences of 3 to 300 nt in length, N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k , K is a sequence complementary to M 3? K? 90, and n = {n | 1? N? K-1}}.

In the mass production of the DNA nanostructures, K unit sequences are individually prepared as K circular DNA templates, and DNA nanostructures are mass produced, so that complementary sequences existing in the individual unit sequences are complementary in the DNA template step And thus, there is no part other than the recognition site of the restriction enzyme that forms a bond. Therefore, the DNA polymerase has the advantage that the energy consumed to solve the bond is relatively reduced, and thus the DNA nanostructure can be produced with higher efficiency.

Each of the K unit sequences is made up of K circular DNA templates, each of which is linked by a DNA primer and a DNA primer that binds to the primer recognition site of the sequence, and amplified individually to form a unit sequence (PM _k -N _k ) To (PM _(Kn) -N _(Kn) ) can be repeated within each amplification sequence.

For example, in the present invention K it is _{5, (PM 5 -N 5)} , (PM 4 -N 4), (PM 3 -N 3), (PM 2 -N 2), (PM 1 -N 1) May be used to form a circular DNA template to form a total of five types of DNA templates. Four individual unit sequences of (PM ₄ -N ₄ ), (PM ₃ -N ₃ ), (PM ₂ -N ₂ ) and (PM ₁ -N ₁ ) can be used when K = 4, Which can form a total of four types of DNA templates. Thus, each unit sequence can form a total of K amplified unitary sequence complementary sequence groups by amplification.

In still another aspect of the invention the sequence of the units, if K is 3 ₍₃ PM -N _3), (PM ₂ -N _2), (PM ₁ -N ₁₎ discloses a, which are shown in SEQ ID NOS: 3 to 5 . More specifically, a portion having a complementary characteristic in the unit sequence SEQ ID NOS: 3 to 5 is represented as follows. As can be seen below, N ₃ is complementary to M ₂ , N ₂ to M ₁ , and N ₁ to M ₃ , respectively.

That is, when the template DNA is amplified according to the present method, it is possible to obtain a polynucleotide which is repeated, such as pM ₃ -N ₃ -pM ₃ -N ₃ -pM ₃ -N ₃ , pM ₂ -N ₂ -pM ₂ -N _2- pM ₂ -N ₂ , pM ₁ -N ₁ -pM ₁ -N ₁ -pM ₁ -N ₁ to obtain a complementary amplification product to three unit sequences consisting of repeating polynucleotides .

The amplification product complementary to the thus obtained unit sequence contains a repeated primer recognition site, which contains a restriction enzyme recognition site sequence. Thus, the amplified polynucleotide sequences produced by the present methods are designed to contain the respective unit sequences by "restriction enzymes ", preferably endonuclease, that recognize and cleave specific restriction enzyme sites within the polynucleotide sequence Can be specifically cleaved and thus a large number of sequences truncated in sequence units complementary to the unit sequence can be obtained. In particular, it is preferred that the restriction enzyme of the present invention cleaves the cleaved polynucleotide sequence asymmetrically, and the amplified sequence group thus obtained is composed of a polynucleotide complementary to a unitary sequence having a sticky end, respectively .

When the cleaved sequence groups are mixed, the presence of mutually complementary sequences existing in each sequence causes self-assembly of the polynucleotide, and thus a DNA nanostructure can be formed.

The present invention also provides a method for mass-producing DNA nanostructures, which further comprises the step of binding an active agent to the DNA nanostructure.

The present invention also provides a DNA nanostructure for activator delivery produced by the above method.

The active agent can be loaded on the prepared DNA nanostructure and can be introduced into the cell by the nanostructure to thereby express the desired effect. However, siRNA and its chemical derivatives, oligonucleotides, Polynucleotides, small molecules, and drugs, and more preferably siRNA and its chemical derivatives, anticancer agents, contrast agents, etc., or drugs such as mitonafide, amonafide, bisnaphthalimide, Ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin, adriamycin, echinomycin, Benzimidazo [ 2-c] quinazoline and imidazodiquinolinium cation naphthalimides. The drug can be. Also particularly particularly preferred are doxorubicin and adriamycin.

In addition, the present invention provides _{1) (Pr-M k -N} k) to _{(Pr-M (Kn)} one to the K unit sequences represented by -N _(Kn)) DNA Riga handle azepin the distal end of the linked sequences Preparing a circular DNA template; 2) obtaining an amplified RNA product in which a circular DNA template is treated with an RNA polymerase to repeat a sequence complementary to the unit sequence of the template DNA; 3) adding a DNA helper sequence to the amplified RNA product to form a double strand of DNA / RNA; 4) cleaving the double strand of DNA / RNA with RNase H to obtain a sequence mixture complementary to the unit sequence; And 5) obtaining the RNA nanostructure by self assembly of the unit sequences in the amplified unit sequence complementary sequence mixture. (Herein, Pr is an RNA polymerase and kinase promoter sequence of the La recognizes the RNA polymerase to dehydratase, and M and N are 15 to 25nt long siRNA sequences, N _k is a sequence complementary to M _(k-1) and, N ₁ is M _k complementary K is an integer of 3? K? 90 or less, and n = {n | 1? N? K-1}

The Pr is a site recognized by the RNA polymerase and is preferably composed of an RNA polymerase promoter sequence. That is, when T-7 RNA polymerase is used as the RNA polymerase, it is preferable that the Pr region is a promoter sequence of T-7 RNA polymerase, and the RNA polymerase and the RNA polymerase Promoter sequences are well known to those of ordinary skill in the art.

One example of the present invention discloses a preferred RNA polymerase, T-7 RNA polymerase, and its promoter sequence is 5'-TAATACGACTCACTATAGGGAT-3 '. Such a sequence may be divided into a unitary sequence used in a mass production method of RNA nanostructure of the present invention, and the sequence may be composed of a sequence obtained by linking the unitary sequence with DNA ligase.

The K unit sequences represented by (Pr- _Mk - _Nk ) to (Pr-M _(Kn) -N _(Kn) ) of the present invention can be obtained by the action of DNA ligase, Lt; RTI ID = 0.0 > -OH < / RTI > The length of such a unitary sequence may be a nucleic acid sequence of 15 to 500 nt in length, preferably 20 to 300 nt, preferably 20 to 200 nt in length. Further, the unitary sequence of the present invention may be a single-stranded polynucleotide, more preferably a single-stranded DNA polynucleotide, but not limited thereto.

In addition, M and N of the present invention are preferably "siRNA sequences" of 15 to 25 nt in length, more preferably 18 nt to 25 nt in length, and when they are out of this length, . That is, since the unit sequence used in the mass production method of RNA of the present invention includes the siRNA sequence within the unit sequence, it is possible to mass-produce the structure including the siRNA in the polynucleotide itself produced through the direct transcription and amplification thereof , There is an advantage that it can be used as a direct siRNA transporter without performing a separate activator loading step.

As noted above, M and N are so preferred that the siRNA sequences, N _k is M _(K- 1) and a complementary sequence, N ₁ and _k is noted that M complementary sequences is N _k is M _{(K -1)} with one another the sense - and antisense sequence, N is ₁ and M _k each sense - means that the antisense sequence.

M and N, which can be used as such, are short sequences of siRNA molecules that, when delivered into cells, induce a decrease in mRNA levels that are complementary, thereby inhibiting the expression of specific genes, which may be effective in the treatment of genetic diseases such as cancer Anything that can be used without limitation. Examples of such siRNAs include EGFR-siRNA, anti-VEGF anti-GFP, anti-Luc, anti-EGF, anti-FVII, anti-ApoB and the like. Such exemplary siRNAs are well known in the art.

Examples of siRNAs that are easy to determine whether siRNA transcription, amplification, and nanostructure formation have been effectively performed include sense of RFP (red fluorescent protein), Luc (firefly luciferase) and GFP (green fluorescent protein) was used as the antisense siRNA sequences, such as Pr-M ₃ -N ₃ is Pr- sense RFP- sense Luc, Pr-M ₂ -N ₂ are Pr- antisense Luc- sense GFP and Pr-M ₁ -N ₁ is Pr- Antisense GFP-antisense RFP.

As is well known in the art, the polynucleotide represented by Pr, M, and N is a form in which a nucleotide is linked to a hydroxyl group at the 3 'end by a phosphodiester bond. M _k -N _k . In such a connection, any polynucleotide of short length may be inserted between the polynucleotides of P, M, and N as long as it does not interfere with the object of the present invention, which may be 1 to 20 nt, preferably 1 to 15 nt Preferably 1 to 10 nt.

Therefore, according to the mass production method of RNA of the present invention, the amplified RNA product in which the sequence complementary to the template DNA unit sequence is obtained by treating the RNA polymerase can be obtained. For example, when K is 5, _{-Pr-M 5 -N 5 -Pr-} M 4 -N 4 -Pr-M 3 -N 3 -Pr-M 2 -N 2 -Pr-M 1 complementary to the RNA sequences from the DNA template is represented by -N ₁ RTI ID = 0.0 > polynucleotide < / RTI > sequence amplified by repetitive transcription.

Also included in the unit sequence of the present invention is a sequence complementary to a RNA strand to be amplified, to which a DNA helper generating DNA / RNA binding can bind. These sequences are transcribed into RNA by RNA polymerase, and complementary DNA helper sequences can be ligated. Therefore, when a DNA helper is added to the amplified polynucleotide sequence transcribed so as to have a repetitive unit sequence, the DNA helper can bind to a specific recognition site present in the RNA sequence transcribed from the Pr sequence, DNA / RNA double strand is formed. In one example of the present invention, TAATACGACTCACTATAG consisting of 18 nt with a DNA helper that can be used is disclosed, but it is limited if it can form double strands of DNA / RNA specifically on the Pr sequence region on the transcribed and amplified RNA polynucleotide strand Can be used without.

The double strand of DNA / RNA thus formed may be a target of RNase H capable of specifically cleaving such double strand. When the DNA / RNA double strand is cleaved by RNase H, a single strand polynucleotide having a sequence complementary to the unit sequence A large amount of the mixture can be obtained.

The sequence mixture thus complementary to the amplified unit sequence can be formed into RNA nanostructures by the binding of complementary sequences present in the unit sequence.

Accordingly, the present invention provides an RNA nanostructure for activator delivery, which is produced by the above method.

The RNA nanostructure includes an siRNA sequence. Since the RNA nanostructure includes the siRNA sequence in the transcribed and amplified sequence, it is possible to deliver siRNA, which is an activator, into the cell without additional siRNA loading.

The present invention also provides an RNA nanostructure in which an activator is further bound to an RNA nanostructure produced by the above method.

The active agent may be loaded on the prepared RNA nanostructure and may be introduced into the cell by the nanostructure so as to express the desired effect. However, siRNA and its chemical derivatives, oligonucleotides, Polynucleotides, small molecules, and drugs, and more preferably siRNA and its chemical derivatives, anticancer agents, contrast agents, etc., or drugs such as mitonafide, amonafide, bisnaphthalimide, Ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin, adriamycin, echinomycin, Benzimidazo [ 2-c] quinazoline and imidazodiquinolinium cation naphthalimides. Cancer can be. Particularly preferred are doxorubicin and adriamycin.

In another aspect, the present invention _{1) (Pr-M k -N} k) to _{(Pr-M (Kn) -N} (Kn)) K of unit sequence to the kinase or DNA ligase treatment circligase K circular each represented by the following DNA Producing a mold; 2) treating each circular DNA template with an RNA polymerase to obtain a separate amplified RNA product in which the sequence complementary to the unit sequence of the template DNA is repeated; 3) adding DNA helper sequences to amplified RNA products to form DNA / RNA duplexes; And 4) cleaving the double strand of DNA / RNA with RNase H to obtain a sequence group complementary to the unit sequence; And 5) obtaining an RNA nanostructure by self-assembly of the sequence by mixing the amplified single sequence group, wherein the Pr is an RNA polymerase M and N are siRNA sequences of 15 to 25 nt in length, N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k , K is an integer equal to or less than 3? K? 90, and n = {n | 1? N? K-1}}.

According to the mass production method of the RNA nanostructure of the present invention, a total of K unit sequences can individually form a circular DNA template, which can be achieved by treatment of DNA ligase or circligase.

When such a circular DNA template is generated, the RNA sequence complementary to the DNA template by the RNA polymerase can be infinitely transcribed by RCA (rolling circle transcription) to generate an amplified sequence. For example, when K is 3 _{Pr-M 3 -N 3),} (PM 2 -N 2), (PM 3 or three amplified RNA product that is complementary to a sequence repeated for an individual sequence units of ₁ -N ₁₎ can be obtained.

DNA helper sequences may be added to the amplified RNA products to form double strands of DNA / RNA. If the DNA helper sequences are capable of forming RNA / DNA double bonds at the helper sequence recognition sites of the amplified RNA products, Can be used without restrictions.

When DNA / RNA double strand is formed as described above, it can be cleaved specifically by RNase H, so that a sequence complementary to a unit sequence can be obtained in a large amount. When a sequence complementary to the amplified unit sequence thus obtained in large quantities is mixed, self-assembly can be carried out using the complementarity of antisense and sense siRNAs present in each unit sequence, and the RNA nanostructure Can be obtained.

The present invention also provides RNA nanostructures for activator delivery produced by the above method. The RNA nanostructure includes an siRNA sequence. Since the RNA nanostructure includes the siRNA sequence in the transcribed and amplified sequence, it is possible to deliver siRNA, which is an activator, into the cell without additional siRNA loading.

The present invention also provides an RNA nanostructure in which an activator is further bound to an RNA nanostructure produced by the above method.

The active agent may be loaded on the prepared RNA nanostructure and may be introduced into the cell by the nanostructure so as to express the desired effect. However, siRNA and its chemical derivatives, oligonucleotides, Polynucleotides, small molecules, and drugs, and more preferably siRNA and its chemical derivatives, anticancer agents, contrast agents, etc., or drugs such as mitonafide, amonafide, bisnaphthalimide, Ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin, adriamycin, echinomycin, Benzimidazo [ 2-c] quinazoline and imidazodiquinolinium cation naphthalimides. It may be an anticancer drug. Also particularly particularly preferred are doxorubicin and adriamycin.

"DNA nanostructure" and "RNA nanostructure" according to the present invention can efficiently transfer the active material into cells by loading the sequence directly into the sequence or by including the activator such as siRNA directly into the sequence .

The present invention also provides a method for transferring an active agent into a DNA nanostructure prepared as described above, into a body or cells.

The present invention also provides a method for delivering the RNA nanostructure thus prepared into the body or cells.

The intracellular or intracellular delivery according to the present invention enables the active agent, preferably siRNA, to be efficiently delivered into cells, and silencing the target gene can achieve such goals as the treatment of diseases.

The numerical values set forth herein should be construed to cover equivalent ranges unless otherwise indicated.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples.

Example 1. Mass production method 1 of DNA nanostructure and its utilization

1.1 Preparation of circular DNA template strands

The sequence of a DNA single strand used as a template is shown in SEQ ID NO: 1. The template DNA strand is composed of 159 nucleotides and has a phosphate group at the 5 'end and an OH group at the 3' end in order to be linked in a circular form. The template DNA strands each contain a primer binding sequence and a restriction enzyme recognition site that the primer can recognize. More specifically, the sequence recognized by the primer in SEQ ID NO: 1 and the site recognized by the pstI restriction enzyme are shown in Table 1 below.

[Table 1]

In Table 1, a total of three primers can be bound to the underlined portion at the position where the primer binds, and the place recognized by the pstI restriction enzyme is shown in gray shade. In order to make the linear DNA template a circular DNA template, 40 pmole of DNA template and 120 pmol of primer (SEQ ID NO: 2) were mixed with 36 μL of 1x reaction buffer (50 mM Tris-HCl (pH 7.5), 10 mM MgCl ₂ , 10 mM DTT, (5 min) to 10 ° C at a rate of -1.5 ° C / s using a thermal cycler (Bio-Rad, T100 ™). (New England Biolabs, NEB) was added and incubated at 20 ° C for 12 hours to form a single-stranded DNA template as a circular template, which was a 5'-terminal phosphate and 3'-terminal OH group was formed while forming the phosphoric acid ester group, and then the enzyme was inactivated by heating at 0 ° C for 10 minutes, and the resulting product was used as a template for nucleic acid infinite replication reaction.

1.2 Infinite replication of nucleic acid using circular DNA template strand

The 5 μL circular DNA template strand prepared in 1.1 above was dissolved in 4 μL of 10 × reaction buffer (400 mM Tris-HCl (pH 7.5), 500 mM KCl, 100 mM MgCl ₂ , 50 mM (NH ₄ ) ₂ SO ₄ , DTT), 25 μL 25 mM dNTPs, 3 μL DEPC-treated deionized water and 3 μL RepliPHITM phi29 DNA polymerase (100 U / μL) (Epicenter Technologies Corporation, Madison). The mixture was incubated at 30 ° C for 18 hours to allow the enzyme to infinitely replicate complementary DNA strands from the circular DNA template strand. Amplification occurs from the 3 'end of each primer and repeats units complementary to the DNA template. The reaction was then terminated by heating at 80 ° C for 20 minutes.

1.3 Preparation of DNA nanostructures using position-specific cleavage and self-assembly

Site-specific cleavage was performed to obtain the desired strand in the synthesized DNA strand produced through the amplification process of 1.2 above. The site-specific cleavage was carried out by allowing the restriction enzyme to recognize and cleave restriction sites present in the cloned DNA sequence, and more specifically, the following. The synthesized DNA strand (40 μL) was mixed with 8 μL 10X NEBuffer 3 (500 mM Tris-HCl (pH 7.9), 100 mM MgCl ₂ , 1000 mM NaCl, and 10 mM DTT), 2 μL DEPC- mu] L PstI restriction enzyme (30 U / [mu] L) and incubated at 37 [deg.] C for 15 hours. PstI restriction enzyme recognizes 5'-CTGCAG-3 'at the restriction site (palindromic) in the amplified strand or between the strand and the restriction site inserted in the DNA template. A single stranded polynucleotide strand population consisting of three strands was generated. Such PstI restriction enzyme recognition can facilitate cleavage without additional helper strand. The enzyme was then inactivated by heating at 95 ° C for 10 minutes to gradually deactivate the enzyme at 95 ° C to 10 ° C at a rate of -0.5 ° C per minute so that the cleaved strands were self- And a Y-shaped DNA nanostructure having a 5'-overhang sticky end. Such a DNA nanostructure having a protruding adhesive end has an advantage of loading a sequence complementary to the corresponding exposed sequence region and a conjugate of a transferring material, and thus can be usefully used for the delivery of drugs such as siRNA. An example of such utilization is shown in Fig.

The DNA nanostructure production method is schematically illustrated in FIG.

1.4 Purification and identification of the prepared Y-form DNA nanostructures

For purification of the resulting Y-shaped DNA nanostructures, 25 μL of 10 × loading dye was added to a Y-shaped DNA nanostructure (80 μL), and the plate was washed with 1 × Tris-borate-EDTA (TBE) Buffer 10% polyacrylamide gel electrophoresis PAGE) in 10 wells. 150V for 30 minutes, then stained with SYBR® Gold (Invitrogen), and the gel image was confirmed with Gel Doc ™ EZ (Bio-Rad). In the image, only the gel portion corresponding to the position of the Y-shaped DNA nanostructure band was cut out and the gel was distributed to a small size of about 2x2 mm. The gel pieces were immersed in a gel tube and 2 ml of 1X phosphate buffer (PBS) in a 50 ml tube and allowed to stand in an oven (Thelco Laboratory oven, Precision Scientific) at 55 ° C for about 48 hours to obtain a Y- 1x PBS. The Y-DNA nanostructures were collected by centrifugation (eppendorf, centrifuge 5415 R) at 3500 rpm at 4 ° C in a 3,000 mw centrifuge filter (Amicon Ulatra, Ultracel®-3k) Remaining, the 1x PBS solvent exits the filter and is concentrated to about 60 μL. All of the eluate was centrifuged in the same centrifugal filter, and the remaining 60 μL of the remaining solution was stirred (GILSON®, GVLab®), inverted into a 1.5 ml ep tube, and centrifuged (Cole-Parmer, Personal Microcentrifuge). To obtain as many Y-shaped DNA nanostructures as possible, 2 ml of 1x PBS was added to the eluted gel, and the elution and concentration steps were repeated once more.

 All products were identified by 10% PAGE in 1 × Tris-borate-EDTA (TBE) buffer at room temperature. The gels were stained with SYBR® Gold (Invitrogen) and gel images were obtained with Gel Doc ™ EZ (Bio-Rad).

The results are shown in Fig.

As shown in Fig. 3, 10% PAGE analysis revealed that DNA synthesis and amplification occurred at each step of the reaction, and finally a Y-shaped DNA nanostructure was formed. In the lane 3, the Y-DNA / primer hybridization product was confirmed. In the lane 4, the position of the band moved upward due to the circular DNA template formed. In the lane 5, the amplification was performed. As a result, As shown in Fig. In lane 6, the cleaved / self-assembled product was identified. In particular, a band located at a position similar to the Y-DNA template strand of the lane 2 was confirmed to be the target Y-type amplified DNA.

In addition, AFM images and selective analysis were performed to analyze the morphology of self - assembled Y - shaped nanostructures. 1 μL AFM sample (1 μM) was dissolved in 30 μL buffer (40 mM HEPES-HCl (pH 7) and 10 mM NiCl ₂ ) and one slice of mica (Pelco Mica sheets, Ted Pella Corp.) He gave me. After 30 min incubation, the surface of mica was rinsed with DEPC-treated deionized water (DW) and immediately dried with nitrogen gas. Then, images were obtained using NC-NCH tip (Park Systems Corp. Korea) in non-contact mode of Park NX-10 ADM (Park Systems Corp. Korea).

The results are shown in Fig.

As shown in FIG. 4, both long-amplified single-stranded DNA amplification products and self-assembled Y-shaped nanostructures in the AFM image and selection analysis were clearly identified, and the Y- The formation of nanostructures was visually confirmed. Fig. 4a shows the product amplified by pI 29 DNA polymerase, and the height of the amplified strand was about 0.45 nm, confirming that the amplified product was a single strand. Fig. 4 (b) shows a Y-shaped DNA nanostructure formed by cleavage and self-assembly of the amplified product. The shape of dispersed nano-sized spheres was observed, and the measured height was about 1.04 nm, , That is, a double-stranded nucleic acid structure.

1.5. Identification of amplification index and Y-shaped nanostructure formation index

The strand amplified by the method of 1.2 above was obtained by ethanol precipitation. More specifically, the ethanol precipitation method is as follows. Transfer the amplified strand (40 μL) from the PCR tube to a 1.7 ml ep tube, add 100 μL 100% ethanol and 200 μL 5 mM ammonium acetate, and leave for 10 minutes in the freezer (-5 ° C.) Respectively. Centrifugation at 15000 rpm for 15 minutes at 4 ° C using a centrifuge (Eppendorf, 5415 R) results in a pallet submerged on the bottom. After removing the supernatant, the supernatant was removed and 500 μL of 70% ethanol was added. The supernatant was centrifuged at 15000 rpm for 10 minutes at 4 ° C without mixing. After removing the supernatant, the supernatant was removed and purged with nitrogen. The ethanol was blown to completely dry the amplified DNA precipitate.

The resulting precipitate was dissolved in 40 μL DEPC-treated DW. 1 μL of this solution was diluted 50 times and OD260 was measured at 1 cm path length. The result was 3.78. The extinction coefficient of the Y-form DNA template is 1,414,900 L / mole · cm, and the concentration of the amplified product based on the Beer-Lamber method is calculated as follows. OD260 (3.78) /Ext.Coefficient (1,414,900 L / mole.cm) x path length (1 cm) = 2.67 [mu] M. The final amount of product amplified was 5340 pmol (2.67 μM x 50 x 40 μL).

That is, it was confirmed that 1068-fold complementary DNA strands were amplified from the 5 pmole DNA template, and its amplification index was 1068. In order to quantify the yield of self-assembled Y-form DNA, a cut / self-assembly process was performed at 80 ° C using a 5340 pmole amplification product. When 1 μL (66.75 pmoles) was lowered to 10% PAGE, the intensity of the band expected to be Y-form DNA in the Image Lab software (Bio-Rad) was measured as 19.2%. The final yield of the Y-form DNA nanostructure from the 5 pmole Y-form DNA template was 1125.28 pmoles (66.75 pmole x 0.214 x 80). Therefore, its production index was 205.1.

As described above, DNAs having a number of amplifications of 1068 and a generation index of 205.1 were synthesized from a DNA template. Thus, it was confirmed that the DNA amplification method of the present invention is a very effective method for synthesizing a large amount of DNA at a high speed.

1.6 Application of prepared Y-type DNA nanostructure - Y-type DNA / FA-siRNA nanostructure

The gene silencing effect was confirmed by binding the purified Y-form DNA nanostructure prepared in Examples 1.1 to 1.4 with the siRNA-FA conjugate. The siRNA-FA conjugate can be prepared according to the method of "Ligand-Targeted Delivery of Small Interfering RNAs to Malignant Cells and Tissues (Oligonucleotide Therapeutics: Ann. NY Acad. Sci. 1175: 32-39 Respectively. The siRNAs used were sense GFP and antisense GFP siRNA, respectively.

- Antisense GFP siRNA:

rArArGrUrCrGrUrGrCrUrGrCrUrUrCrArUrGrUTTTGCAGCTACCTCGCCTTGAA

-Sense GFP siRNA: rArCrArUrGrArArGrCrArGrCrArCrGrArCrUrUTT

The prepared siRNA-FA conjugate was added to a 1: 3 molar ratio of Y-type DNA nanostructure and siRNA-FA conjugate in 1X phosphate buffered saline (PBS) for 2 hours at room temperature to obtain a Y-type DNA nanostructure A Y-form DNA / FA-siRNA nanostructure with FA-siRNA bound at the protruding sticky end was prepared. In order to confirm that the prepared Y-form DNA / FA-siRNA nanostructures can serve as a transporter to effectively deliver siRNA, its gene silencing effect was confirmed as follows.

Were cultured in RPMI medium (10% FBS, 1% Glutamax) free of folic acid for at least one week to overexpress folic acid reporter in GFP-overexpressed KB cells (GFP-KB cells). For confirmation of gene silencing effect, GFP-KB cells were plated on a 6-well culture plate at a concentration of 3.0 x 105 cells / well. After culturing for 24 hours, Y-type DNA / FA-siRNA nanostructured samples with siRNA binding to Y-type nanostructures were seeded onto normal growth medium containing 10% serum for 24 hours at 50 and 100 nM on the basis of siRNA Respectively. The GFP expression level of GFP-KB cells was measured by FACSCalibur system (BD biosciences) and the silencing effect of GFP gene was analyzed using flowJo program. Fluorescence images of cells treated with untreated cells (negative control) and Y-form DNA / FA-siRNA nanostructures (100 nM) were obtained on a Zeiss Axiovert 200 microscope (Carl Zeiss).

The results are shown in Fig.

As shown in Figure 5a, Y-type DNA / FA-siRNA nanostructures hybridized in lane 2 and Y-type DNA / FA-siRNA hybridized in lane 2 were identified by lane 1 and 10% PAGE analysis. Also, as can be seen in Figures 5b and 5c, in the experiment through GFP-KB cell infusion, only 100 nM of folic acid-siRNA without Y-form DNA nanostructures were transferred to the experimental group, which was not different from the negative control group without treatment However, Y-type DNA / FA-siRNA nanostructures loaded with folate-siRNA conjugate showed a concentration-dependent fluorescence reduction of 25% at 50 nM and 40% at 100 nM. This increases the local density of folic acid in the Y-shaped DNA / FA-siRNA nanostructures, thereby increasing the interaction with the folate receptors on the cell surface, thereby promoting siRNA delivery into the cell . According to the above-described results, the Y-shaped DNA nanostructure produced in the present invention can be loaded with a target substance such as siRNA by the protruding adhesive end formed according to the amplification process, thereby effectively transferring the target substance into the cell It is confirmed that this method can be used very usefully.

Example 2. Mass production method of DNA nanostructure 2.

The Y-DNA nanostructure amplification method of Example 1 was partially modified to prepare a Y-DNA nanostructure by DNA amplification. As a DNA template for amplification, unlike Example 1, a total of three DNA strands, i.e., Y1, Y2, and Y3, which were not single single strand DNAs, were used as templates, and the sequence information of the template used was as follows. Also, each template strand is shown in SEQ ID NOS: 3-5.

[Table 2]

The primer binding sites in the sequence are indicated by underlined letters, and the pstI restriction enzyme recognition sequence is indicated by shading. As can be seen from the above, each of the DNA template sequences Y1 to Y3 contains the restriction enzyme recognition site in the sequence.

The three template strands were amplified in the same manner as in Example 1, respectively, in separate tubes. Namely, for each of the sequences, a primer of SEQ ID NO: 2 was hybridized, and then a circular template was prepared using T4 DNA ligase in the same manner as in Example 1. Thereafter, amplification using pie 29 DNA polymerase was performed according to the method using the same reagents and conditions as in Example 1.2. DNA was amplified from the 3 'end of each primer and an amplification product was generated in which the unit complementary to the Y-DNA template was repeated. The restriction positions inserted in the DNA template between the amplified strand and the strand palindromic (5'-CTGCAG-3 ').

The process of recognizing and cutting the thus formed cross-section structure was performed in the same manner as in Example 1.3. A single-stranded polynucleotide population was generated in each tube by recognizing and cleaving restriction enzyme recognition sites of pstI, which is a population of polynucleotides for each of the Y1, Y2, and Y3 template sequences. Thus, unlike the method of Example 1, a population of Y1, Y2, Y3 polynucleotides generated without self-assembly between amplified single-stranded polynucleotides was purified in the same manner as in Example 1.4. The resulting three polynucleotides were mixed at the same molar concentration and hybridized to finally obtain a Y-shaped DNA nanostructure with 20 nt protruding sticky ends. A method for producing a Y-shaped DNA nanostructure by DNA amplification is shown in FIG.

In the amplification method using the three templates, there is no part forming a sequence bond in addition to the PstI recognition site in the circular template, so that the energy consumption in the amplification process by Pie 29 polymerase is reduced, The production efficiency of the Y-shaped DNA nanostructure can be ultimately increased.

2.2 Identification of the prepared Y-shaped DNA nanostructures

10% PAGE analysis was carried out in the same manner as in Example 1 to confirm whether the Y-form DNA nanostructures amplified by the method 2.1 actually formed a reaction product.

The results are shown in Fig. 7 and Fig.

As shown in FIG. 7, it was confirmed that a circular DNA was formed in the single stranded DNA template Y1, Y2, and Y3 as the reaction proceeded, and band changes were observed in both amplification and cleavage steps. After the cleavage process, it was found that the same DNA as the template was amplified through the appearance of a band formed at a position similar to the single stranded DNA template. In the result of FIG. 8 in which a Y-shaped DNA nanostructure was actually formed after hybridizing Y1, Y2, and Y3 by purifying an amplification product formed at a position similar to the single stranded DNA template identified in FIG. 7, Y1 + Y2 and Y2 + Y3, Y1 + Y3, and Y1 + Y2 + Y3. In particular, the positions of the bands representing Y-shaped DNA nanostructures hybridized with Y1 + Y2 + Y3 are the same as those of the single-stranded DNA template identified in Example 1 and the self-assembled Y-shaped nanostructures amplified therefrom, Template or amplified DNA. From the above results, it can be seen that the amplification of the target nucleic acid was effectively performed according to the method of Example 2.1.

Example 3 Mass Production of RNA Nanostructure Method 1

3.1 Preparation of circular DNA template strands

In order to mass-produce RNA, 68 nt units of S1, S2 and S3 strands were used as templates. Specific DNA unit sequences are shown in Table 3 below.

[Table 3]

(R: sense-RFP, R'-antisense-RFP, L: sense-Luc, L ': antisense-Luc, G: sense-GFP, G'-antisense-GFP, Pho:

The sequences S1, S2, and S3 are shown in SEQ ID NOS: 6 to 8, respectively. The positions where the primers bind are indicated by underlines, and sequences complementary to the amplified RNA strand sequences recognized by the 18 nt DNA helper Lt; / RTI > Among the used templates, S 1 represents Sense-RFP (R), Sense-Luc, (L), S 2 represents antisense-Lu (L ') and Sense- And RFP (R ') as an indicator sequence. The sequence of such a surface sequence is shown in Table 4 below.

[Table 4]

The DNA template for amplification is composed of three S1, S2, and S3 strands hybridized to each other to form a hairpin loop structure, and the specific form of the template and the sequence diagram thereof are shown in FIG. As shown in FIG. 9, a DNA template used as a template has three nicks, and a 5 'phosphate and 3'-OH terminus exists to form a circular form by T4 DNA ligase . In addition, the T7 promoter sequence was located in the loop portion formed, and the structure itself, in which the siRNA sequence was located in each of the three arm portions, was amplified without additional siRNA loading, was designed to function as an siRNA transporter . The manufacturing process of the specific product is as follows. First, 20 pmoles of three 68-nt single-stranded DNAs S1, S2 and S3 with phosphate groups and 30 pmoles of primers were added to 10 μl of 10x Buffer for T4 DNA Ligase with 10 mM ATP (500 mM Tris-HCl, pH 7.5, 100 mM MgCl ₂ , 100 mM DTT, and 10 mM ATP) and 13 μL DEPC-treated deionized water (DW) at 95 ° C for 2 minutes at a rate of -1.0 ° C / s using a thermal cycler (Bio- Rad T100 ™) To 10 < 0 > C to hybridize the three template strands with the primer. After hybridization, 1 μL of T4 DNA ligase (400 U / μL) is added and incubated in a thermal cycler at 25 ° C. for 1 hour to round out the linear template DNA. Heat the reaction at 65 ° C for 10 minutes to inactivate the enzyme and terminate the reaction. The product is used for the next nucleic acid infinite replication reaction.

3.2 Nucleic acid infinite transcription using circular DNA template strands

The 10 μL circular DNA template strand prepared in 3.1 was dissolved in 2 μL 10x RNAPol reaction buffer (400 mM Tris-HCl (pH 7.9), 60 mM MgCl 2, 20 mM spermidine, 100 mM DTT) rNTPs, 3 μL DEPC-treated deionized water (DW) and 2 μL T7 RNA polymerase (50 U / μL). The mixture was incubated in a thermal cycler for 1 hour at 37 ° C, allowing the T7 RNA polymerase to amplify RNA strands complementary to the circular DNA template strand from the 3 'end of the T7 promoter sequence located in the loop region of the template. Heat is then applied at 65 DEG C for 10 minutes to terminate the reaction.

3.3 Preparation of RNA Nanostructures by Site-Specific Cleavage and Self-Assembly

The amplified RNA amplification product (19 μL) was mixed with 3 μL 10X RNase H reaction buffer (750 mM KCl, 500 mM Tris-HCl (pH 8.3), 30 mM MgCl 2 and 100 mM DTT) and 5.5 μL DEPC- (DW). This mixture was sonicated for 3 minutes using an ultrasonic generator (BRANSON 5510) and then agitated (GILSON®, GVLab®) and spin down (Cole-Parmer, Personal Microcentrifuge) was repeated five times to release the amplified RNA strands so that the DNA helper sticks well. RNase H, which can recognize and cleave positions, is used instead of random cleavage to obtain a desired sequence by specifically cleaving RNA. RNase H recognizes and cleaves RNA / DNA strands, DNA helper was used for strand formation. The sequence of the DNA helper used is shown in SEQ ID NO: 10 and consists of TAATACGACTCACTATAG. The amplified RNA strand and DNA helper were hybridized by adding 50 pmole 18 nt DNA helper and decreasing the temperature from 95 ° C (2 min) to 10 ° C at a rate of -1.5 ° C / s with a thermal cycler. After hybridization, 1 μL RNase H (5 U / μL) was added and incubated in a thermal cycler at 37 ° C for 6 hours to cut RNA / DNA double stranded RNA strands. The cleaved RNA is divided into the initial S1, S2, and S3 units and forms a single-stranded polynucleotide pool. The enzyme was then inactivated by heating at 65 ° C for 20 minutes and the product was allowed to self-assemble between the truncated RNA strands by reducing the temperature from 95 ° C to 10 ° C at a rate of-1.5 ° C / min.

The process of forming the Y-shaped RNA nanostructure as described above is schematically illustrated in FIG. 10, and the respective parameters and conditions for the experimental steps used are summarized in Table 5 below.

[Table 5]

3.3 Purification and Identification of Y-shaped RNA Nanostructures Prepared

 The prepared Y-shaped RNA nanostructure was purified and confirmed. The gel was stained with GelRed ™ (Biotium) and gel image was obtained with Gel Doc ™ EZ (Bio-Rad) at room temperature. The gel was confirmed by 5% PAGE in 1 × Tris-borate-EDTA buffer solution. Other specific conditions and methods were the same as those used in Example 1.4.

The results are shown in Fig.

As shown in Fig. 11, it was confirmed that a Y-form DNA template to which S1 + S2 + S3 was linked was formed in lane 3, and Y-type RNA construct products were cleaved and self-assembled after RNase H treatment in lane 8 . In other words, it was confirmed that the generation of the template and the production of the final product according to the amplification method process were all performed as intended.

3.4 Identification of amplification index of Y type RNA nanostructure

Amplified strands from the product were obtained by precipitation with isopropanol. Specifically, 40 μL of the RCT product (40 μL) in the PCR tube was transferred to a 1.7 mL ep tube, and 40 μL of 5 mM ammonium acetate and 500 μL of isopropanol (99.8%) solution were added and left in the freezer (-5 ° C.) for 20 minutes Respectively. Centrifugation at 13000 rpm for 10 minutes at 4 ° C using a centrifuge (Eppendorf, 5415 R) results in a pallet submerged on the bottom. After removing the supernatant, the supernatant was removed and 500 μL of 70% ethanol was added. The supernatant was centrifuged at 13000 rpm for 10 minutes at 4 ° C without mixing. The supernatant was removed except for the precipitate, and the precipitate was completely dried for 15 minutes while centrifuging at 1500 rpm using a speed vacuum pump (Scanvac). The resulting precipitate was dissolved in 30 μL DEPC-treated DW. 1 μL of this solution was diluted 10 times and OD260 was measured by Nanodrop (IMPLEN) at 1 mm path length. The result was 2.193. The extinction coefficient of the amplified RNA was 2,653,200 L / mole · cm, and the concentration of the amplified product based on the Beer-Lamber method was calculated as follows. OD260 (2.193) /Ext.Coefficient (2,653,200 L / mole.cm) x path length (0.1 cm) = 8.26 [mu] M. The final amount of amplified product was 2,480 pmol (8.26 μM x 10 x 30 μL). These results indicate that 2480-fold complementary RNA strands were amplified from the 1 pmole DNA template. Therefore, the amplification index was 2,480.

These results indicate that Y-form RNA nanostructures containing siRNA can be efficiently transcribed and amplified from DNA templates using the method of the present invention.

Example 4. Mass production method of RNA nanostructure 2

The Y-RNA nanostructure amplification method of Example 3 was partially modified to prepare an amplified Y-RNA nanostructure.

Samples Nos. 6 to 8 were used as the DNA strands, namely, S1, S2, and S3 (total of three DNA strands), but these three sequences were complementary to Y- , But each of the sequences was subjected to a circular template to perform amplification of individual S1, S2 and S3 sequences and to hybridize them. More specifically:

4.1 Preparation of circular DNA template

The circular DNA template can be performed in either of two ways.

As a first method, a method using T4 DNA ligase was used. 20 pmole of 68 nt single stranded template DNA S1, S2, S3 with phosphate at the 5 'end and 20 pmole of the primer were added to 2 μl of 10x T4 DNA ligase buffer (500 mM Tris-HCl (pH 7.5), 100 mM MgCl2 (2 min) at a rate of -1.5 [deg.] C / s using a thermal cycler (Bio-Rad T100) on 14 μL DEPC-treated deionized water Deg.] C, and three template strands and primers were hybridized in PCR tubes, respectively. After hybridization, 1 μL of T4 DNA ligase (400 U / μL) was added and incubated in a thermal cycler at 25 ° C for 1 hour to produce linear template DNA. The enzyme was inactivated by heating at 65 ° C for 10 minutes.

As a second method, Circligase ™ ssDNA ligase was used. 20 pmole of 68 nt single stranded DNA template S1, S2, S3 with phosphate at the 5 'end was added to 2 μL CircLigase ™ 10X reaction buffer (0.5 M MOPS (pH 7.5), 0.1 M KCl, 50 mM MgCl ₂ , and 10 mM DTT), 1 μL of CircLigase ™ ssDNA ligase (100 U / μL) was added to 1 μL 1 mM ATP, 1 μL of 50 mM MnCl ₂ and 14 μL of DEPC-treated deionized water (DW) Lt; / RTI > for 1 hour to round the single stranded DNA template. Heat the enzyme at 80 ° C for 10 min to inactivate the enzyme.

To remove the unreacted linear DNA strand and use only the circular DNA template for subsequent reactions, 10 μL of the resulting circular template was mixed with 2 μL 10x exonuclease I reaction buffer (670 mM Glycine-KOH (pH 9.5), 67 mM MgCl ₂ , 100 mM 2-mercaptoethanol), 7 μL DEPC-treated deionized water (DW) and 1 μL exonuclease I (20 U / μL). This mixture was incubated in a thermal cycler at 37 ° C for 1 hour to break down linear DNA strands that were not circular. Then, the reaction was terminated by heating at 80 ° C for 20 minutes to remove the linear DNA, leaving only a circular DNA template.

4.2 Nucleic acid infinite transcription of circular DNA template strands

The 10 μL circular DNA template strand produced by the method using T4 DNA ligase was digested with 2 μL of 10 × RNAPol reaction buffer (400 mM Tris-HCl (pH 7.9), 60 mM MgCl 2, 20 mM spermidine, and 100 mM DTT), 2 μL 25 mM rNTPs, 3 μL DEPC-treated deionized water (DW) and 3 μL T7 RNA polymerase (50 U / μL).

5 pmole primer (SEQ ID NO: 10) was added to 5 pmole of the 10 μL circular DNA template strand produced by the method using Circligase ™ ssDNA ligase, followed by hybridization with 2 μL of 10x RNAPol reaction buffer (400 mM Tris-HCl pH 7.9), 60 mM MgCl2, 20 mM spermidine, and 100 mM DTT), 2 μL 25 mM rNTPs, 2.5 μL DEPC-treated deionized water (DW) and 3 μL T7 RNA polymerase ). A mixture of the circular DNA template and the T7 RNA polymerase was incubated in a thermal cycler at 37 ° C for 3 hours, and a T7 RNA polymerase was ligated from the 3 'end of the primer with a RNA strand complementary to the circular DNA template strand Amplified. This process was performed by a rolling circle transcription (RCT) method. Heat is then applied at 65 DEG C for 10 minutes to terminate the reaction.

4.3 Preparation of RNA nanostructures using position-specific cleavage and self-assembly

RCA product (19 μL) was mixed with 3 μL 10X RNase H reaction buffer (750 mM KCl, 500 mM Tris-HCl (pH 8.3), 30 mM MgCl ₂ and 100 mM DTT) and 4 μL DEPC-treated deionized water ). Sonication was performed for 3 minutes using an ultrasonic generator (BRANSON 5510) and vortex (GILSON®, GVLab®) and spin down (Cole-Parmer, Personal Microcentrifuge) Repeatedly, the amplified RNA strands were loosened so that the DNA helper sticks well. The amplified RNA strand and DNA helper were then hybridized by adding 300 pmole 18 nt DNA helper and decreasing the temperature from 95 ° C (2 min) to 10 ° C at a rate of -1.5 ° C / s with a thermal cycler. Then, RNase H (5 U / μL) is added and incubated in a thermal cycler at 37 ° C for 10 hours to cut RNA strands in the RNA / DNA double strand. The RNA strands amplified by this cleavage were first cleaved into the template units S1, S2, S3, forming a single stranded polynucleotide population. After that, heat is applied at 65 ° C for 20 minutes to inactivate the enzyme. The truncated strand products were hybridized at a volume ratio of 1: 1: 1 in 0.5 μL and 8.5 μL in 1 × phosphate buffer (PBS) at a rate of 1.5 ° C./min to reduce the temperature from 95 ° C. to 10 ° C., Respectively.

The above Y-shaped RNA nanostructure amplification method is schematically illustrated in FIG. 12 (circligase) and FIG. 12 (T4 DNA ligase), and experimental parameters and conditions used for each step are summarized in Table 6 below.

[Table 6]

4.4 Purification and Identification of Y RNA Nanostructures

10% PAGE analysis was performed to confirm that Y RNA nanostructures were formed according to the method of the present invention. This was confirmed by 1 × Tris-borate-EDTA (TBE) buffers 10% PAGE at room temperature. The gel was stained with GelRed ™ (Biotium) and images were obtained with Gel Doc ™ EZ (Bio-Rad). Other specific conditions and methods were the same as those used in Example 1.4.

The results are shown in Fig.

13 shows the reaction process according to the method (A) for producing a template using T4 ligase and the method (B) for producing a template using circligase, respectively. As can be seen from FIG. 14A, the formation of a circular DNA template by circularization is confirmed in the corresponding lanes, and it is confirmed that RNA strands corresponding to S1, S2, and S3 DNA templates are amplified and formed do. It was also confirmed that each truncated RNA strand forms a band of cS1 + cS2 + cS3, which is a hybridized form of S1, S2, S3 cut through hybridization. Similarly, as can be seen from FIG. 14B, it was confirmed that a band of cS1 + cS2 + cS3 was finally formed also in the method using circligase.

Example  5. Mass production method of RNA nanostructure 3 - 2'-O-methyl DNA Helpers  Method for mass production of RNA nanostructure using

Y-shaped RNA nanostructures were produced in large quantities. Uses a T7 RNA polymerase that is the same as Examples 3 and 4 One, was used for 2 '-O-methyl DNA helper is a difference.

5.1 Preparation of circular DNA template strands

198 nt single stranded DNA was used as a template for mass production of RNA. The specific DNA sequences, primers and 9 nt helper are shown in Table 7 below.

[Table 7]

(R: sense-RFP, R'-antisense-RFP, L: sense-Luc, L ': antisense-Luc, G: sense-GFP, G'-antisense-GFP, Pho:

The 198 nt single stranded DNA and primer with phosphate at the 5 'end were purchased from Integrated DNA Technologies, IDT, and the 9nt helper was purchased from Bioneer Corporation.

The positions at which the primers bind are underlined and the sequence complementary to the amplified RNA strand sequences recognized by the 9 nt DNA helper is shaded. The portion indicated in bold in the 9nt DNA helper corresponds to the 2'-O-methylated portion. The template used was an antisense-RFP (R '), a sense-GFP (G), an antisense-GFP (G'), a sense-Luc (L), an antisense- . The sequence of such an indicator sequence is the same as that shown in Table 3 above.

T4 DNA ligase, T7 RNA polymerase, Pyrophosphatase, and RNase H were purchased from New England Biolabs (NEB).

80 pmole of the 198 nt single-stranded template and 240 pmole of the primer were mixed with 2 μL of 10 × buffer and 10 mM ATP (500 mM Tris-HCl (pH 7.5), 100 mM MgCl ₂ , 100 mM DTT, and 10 μL of T4 DNA ligase The temperature was decreased from 95 ° C (2 min) to 10 ° C at a rate of -1.0 ° C / s using a thermal cycler (Bio-Rad T100 ™) on a single-stranded template (ATP-ATP) to hybridize the single-stranded template with the primer. After hybridization, 2 μL of T4 DNA ligase (50 U / μL) was added and incubated in a thermal cycler at 25 ° C for 1 hour to form linear template DNA. The reaction was terminated by inactivating the enzyme by heating at 65 ° C for 10 minutes.

5.2 Circular DNA Mold strand  Nucleic acid infinite transcription process

2 μL DNA template strand round the 2 μL RNAPol 10x reaction buffer (400 mM Tris-HCl (pH 7.9), 60 mM MgCl 2, 20 mM Fermi's Dean, and 100 mM DTT), 0.8 μ25 mM rNTPs, 10.4 μL DEPC- Treated DW, 0.8 μL pyrophosphatase (0.1 U / μL) and 4 μL T7 RNA polymerase (50 U / μL). The mixture was incubated in a thermal cycler at 37 ° C for 18 hours to amplify RNA strands complementary to circular DNA template strands from the 3 'end of the T7 RNA polymerase primer. The reaction was then terminated by inactivating the enzyme by heating at 65 DEG C for 10 minutes.

5.3 DNaseI  DNA by treatment Mold strand  remove

If the DNA template strand is not removed, the DNA template strand acts as a helper in the RNaseH treatment step, and the amplified RNA may be destroyed.

RCA product (20 μL) was mixed with 4 μl 10 DNase I buffer (100 mM Tris-HCl, 25 mM MgCl ₂ and 5 mM CaCl ₂ ), 15 μL DEPC-treated deionized water (DW) and 1 μDNaseI . This mixture was incubated in a thermal cycler at 37 ° C for 1 hour, allowing DNase I to digest DNA template strands. The reaction was then terminated by inactivating the enzyme by heating at 65 DEG C for 10 minutes.

5.4 9nt  2'-O- methyl helper Hybridization  And RNase  Self-assembly after cutting by H

DNaseI product (40 μL) was added to 8 μl 10 RNase H reaction buffer (750 mM KCl, 500 mM Tris-HCl (pH 8.3), 30 mM MgCl ₂ , and 100 mM DTT), 0.2 μL 9nt 2'- 6 μL RNase H (5 U / μL) was added to the mixture and incubated in a thermal cycler at 37 ° C for 18 hours to obtain RNA / DNA duplex The RNA was then heat-inactivated at 65 ° C for 20 min to inactivate the enzyme, and the product was incubated with the cleaved RNA strands by reducing the temperature from 95 ° C to 10 ° C at a rate of-1.5 ° C / min Self-assembly.

The above-described Y-shaped RNA nanostructure amplification method is illustrated in FIG. 14, and experimental variables and conditions used for each step are summarized in Table 8 below.

[Table 8]

As shown in Fig. 14, the method is the same as the method of Example 3 (see Fig. 10), but the used DNA helper is different. The 2'-O-methyl DNA helper used in the above method can hybridize more stably with the RNA strand because the 2'-O-methyl substituted portion is not truncated by RNaseH. In this method, a 9 nt DNA helper (5'- TAA TAC GAC- 3, bolded methylated portion) was used, and a DNA helper of 12 nt or 18 nt in length could also be used.

5.5 Purification and identification of Y-shaped RNA nanostructures

10% PAGE analysis was performed to confirm that Y-form RNA nanostructures were formed according to the method of the present invention. This was confirmed by 1 × Tris-borate-EDTA (TBE) buffers 10% PAGE at room temperature. The gel was stained with GelRed ™ (Biotium) and images were obtained with Gel Doc ™ EZ (Bio-Rad). Other specific conditions and methods were the same as those used in Example 1.4.

The results are shown in Fig.

In Fig. 15, L on the left side represents a ladder, and lane 1 represents a primer. Lane 2 represents a DNA template, lane 3 represents a hybridization of a DNA template and a primer, and lane 4 represents a hybridization of a circularized DNA template and a primer. That is, when the ligation is performed and circularized, the position of the band moves slightly upward. Lane 5 represents an RCA product in which the amplified RCA product does not migrate evenly over the gel and hangs on the well and exhibits this pattern. Lane 6 shows the RCA product after cleavage and self-assembly. The bands of the nucleic acid nanostructures produced by the method of the present invention are bands at a position similar to the DNA template in lane 2 .

5.6 Identification of gene silencing effects of Y-shaped RNA nanostructures

GFP-overexpressed KB cells (GFP-KB cells) were cultured in RPMI medium (10% FBS, 1% penicillin / streptomycin, 1% Glutamax) without folic acid. The GFP-KB cells were dispensed in 6-well concentration of 3.0 × 10 on a culture plate ⁵ cells / well. After incubation for 24 hours, 10 nM of the Y-RNA nanostructures produced in 5.5 were mixed with lipofectamine RNAiMAX in the normal growth medium containing 10% serum, and treated for 24 hours , And the positive control group was treated with double-stranded GFP siRNA for 24 hours after complexing with lipofectamine RNAiMAX.

The GFP expression level of GFP-KB cells was measured by FACSCalibur system (BD biosciences), and the silencing effect of GFP gene was analyzed using flowJo program.

The results are shown in Fig. As a result of the positive control group on the left side of FIG. 16, it can be seen that a silencing effect of about 63% is exhibited for GFP. The right side of FIG. 16 is the result for the experimental group, showing a silencing effect of about 27%.

<110> Ewha University - Industry Collaboration Foundation <120> Method for mass production of nucleic acid nanostructure and use          that in drug delivery systems <130> P14-091-REA-EWHA <150> KR 10-2014-0142589 <151> 2014-10-21 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 159 <212> DNA <213> Artificial Sequence <220> <223> DNA template <400> 1 gctacctcgc cttgaagcct acatcgtcac ggcgggcggg caaggcccct gcagctacct 60 cgccttgaag ccttgcccgc ccgcgcgccc cggaaaggcc cctgcagcta cctcgccttg 120 aagcctttcc ggggcgccgt gacgatgtag gcccctgca 159 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ttcaaggcga ggtagctgca ggg 23 <210> 3 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> DNA template Y1 <400> 3 gctacctcgc cttgaagcct acatcgtcac ggcgggcggg caaggcccct gca 53 <210> 4 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> DNA template Y2 <400> 4 gctacctcgc cttgaagcct tgcccgcccg cgcgccccgg aaaggcccct gca 53 <210> 5 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> DNA template Y3 <400> 5 gctacctcgc cttgaagcct ttccggggcg ccgtgacgat gtaggcccct gca 53 <210> 6 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> DNA template S1 <400> 6 ctatagggat tgtagatgga cttgaactct tcgtgaaaac gctgggcgtt aatcaataat 60 acgactca 68 <210> 7 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> DNA template S2 <400> 7 ctatagggat ttgattaacg cccagcgttt tcacaaaaca tgaagcagca cgactttaat 60 acgactca 68 <210> 8 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> DNA template S3 <400> 8 ctatagggat aagtcgtgct gcttcatgtt ttgcgaagag ttcaagtcca tctacataat 60 acgactca 68 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 atccctatag tgagtcgtat ta 22 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> helper <400> 10 taatacgact cactatag 18

Claims (32)

1) A polynucleotide to which K unit sequences represented by (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) are ligated is treated with an DNA ligase to form a circular DNA template Producing;
2) treating the circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to the unit sequence is repeated;
3) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain an amplified sequence group; And
4) obtaining a DNA nanostructure through self assembly of the amplified sequence group; and mass-producing the DNA nanostructure.
(Wherein P is a primer binding sequence comprising a restriction enzyme recognition site,
M and N are single stranded DNA sequences 3 to 300 nt in length,
N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k ,
K is an integer of 3? K? 90 or less,
n = {n | 1? N? K-1}}) The method of claim 1, wherein the DNA polymerase is selected from the group consisting of Bst DNA polymerase, exonuclease minus, Tth DNA polymerase, PyroPhage TM 3173 DNA polymerase, BcaBEST DNA polymerase, Phi) 29 DNA polymerase, wherein the DNA nanostructure is at least one selected from the group consisting of DNA polymerase and DNA polymerase. The method according to claim 1, wherein the restriction enzyme recognition site in step 3) is palindromic. The method according to claim 1, wherein the restriction enzyme is selected from the group consisting of BamHI, HindIII, EcoRI, EcoRII, TaqI, NotI, Sau3AI, PvuII, SmaI, HaeIII, HgaI, EcoRV, KpnI, EcoP15I, AluI, XbaI, StuI, SphI, SpeI, ScaI, SalI, SacI, KpnI, EcoP15I, and PstI. The method according to claim 1, further comprising: 5) binding the DNA nanostructure with an active agent. A DNA nanostructure having a sticky end made by the method of any one of claims 1 to 4. A DNA nanostructure for the delivery of an activator produced by the method of claim 5. 8. The DNA nanostructure of claim 7, wherein the activator is at least one selected from the group consisting of siRNA and its chemical derivatives, oligonucleotides, polynucleotides, small molecules, and drugs. 9. The method of claim 8, wherein the drug is selected from the group consisting of mitonafide, amonafide, bisnaphthalimide, ellipticine, 9-methoxyellipticine, Ditercalinium daunomycin, ametantrone, mitoxantrone, doxorubicin wherein the at least one anticancer agent is selected from the group consisting of doxorubicin, adriamycin, echinomycin, benzimidazo [1,2-c] quinazoline, and imidazodiquinolinium cation naphthalimides. 1) preparing K circular DNA templates with the ends of the sequence connected by treating each of K unit sequences represented by (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) with DNA ligase ;
2) treating the circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to the unit sequence is repeated;
3) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain K amplified sequence groups; And
4) mixing the K groups, and obtaining a DNA nanostructure through self assembly of the sequence; and mass production of the DNA nanostructure.
(Wherein P is a primer binding sequence comprising a restriction enzyme recognition site,
M and N are single stranded DNA sequences 3 to 300 nt in length,
N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k ,
K is an integer of 3? K? 90 or less,
n = {n | 1? N? K-1}}) 11. The method of mass production of a DNA nanostructure according to claim 10, further comprising the step of binding the DNA nanostructure of step (5) with an activator. 12. The DNA nanostructure for activator delivery according to claim 10. 13. The DNA nanostructure according to claim 12, wherein the activator is at least one selected from the group consisting of siRNA and its chemical derivatives, oligonucleotides, polynucleotides, small molecules and drugs. 1) A K DNA unit represented by (Pr-M _k -N _k ) to (Pr-M _(Kn) -N _(Kn) ) is treated with an DNA ligase to form a circular DNA template Producing;
2) obtaining an amplified RNA product in which a circular DNA template is treated with an RNA polymerase to repeat a sequence complementary to the unit sequence of the template DNA;
3) adding a DNA helper sequence to the amplified RNA product to form a double strand of DNA / RNA;
4) cleaving the double strand of DNA / RNA with RNase H to obtain a sequence mixture complementary to the unit sequence; And
5) amplifying the amplified unit sequence to obtain an RNA nanostructure through self assembly of the unit sequences in the complementary sequence mixture; and mass-producing the RNA nanostructure.
(Wherein Pr is a promoter sequence of an RNA polymerase recognized by an RNA polymerase,
M and N are siRNA sequences of 15 to 25 nt in length,
N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k ,
K is an integer of 3? K? 90 or less,
n = {n | 1? N? K-1}}) 15. The method according to claim 14, wherein the RNA polymerase is a T7-RNA polymerase. 14. An RNA nanostructure for activator delivery produced by the method of claim 14. 17. The RNA nanostructure according to claim 16, characterized in that the siRNA sequence is included. 17. The RNA nanostructure of claim 16, wherein the activator is further bound. 19. The method of claim 18, wherein the active agent is selected from the group consisting of mitonafide, amonafide, bisnaphthalimide, ellipticine, 9-methoxyellipticine, But are not limited to, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin, adriamycin, echinomycin, Which is one or more anticancer agents selected from the group consisting of [1,2-c] quinazoline and imidazodiquinolinium cation naphthalimides. Nanostructures. _{1) (Pr-M k -N} k) to _{(Pr-M (Kn)} by the K unit sequences each represented by -N _(Kn)) DNA Riga handle kinase or circligase for producing a circular DNA template K step;
2) treating each circular DNA template with an RNA polymerase to obtain a separate amplified RNA product in which the sequence complementary to the unit sequence of the template DNA is repeated;
3) adding DNA helper sequences to amplified RNA products to form DNA / RNA duplexes;
4) cleaving the double strand of DNA / RNA with RNase H to obtain a sequence group complementary to the unit sequence; And
And 5) obtaining a RNA nanostructure by self-assembly of the sequence by mixing the amplified single sequence group to mass-produce the RNA nanostructure.
(Wherein Pr is a promoter sequence of an RNA polymerase recognized by an RNA polymerase,
M and N are siRNA sequences of 15 to 25 nt in length,
N _k is a sequence complementary to M _(K-1) , N _{1 is} a sequence complementary to M _k ,
K is an integer of 3? K? 90 or less,
n = {n | 1? N? K-1}}) 20. An RNA nanostructure for activator delivery produced by the method of claim 20. 22. The RNA nanostructure of claim 21, wherein the activator is further conjugated. 21. The method of claim 20, wherein the DNA helper is 2'-O-methylated with one to six nucleotides each from the 3'end and the 5'end.
1) (P-first part - second part) is ligated with an DNA ligase to form a circular DNA having the 5 'end and the 3' end of the polynucleotide linked to each other Producing a mold;
2) treating the circular DNA template with a DNA polymerase to obtain an amplification product by RCA (Rolling Circle Amplification);
3) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain an amplified sequence group; And
4) obtaining a DNA nanostructure through self assembly of the amplified sequence group; and mass-producing the DNA nanostructure.
(Wherein P is a primer binding sequence comprising a restriction enzyme recognition site,
The second portion of any one of the unit sequences other than the first unit sequence located at the 3 'end of the polynucleotide is complementary to the first portion of the other unit sequence linked to the 3' end of the unit sequence , The second portion of the first unit sequence located at the 3 'end of the polynucleotide is complementary to the first portion of the first unit sequence located at the 5' end of the polynucleotide,
The first and second portions of each unit sequence are single stranded DNA sequences 3 to 300 nt in length,
K is an integer equal to or smaller than 3? K?
1) (P-first part-second part) are treated with DNA ligase to prepare K circular DNA templates each having a 5 'end and a 3' end linked to each unit sequence step;
2) treating each of the circular DNA templates with DNA polymerase to obtain an amplified product by RCA (Rolling Circle Amplification);
3) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain amplified K sequence groups; And
4) mixing the K sequence groups and obtaining DNA nanostructures through self assembly of the sequences.
(Wherein P is a primer binding sequence comprising a restriction enzyme recognition site,
The second portion of any one unitary sequence is complementary to the first portion of the other unitary sequence,
The first and second portions of each unit sequence are single stranded DNA sequences 3 to 300 nt in length,
K is an integer equal to or smaller than 3? K?
1) (P - first part - second part) and combining the complementary parts with each other to produce K DNA nicks;
2) treating the DNA template with an DNA ligase to prepare a circular DNA template having nicks connected thereto;
3) treating the circular DNA template with a DNA polymerase to obtain an amplified product by RCA (Rolling Circle Amplification);
4) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain an amplified sequence group; And
5) obtaining a DNA nanostructure through self assembly of the amplified sequence group; and mass production of the DNA nanostructure.
(Wherein P is a primer binding sequence comprising a restriction enzyme recognition site,
The second portion of any one unitary sequence is complementary to the first portion of the other unitary sequence,
The first and second portions of each unit sequence are single stranded DNA sequences 3 to 300 nt in length,
K is an integer equal to or smaller than 3? K? 1) (Pr - first part - second part) is ligated with an DNA ligase to prepare a circular DNA (SEQ ID NO: 2) linked with the 5 'end and the 3' end of the polynucleotide Producing a mold;
2) treating the circular DNA template with RNA polymerase to obtain an amplified RNA product by RCA (Rolling Circle Amplification);
3) adding a DNA helper sequence to the amplified RNA product to form double strands of DNA / RNA;
4) cleaving the double strand of DNA / RNA with RNase H to obtain an amplified sequence group; And
5) obtaining an RNA nanostructure through self assembly of the amplified sequence group; and mass-producing the RNA nanostructure.
(Wherein the nucleic acid is DNA or RNA,
Pr is a promoter sequence of an RNA polymerase recognized by an RNA polymerase,
The second portion of any one of the unit sequences other than the first unit sequence located at the 3 'end of the polynucleotide is complementary to the first portion of the other unit sequence linked to the 3' end of the unit sequence , The second portion of the first unit sequence located at the 3 'end of the polynucleotide is complementary to the first portion of the first unit sequence located at the 5' end of the polynucleotide,
The first and second portions of each unit sequence are single stranded DNA sequences 3 to 300 nt in length,
K is an integer equal to or smaller than 3? K?
1) (Pr-first part-second part) are treated with DNA ligase to prepare K circular DNA templates each having a 5 'terminal and a 3' terminal terminal connected to each other step;
2) treating each of the circular DNA templates with RNA polymerase to obtain an amplified RNA product by RCA (Rolling Circle Amplification);
3) adding a DNA helper sequence to the amplified RNA product to form double strands of DNA / RNA;
4) cleaving DNA / RNA double strand with RNase H to obtain amplified K sequence groups; And
5) mixing the K sequence groups and obtaining RNA nanostructures through self-assembly of the sequences; and mass production of the RNA nanostructures.
(Pr is a promoter sequence of an RNA polymerase recognized by an RNA polymerase,
The second portion of any one unitary sequence is complementary to the first portion of the other unitary sequence,
The first and second portions of each unit sequence are single stranded DNA sequences 3 to 300 nt in length,
K is an integer equal to or smaller than 3? K?
1) (Pr - first part - second part) and combining the complementary parts with each other to produce K DNA nicks;
2) treating the DNA template with an DNA ligase to prepare a circular DNA template having nicks connected thereto;
2) treating the circular DNA template with RNA polymerase to obtain an amplified RNA product by RCA (Rolling Circle Amplification);
3) adding a DNA helper sequence to the amplified RNA product to form double strands of DNA / RNA;
4) cleaving the double strand of DNA / RNA with RNase H to obtain an amplified sequence group; And
5) obtaining an RNA nanostructure through self assembly of the amplified sequence group; and mass-producing the RNA nanostructure.
(Wherein Pr is a promoter sequence of an RNA polymerase recognized by an RNA polymerase,
The second portion of any one unitary sequence is complementary to the first portion of the other unitary sequence,
The first and second portions of each unit sequence are single stranded DNA sequences 3 to 300 nt in length,
K is an integer equal to or smaller than 3? K?
A nucleic acid nanostructure having K branches extending radially,
Each branch comprising a double-stranded nucleic acid,
A nucleic acid nanostructure in which a single stranded nucleic acid is present at each branch end.
(The nucleic acid is DNA or RNA,
Each branch is 3 to 300 nt long,
K is an integer equal to or smaller than 3? K?
31. The method of claim 30, wherein K is 3,
Wherein the nucleic acid nanostructure is a Y-shaped nanostructure.
31. The nanostructure of claim 30, wherein the active agent is bound to 1 to K of the single-stranded nucleic acid.

Images