KR101866968B1 - Method for mass production of nucleic acid nanostructure and use thereof in drug delivery systems - Google Patents

Abstract

The present invention relates to a method for mass production of DNA or RNA nucleic acid nanostructures and to the use of nucleic acid nanostructures prepared by such a method for activating nucleic acid nanostructures. According to the mass production method of the DNA nanostructure or RNA nanostructure of the present invention, since the cleavage site exists in the amplification template, the desired nucleic acid can be mass-produced at a high efficiency through the site-specific cleavage, Or it is possible to directly produce a nanostructure capable of delivering siRNA by directly including the desired siRNA sequence in the template. Therefore, efficient nucleic acid amplification can be achieved, mass production of nucleic acid nanostructures, and delivery of the active agent into cells Can be used effectively.

Description

[Method for mass production of nucleic acid nanostructure and use thereof in drug delivery systems]

The present invention relates to a method for mass-producing DNA or RNA nucleic acid nanostructures, and to utilization of the nucleic acid nanostructures produced by such a method as a drug delivery system.

Nucleic acid, which has been recognized as a genome that stores and transmits biological genetic information, has recently been recognized for its potential as a functional biopolymer based on the self-assembly property by the complementary sequence of nucleic acids. Research is being conducted in various technical fields, such as making sophisticated structures. Nucleic acid nanostructures produced in this way are not only prepared in the manufacture of nanostructures themselves, but are also a research field with great potential because they have the potential to be applied to various fields such as treatment, medical diagnosis, criminal medicine, and environmental fields.

The only enzyme required in bacteriophage pi 29 to replicate the genome is its DNA polymerase, a 66KDa monomeric protein that can catalyze both the replication initiation and elongation of the synthesized strand. For initiation, this polymerase binds to a protein known as the "terminal" (TP), recognizes the end of the Pi 29 DNA and catalyzes the formation of the TP-dAMP covalent complex. After polymerization of 10 nucleotides, the DNA polymerase/TP heterodimer is dissociated, and the strand from the DNA is stretched. Replicative DNA polymerases require interaction with enzymes and accessory proteins that stabilize the binding between DNA (Kuriyan and O'Donnell. J Mol Biol. 1993; 234: 915-925). Meanwhile, since the DNA polymerases require functional association with helicase-type proteins, they need to be linked to the polymerization when separating non-replicating DNA strands. In this sense, the DNA polymerase of the bacteriophage PI 29 has various unique functional characteristics that make it unique, that is, high processability, high strand resolution, and high accuracy.

All of these features have led to the development of a wide variety of isothermal (ie, constant temperature) protocols for amplifying double-stranded DNA (dsDNA) based on the use of this polymerase. In a simple structure, the ability of the PI 29 DNA polymerase to use circular single-stranded DNA (ssDNA) enables amplification of DNA by a rolling circle method (or RCA-rolling circle amplification), It allows the production of long single-stranded DNA molecules. However, in spite of such reports on DNA amplification methods, there is a continuing demand for the development of technologies that enable effective amplification of nucleic acids starting from a smaller amount of nucleic acids, and in particular, amplifying and utilizing nucleic acids with specific functionality quickly and accurately. There is.

In particular, in the case of certain diseases, as it is known that the disease can be effectively treated by RNA interference, there are attempts to treat cancer and various genetic diseases using siRNA, and a nucleic acid construct for delivery that has a function to effectively deliver it. There is an attempt to The discovery of RNA interference (RNAi) has opened the way to completely new fields in biology and pharmaceuticals. RNAi's ability to specifically silence target genes is not only a new tool for basic research, but has resulted in initiatives for the development of RNAi-based drugs. RNAi targets the mRNA through sequence-specific binding, resulting in the degradation of the target mRNA or inhibiting its translation, leading to loss of protein expression. This is achieved pharmaceutically through the introduction of small 19-21 bp dsRNA molecules called small interfering RNA (siRNA). From this discovery ten years ago, siRNA has been extensively studied in vitro for its use in the treatment of a variety of diseases such as cancer, neurodegenerative and infectious diseases.

However, in the disease treatment method using siRNA, the limitation of being able to effectively deliver siRNA in vivo due to its relatively large molecular weight (eg, 13 kDa) and polyanionic characteristics (eg, 40 negatively charged phosphate) continues. Has been a problem. Naked siRNAs cannot freely pass through cell membranes, and unmodified naked siRNAs are relatively unstable in blood and serum because they are rapidly degraded by endonucleases or exonucleases. The problem of having a half-life has also been reported, and in order to solve this problem, a method of performing a chemical modification to improve biological stability without negatively affecting the gene-silent activity has been reported. Or, alternatively, it can be formulated as a delivery system that not only improves cell uptake, but also provides biological stability. Several chemical modifications to the backbone, base or sugar of RNA have been used to improve siRNA stability and activity. However, in such a delivery system, the need for facilitating the access of siRNA to the site of action in the cell continues to be a problem.

In order to solve this problem, a method of using cationic particles to ensure effective interaction between negatively charged siRNA nucleotides and particles and to promote their entry into cells has been studied. However, when siRNA is delivered systemically of these cationic particles, it has been reported that there is a problem that the delivery of these particles to the site of interest cannot be effectively performed due to rapid ingestion by the reticuloendothelial organ. .

Accordingly, studies on nanocarriers for loading and delivery of siRNA were attempted. However, the number of clinically relevant nanocarriers used for this purpose is scarce, the main obstacles still remain unresolved, and the problem of their effective delivery, especially via parenteral route administration, still remains. siRNA represents a class of hydrophilic bio-polymers that most require the application of suitable nanocarriers to exploit their full therapeutic potential.

Therefore, there is still a need for research on a method that can effectively deliver small molecules, that is, drugs or siRNA, into cells to treat genetic diseases such as cancer, and research on the most efficient drug delivery constructs to effectively deliver them is urgently required. Has become.

The inventors of the present invention are studying nucleic acid nanostructures for effective delivery of active agents into cells, and in the case of amplifying DNA or RNA using DNA having a specific sequence as a template, DNA or RNA nanostructures are highly modified by the self-assembly properties of nucleic acids. It can be obtained by amplification with high efficiency, and it has been found that it can be used for delivery of active agents, and the present invention is completed.

Accordingly, an object of the present invention is to obtain a template DNA amplification product in which a sequence complementary to the unit sequence is repeated by preparing a specific unit sequence as a circular template, and to produce a large amount of cloned DNA nanostructures through its cleavage and self-assembly process. It is to provide a method for mass production of nanostructures.

It is also an object of the present invention to provide a DNA nanostructure for delivery of an active agent having an adhesive end made by the above method.

In addition, an object of the present invention is to obtain a template DNA amplification product in which a sequence complementary to the unit sequence is repeated by preparing a plurality of specific unit sequences into a circular template, and amplifying them, and cutting and mixing them to self-assemble to mass-produce DNA nanostructures. Is to provide a way to do it.

It is also an object of the present invention to provide a DNA nanostructure for delivery of an active agent made by the above method.

In addition, it is an object of the present invention to prepare a plurality of specific unit sequences as a single circular DNA template and transcribe them with RNA polymerase to obtain an amplified RNA product in which a sequence complementary to the template DNA unit sequence is repeated, and cut and self-assemble it. It is to provide a method for mass-producing RNA nanostructures.

It is also an object of the present invention to provide an RNA nanostructure for delivery of an active agent made by the above method.

In addition, an object of the present invention is to prepare a plurality of unit sequences having a specific unit sequence into a plurality of circular DNA templates, respectively, and transcribed them with RNA polymerase to obtain an individual amplified RNA product in which the template DNA unit sequence and the complementary sequence are repeated. It is to provide a method for mass-producing RNA nanostructures by cutting them and mixing them to self-assemble.

It is also an object of the present invention to provide an RNA nanostructure for delivery of an active agent made by the above method.

In order to achieve the above object, the present invention 1) (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) one polynucleotide to which the K unit sequences are linked is treated with DNA ligase Thereby preparing a circular DNA template to which the ends of the sequence are linked; 2) treating a circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to a unit sequence is repeated; 3) cutting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain an amplified sequence group; And 4) obtaining a DNA nanostructure through self-assembly of the amplified sequence group; provides a method for mass-producing a DNA nanostructure comprising (wherein P is a primer binding including a restriction enzyme recognition site) Sequence, M and N is a single-stranded DNA sequence of 3 to 300 nt in length, N _k is a sequence that is complementary to _{M (K-1) , N 1} is _{a sequence that is complementary to M k,} and K is 3 ≤ K ≤ It is an integer of 90 or less, n={n| 1≤n≤k-1}}).

More specifically, for the polynucleotide of the method, in'(PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) one polynucleotide to which K unit sequences are linked' _k -N _k ), (PM _(Kn) -N _(Kn) ) refer to each unit sequence, and each unit sequence is'P (primer binding sequence, including a restriction enzyme recognition site inside)- It can be expressed as a first part-a second part. In the polynucleotide, the second part of any one unit sequence excluding the unit sequence located first from the 3'end is complementary to the first part of the other unit sequence linked to the 3'end of the unit sequence, and In the polynucleotide, the second portion of the unit sequence positioned first from the 3'end is complementary to the first portion of the unit sequence positioned first from the 5'end of the polynucleotide. The polynucleotide is a single-stranded structure in which K unit sequences having the configuration of'P-first part-second part' are linked (K is an integer of 3≦K≦90). It can be a polynucleotide.

In addition, in the above method, when the'circular DNA template' is described in more detail, it means that the 5'end and the 3'end are connected to each other by treating the polynucleotide of the method with DNA ligase. However, since there are sequence portions that are complementary to each other in the polynucleotide, the sequence portions that are complementary to each other are combined in a circle as described in the upper left of FIG. 2.

In addition, in the present invention, the DNA polymerase is Bst DNA polymerase, exonuclease minus, Tth DNA polymerase, fatigue phage (PyroPhage TM) 3173 DNA polymerase, BcaBEST DNA polymerase and Pi (Phi) 29 Provides a method for mass-producing DNA nanostructures, which is one or more selected from the group consisting of DNA polymerases.

In addition, the present invention provides a method for mass-producing DNA nanostructures in which the restriction enzyme recognition site is palindromic.

In addition, in the present invention, the restriction enzymes are BamHI, HindIII, EcoRI, EcoRII, TaqI, NotI, Sau3AI, PvuII, SmaI, HaeIII, HgaI, EcoRV, KpnI, EcoP15I, AluI, XbaI, StuI, SphI, SpeI, ScaI, SalI, It provides a method for mass-producing DNA nanostructures, one or more selected from the group consisting of SacI, KpnI, EcoP15I and PstI.

In addition, the present invention provides a method for mass production of a DNA nanostructure further comprising: 5) binding an active agent to the DNA nanostructure in the mass production method.

In addition, the present invention provides a DNA nanostructure having an adhesive end made by the mass production method of the DNA nanostructure.

The structure of the DNA nanostructure will be described in more detail as follows. Since the second part of one unit sequence in the DNA nanostructure is complementary to the first part of the other unit sequence, the resulting nucleic acid has the same number of double-stranded nucleic acid branches as the number of unit sequences. It has a shape that extends from one point in the center (that is, a shape that extends outwardly like a spider web or spokes in two or three dimensions at a point in the center). In addition, the P portion present in each unit sequence exists as a single-stranded nucleic acid at each branch end of the prepared nucleic acid nanostructure, and this portion acts as a sticky end to which other active agents can be attached. RNA nanostructures prepared by a method of preparing a DNA nanostructure using each of the K unit sequences described below as a template, or a method of preparing an RNA nanostructure using each of a polynucleotide or each of the K unit sequences as a template. Likewise, double-stranded nucleic acid branches of the same number as the number of unit sequences have a shape that extends radially, and a single-stranded nucleic acid that can act as an adhesive end at the end of each branch exists.

As an embodiment of the present invention, when K is 3, that is, when a nucleic acid nanostructure is produced using one polynucleotide to which three unit sequences are linked, the produced nucleic acid nanostructure forms a Y shape. The nucleic acid can be DNA or RNA.

In addition, the present invention provides a DNA nanostructure for delivery of an active agent made by the above method.

In addition, the present invention provides a DNA nanostructure to which the active agent is bound, wherein the active agent is at least one selected from the group consisting of siRNA and chemical derivatives thereof, oligonucleotides, polynucleotides, small molecules, and drugs.

In addition, in the present invention, the drugs are mitonafide, amonafide, bisnaphthalimide, ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin ( Doxorubicin), adriamycin, echinomycin, Benzimidazo[1,2-c]quinazoline and imidazodiquinolinium cation naphthalimides. . In addition, particularly most preferred examples may be doxorubicin and adriamycin.

In addition, the present invention is 1) (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) by treating each of the K unit sequences represented by DNA ligase to connect the end of the sequence K circular DNA template Manufacturing a; 2) treating a circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to a unit sequence is repeated; 3) cutting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain a group of amplified K sequences; And 4) mixing K populations and obtaining a DNA nanostructure through self-assembly between sequences; providing a method for mass production of a DNA nanostructure comprising (wherein P is a restriction enzyme recognition site Is a primer binding sequence including, M and N is a single-stranded DNA sequence of 3 to 300 nt in length, N _k is a sequence complementary to _{M (K-1) , N 1} is a sequence complementary to _{M k, and K is} It is an integer of 3≤K≤90, n={n| 1≤n≤k-1}}).

More specifically, the method is not using one polynucleotide to which K unit sequences are linked, but to prepare a circular template using each of the K unit sequences. Each unit sequence such as (PM _k -N _k ), (PM _(Kn) -N _(Kn) ) is'P (primer binding sequence, including a restriction enzyme recognition site inside)-first part-agent 2 parts', and the second part of one unit sequence is complementary to the first part of the other unit sequence. In this way, when each unit sequence becomes a circular template, the energy consumed to release the bond by the DNA polymerase is relatively reduced because it does not form a complementary bond inside at the template stage, and the DNA nanostructure is produced with higher efficiency. There is an advantage that it can be. In addition, in some cases, there is an advantage that it may be more economical to synthesize and use each short unit sequence than to synthesize one long polynucleotide.

In addition, the present invention comprises the steps of preparing a DNA template having K nicks by mixing K unit sequences represented by (P-first part-second part) to bind complementary parts to each other;

2) A circular DNA template may be prepared by treating the DNA template with DNA ligase to prepare a circular DNA template to which each nick is linked. The following steps can be performed by amplifying through RCA and digesting with restriction enzymes, as described above.

In addition, the present invention provides a method for mass-producing a DNA nanostructure further comprising: binding an active agent to the DNA nanostructure of step 5).

In addition, the present invention provides a DNA nanostructure for delivery of an active agent made by the above method.

In addition, the present invention provides a DNA nanostructure to which the active agent is bound, wherein the active agent is at least one selected from the group consisting of siRNA and chemical derivatives thereof, oligonucleotides, polynucleotides, small molecules, and drugs.

In addition, the present invention is 1) (Pr-M _k -N _k ) to (Pr-M _(Kn) -N _(Kn) ) by treating the DNA ligase to the K unit sequences represented by one end of the sequence is linked Preparing a circular DNA template; 2) treating a circular DNA template with an RNA polymerase to obtain an amplified RNA product in which a sequence complementary to a unit sequence of the template DNA is repeated; 3) forming a DNA/RNA double strand by adding a DNA helper sequence to the amplified RNA product; 4) cutting the DNA/RNA double strand with RNase H to obtain a sequence mixture complementary to the unit sequence; And 5) obtaining an RNA nanostructure through self-assembly between unit sequences in a sequence mixture that is complementary to the amplified unit sequence; The promoter sequence of RNA polymerase recognized by polymerase, M and N are siRNA sequences of 15 to 25 nt in length, N _k is a sequence complementary to _{M (K-1), and N 1} is complementary to M _k Is a typical sequence, and K is an integer of 3≦K≦90 or less, n={n| 1≦n≦k-1}}).

As an embodiment of the present invention, the DNA helper may be a 2'-O-methylated 1 to 6 nucleotides from the 3'end and the 5'end.

As described above _{, (Pr-M k} -N _k ) and (Pr-M _(Kn) -N _(Kn) ) refer to the respective unit sequences. It can also be expressed as a promoter sequence)-first part-second part'. As described above, the second part of one unit sequence is complementary to the first part of the other unit sequence.

One circular DNA template in which the end of the sequence is linked by treating DNA ligase to the K unit sequences represented by'(Pr-M _k -N _k ) to (Pr-M _(Kn) -N _{(Kn)) in the above.} In more detail, the complementary parts between unit sequences bind to each other to form a template with K nicks, and the nicks are linked to each other by DNA ligase treatment to form a single circular DNA template. It means achieving.

In the present invention, each of the K unit sequences is treated with DNA ligase to prepare K circular DNA templates, amplified with RCA for each circular DNA template, and then mixed with the amplified sequence population to self-assemble RNA nanoparticles. Provides a way to produce structures. In addition to preparing K circular DNA templates, amplifying each with RCA, and preparing a sequence population, a specific method can be carried out as described above.

In addition, the present invention provides a method for mass-producing RNA nanostructures, wherein the RNA polymerase is a T7-RNA polymerase.

In addition, the present invention provides an RNA nanostructure for delivery of an active agent made by the above method.

In addition, the present invention provides an RNA nanostructure, characterized in that the siRNA sequence is included.

In addition, the present invention provides an RNA nanostructure in which an active agent is further bound to the RNA nanostructure.

In the present invention, the active agents are mitonafide, amonafide, bisnaphthalimide, ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin ( doxorubicin), adriamycin, echinomycin, Benzimidazo[1,2-c]quinazoline, and at least one anticancer agent selected from the group consisting of imidazodiquinolinium cation naphthalimides, RNA nanostructures.

In addition, the present invention is 1) (Pr-M _k -N _k ) to (Pr-M _(Kn) -N _(Kn) ) by treating each of the K unit sequences represented by DNA ligase or circligase to K circular DNA Preparing a mold; 2) treating each circular DNA template with an RNA polymerase to obtain an individual amplified RNA product in which the unit sequence and the complementary sequence of the template DNA are repeated; 3) forming a DNA/RNA double strand by adding a DNA helper sequence to each of the amplified RNA products; And 4) cutting the DNA/RNA double strand with RNase H to obtain a sequence group complementary to the unit sequence; And 5) mixing the amplified single sequence population to obtain an RNA nanostructure through self-assembly between sequences; (wherein Pr is an RNA polymerase Is the promoter sequence of the RNA polymerase recognized by M and N is a 15 to 25 nt long siRNA sequence, N _k is a sequence complementary to _{M (K-1), and N 1} is a sequence complementary to _{M k} , K is an integer of 3≤K≤90 or less, n={n| 1≤n≤k-1}}).

_{(Pr-M k} -N _k ), (Pr-M _(Kn) -N _(Kn) ), meaning each unit sequence, can also be expressed as'Pr-first part-second part' as described above. have. As described above, the second part of one unit sequence is complementary to the first part of the other unit sequence.

In addition, the present invention provides an RNA nanostructure for delivery of an active agent made by the above method.

In addition, the present invention provides an RNA nanostructure in which an active agent is further bound to the RNA nanostructure.

According to the mass production method of DNA nanostructures or RNA nanostructures of the present invention, the presence of a cleavage site in the amplification template enables mass production of nanostructures based on desired nucleic acids with high efficiency through site-specific cleavage, and uses this Thus, the desired activator can be easily delivered into cells, or a nanostructure capable of siRNA delivery can be directly produced by including the desired siRNA sequence in a template, thus achieving efficient nucleic acid amplification to mass-produce nucleic acid nanostructures. , It can be usefully used to deliver the active agent into the cell.

1 is a diagram showing an example of loading siRNA into a protruding adhesive end and utilizing it as a drug delivery system.
2 is a schematic diagram showing a method of amplifying a Y-type DNA nanostructure through a single-stranded DNA template.
3 is a diagram showing the results of confirming the products produced in each step of the mass production method through 10% PAGE (L: DNA ladder, 1: primer, 2: Y-DNA template, 3: hybridized Y-DNA/primer Product, 4: circular Y-DNA template, 5: RCA product, 6: cleaved/self-assembled product, 7: purified Y-DNA product)
4 is a diagram showing the result of confirming the Y-shaped nanostructure generated using an AFM image
(a: RCA product; top: single-stranded DNA amplified and extended by PI 29 DNA polymerase, bottom: amplified strand and single-stranded nucleic acid height comparison / b: self-assembled Y-shaped nanostructure; top: Nano-sized spheres dispersed through the cutting/connecting process, bottom: double strands by checking height).
5A is a diagram showing the results of confirming the Y-type DNA/FA-siRNA nanostructure through 10% PAGE analysis (L: DNA ladder, 1: Y-DNA nanostructure, 2: Y-DNA structure conjugated FA -siRNA hybridization).
5B is a diagram showing the result of confirming the gene silencing effect of the gene delivery system through GFP-KB cell infection.
5C is a diagram showing the result of confirming the gene silencing effect through a fluorescence microscope after culturing GFP-KB cells and Y-FA-siRNA.
6 is a diagram schematically showing a method of amplifying a Y-type DNA nanostructure through three single-stranded DNA templates.
7 is a diagram showing the results of confirming the products produced in each step of the mass production method through 10% PAGE analysis (L: DNA ladder).
8 is a diagram showing the results of confirming the formation of Y-type DNA nanostructures through Y1 to Y3 hybridization.
9 is a schematic diagram of a DNA template and its sequence.
10 is a diagram schematically showing a process of mass-producing a Y-type RNA nanostructure through a single-stranded DNA template.
11 is a diagram showing the results of confirming the products produced in each step of the mass production method through 5% PAGE analysis (L: DNA ladder, 1: S1, 2: S1 + S2, 3: Y DNA template (S1 + S2 +S3), 4: primer, 5: hybridized Y-DNA/primer product, 6: circular Y-DNA template, 7: RCT product, 8; cleaved strand after 18 nt DNA helper hybridization and RNase treatment, Y-RNA construct)
Figure 12 is a schematic diagram showing a method for mass-producing Y-type RNA nanostructures through three single-stranded DNA templates, Figure 12a is a method using Circligase, Figure 12b is a diagram showing a method using T4 DNA ligase to be.
13 is a diagram showing the results of confirming the products produced in each step of the mass production method through 5% PAGE analysis (A: ligase, B: circligase).
14 is a diagram schematically showing a process of mass-producing a Y-type RNA nanostructure through a single-stranded DNA template, and a diagram showing the use of a 2'-O-methylated DNA helper.
15 is a diagram showing the results of confirming the products produced in each step of the mass production method through 10% PAGE analysis.
16 is a diagram showing the results of confirming the gene silencing effect through Flow Cytometry after processing GFP-KB cells and Y-type RNA nanostructures.

In the present invention, 1) (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) One polynucleotide to which the K unit sequences are linked is treated with DNA ligase to connect the ends of the sequence Preparing a DNA template; 2) treating a circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to a unit sequence is repeated; 3) cutting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain an amplified sequence group; And 4) obtaining a DNA nanostructure through self-assembly of the amplified sequence group; providing a method for mass production of a DNA nanostructure comprising (wherein P is a primer binding including a restriction enzyme recognition site) Sequence, M and N is a single-stranded DNA sequence of 3 to 300 nt in length, N _k is a sequence that is complementary to _{M (K-1) , N 1} is _{a sequence that is complementary to M k,} and K is 3 ≤ K ≤ It is an integer of 90 or less, n={n| 1≤n≤k-1}}).

According to the mass production method of the present invention, not only can the DNA and RNA nanostructures be mass-produced with high efficiency, but also the desired unit sequence can be obtained through a simple method due to the presence of a cleavage sequence inside the nanostructure, or siRNA inside the nanostructure. By including the sequence itself, there is an excellence in producing siRNA carriers with high efficiency without a separate loading process.

The "unit sequence" of the present invention refers to a sequence that repeatedly appears in the process of infinite replication or transcription of a nucleic acid, and may be a nucleic acid sequence of 3 to 500 nt in length, preferably 9 to 300 nt, preferably a nucleic acid of 9 to 200 nt in length It can be a sequence. In addition, the unit sequence of the present invention is not limited thereto, but may be preferably a single-stranded polynucleotide, more preferably a single-stranded DNA polynucleotide.

The unit sequence of the present invention is capable of infinite replication or transcription until the reaction is stopped through the infinite replication or transcription process of the nucleic acid, and the replication sequence of the unit sequence unit or a transcription sequence complementary thereto through the cleavage process in the replicated or transcribed template This can be obtained in large quantities.

The unit sequence in the mass production method of the DNA nanostructure may be expressed as _{"(PM k} -N _k ) to (PM _(Kn) -N _{(Kn) )".}

Here, P is a primer binding sequence containing an endonuclease restriction enzyme recognition site, and a primer of a sequence complementary thereto recognizes and binds the primer binding sequence, thereby allowing the 3'OH end and 5'-phosphate of the unit sequence. The ends can be located close to each other, which can then help to be linked by DNA ligase. The length of such a primer binding sequence may be used without limitation as long as it includes a restriction enzyme recognition site and can fulfill the role described above, but may be exemplarily 6 to 40 nt, preferably 12 nt to 30 nt. In an embodiment of the present invention, a sequence recognized by a primer represented by'TTCAAGGCGAGGTAGCTGCAGGG (SEQ ID NO: 2)' as an exemplary primer sequence is included in the unit sequence. It can be seen that the primer sequence of SEQ ID NO: 2 contains the CTGCAG sequence, which is a restriction enzyme recognition site.

The unit sequence "(PM _k -N _k ) to (PM _(Kn) -N _(Kn) )" in the above method is preferably in the form of a linear polynucleotide strand in which all unit sequences are linked into one, and the DNA nano In the process of manufacturing the structure, the 5'phosphate end and the 3'OH end can be connected to form a single-connected circular template.

In addition, in the "(PM _k -N _k ) to (PM _(Kn) -N _(Kn) )" of the unit sequence, M and N are most preferably linear single-stranded DNA polynucleotides, and M and N are 3 to It may be a polynucleotide of 300 nt length, preferably 6 to 200 nt long, more preferably 6 to 100 nt long.

Polynucleotides represented by P, M, and N are in a form in which a nucleotide is linked to a hydroxyl group at the 3'end by a phosphodiester bond, as is well known in the art, and such linkage is in the specification of the present invention, for example PM _k It is expressed as _{-N k.} In such a linkage, any nucleotide of a short length may also be inserted between the polynucleotides of P, M, and N as long as the object of the present invention is not impaired.

In the unit sequence, N _k is a sequence complementary to _{M (K-1), and N 1} is a sequence complementary to _{M k.} Illustratively, when K is 5, N ₅ may be M ₄ , N ₄ may be M ₃ , N ₃ may be M ₂ , N ₂ may be M ₁ and N ₁ may be a sequence complementary to M _5, When K is 4, it means that N ₄ may be a sequence complementary to M ₃ , N ₃ to M ₂ , N ₂ to M ₁ , and N ₁ to M _4.

In the present invention, the "complementary sequence" is a complementary sequence of 60 to 100% in addition to the 100% complementary sequence, preferably 80% to 100% complementary sequence, further It may include those consisting of preferably 90 to 100% complementary sequence, even more preferably 95% to 100% of the complementary sequence.

In an embodiment of the present invention, when K=3, N ₃ is M ₂ , N ₂ is M ₁ , and N ₁ is one polynucleotide in which three unit sequences having a sequence complementary to _{M 3 are linked to each other.} And is represented by the 159 nt long polynucleotide sequence of SEQ ID NO: 1.

When the polynucleotide sequence of SEQ ID NO: 1 is expressed as a unit sequence, it can be expressed as pho-M ₃ -N ₃ -M ₂ -N ₂ -M ₁ -N ₁ as follows. That is, it is preferable that one polynucleotide in which the unit sequences are linked to each other is a polynucleotide that is aligned in descending order of K and linked into one.

Such complementary sequences can be combined by recognizing mutually complementary sequences when preparing template DNA by linking the 5'end and the 3'end, and through this, a template having a specific shape, such as a Y-shaped template, is formed. You can do it.

The "DNA polymerase" may be used without limitation as long as it can produce a template DNA amplification product in which the unit sequence is repeated from a DNA template, and preferably Bst DNA polymerase, exonuclease minus , Tth DNA polymerase, pyrophage (PyroPhage TM) 3173 DNA polymerase, BcaBEST DNA polymerase and Pi (Phi) 29 may be one or more selected from the group consisting of DNA polymerase, more preferably pi (Phi) 29 It may be a DNA polymerase. The Phi 29 DNA polymerase enables amplification of DNA by a rolling circle method (or RCA-rolling circle amplification) using a circular single-stranded DNA template, and the unit sequence is It can produce repeating long length single-stranded DNA molecules.

In addition, in the present invention, it is preferable that the "restriction enzyme recognition site" formed in the DNA amplification product forms a palindromic structure. The term "palindromic structure" refers to the same structure even if the nucleotide sequence on the DNA molecule is read from either the right or the left. This restriction enzyme recognition site is repetitively present in the amplified sequence by the restriction enzyme sequence site included in the primer sequence of the unit sequence, and is recognized by the restriction enzyme to enable precise position-specific cleavage in unit sequence units. Let's do it. The presence of such a restriction enzyme recognition site has the advantage of being able to obtain a desired unit sequence simply by treatment with a restriction enzyme.

In addition, in the present invention, the "restriction enzyme" is preferably an endonuclease that recognizes and cuts a specific restriction enzyme site inside the polynucleotide sequence. Also preferably among the endonucleases BamHI, HindIII, EcoRI, EcoRII, TaqI, NotI, Sau3AI, PvuII, SmaI, HaeIII, HgaI, EcoRV, KpnI, EcoP15I, AluI, XbaI, StuI, SphI, SpeI, ScaI, SalI , SacI, KpnI, EcoP15I, and may be one or more selected from the group consisting of PstI, and PstI is used as a preferred example in the present invention. Restriction enzyme recognition sequences recognized and cleaved by the endonuclease are known in the art, and can be easily derived by those skilled in the art.

The restriction enzyme recognizes and specifically cuts a restriction enzyme recognition site in an amplified long polynucleotide sequence that repeatedly contains a unit sequence, and thus, a large amount of a sequence cut in units of unit sequence can be obtained. In particular, it is preferable that the restriction enzyme of the present invention asymmetrically cleaves the cleaved polynucleotide sequence, and the amplified unit sequence group thus obtained may consist of a unit sequence polynucleotide having a sticky end, respectively. .

In addition, the present invention provides a method for mass-producing a DNA nanostructure further comprising the step of binding an active agent to the DNA nanostructure prepared by the mass production method.

Since the unit sequence group obtained by amplification and cleavage through the method of the present invention is composed of a unit sequence polynucleotide having a sticky end, there is an advantage that the active agent can be easily loaded at the adhesive end portion. .

Accordingly, the present invention provides a DNA nanostructure to which an active agent is bonded made by the above method.

In the present invention, the "active agent" may be loaded onto the made DNA nanostructure, and may be included without limitation as long as it is a material capable of expressing the desired effect thereof by being delivered into cells by the nanostructure, but preferably siRNA and its It may be one or more selected from the group consisting of chemical derivatives, oligonucleotides, polynucleotides, small molecules and drugs, more preferably siRNA and chemical derivatives thereof, drugs such as anticancer agents, contrast agents, etc., such as mitonafide, amonafide, bisnaphthalate Imide, ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin, adriamycin, echinomycin ), Benzimidazo[1,2-c]quinazoline, imidazodiquinolinium cation naphthalimides, etc., and the active agent that can be loaded and delivered in this way is "Intercalators as Anticancer Drugs (A. Ramos et al., Current Pharmaceutical Design, 2001, 7) , 1745-1780)", and examples of drugs that can be loaded into nanostructures as such may be incorporated herein by reference in their entirety.

In addition, the present invention is 1) (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) by treating each of the K unit sequences represented by DNA ligase to connect the end of the sequence K circular DNA template Manufacturing a; 2) treating a circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to a unit sequence is repeated; 3) cutting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain a group of amplified K sequences; And 4) mixing K populations and obtaining a DNA nanostructure through self-assembly between sequences; providing a method for mass production of a DNA nanostructure comprising (wherein P is a restriction enzyme recognition site Is a primer binding sequence including, M and N is a single-stranded DNA sequence of 3 to 300 nt in length, N _k is a sequence complementary to _{M (K-1) , N 1} is a sequence complementary to _{M k, and K is} It is an integer of 3≤K≤90, n={n| 1≤n≤k-1}}).

In the mass production method of the DNA nanostructure, K unit sequences are individually prepared as K circular DNA templates to mass-produce DNA nanostructures, so that the complementary sequences present in the individual unit sequences are complementary in the DNA template step. It does not form, and thus has a characteristic that there is no part forming a bond except for the restriction enzyme recognition site. Therefore, there is an advantage that the energy consumed for uncoupling the DNA polymerase is relatively reduced, and thus DNA nanostructures can be produced with higher efficiency.

Each of the K unit sequences is connected by a primer and a DNA ligase that binds the end of the sequence to the primer recognition site of the sequence to be prepared into K circular DNA templates, which are individually amplified to a unit sequence (PM _k -N _k ) To (PM _(Kn) -N _(Kn) ) may be repeated within each amplification sequence.

In the present invention, for example, when K is 5, (PM ₅ -N ₅ ), (PM ₄ -N ₄ ), (PM ₃ -N ₃ ), (PM ₂ -N ₂ ), (PM ₁ -N ₁ ) Five individual unit sequences of can be used, which can individually form a circular DNA template to form a total of five types of DNA templates. In addition, when K=4, 4 individual unit sequences of _{(PM 4} -N ₄ ), (PM ₃ -N ₃ ), (PM ₂ -N ₂ ), (PM ₁ -N _{1) can be used,} This can form a total of 4 types of DNA templates. Therefore, each unit sequence can form a total of K amplified unit sequences complementary sequence groups by amplification.

In an example of the present invention, unit sequences (PM ₃ -N ₃ ), (PM ₂ -N ₂ ), (PM ₁ -N ₁ ) when K is 3 are disclosed, which are SEQ ID NOs 3 to 5, respectively. It is described in. More specifically, a portion having a complementary characteristic in the unit sequence SEQ ID NO: 3 to 5 is as follows. As can be seen below, N ₃ is _{complementary to M 2} , N ₂ to M ₁ , and N ₁ to M ₃ , respectively.

That is, when the amplification of the template DNA is performed according to the present manufacturing method, a polynucleotide repeated as _{pM 3} -N ₃ -pM ₃ -N ₃ -pM ₃ -N _{3 , pM 2} -N ₂ -pM ₂ -N, respectively. ₂ -pM ₂ -N ₂ repeating polynucleotides, pM ₁ -N ₁ -pM ₁ -N ₁ -pM ₁ -N ₁ repeating polynucleotides. I can.

The amplification product complementary to the unit sequence thus obtained contains a repeating primer recognition site, which includes a restriction enzyme recognition site sequence. Therefore, the amplified polynucleotide sequence produced by the present method may include each unit sequence by a "restriction enzyme" that recognizes and cuts a specific restriction enzyme site inside the polynucleotide sequence, preferably an endonuclease. It can be specifically cleaved, and accordingly, a sequence cleaved into a sequence unit complementary to the unit sequence can be obtained in large quantities. In particular, it is preferable that the restriction enzyme of the present invention asymmetrically cleaves the truncated polynucleotide sequence, and the amplified sequence group thus obtained consists of a polynucleotide complementary to a unit sequence each having a sticky end. I can.

When the group of sequences cut in this way is mixed, self-assembly of polynucleotides occurs due to the presence of mutually complementary sequences present in each sequence, thereby forming a DNA nanostructure.

In addition, the present invention provides a method for mass-producing a DNA nanostructure further comprising the step of binding an active agent to the prepared DNA nanostructure in the mass production method.

In addition, the present invention provides a DNA nanostructure for delivery of an active agent made by the above method.

The active agent may be loaded onto the prepared DNA nanostructure, and may be included without limitation as long as it is a material capable of expressing the desired effect thereof by being delivered into the cell by the nanostructure, but preferably siRNA and its chemical derivatives, oligonucleotides, It may be one or more selected from the group consisting of polynucleotides, small molecules, and drugs, more preferably siRNA and chemical derivatives thereof, drugs such as anticancer agents, contrast agents, etc., such as mitonafide, amonafide, bisnaphthalimide, Ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin, adriamycin, echinomycin 1, Benzimida It may be one or more drugs selected from the group consisting of 2-c]quinazoline and imidazodiquinolinium cation naphthalimides. Also particularly preferred examples may be doxorubicin and adriamycin.

In addition, the present invention is 1) (Pr-M _k -N _k ) to (Pr-M _(Kn) -N _(Kn) ) by treating the DNA ligase to the K unit sequences represented by one end of the sequence is linked Preparing a circular DNA template; 2) treating a circular DNA template with an RNA polymerase to obtain an amplified RNA product in which a sequence complementary to a unit sequence of the template DNA is repeated; 3) forming a DNA/RNA double strand by adding a DNA helper sequence to the amplified RNA product; 4) cutting the DNA/RNA double strand with RNase H to obtain a sequence mixture complementary to the unit sequence; And 5) obtaining an RNA nanostructure through self-assembly between unit sequences in a sequence mixture that is complementary to the amplified unit sequence; The promoter sequence of RNA polymerase recognized by polymerase, M and N are siRNA sequences of 15 to 25 nt in length, N _k is a sequence complementary to _{M (K-1), and N 1} is complementary to M _k Is a typical sequence, K is an integer of 3≤K≤90 or less, n={n| 1≤n≤k-1}})

The Pr is a site recognized by RNA polymerase, and is preferably composed of an RNA polymerase promoter sequence. That is, in the case of using T-7 RNA polymerase as RNA polymerase, the Pr portion is preferably a promoter sequence of T-7 RNA polymerase, and RNA polymerase that can be used for such RNA synthesis and its Promoter sequences are well known to those skilled in the art.

In one example of the present invention, T-7 RNA polymerase is disclosed as a preferred RNA polymerase, and 5'-TAATACGACTCACTATAGGGAT-3' is disclosed as its promoter sequence. Such a sequence may be divided and included in the unit sequence used in the mass production method of the RNA nanostructure of the present invention, and the unit sequence may be composed of a completed sequence while being linked by a DNA ligase.

The K unit sequences represented by (Pr-M _k -N _k ) to (Pr-M _(Kn) -N _(Kn) ) of the present invention are 5'-phosphate and 3'of the sequence by the action of DNA ligase. It is possible to form a single circular DNA template with the -OH ends linked. The length of such a unit sequence may be a nucleic acid sequence of 15 to 500 nt in length, preferably a nucleic acid sequence of 20 to 300 nt, preferably 20 to 200 nt in length. In addition, the unit sequence of the present invention is not limited thereto, but may be preferably a single-stranded polynucleotide, more preferably a single-stranded DNA polynucleotide.

In addition, M and N of the present invention are particularly preferably 15 to 25 nt in length "siRNA sequence", more preferably 18 nt to 25 nt in length, and if the length is out of this length, the efficiency or accuracy of delivery into the cell may be degraded. . That is, since the unit sequence used in the mass production method of RNA of the present invention contains the siRNA sequence in the unit sequence, a structure containing siRNA can be mass-produced in the polynucleotide itself produced through the process of directly transcribing and amplifying it. , There is an advantage that it can be used as a direct siRNA delivery system without performing a separate active agent loading step.

As mentioned above, since M and N are preferably siRNA sequences, mentioning that N _k is _{a sequence complementary to M (K-} 1), and N ₁ is a sequence complementary to _{M k refers to N k} being M _{(K -1) is a} sense-antisense sequence to each other, and N ₁ means that M _k is a sense-antisense sequence to each other.

M and N, which can be used in this way, inhibit the expression of specific genes by inducing a decrease in complementary mRNA when delivered into cells with a short sequence of siRNA molecules, and can be effective in the treatment of genetic diseases such as cancer. If there is one, you can use it without limitation. Examples of such siRNA include EGFR-siRNA, anti-VEGF anti-GFP, anti-Luc, anti-EGF, anti-FVII, anti-ApoB, and the like, and such exemplary siRNAs are widely known in the art.

In one embodiment of the present invention, as an example of a siRNA that is easy to confirm whether the transcription, amplification, and nanostructure formation of siRNA has occurred effectively, the sense for red fluorescent protein (RFP), Firefly Luciferase (Luc), and green fluorescent protein (GFP), Antisense siRNA sequence was used, for example, Pr-M ₃ -N ₃ is Pr-sense RFP-sense Luc, Pr-M ₂ -N ₂ is Pr-antisense Luc-sense GFP and Pr-M ₁ -N ₁ is Pr- It may be antisense GFP- antisense RFP.

Polynucleotides represented by Pr and M, N are in a form in which a nucleotide is linked to a hydroxyl group at the 3'end by a phosphodiester bond, as is well known in the art, and such a linkage is, for example, Pr- It is expressed as _{M k} -N _k. In such a linkage, any nucleotide of a short length may also be inserted between the polynucleotides of P, M, and N, as long as the object of the present invention is not inhibited, which is 1 to 20 nt, preferably 1 to 15 nt, more Preferably it may be 1 to 10 nt in length.

Therefore, according to the RNA mass production method of the present invention, an RNA polymerase can be treated to obtain an amplified RNA product in which a sequence complementary to a template DNA unit sequence is repeated, and such amplified RNA product is, for example, pho Complementary RNA sequence from the DNA template represented by -Pr-M ₅ -N ₅ -Pr-M ₄ -N ₄ -Pr-M ₃ -N ₃ -Pr-M ₂ -N ₂ -Pr-M ₁ -N ₁ This repetitive transcription can result in amplified long RNA polynucleotide sequences.

In addition, within the unit sequence of the present invention, a sequence complementary to the RNA strand to be amplified to which a DNA helper that generates DNA/RNA binding can bind is included. These sequences are transcribed into RNA by an RNA polymerase, and a DNA helper sequence complementary thereto can be bound. Therefore, if a DNA helper is added to the amplified polynucleotide sequence transcribed to have a repetitive unit sequence, the DNA helper can bind to a specific recognition site present in the RNA sequence transcribed from the Pr sequence. As a result, DNA/RNA double strands are formed. An example of the present invention discloses TAATACGACTCACTATAG consisting of 18 nt as a DNA helper that can be used, but is limited thereto as long as it can form a DNA/RNA double strand specifically for the Pr sequence site in the transcribed and amplified RNA polynucleotide strand. Can be used without.

The DNA/RNA double strand formed as described above can be a target of RNase H capable of specifically cleaving such a double strand, and when cleaved by RNase H, the single stranded polynucleotide of a sequence complementary to the unit sequence Mixtures can be obtained in large quantities.

The sequence mixture complementary to the amplified unit sequence may be formed into an RNA nanostructure by binding of the complementary sequences present in the unit sequence.

Accordingly, the present invention provides an RNA nanostructure for delivery of an active agent made by the above method.

The RNA nanostructure is an RNA nanostructure characterized in that the siRNA sequence is included, and since the siRNA sequence is included in the transcribed and amplified sequence, there is an advantage that siRNA, an active agent, can be delivered into cells without additional siRNA loading.

In addition, the present invention provides an RNA nanostructure in which an active agent is additionally bound to an RNA nanostructure made by the above method.

The active agent may be loaded onto the RNA nanostructure made, and may be included without limitation as long as it is a material capable of expressing the desired effect thereof by being delivered into the cell by the nanostructure, but preferably siRNA and its chemical derivatives, oligonucleotides, It may be one or more selected from the group consisting of polynucleotides, small molecules, and drugs, more preferably siRNA and chemical derivatives thereof, drugs such as anticancer agents, contrast agents, etc., such as mitonafide, amonafide, bisnaphthalimide, Ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin, adriamycin, echinomycin 1, Benzimida It may be one or more anticancer agents selected from the group consisting of 2-c]quinazoline and imidazodiquinolinium cation naphthalimides. Particularly most preferred examples may be doxorubicin and adriamycin.

In addition, the present invention is 1) (Pr-M _k -N _k ) to (Pr-M _(Kn) -N _(Kn) ) by treating each of the K unit sequences represented by DNA ligase or circligase to K circular DNA Preparing a mold; 2) treating each circular DNA template with an RNA polymerase to obtain an individual amplified RNA product in which the unit sequence and the complementary sequence of the template DNA are repeated; 3) forming a DNA/RNA double strand by adding a DNA helper sequence to each of the amplified RNA products; And 4) cutting the DNA/RNA double strand with RNase H to obtain a sequence group complementary to the unit sequence; And 5) mixing the amplified single sequence population to obtain an RNA nanostructure through self-assembly between sequences; (wherein Pr is an RNA polymerase Is the promoter sequence of the RNA polymerase recognized by M and N is a 15 to 25 nt long siRNA sequence, N _k is a sequence complementary to _{M (K-1), and N 1} is a sequence complementary to _{M k} , K is an integer of 3≤K≤90 or less, n={n| 1≤n≤k-1}}).

According to the method for mass-producing RNA nanostructures of the present invention, a total of K unit sequences can individually generate a circular DNA template, which can be achieved by treatment with DNA ligase or circligase.

When such a circular DNA template is generated, an RNA sequence complementary to the DNA template by RNA polymerase is infinitely transcribed by RCA (Rolling circle transcription) to generate an amplified sequence.For example, if K is 3 ( Pr-M ₃ -N ₃ ), (PM ₂ -N ₂ ), (PM ₁ -N ₁ ) 3 amplified RNA products in which the complementary sequences for the three individual unit sequences are repeated can be obtained.

A DNA helper sequence can be added to each of these amplified RNA products to form a DNA/RNA double strand, and the DNA helper sequence is one capable of forming an RNA/DNA double bond at the helper sequence recognition site of the amplified RNA product, Can be used without restrictions.

When the DNA/RNA double strand is formed as described above, it can be specifically cleaved by RNase H, and thus a sequence complementary to the unit sequence can be obtained in large quantities. When the complementary sequence is mixed with the amplified unit sequence obtained in such a large quantity, self-assembly can occur using the complementarity of the antisense and sense siRNAs present in each unit sequence, through which RNA nanostructures Can be obtained.

In addition, the present invention provides an RNA nanostructure for delivery of an active agent made by the above method. The RNA nanostructure is an RNA nanostructure characterized in that the siRNA sequence is included, and since the siRNA sequence is included in the transcribed and amplified sequence, there is an advantage that siRNA, an active agent, can be delivered into cells without additional siRNA loading.

In addition, the present invention provides an RNA nanostructure in which an active agent is additionally bound to an RNA nanostructure made by the above method.

The active agent may be loaded onto the RNA nanostructure made, and may be included without limitation as long as it is a material capable of expressing the desired effect thereof by being delivered into the cell by the nanostructure, but preferably siRNA and its chemical derivatives, oligonucleotides, It may be one or more selected from the group consisting of polynucleotides, small molecules, and drugs, more preferably siRNA and chemical derivatives thereof, drugs such as anticancer agents, contrast agents, etc., such as mitonafide, amonafide, bisnaphthalimide, Ellipticine, 9-methoxyellipticine, Ditercalinium, daunomycin, ametantrone, mitoxantrone, doxorubicin, adriamycin, echinomycin 1, Benzimida It may be one or more anticancer agents selected from the group consisting of 2-c]quinazoline and imidazodiquinolinium cation naphthalimides. In addition, particularly most preferred examples may be doxorubicin and adriamycin.

The "DNA nanostructure" and "RNA nanostructure" according to the present invention can effectively deliver an active substance into a cell by directly loading an activator, preferably an activator such as siRNA, into the sequence, or by including itself in the sequence. .

In addition, the present invention provides a method of loading an active agent onto the DNA nanostructures prepared as described above and delivering them into the body or cells.

In addition, the present invention provides a method of delivering the RNA nanostructures prepared as described above into the body or cells.

According to the delivery in the body or cells according to the present invention, the active agent, preferably siRNA, can be effectively delivered into the cell, and by silencing the target gene, the object such as the treatment of a disease can be achieved.

The numerical values described above in the present specification should be interpreted as including to an equivalent range unless otherwise specified.

Hereinafter, a preferred embodiment is presented to aid the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the examples.

Example 1. Method 1 and application of mass production of DNA nanostructures

1.1 Preparation of circular DNA template strand

The sequence of a single strand of DNA used as a template is shown in SEQ ID NO: 1. The template DNA strand consists of 159 nucleotides and has a phosphate group at the 5'end and an OH group at the 3'end to be connected in a circular form. The template DNA strand contains a primer binding sequence that can be recognized by a primer and a restriction enzyme recognition site, respectively. More specifically, the sequence recognized by the primer in SEQ ID NO: 1 and the site recognized by the pstI restriction enzyme are shown in Table 1 below.

[Table 1]

In Table 1, the underlined region is a position to which the primers are bound, and a total of three primers can be bound, and the site recognized by the pstI restriction enzyme was shown in gray shades. To make a linear DNA template into a circular DNA template, 40 pmoles of DNA template and 120 pmol of primer (SEQ ID NO: 2) were added to 36 μL 1x reaction buffer (50 mM Tris-HCl (pH 7.5), 10 mM MgCl ₂ , 10 mM DTT, and 1 mM). ATP) using a thermal cycler (Bio-Rad, T100TM) at a rate of -1.5°C/s to reduce the temperature from 95°C (5 minutes) to 10°C. After that, 4 μL of T4 DNA ligase was performed. (New England Biolabs, NEB) was added 400 U/μL and incubated at 20°C for 12 hours to make a single-stranded DNA template into a circular template, which was The OH group occurs while forming a diphosphate ester group After that, heat was applied at 0°C for 10 minutes to inactivate the enzyme, and the product produced through this process was used as a template for the nucleic acid infinite replication reaction.

1.2 Infinite replication of nucleic acids using circular DNA template strands

The 5 μL circular DNA template strand prepared in 1.1 above was used in 4 μL 10x reaction buffer (400 mM Tris-HCl (pH 7.5), 500 mM KCl, 100 mM MgCl ₂ , 50 mM (NH ₄ ) ₂ SO ₄ , and 40 mM). DTT), 25 μL 25 mM dNTPs, 3 μL DEPC-treated deionized water and 3 μL RepliPHITM phi29 DNA polymerase (100 U/μL) (Epicentre Technologies Corporation, Madison). The mixture was incubated at 30° C. for 18 hours so that the enzyme could infinitely replicate the complementary DNA strand from the circular DNA template strand. Amplification occurs from the 3'end of each primer, and units complementary to the DNA template are repeated. Then, the reaction was terminated by applying heat for 20 minutes at 80°C.

1.3 Preparation of DNA nanostructures using site-specific cleavage and self-assembly

Site-specific cleavage was performed to obtain a desired strand from the synthesized DNA strand produced through the amplification process of 1.2. The site-specific cleavage was performed by allowing a restriction enzyme to recognize and cleave a restriction site present in the cloned DNA sequence, and more specifically as follows. The synthesized DNA strand (40 μL) was mixed with 8 μL 10X NEBuffer 3 (500 mM Tris-HCl (pH 7.9), 100 mM MgCl ₂ , 1000 mM NaCl, and 10 mM DTT), 2 μL DEPC-treated deionized water and 30 After mixing in μL PstI restriction enzyme (30 U/μL), it was incubated at 37°C for 15 hours. In the amplified strand or between the strands, the restriction site inserted in the DNA template forms a palindromic structure, and the restriction site 5'-CTGCAG-3' is recognized and cut by the PstI restriction enzyme. A population of single-stranded polynucleotide strands consisting of three strands was created. By such PstI restriction enzyme recognition, cleavage can easily occur without adding a separate helper strand. After that, heat was applied at 95℃ for 10 minutes to inactivate the enzyme, and by gradually decreasing the temperature from 95℃ to 10℃ at a rate of -0.5℃/min, the cut strands were self-assembled to the protruding adhesive end of 20nt length. It was made to be formed into a Y-shaped DNA nanostructure with a (5'-overhang sticky end). The DNA nanostructure having such a protruding adhesive end has the advantage of being able to load a complementary sequence and a delivery material conjugate to a corresponding exposed sequence site, and thus can be usefully used for delivery of drugs such as siRNA. An example of such use is shown in FIG. 1.

The DNA nanostructure manufacturing method as described above is schematically illustrated in FIG. 2.

1.4 Purification and identification of the prepared Y-type DNA nanostructure

To purify the resulting Y-type DNA nanostructure, add 25 μL 10x loading dye to the Y-type DNA nanostructure (80 μL) and then 1 X Tris-borate-EDTA (TBE) buffer 10% polyacrylamide gel electrophoresis ( PAGE) was loaded into 10 wells of 10.5 μL each. After dropping on the gel for 30 minutes at 150V, stained with SYBR® Gold (Invitrogen), the gel image was confirmed with Gel Doc™ EZ (Bio-Rad). In the image, only the portion of the gel that coincided with the position of the Y-shaped DNA nanostructure band was cut out, and the gel was divided into small sizes of 2x2mm. Put the gel piece and 2 ml 1X phosphate buffer (PBS) in a 50 mL tube to submerge the gel piece and leave it in an oven (Thelco Laboratory oven, Precision Scientific) at 55° C. for 48 hours to obtain the Y-shaped DNA nanostructures in the gel. It was allowed to spread over 1x PBS. When 500 μL of the elution solution is added to a 3,000 mw centrifugal filter (Amicon® Ulatra, Ultracel®-3k) and centrifuged for 25 minutes at 13500 rpm at 4°C (eppendorf, centrifuge 5415 R), the Y-DNA nanostructure is placed in the filter. The remaining, 1x PBS solvent is passed out of the filter and concentrated to about 60 μL. All the elution solutions were centrifuged in the same centrifugal filter, and finally the remaining 60 μL was stirred (GILSON®, GVLab®), placed in a 1.5 ml ep tube, and centrifuged (Cole-Parmer, Personal Microcentrifuge). In order to obtain as many Y-type DNA nanostructures as possible, the elution and concentration steps were performed once more by adding 2 ml 1x PBS to the eluted gel again.

All products were confirmed by 10% PAGE in 1 X Tris-borate-EDTA (TBE) buffer at room temperature, and the gel was stained with SYBR® Gold (Invitrogen) and gel images were obtained with Gel Doc™ EZ (Bio-Rad).

The results are shown in FIG. 3.

As shown in FIG. 3, as a result of 10% PAGE analysis, it was confirmed that DNA synthesis and amplification occurred in each step of the reaction, and finally, a Y-shaped DNA nanostructure was formed. In lane 3, the product of Y-DNA/primer hybridization was confirmed, in lane 4, the position of the band was moved upward by the formed circular DNA template, and as a result of amplification in lane 5, the strands could not escape the gel and You can see that it is hanging on. In lane 6, a truncated/self-assembled product was identified, and among these bands, a band located at a position similar to the Y-DNA template strand in lane 2 was confirmed to be the target Y-shaped amplified DNA.

In addition, AFM images and selection analysis were performed to analyze the morphology of self-assembled Y-shaped nanostructures. 1 μL AFM sample (1 μM) is dissolved in 30 μL buffer (40 mM HEPES-HCl (pH 7) and 10 mM NiCl ₂ ), and a thin sheet of mica (Pelco Mica sheets, Ted Pella Corp.) is removed and dropped on it. I let it go. After incubation for 30 minutes, the mica surface was washed with DEPC-treated deionized water (DW) and immediately dried with nitrogen gas. After that, an image was obtained using an NC-NCH tip (Park Systems Corp. Korea) in a non-contact mod of Park NX-10 ADM (Park Systems Corp. Korea).

The results are shown in FIG. 4.

As shown in FIG. 4, both the long amplified single-stranded DNA amplification product and the self-assembled Y-shaped nanostructure were clearly identified on the AFM image and selection analysis, and according to the amplification method according to the present method, the Y-shaped It was visually confirmed that the nanostructure was formed. 4A shows the product amplified by the PI 29 DNA polymerase, and the height of the amplified strand is about 0.45 nm, confirming that the amplification product is a single strand. In addition, b of FIG. 4 relates to a Y-shaped DNA nanostructure formed by cutting and self-assembly of the amplified product. The shape of a dispersed nano-sized sphere was observed, and the measured height was about 1.04 nm, which was about twice the size of a single strand. It was confirmed that a tall genome, that is, a double-stranded nucleic acid structure was formed.

1.5. Confirmation of amplification index and Y-shaped nanostructure generation index

The strand amplified by the method of 1.2 was obtained by ethanol precipitation. More specifically, the ethanol precipitation method is as follows. Transfer the amplified strand (40 μL) from the PCR tube to a 1.7 ml ep tube, add 100 μL 100% ethanol and 200 μL 5M ammonium acetate to it, and then stand in a freezer (-5° C.) for 10 minutes. I did. After that, centrifugation for 15 minutes at 15000 rpm at 4°C using a centrifuge (Eppendorf, 5415 R) reveals a pallet settled on the bottom. The supernatant was removed except for this precipitation, and 500 μL 70% ethanol was added, followed by centrifugation for 10 minutes at 15000 rpm at 4° C. without mixing. The supernatant was removed except for the precipitation and gently purged with nitrogen to blow off ethanol to completely dry the amplified DNA precipitation.

The obtained precipitate was dissolved in 40 μL DEPC-treated DW. After diluting 1 μL of this solution 50 times, OD260 was measured at 1 cm path length, and it was found to be 3.78. The extinction coefficient value of the Y-type DNA template is 1,414,900 L/mole·cm, and the concentration of the amplified product is calculated as follows based on the Beer-Lamber method. OD260 (3.78)/Ext.Coefficient (1,414,900 L/mole cm) x path length (1 cm) = 2.67 μM. The amount of the finally amplified product was 5340 pmol (2.67 μM x 50 x 40 μL).

That is, it was confirmed that a 1068-fold complementary DNA strand was amplified from the 5 pmole DNA template, and its amplification index was 1068. In order to quantify the yield of self-assembled Y-type DNA, a digestion/self-assembly process was performed at 80°C using 5340 pmole amplification products. When 1 μL (66.75 pmole) was lowered by 10% PAGE, the intensity of the band expected as Y-form DNA was measured as 19.2% in Image Lab software (Bio-Rad). The final production of Y-shaped DNA nanostructures from the 5 pmole Y-shaped DNA template was 1125.28 pmoles (66.75 pmoles x 0.214 x 80). Therefore, its generation index was 205.1.

As described above, DNA having an amplification time of 1068 and a production index of 205.1 was synthesized from the DNA template, and through this, it was confirmed that the DNA amplification method of the present invention is a very effective method for synthesizing a large amount of DNA at a high speed.

1.6 Utilization of the prepared Y-type DNA nanostructure-Y-type DNA/FA-siRNA nanostructure

The gene silencing effect was confirmed by combining the purified Y-type DNA nanostructures prepared in Examples 1.1 to 1.4 with siRNA-FA conjugates. siRNA-FA conjugates refer to the method of "Ligand-Targeted Delivery of Small Interfering RNAs to Malignant Cells and Tissues (Oligonucleotide Therapeutics: Ann. NY Acad. Sci. 1175: 32-39 (2009), Mini Thomas et al.)" Was produced. The siRNAs used were sense GFP and antisense GFP siRNA, and their sequences are as follows.

-AntisenseGFP siRNA:

rArArGrUrCrGrUrGrCrUrGrCrUrUrCrArUrGrUTTTGCAGCTACCTCGCCTTGAA

-Sense GFP siRNA: rArCrArUrGrArArGrCrArGrCrArCrGrArCrUrUTT

The prepared siRNA-FA conjugate was put in a Y-type DNA nanostructure and siRNA-FA conjugate in a molar ratio of 1:3 and left in 1X phosphate buffered saline (PBS) at room temperature for 2 hours to obtain a Y-type DNA nanostructure. A Y-type DNA/FA-siRNA nanostructure in which FA-siRNA was bound to the protruding adhesive end was prepared. In order to confirm whether the prepared Y-type DNA/FA-siRNA nanostructure can perform the role of a carrier that effectively delivers siRNA, its gene silencing effect was confirmed as follows.

In order to overexpress the folic acid receptor in GFP-overexpressing KB cells (GFP-KB cells), they were cultured in RPMI medium (10% FBS, 1% Glutamax) without folic acid for at least one week. To confirm the gene silencing effect, GFP-KB cells ^{were laid in a 6-well culture plate at a concentration of 3.0 x 10 5} cells/well. After 24 hours incubation, a sample of Y-form DNA/FA-siRNA nanostructures with siRNA bound to Y-form nanostructures in a normal growth medium with 10% serum was treated on cells for 24 hours at 50 and 100 nM based on siRNA. I did. The degree of GFP expression of GFP-KB cells was measured with the FACSCalibur system (BD biosciences), and the GFP gene silencing effect was analyzed using the flowJo program. Fluorescence images of cells treated with nothing (negative control) and cells treated with Y-type DNA/FA-siRNA nanostructures (100 nM) were obtained with a Zeiss Axiovert 200 microscope (Carl Zeiss).

The results are shown in FIG. 5.

As shown in Fig. 5a, by 10% PAGE analysis, a Y-type DNA nanostructure in lane 1 and a hybridized Y-type DNA/FA-siRNA nanostructure in lane 2 were identified. In addition, as can be seen in b and C of Figure 5, in the experiment through GFP-KB cell infection, the experimental group in which only 100 nM of folic acid-siRNA without Y-type DNA nanostructure was delivered was not different from the negative control group without any treatment. However, the Y-form DNA/FA-siRNA nanostructure loaded with folic acid-siRNA conjugate showed a concentration-dependent decrease in fluorescence of about 25% at 50 nM and 40% at 100 nM based on siRNA. In the Y-form DNA/FA-siRNA nanostructure, the Y-form DNA nanostructure increases the local density of folic acid to increase the interaction with the folate receptor on the cell surface, thereby promoting siRNA delivery into cells. It was thought to be because of it. According to the above results, the Y-shaped DNA nanostructure prepared in the present invention can be loaded with a delivery target material such as siRNA by the protruding adhesive end formed according to the amplification process, thereby effectively delivering the target material into the cell. It was confirmed that it can be used very usefully.

Example 2. Method for mass production of DNA nanostructures 2.

The Y-DNA nanostructure amplification method of Example 1 was partially modified to prepare a Y-DNA nanostructure through DNA amplification. Unlike Example 1, as a DNA template for amplification, not one single-stranded DNA, but a total of three DNA strands, that is, the following Y1, Y2, Y3, were used as the template, and the sequence information of the used template is as follows. In addition, each template strand is shown in SEQ ID NOs: 3 to 5.

[Table 2]

Among the above sequences, primer binding sites are indicated by underlined, and pstI restriction enzyme recognition sequences are indicated by shades. As can be seen above, each of the DNA template sequences Y1 to Y3 contains a restriction enzyme recognition site in the sequence.

Each of the three template strands was amplified in a separate tube in the same manner as in Example 1. That is, after hybridizing the SEQ ID NO: 2 primers for each sequence, it was made into a circular template using T4 DNA ligase in the same manner as in Example 1. Thereafter, amplification using PI 29 DNA polymerase was performed according to a method using the same reagents and conditions as in Example 1.2. DNA was amplified from the 3'end of each primer to create an amplification product in which the units complementary to the Y-DNA template were repeated.At this time, the restriction sites inserted in the DNA template within the amplified strand and between the strands were palindromic structures ( palindromic) (5'-CTGCAG-3').

The process of recognizing and cutting the palindromic structure thus formed was performed in the same manner as in Example 1.3. A population of single-stranded polynucleotides was generated in each tube by pstI recognizing and cleaving the restriction enzyme recognition site, which is a population of polynucleotides for each of the Y1, Y2, and Y3 template sequences. Therefore, unlike the method of Example 1, a population of Y1, Y2, and Y3 polynucleotides generated without self-assembly between the amplified single-stranded polynucleotides was purified in the same manner as in Example 1.4. Thereafter, the three polynucleotides obtained were mixed at the same molar concentration, followed by hybridization to finally obtain a Y-shaped DNA nanostructure having a 20 nt protruding adhesive end. A method for preparing a Y-type DNA nanostructure through such DNA amplification is briefly illustrated in FIG. 6.

The amplification method using these three templates can further improve the efficiency of nucleic acid amplification because there is no part in the circular template that additionally forms an intersequence bond other than the PstI recognition site, so energy consumption in the amplification process by PI 29 polymerase is reduced. Therefore, the production efficiency of the Y-type DNA nanostructure can be finally increased.

* 2.2 Confirmation of the prepared Y-type DNA nanostructure

A 10% PAGE analysis was performed in the same manner as in Example 1 to confirm whether the Y-type DNA nanostructure prepared by amplifying by the method of 2.1 actually formed a reaction product.

The results are shown in FIGS. 7 and 8.

As shown in FIG. 7, it was confirmed as a band that a circular DNA was formed as the reaction proceeded in the single-stranded DNA templates Y1, Y2, and Y3, and changes in the band were observed in both the amplification and cleavage steps. After the cleavage process, a band formed at a position similar to that of the single-stranded DNA template appeared, indicating that the same DNA as the template was amplified. After purifying the amplification product formed at a position similar to the single-stranded DNA template identified in FIG. 7 and hybridizing Y1, Y2, and Y3, it was confirmed that the Y-shaped DNA nanostructure was actually formed. The bands of the Y-shaped nanostructure hybridized with +Y3, Y1+Y3, and Y1+Y2+Y3 were identified. In particular, the positions of the bands representing the Y-type DNA nanostructure hybridized with Y1+Y2+Y3 are the same as the band positions of the single-stranded DNA template and the self-assembled Y-type nanostructures amplified in Example 1 above. It was confirmed that it had a template or amplified DNA. Through the above results, it was found that the amplification of the target nucleic acid effectively occurred according to the method of Example 2.1.

Example 3. RNA nanostructure mass production method 1

3.1 Preparation of circular DNA template strands

To mass-produce RNA, 68nt units of S1, S2, and S3 strands were used as a template. The specific DNA unit sequence is shown in Table 3 below.

[Table 3]

(R: sense-RFP, R'-antisense-RFP, L: sense-Luc, L': antisense-Luc, G: sense-GFP, G'-antisense-GFP, Pho: phosphate group)

The sequences S1, S2, S3 are shown in SEQ ID NOs: 6 to 8, respectively, and the positions to which the primers are bound are indicated by an underline, and a sequence complementary to the amplified RNA strand sequence recognized and bound by the 18nt DNA helper is Marked in shades. Among the templates used, S1 is sense-RFP(R), sense-Luc,(L), S2 is antisense-Lu(L') and sense-GFP(G), and S3 is antisense-GFP(G') and antisense- RFP(R') is included as an index sequence. The sequence of such an indicator sequence is shown in Table 4 below.

[Table 4]

As for the DNA template for amplification, three S1, S2, and S3 strands are hybridized to each other to form a hairpin loop structure, and a specific shape of the template and a sequence schematic diagram thereof are shown in FIG. 9. As shown in Fig. 9, the DNA template used as a template has 3 nicks, and there are 5'phosphoric acid and 3'-OH ends to form and connect by T4 DNA ligase. . In addition, the T7 promoter sequence was located in the formed loop part, and the siRNA sequence was located in each of the three arm parts, so that the structure itself to be amplified and formed without separate siRNA loading was designed to function as a siRNA carrier. . The specific manufacturing process thereof is as follows. First, 2 μL 10x Buffer for T4 DNA Ligase with 10 mM ATP (500 mM Tris-HCl (pH 7.5), 100 mM) with 20 pmoles of three 68nt single-stranded template DNAs S1, S2, S3 with a phosphate group at the 5'end and 30 pmoles of primers. MgCl ₂ , 100 mM DTT, and 10 mM ATP) and 13 μL DEPC-treated deionized water (DW) using a thermal cycler (Bio-Rad T100TM) at 95° C. (2 min) at a rate of -1.0° C./s. By reducing the temperature from to 10 ℃, the three template strands and the primer was hybridized. After hybridization, 1 μL of T4 DNA ligase (400 U/μL) was added and incubated at 25° C. for 1 hour in a thermal cycler to form a linear template DNA. Heat is applied at 65° C. for 10 minutes to inactivate the enzyme to complete the step, and this product is used in the next nucleic acid infinity replication reaction.

3.2 Infinite transcription of nucleic acids using circular DNA template strands

2 μL 10x RNAPol reaction buffer (400 mM Tris-HCl (pH 7.9), 60 mM MgCl2, 20 mM spermidine, 100 mM DTT), 3 μL 25 mM Mix with rNTPs, 3 μL DEPC-treated deionized water (DW) and 2 μL T7 RNA polymerase (50 U/μL). The mixture was incubated at 37°C for 1 hour in a thermal cycler to amplify the RNA strand complementary to the circular DNA template strand from the 3'end of the T7 promoter sequence located at the loop portion of the template by T7 RNA polymerase. After that, heat was applied at 65° C. for 10 minutes to terminate the reaction.

3.3 Preparation of RNA nanostructures using site-specific cleavage and self-assembly

The amplified RNA amplification product (19 μL) was added to 3 μL 10X RNase H reaction buffer (750 mM KCl, 500 mM Tris-HCl (pH 8.3), 30 mM MgCl2, and 100 mM DTT), and 5.5 μL DEPC-treated deionized water. (DW) and mixed. The mixture was subjected to sonication for 3 minutes using an ultrasonic generator (BRANSON 5510), followed by stirring (GILSON　, GVLab®) and spin down (Cole-Parmer, Personal Microcentrifuge). ) Was repeated 5 times to release the amplified RNA strand so that the DNA helper could adhere well. In order to obtain the desired sequence by specifically cutting RNA, RNase H, which can recognize and cut positions rather than random cuts, was used.Since RNase H has the property of recognizing and cutting RNA/DNA strands, such A DNA helper was used for strand formation. The sequence of the used DNA helper is shown in SEQ ID NO: 10, and consists of TAATACGACTCACTATAG. 50 pmole 18nt DNA helper was added and the temperature was decreased from 95°C (2 minutes) to 10°C at a rate of -1.5°C/s with a thermal cycler to hybridize the amplified RNA strand and the DNA helper. At the end of the hybridization process, 1 μL RNase H (5 U/μL) was added and incubated at 37° C. for 6 hours in a thermal cycler to cut the RNA strands of the RNA/DNA double strands. The truncated RNA is divided into the initial S1, S2, and S3 units, forming a single-stranded polynucleotide pool. Thereafter, heat was applied at 65°C for 20 minutes to inactivate the enzyme, and the temperature of this product was reduced from 95°C to 10°C at a rate of -1.5°C/min, so that self-assembly between the cut RNA strands was achieved.

The process of forming the Y-type RNA nanostructure as described above is schematically illustrated in FIG. 10, and each variable and condition for each experimental step used is summarized in Table 5 below.

[Table 5]

3.3 Purification and identification of the prepared Y-type RNA nanostructure

The prepared Y-type RNA nanostructure was purified and confirmed. It was confirmed through 5% PAGE in 1 X Tris-borate-EDTA (TBE) buffer at room temperature, and the gel was stained with GelRed™ (Biotium) and a gel image was obtained with Gel Doc™ EZ (Bio-Rad). Other specific conditions and methods were performed in the same manner as the method used in Example 1.4.

The results are shown in FIG. 11.

As shown in FIG. 11, it was confirmed that a Y-type DNA template was formed in which S1+S2+S3 was linked in lane 3, and in lane 8, Y-type RNA structure products cut off after RNase H treatment and self-assembled were confirmed. . In other words, it was confirmed that both the creation of the template and the final product were performed as intended according to the process of the amplification method.

3.4 Confirmation of Y-type RNA nanostructure amplification index

The amplified strand from the product was obtained by isopropanol precipitation. Specifically, the RCT product (40 μL) in the PCR tube was transferred to a 1.7 ml ep tube, 40 μL 5M ammonium acetate and 500 μL isopropanol (99.8%) solution were added, and left in a freezer (-5° C.) for 20 minutes. I did. After that, centrifugation at 13000 rpm at 4° C. for 10 minutes using a centrifuge (Eppendorf, 5415 R) shows a settled pallet on the bottom. The supernatant was removed except for this precipitation, 500 μL 70% ethanol was added, and then immediately centrifuged at 4° C. at 13000 rpm for 10 minutes without mixing. The supernatant was removed except for the precipitation, and the precipitate was completely dried for 15 minutes while centrifuging at 1500 rpm using a speed vacuum pump (Scanvac). The precipitate obtained after this was dissolved in 30 μL DEPC-treated DW. After diluting 1 μL of this solution 10 times, OD260 was measured with Nanodrop (IMPLEN) at 1 mm path length, and it was found to be 2.193. The extinction coefficient of the amplified RNA was 2,653,200 L/mole·cm, and the concentration of the amplified product was calculated as follows based on the Beer-Lamber method. OD260 (2.193)/Ext.Coefficient (2,653,200 L/mole cm) x path length (0.1 cm) = 8.26 μM. The amount of the finally amplified product was 2,480 pmol (8.26 μM x 10 x 30 μL). These results indicate that 2480-fold complementary RNA strands were amplified from the 1 pmole DNA template. Therefore, the amplification index was 2,480.

According to these results, it was found that using the method of the present invention, Y-type RNA nanostructures including siRNA can be very effectively transcribed and amplified from a DNA template.

Example 4. RNA nanostructure mass production method 2

The Y-RNA nanostructure amplification method of Example 3 was partially modified to prepare an amplified Y-RNA nanostructure.

Using the DNA strands divided into three segments as a DNA template, that is, S1, S2, S3 (SEQ ID NOs: 6 to 8) as a template, was the same, but a Y-shaped template through complementary bonding of these three sequences Rather than forming a prototype, each sequence was used to amplify individual S1, S2, and S3 sequences and hybridize them. More specifically as follows.

4.1 Preparation of prototype DNA template

Prototype DNA templates can be performed in either of the following two ways.

As the first method, a method using T4 DNA ligase was used. 68nt single-stranded template DNA S1,S2,S3 with a phosphate group at the 5'end and 20 pmoles of primers were added to 2 μL 10x T4 DNA ligase buffer with 10 mM ATP (500 mM Tris-HCl (pH 7.5), 100 mM MgCl2 , 100 mM DTT, and 10 mM ATP) and 14 μL DEPC-treated deionized water (DW) at 95° C. (2 min) at a rate of -1.5° C./s using a thermal cycler (Bio-Rad T100TM). By reducing the temperature to °C, the three template strands and the primers were hybridized in each PCR tube. After hybridization, 1 μL of T4 DNA ligase (400 U/μL) was added and incubated at 25° C. for 1 hour in a thermal cycler to form a linear template DNA. Heat was applied at 65° C. for 10 minutes to inactivate the enzyme.

As a second method, Circligase™ ssDNA ligase was used. _{2 μL CircLigase™ 10X reaction buffer (0.5M MOPS (pH 7.5), 0.1M KCl, 50 mM MgCl 2} , and 10 mM) in a PCR tube with 20 pmoles of 68nt single-stranded template DNA S1, S2, S3 with a phosphate group at the 5'end, respectively. DTT), 1 μL 1mM ATP, 1 μL 50mM MnCl ₂ and 14 μL DEPC-treated deionized water (DW) after mixing, 1 μL of CircLigase™ ssDNA ligase (100 U/μL) was added to 60°C in a thermal cycler. Incubate for 1 hour to make a single-stranded DNA template into a prototype. Heat is applied at 80° C. for 10 minutes to inactivate the enzyme.

In order to remove the unreacted linear DNA strand and use only the circular DNA template for subsequent reactions, 10 μL of the generated circular template was added to 2 μL 10x exonuclease I reaction buffer (670 mM Glycine-KOH (pH 9.5), 67 mM MgCl _{2 ).} , 100 mM 2-mercaptoethanol), 7 μL DEPC-treated deionized water (DW) and 1 μL exonuclease I (E.coli) (20 U/μL) were mixed. The mixture was incubated at 37°C for 1 hour in a thermal cycler to decompose linear DNA strands that were not circular. Thereafter, the reaction was terminated by heating at 80° C. for 20 minutes to remove the linear DNA, leaving only the circular DNA template.

4.2 Infinite transcription of nucleic acids on circular DNA template strands

10 μL circular DNA template strands generated by the method using T4 DNA ligase were mixed with 2 μL 10x RNAPol reaction buffer (400 mM Tris-HCl (pH 7.9), 60 mM MgCl2, 20 mM spermidine, and 100). mM DTT), 2 μL 25 mM rNTPs, 3 μL DEPC-treated deionized water (DW) and 3 μL T7 RNA polymerase (50 U/μL).

After hybridization by adding 5 pmole primer (SEQ ID NO: 10) to 10 μL circular DNA template strand (5 pmole) generated by the method using Circligase™ ssDNA ligase, 2 μL 10x RNAPol reaction buffer (400 mM Tris-HCl ( pH 7.9), 60 mM MgCl2, 20 mM spermidine, and 100 mM DTT), 2 μL 25 mM rNTPs, 2.5 μL DEPC-treated deionized water (DW) and 3 μL T7 RNA polymerase (50 U/μL ) And mix. A mixture of such a circular DNA template and T7 RNA polymerase was incubated for 3 hours at 37°C in each thermal cycler, while the T7 RNA polymerase formed an RNA strand complementary to the circular DNA template strand from the 3'end of the primer. Amplify. This process was performed by the RCT (Rolling circle transcription) method. Then, heat was applied at 65° C. for 10 minutes to terminate the reaction.

4.3 Preparation of RNA nanostructures using site-specific cleavage and self-assembly

RCA product (19 μL) was added to 3 μL 10X RNase H reaction buffer (750 mM KCl, 500 mM Tris-HCl (pH 8.3), 30 mM MgCl ₂ , and 100 mM DTT), and 4 μL DEPC-treated deionized water (DW). ) And mix. The mixture is subjected to sonication for 3 minutes using an ultrasonic generator (BRANSON 5510), and when it is finished, the process of vortex (GILSON®, GVLab®) and spin down (Cole-Parmer, Personal Microcentrifuge) is 5 Repeatedly, the amplified RNA strand was released so that the DNA helper could adhere well. Then, 300 pmole 18nt DNA helper was added and the temperature was decreased from 95°C (2 minutes) to 10°C at a rate of -1.5°C/s with a thermal cycler to hybridize the amplified RNA strand and the DNA helper. After that, RNase H (5 U/μL) was added and incubated for 10 hours at 37°C in a thermal cycler, and the RNA strand was cut out of the RNA/DNA double strands. RNA strands amplified by such cleavage were first cleaved into units of the template, S1, S2, S3, and a single-stranded polynucleotide group was formed. After that, heat is applied at 65℃ for 20 minutes to inactivate the enzyme. The cut strand product is hybridized at a volume ratio of 1: 1: 1 in 0.5 μL each and 8.5 μL 1x phosphate buffer (PBS)-1.5 °C/min at a rate of 95 °C to 10 °C while reducing the temperature to self-assemble between RNA strands. Let this happen.

The Y-type RNA nanostructure amplification method as described above was schematically schematically illustrated in FIGS. 12a (circligase) and 12b (T4 DNA ligase), and experimental variables and conditions used in each step are summarized in Table 6 below.

[Table 6]

4.4 Purification and confirmation of Y RNA nanostructure

10% PAGE analysis was performed to confirm whether the Y RNA nanostructure was formed according to the method of the present invention. This was confirmed by 1 X Tris-borate-EDTA (TBE) buffers 10% PAGE at room temperature, and the gel was stained with GelRed™ (Biotium) and images were obtained with Gel Doc™ EZ (Bio-Rad). Other specific conditions and methods were performed in the same manner as the method used in Example 1.4.

The results are shown in FIG. 13.

In FIG. 13, the reaction process according to the method (A) for producing the template using T4 ligase and the method (B) for producing the template using circligase are divided and shown. As can be seen in Fig. 14A, it is confirmed in the corresponding lane that a circular DNA template is formed by circularization, and RNA strands corresponding to the S1, S2, S3 DNA templates are amplified and formed. do. In addition, it was confirmed that each of the cut RNA strands formed a band of cS1+cS2+cS3, which is a hybridization form of S1, S2, and S3 cut through hybridization. Likewise, as can be seen in B of FIG. 14, it was confirmed that a band of cS1+cS2+cS3 was finally formed in the method using circligase.

Example 5. Mass production method of RNA nanostructure 3-2′-O-methyl DNA Helpers RNA nanostructure mass production method using

Y-type RNA nanostructures were produced in large quantities. It uses a T7 RNA polymerase that is the same as Examples 3 and 4 One, was used for 2 '-O-methyl DNA helper is a difference.

5.1 Preparation of circular DNA template strands

To mass-produce RNA, 198 nt single-stranded DNA was used as a template. Specific DNA sequences, primers, and 9nt helpers are shown in Table 7 below.

[Table 7]

(R: sense-RFP, R'-antisense-RFP, L: sense-Luc, L': antisense-Luc, G: sense-GFP, G'-antisense-GFP, Pho: phosphate group)

The 198 nt single-stranded DNA and primer with a phosphate group at the 5'end were purchased from Integrated DNA Technologies, IDT, and the 9nt helper was purchased from Bioneer Corporation.

The position to which the primer binds is indicated by an underline, and a sequence complementary to the amplified RNA strand sequence to which the 9nt DNA helper recognizes and binds is indicated by a shade. The part marked in bold in the 9nt DNA helper corresponds to the 2'-O-methylated part. The template used was an indicator of antisense-RFP (R'), sense-GFP (G), antisense-GFP (G'), sense-Luc (L), antisense-Lu (L'), and sense-RFP (R). Included in sequence. The sequence of such an indicator sequence is the same as that shown in Table 3 above.

T4 DNA ligase, T7 RNA polymerase, Pyrophosphatase, and RNase H used in the following experiments were all purchased and used from New England Biolabs (NEB).

80 pmoles of the 198 nt single-stranded template and 240 pmoles of the primer were mixed with 2 μL 10x buffer for T4 DNA ligase and 10 mM ATP (500 mM Tris-HCl (pH 7.5), 100 mM MgCl ₂ , 100 mM DTT, and 10 mM ATP) using a thermal cycler (Bio-Rad T100TM) at a rate of -1.0°C/s from 95°C (2 minutes) to 10°C to hybridize the single-stranded template with the primer. After hybridization, 2 μL of T4 DNA ligase (50 U/μL) was added and incubated at 25° C. for 1 hour in a thermal cycler to form a linear template DNA. Heat was applied at 65° C. for 10 minutes to inactivate the enzyme to terminate the reaction.

5.2 Circular DNA Mold-stranded Nucleic acid infinite transcription process

2 μL circular DNA template strands were placed in 2 μL 10x RNAPol reaction buffer (400 mM Tris-HCl (pH 7.9), 60 mM MgCl ₂ , 20 mM spermidine, and 100 mM DTT), 0.8 μ25 mM rNTPs, 10.4 μL DEPC- It was mixed with treated deionized water (DW), 0.8 μL pyrophosphatase (0.1 U/μL) and 4 μL T7 RNA polymerase (50 U/μL). The mixture was incubated at 37°C for 18 hours in a thermal cycler, while T7 RNA polymerase amplified the RNA strand complementary to the circular DNA template strand from the 3'end of the primer. Then, the reaction was terminated by inactivating the enzyme by heating at 65° C. for 10 minutes.

5.3 DNaseI DNA by treatment Mold strand remove

If the DNA template strand was not removed, the amplified RNA could be destroyed by the DNA template strand acting as a helper in the RNaseH treatment step, so the DNA template strand was removed through the following process.

RCA product (20 μL) was mixed with 4 μ10X DNaseI buffer (100 mM Tris-Hcl, 25 mM MgCl ₂ and 5 mM CaCl ₂ ), 15 μL DEPC-treated deionized water (DW) and 1 μDNaseI (2 U/μL). Mixed. The mixture was incubated for 1 hour at 37°C in a thermal cycler to allow DNase I to degrade the DNA template strands. Then, the reaction was terminated by inactivating the enzyme by heating at 65° C. for 10 minutes.

5.4 9nt 2’-O- methyl helper Hybridization And RNase Self-assembly after cutting by H

DNaseI product (40 μL) in 8 μ10X RNase H reaction buffer (750 mM KCl, 500 mM Tris-HCl (pH 8.3), 30 mM MgCl ₂ , and 100 mM DTT), 0.2 μL 9nt 2'-O-methyl DNA helper ( 10 μL and 25.8 μL DEPC-treated deionized water (DW) were mixed, to this mixture 6 μL RNase H (5 U/μL) was added and incubated for 18 hours at 37°C in a thermal cycler to double RNA/DNA. The RNA strands were cut out of the strands After that, heat was applied at 65℃ for 20 minutes to inactivate the enzyme, and this product was reduced from 95℃ to 10℃ at a rate of -1.5℃/min. Assembling was done.

The Y-type RNA nanostructure amplification method as described above is schematically illustrated in FIG. 14, and experimental variables and conditions used in each step are summarized in Table 8 below.

[Table 8]

As shown in Fig. 14, the method is the same as the method of Example 3 (see Fig. 10), but the DNA helper used is different. The 2'-O-methyl DNA helper used in the above method can hybridize more stably with the RNA strand because the portion substituted with the 2'-O-methyl group is not cut by RNaseH. In the above method, a 9 nt DNA helper (5′- TAA TAC GAC -3, a methylated portion in bold) was used, and a 12 nt or 18 nt long DNA helper may also be used.

5.5 Purification and identification of Y-type RNA nanostructures

10% PAGE analysis was performed to confirm whether the Y-type RNA nanostructure was formed according to the method of the present invention. This was confirmed by 1 X Tris-borate-EDTA (TBE) buffers 10% PAGE at room temperature, and the gel was stained with GelRed™ (Biotium) and images were obtained with Gel Doc™ EZ (Bio-Rad). Other specific conditions and methods were performed in the same manner as the method used in Example 1.4.

The results are shown in FIG. 15.

In FIG. 15, L on the left side represents a ladder, and lane 1 represents a primer. Lane 2 represents the DNA template, lane 3 represents the hybridization of the DNA template and the primer, and lane 4 represents the hybridization of the circularized DNA template and the primer. In other words, when ligation is made and circularized, the position of the band moves slightly upwards. Lane 5 shows the RCA product, and the amplified RCA product does not move evenly on the gel and hangs in the well, showing this pattern. Lane 6 shows after the RCA product is cleaved and self-assembled, and various bands appear, but among them, the band of the nucleic acid nanostructure produced by the method of the present invention is a band at a position similar to that of the DNA template in lane 2 .

5.6 Confirmation of gene silencing effect of Y-type RNA nanostructure

GFP-overexpressing KB cells (GFP-KB cells) were cultured in RPMI medium (10% FBS, 1% penicillin/streptomycin, 1% Glutamax) without folic acid. The GFP-KB cells were dispensed in a 6-well culture plate at ^{a concentration of 3.0 × 10 5} cells/well. After 24 hours incubation, 10 nM of the Y-RNA nanostructure produced in 5.5 was complexed to the experimental group in a normal growth medium containing 10% serum and treated for 24 hours after forming a complex with lipofectamine RNAiMAX. , In the positive control, double-stranded GFP siRNA was complexed with lipofectamine RNAiMAX and then treated for 24 hours.

The level of GFP expression in GFP-KB cells was measured with the FACSCalibur system (BD biosciences), and the GFP gene silencing effect was analyzed using the flowJo program.

The results are shown in Figure 16. The left diagram of FIG. 16 is a result of the positive control, and it can be seen that about 63% of the silencing effect appears for GFP. As a result of the experiment group shown on the right side of FIG. 16, it can be seen that a silent effect of about 27% appears.

<110> Ewha University-Industry Collaboration Foundation <120> Method for mass production of nucleic acid nanostructure and use thereof in drug delivery systems <130> P14-091-REA-EWHA-DA2 <150> KR 10-2014-0142589 <151> 2014-10-21 <160> 10 <170> KopatentIn 2.0 <210> 1 <211> 159 <212> DNA <213> Artificial Sequence <220> <223> DNA template <400> 1 gctacctcgc cttgaagcct acatcgtcac ggcgggcggg caaggcccct gcagctacct 60 cgccttgaag ccttgcccgc ccgcgcgccc cggaaaggcc cctgcagcta cctcgccttg 120 aagcctttcc ggggcgccgt gacgatgtag gcccctgca 159 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ttcaaggcga ggtagctgca ggg 23 <210> 3 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> DNA template Y1 <400> 3 gctacctcgc cttgaagcct acatcgtcac ggcgggcggg caaggcccct gca 53 <210> 4 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> DNA template Y2 <400> 4 gctacctcgc cttgaagcct tgcccgcccg cgcgccccgg aaaggcccct gca 53 <210> 5 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> DNA template Y3 <400> 5 gctacctcgc cttgaagcct ttccggggcg ccgtgacgat gtaggcccct gca 53 <210> 6 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> DNA template S1 <400> 6 ctatagggat tgtagatgga cttgaactct tcgtgaaaac gctgggcgtt aatcaataat 60 acgactca 68 <210> 7 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> DNA template S2 <400> 7 ctatagggat ttgattaacg cccagcgttt tcacaaaaca tgaagcagca cgactttaat 60 acgactca 68 <210> 8 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> DNA template S3 <400> 8 ctatagggat aagtcgtgct gcttcatgtt ttgcgaagag ttcaagtcca tctacataat 60 acgactca 68 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 atccctatag tgagtcgtat ta 22 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> helper <400> 10 taatacgact cactatag 18

Claims (32)

1) preparing K circular DNA templates with the ends of the sequence connected by treating each of K unit sequences represented by (PM _k -N _k ) to (PM _(Kn) -N _(Kn) ) with DNA ligase ;
2) treating the circular DNA template with a DNA polymerase to obtain an amplification product in which a sequence complementary to the unit sequence is repeated;
3) digesting the restriction enzyme recognition site formed in the amplification product with a restriction enzyme to obtain K amplified sequence groups; And
4) mixing the K groups, and obtaining a DNA nanostructure through self assembly of the sequence; and mass production of the DNA nanostructure.
(Wherein P is a primer binding sequence comprising a restriction enzyme recognition site,
M and N are single stranded DNA sequences 3 to 300 nt in length,
N _k is a sequence complementary to M _(K-1) , N ₁ is a sequence complementary to M _k ,
K is an integer of 3? K? 90 or less,
n = {n | 1? N? K-1}}) The method according to claim 1, further comprising: 5) binding the DNA nanostructure with an active agent. A DNA nanostructure for activator delivery produced by the method of claim 1. 4. The DNA nanostructure of claim 3, wherein the activator is at least one selected from the group consisting of siRNA and its chemical derivatives, oligonucleotides, polynucleotides, small molecules, and drugs. _{1) (Pr-M k -N} k) to _{(Pr-M (Kn)} by the K unit sequences each represented by -N _(Kn)) DNA Riga handle kinase or circligase for producing a circular DNA template K step;
2) treating each circular DNA template with an RNA polymerase to obtain a separate amplified RNA product in which the sequence complementary to the unit sequence of the template DNA is repeated;
3) adding DNA helper sequences to amplified RNA products to form DNA / RNA duplexes;
4) cleaving the double strand of DNA / RNA with RNase H to obtain a sequence group complementary to the unit sequence; And
And 5) obtaining a RNA nanostructure by self-assembly of the sequence by mixing the amplified single sequence group to mass-produce the RNA nanostructure.
(Wherein Pr is a promoter sequence of an RNA polymerase recognized by an RNA polymerase,
M and N are siRNA sequences of 15 to 25 nt in length,
N _k is a sequence complementary to M _(K-1) , N _{1 is} a sequence complementary to M _k ,
K is an integer of 3? K? 90 or less,
n = {n | 1? N? K-1}}) 6. An RNA nanostructure for activator delivery produced by the method of claim 5. 7. The RNA nanostructure of claim 6 wherein the activator is further conjugated. 6. The method of claim 5, wherein the DNA helper is 2'-O-methylated with one to six nucleotides each from the 3 'and 5' ends. delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete

Images